TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-199b-5p
miRNA Sequence: CCCAGUGUUUAGACUAUCUGUUC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr531273 671 172 ------
NM_000084chrX12427 1418 26886 998 11681
NM_000108chr731523 714 684 ----1427
NM_000168chr73853 807 562 --22823 508 --
NM_000210chr222011 630 ------
NM_000214chr2031785 1306 1177 11805 1141 --
NM_000216chrX43119 2775 1482 1185 --14093 --
NM_000248chr363003 2849 1027 801 532 481 12170 21964 1938 --
NM_000259chr15116120 5987 4725 4688 4664 1898 1839 1311 886 646 335 ----1786
NM_000264chr963241 2937 2858 851 688 300 --12158 --
NM_000314chr1053157 2922 2260 1273 93 12366 1395 --
NM_000321chr132591 26 --11138 --
NM_000332chr686482 6282 5443 2371 1589 1252 1131 683 16672 1860 16144
NM_000333chr321057 429 ----1209
NM_000337chr564902 4597 1587 1185 367 23 --161 12060
NM_000378chr1141192 991 817 349 ------
NM_000430chr1793552 2587 2490 2477 2358 926 733 244 185 ----2765 547
NM_000489chrX62688 1342 1075 920 748 217 ------
NM_000599chr224368 3866 22974 1211 13399 --
NM_000609chr1062963 2500 1126 882 779 213 32912 2657 2647 ----
NM_000615chr1122974 2963 12726 ----
NM_000724chr1041652 773 729 90 11284 --1239
NM_000793chr1444778 4646 1929 178 --24269 3271 --
NM_000806chr541822 1481 372 39 ------
NM_000827chr552370 643 606 329 240 1306 ----
NM_000875chr1586046 5994 5548 4939 4683 4288 1996 578 34281 2062 1605 34532 2707 692 --
NM_000944chr432035 329 290 1375 ----
NM_000964chr172507 117 11391 --11135
NM_000965chr341262 1222 1206 366 ------
NM_001001323chr1253205 2663 2216 827 119 --12157 --
NM_001001331chr32462 225 --1854 1129
NM_001001396chr174483 4473 4119 3771 1764 1274 1248 ------
NM_001001481chr842140 527 442 173 --1660 --
NM_001001549chr752235 2224 1916 1884 1107 ----146
NM_001001664chr274118 3869 2725 1263 1251 746 533 11535 ----
NM_001001740chr11227 ------
NM_001002243chr21174 --1288 --
NM_001002295chr103453 305 277 ------
NM_001002296chr84906 523 350 52 ----11222
NM_001002838chrX41487 1298 266 201 --11262 --
NM_001002860chr1484674 4372 4345 3917 3883 1854 1439 1162 23402 424 11447 --
NM_001002909chr1751681 1601 877 809 622 11974 ----
NM_001002914chr1741257 1225 1016 982 ------
NM_001003712chr1273894 3837 3488 2976 1481 358 165 --1706 --
NM_001003760chr633462 254 107 --12335 --
NM_001003792chr321004 280 ------
NM_001003940chr1562970 911 769 464 221 77 --11387 12902
NM_001004304chr1232389 1989 612 12732 1742 12966
NM_001004328chr1242407 2255 895 155 1734 --3814 253 105
NM_001004360chr241713 1493 1224 335 1118 ----
NM_001004419chr1233079 2811 759 --23238 810 14563
NM_001005209chr21228 ------
NM_001005386chr221835 400 ------
NM_001005463chr1052413 1982 779 672 381 11608 ----
NM_001005473chr585995 5968 5410 4555 2128 1908 449 343 --15533 --
NM_001005476chr2----1476 --
NM_001005781chr22466 220 ----1398
NM_001006115chr312108 --1306 --
NM_001006624chr111284 21247 315 --21942 307
NM_001007250chr1158 --1219 --
NM_001007277chr111807 ------
NM_001007559chr1851507 1493 742 655 61 1472 --1231
NM_001008239chr1873310 3140 2735 1496 1089 418 29 23438 1165 ----
NM_001008401chr1931389 912 528 1467 21147 63 4566 313 228 146
NM_001008405chr711600 --1641 --
NM_001008407chr731385 403 391 1488 ----
NM_001008541chr102351 42 ----1307
NM_001008564chr132426 160 12165 ----
NM_001008707chr1431254 340 220 --11675 --
NM_001008710chr831320 1096 231 --1401 --
NM_001008801chr1931328 508 238 21391 831 --5677 593 324 155 71
NM_001009569chr1041566 1416 1338 232 ------
NM_001009899chr356244 5899 5330 4171 307 12241 26137 166 15608
NM_001010895chr921663 1457 ------
NM_001010935chr131033 777 420 --1827 --
NM_001011537chr352299 1966 1960 1791 903 --12245 --
NM_001012264chr143901 715 308 ------
NM_001012393chr1195129 4617 3925 3818 3443 1666 1297 232 64 --11050 --
NM_001012753chr191420 1236 --61028 944 860 506 154 70
NM_001013399chr6--149 1914 --
NM_001013691chr19----1289 140
NM_001013703chr15------152
NM_001013746chr731841 1654 789 1211 2863 126 6626 542 458 378 294 43
NM_001014797chr1077258 7225 6379 5736 2578 2139 218 12740 16602 --
NM_001015877chrX32396 2263 407 --11112 --
NM_001017368chr1732695 2244 491 --21904 1813 12635
NM_001017977chr1----1142 --
NM_001018064chr931692 815 704 31956 1666 81 ----
NM_001018067chr165067 4803 4231 4207 1699 1055 --1427 13707
NM_001018111chr754016 3005 2569 2533 410 13095 1867 23930 2914
NM_001023567chr1582419 2270 2126 1595 979 718 495 332 --12431 --
NM_001023587chr3------1182
NM_001024593chr103778 751 620 ----1919
NM_001024660chr31598 ------
NM_001024847chr352302 2221 643 568 198 11594 12136 --
NM_001024937chr171106 1121 --133
NM_001025076chr10106222 5948 5811 5695 5250 1481 1311 740 403 255 ----16044
NM_001025077chr10137580 7306 7169 7053 6608 2839 2669 2098 1761 1613 421 405 99 --1634 27402 4833
NM_001025266chr374179 3164 3127 3053 515 470 271 23216 561 ----
NM_001025579chr172456 237 1373 1278 --
NM_001025580chrX53821 3806 1298 775 26 --13345 --
NM_001029858chr653269 2965 2713 1015 38 2924 169 ----
NM_001029863chr623174 2224 --23242 2597 --
NM_001029997chr191147 --166 --
NM_001030001chr142187 79 ------
NM_001030007chr1631511 1463 539 23360 3164 11147 1674
NM_001031695chr2255443 5411 5256 3725 2024 --24431 1625 --
NM_001031716chr22742 201 ----1828
NM_001031732chr463004 2475 1459 738 581 262 --1678 --
NM_001032280chr621676 1255 ------
NM_001032282chr831194 1145 375 ------
NM_001032293chr171212 ----1452
NM_001032380chr1041586 781 387 121 ------
NM_001033059chr652012 1633 704 695 514 ------
NM_001033087chr2032830 715 66 --12780 --
NM_001033117chr351797 1285 1182 1105 156 21967 308 --11789
NM_001033557chr231076 946 58 --1390 --
NM_001035260chr1021432 1281 ----1304
NM_001035chr12416 263 ----11270
NM_001037582chr411742 ----181
NM_001039538chr233544 2659 1473 --1210 --
NM_001039590chrX53595 1594 1296 1223 573 1493 ----
NM_001039690chr1652226 1613 313 234 129 11954 11910 --
NM_001039693chr21596 1639 1379 --
NM_001039840chrX45361 5037 4309 488 25458 396 --14705
NM_001040101chr42486 256 ----1295
NM_001040284chr16115776 5426 5411 2270 2120 1959 1656 1376 833 309 97 --11358 --
NM_001040429chr13125 ------
NM_001040441chr12103 45 1201 ----
NM_001040633chr73986 299 255 --176 --
NM_001040712chr953029 2491 2442 525 439 --13536 --
NM_001040715chr1641147 821 758 431 ------
NM_001042413chr932867 2609 1574 13389 13914 13570
NM_001042533chr333338 3252 2899 2869 711 12722 --
NM_001042555chr12114701 4565 4226 4011 3995 3746 3409 1248 803 615 372 ----14680
NM_001042599chr277784 5676 5614 5502 4761 2699 1595 ----22362 1041
NM_001042601chr342109 772 327 123 --1846 11085
NM_001042681chr131741 481 365 --31959 1650 22 --
NM_001044385chr242537 902 305 119 --11154 --
NM_001046chr562938 2437 2338 1021 962 453 ------
NM_001048183chr162420 1340 1091 539 300 257 1157 1514 --
NM_001095chr1221778 779 11896 ----
NM_001106chr3119670 9547 8173 7407 6941 3655 3584 3157 2132 1110 652 16977 26264 6137 26080 682
NM_001121chr1021479 42 11580 1496 --
NM_001123chr103797 314 40 --1737 --
NM_001148chr412082 11960 1619 1378
NM_001149chr1051185 1158 887 549 503 ----11392
NM_001174chrX12059 ------
NM_001198chr632336 2033 1915 --12383 --
NM_001204chr287046 6822 6586 6356 6059 2944 1203 712 12719 --17712
NM_001206chr963005 2995 2726 2132 415 177 --1397 --
NM_001271chr15103232 2922 2830 2367 2019 798 689 294 167 128 ------
NM_001290chr41781 --1236 --
NM_001299chr191172 1503 ----
NM_001304chr1753705 1245 619 154 69 ------
NM_001315chr632284 2031 1465 ------
NM_001356chrX42436 2217 2125 717 --11892 --
NM_001383chr174724 304 152 132 194 ----
NM_001390chr1873475 3154 2839 2581 2215 528 463 ------
NM_001396chr2172797 2419 1747 760 360 170 107 ------
NM_001419chr1954848 3760 784 587 449 --14274 1809
NM_001427chr721720 1598 ----1317
NM_001430chr221872 1482 --22011 1621 --
NM_001440chr882576 2344 2157 2013 1727 537 244 227 --22267 179 12780
NM_001491chr631971 919 359 1157 --12534
NM_001530chr1421080 106 --137 --
NM_001554chr1------1577
NM_001616chr223073 1398 ----22458 975
NM_001663chr1412514 --12021 --
NM_001679chr3----1123 --
NM_001699chr1951614 1519 1329 55 48 ------
NM_001701chr92581 164 --21426 286 --
NM_001717chr1521223 1108 1970 1181 --
NM_001753chr721781 1634 --11579 --
NM_001755chr1642275 2267 791 92 ----12030
NM_001792chr184391 229 190 175 --11023 --
NM_001829chr41367 1271 ----
NM_001858chr643949 1758 1299 704 149 23997 1316 11513
NM_001859chr943895 3437 1433 844 13238 ----
NM_001901chr61149 --1189 --
NM_001904chr31720 ----1171
NM_001920chr12----1598 184
NM_001938chr11114 ----1438
NM_001949chr652734 2368 2332 2043 1991 22034 1071 ----
NM_001968chr4----1600 --
NM_001981chr142166 1788 1557 52 ------
NM_002006chr444645 4525 4505 1630 ----15560
NM_002024chrX41624 762 315 214 11899 ----
NM_002025chrX139278 7698 5704 3599 3289 3125 2146 1523 1386 521 87 69 58 48204 6607 6340 3378 11350 --
NM_002061chr1------1439
NM_002126chr17103785 3699 3404 3076 3017 2911 2570 1478 963 711 --11316 --
NM_002188chr53771 578 290 --1757 --
NM_002210chr232667 2414 885 --23472 2396 --
NM_002235chr1261689 1314 1206 644 460 35 ------
NM_002264chr344855 3886 3593 112 14038 1698 --
NM_002265chr173807 212 145 141 ----
NM_002268chr331740 332 36 --1724 1688
NM_002270chr5145187 4995 4959 4519 3622 3612 2066 2033 1952 1690 1478 1393 318 148 --15295 --
NM_002293chr122607 601 ------
NM_002334chr1151932 1617 785 752 633 12026 1655 --
NM_002336chr1211579 ----1147
NM_002355chr1221003 320 11197 --1366
NM_002356chr63966 457 74 ----11094
NM_002380chr81267 1393 1363 --
NM_002401chr1741996 1731 314 151 1886 ----
NM_002419chr111143 ----2165 61
NM_002481chr197883 7426 7066 5943 5875 5813 2757 1189 1156 --25384 3104 22899 332
NM_002499chr1542351 2098 1892 745 --1365 --
NM_002515chr1441709 738 532 420 ----11817
NM_002518chr23959 190 112 ----1244
NM_002581chr975575 3977 3944 3736 3715 1934 869 11181 1161 --
NM_002590chr13----1140 --
NM_002595chr122786 113 1750 1561 --
NM_002641chrX41884 1862 1510 1379 ------
NM_002655chr864568 4222 4085 3907 3458 793 ----13984
NM_002699chr111281 --11194 --
NM_002710chr123928 421 80 ------
NM_002718chr342161 612 480 80 ----1517
NM_002731chr132918 1143 293 --1964 --
NM_002737chr1755937 4536 2011 1449 575 21857 356 25685 5421 15032
NM_002838chr111109 ------
NM_002843chr1153255 2979 1323 1129 796 13019 12124 --
NM_002852chr32155 145 ----1183
NM_002855chr1193401 3341 3097 2251 1375 862 807 659 391 ----1368
NM_002856chr191120 ----1109
NM_002859chr1241561 722 695 126 ----1321
NM_002868chr1262005 1612 821 580 193 102 ------
NM_002874chr912331 22489 60 1364 1423
NM_002892chr1441580 1405 1203 99 ------
NM_002906chr1122394 692 12027 ----
NM_002956chr121250 ----1421
NM_002971chr33756 397 36 ------
NM_002994chr441941 1320 449 309 --11380 --
NM_003011chr941293 1145 1084 414 ------
NM_003032chr342491 2280 2254 746 --12347 --
NM_003071chr342014 1339 562 210 11936 ----
NM_003079chr172645 336 --1668 --
NM_003107chr622017 1978 12141 ----
NM_003108chr297081 6765 2910 2654 2480 2144 1984 1502 1323 16968 14592 --
NM_003110chr1731076 943 371 --1240 --
NM_003161chr1743065 2298 2224 1003 1893 ----
NM_003202chr531906 1797 1756 ------
NM_003204chr1761655 1114 676 648 513 165 --1689 --
NM_003216chr2233250 698 205 22428 2381 ----
NM_003222chr202234 139 --1910 --
NM_003234chr341602 978 869 745 ------
NM_003270chrX3987 390 339 ----1307
NM_003274chr2182885 2624 2328 992 969 739 302 277 ------
NM_003325chr222590 186 --2547 109 --
NM_003339chr541281 1024 202 183 --1986 --
NM_003340chr421008 899 --11080 --
NM_003342chr1772639 2504 1171 1005 615 295 63 --1124 --
NM_003390chr1141120 926 772 32 1714 11023 --
NM_003392chr353873 3575 1097 1030 970 ------
NM_003406chr831937 382 283 --21350 349 --
NM_003409chr1831217 486 108 1119 --11115
NM_003411chrY51249 1144 250 161 92 ----1390
NM_003439chr763519 3401 2483 1211 796 527 --22629 473 11334
NM_003458chr363589 1255 754 657 439 239 13602 ----
NM_003468chr244047 3916 3126 1614 12770 11221 --
NM_003470chr163682 651 629 ------
NM_003488chr173126 92 37 ----2835 713
NM_003489chr2123394 138 ----13255
NM_003566chr1243336 2400 2188 839 --198 --
NM_003618chr22919 833 ------
NM_003622chr1242634 1759 1063 657 11951 1190 --
NM_003624chr192293 118 1518 1508 11077
NM_003651chr12------1154
NM_003654chr112760 195 ------
NM_003679chr153082 2357 2318 1132 162 ------
NM_003766chr172563 514 ------
NM_003774chr1221192 158 1127 ----
NM_003808chr17--1287 --155
NM_003872chr232934 2463 2108 11058 12584 --
NM_003873chr10112478 2320 2141 2111 1844 768 727 687 679 581 546 ------
NM_003887chr231980 1810 199 ------
NM_003916chrX41464 1209 965 44 ----11262
NM_003939chr1063835 3168 1370 1283 1108 318 ----33252 2794 607
NM_003941chr752527 2265 898 618 495 --12128 --
NM_003972chr1041337 1284 180 148 --11001 --
NM_004035chr17115197 5154 4775 4245 3498 3338 1959 1394 733 351 194 ------
NM_004117chr632174 784 371 --11504 --
NM_004124chr1463576 972 838 791 501 91 1311 --33073 368 52
NM_004171chr11119352 8690 8024 7706 7675 7666 7593 6311 3800 3052 2014 16267 21849 1073 19606
NM_004241chr10176 --1726 --
NM_004331chr812279 ----12465
NM_004349chr8--1478 1948 --
NM_004392chr13------11656
NM_004420chr1182245 1960 1858 1796 955 634 311 93 ------
NM_004432chr961966 1782 950 877 698 239 ----1587
NM_004438chr2103112 3089 2986 2799 1185 1085 1073 961 326 288 1421 ----
NM_004440chr631643 1596 53 --2585 514 --
NM_004474chr121038 933 ------
NM_004505chr1732001 1853 608 --11746 --
NM_004537chr1241130 1056 258 37 11178 ----
NM_004586chrX84238 4068 1280 1235 688 424 294 100 ------
NM_004630chr1151161 1110 1093 361 141 --2462 90 --
NM_004630chr1151161 1110 1093 361 141 --2462 90 --
NM_004630chr1151161 1110 1093 361 141 --2462 90 --
NM_004630chr1151161 1110 1093 361 141 --2462 90 --
NM_004635chr361199 1161 1107 418 411 327 ------
NM_004637chr31100 2357 333 ----
NM_004654chrY2354 134 ------
NM_004656chr3------11239
NM_004660chrY32307 2050 1933 --11823 --
NM_004709chrX21833 1733 --1391 --
NM_004730chr541636 1615 1395 686 2277 134 1401 --
NM_004734chr1353124 2435 2131 1230 1065 --22668 1178 --
NM_004737chr2211240 ----11190
NM_004745chr895761 5530 5389 5052 4918 4672 2455 2217 1706 16466 12205 --
NM_004772chr541375 1342 548 215 --11011 --
NM_004779chr531351 482 103 ------
NM_004781chr141691 1359 1148 572 11407 ----
NM_004815chr164519 4315 3302 1948 1343 159 24621 203 ----
NM_004842chr641731 1549 1385 337 11660 ----
NM_004849chr6--11073 1404 --
NM_004852chr181713704 13469 13133 13099 12693 11862 10472 9206 9078 3494 3264 1821 1615 1340 1292 244 107 --34803 3808 2660 --
NM_004859chr1773075 2632 2535 2294 2017 1051 993 1905 1450 1515
NM_004865chr6------161
NM_004922chr1021011 785 ----1690
NM_004938chr91826 --11186 --
NM_004985chr1274314 3530 3117 1362 1087 530 438 11503 11348 13877
NM_004996chr16196 ----11733
NM_005100chr61684 ----1950
NM_005124chr6------162
NM_005147chr165878 796 472 249 107 130 ----
NM_005160chr22116597 6560 6229 5848 5061 4587 4571 4178 1838 1067 416 24793 691 15438 --
NM_005188chr11127207 7160 6988 6630 6074 5189 3165 2800 2219 2052 847 830 --1814 --
NM_005238chr1173533 3195 2203 2167 989 479 364 1726 --12715
NM_005239chr2111982 ------
NM_005316chr111809 ----1164
NM_005336chr2------12275
NM_005347chr921509 1394 --21548 351 139
NM_005387chr111546 1164 199 --
NM_005406chr1841419 1230 627 160 11362 ----
NM_005440chr1743358 2090 2038 948 --13300 --
NM_005465chr141972 710 644 383 ----11921
NM_005502chr9103091 3066 2927 2860 2386 2288 933 586 342 121 13120 ----
NM_005581chr19------2465 384
NM_005584chr13------1777
NM_005604chr652086 2020 897 528 325 11596 --1179
NM_005627chr62295 143 1152 1840 --
NM_005660chrX----122 --
NM_005748chr1222581 696 --22132 746 --
NM_005776chr14------1334
NM_005813chr242618 2283 2245 569 1845 1510 12435
NM_005839chr13609 276 157 ----1652
NM_005862chr33355 323 61 ------
NM_005898chr1163191 1966 846 641 578 499 --21157 42 1356
NM_005899chr17161 ----1204
NM_005909chr554017 3061 2656 712 130 14044 11306 --
NM_005920chr121010 253 13121 11074 --
NM_005935chr4104899 4629 4468 4327 4321 4180 4080 674 178 168 ----150
NM_005941chr824172 1334 ------
NM_005955chr185226 4778 4691 4640 4238 1613 367 249 14754 ----
NM_005966chr241835 1637 1540 829 ------
NM_006037chr294655 4610 4285 4141 3531 3318 3211 3149 1402 14854 ----
NM_006047chr2073543 3488 3475 3401 2432 182 141 33214 3097 2455 ----
NM_006060chr784214 3220 1612 1456 1412 711 261 214 13733 13841 --
NM_006094chr842448 2137 821 525 1391 ----
NM_006108chr1122331 1521 --12319 --
NM_006195chr941123 1013 937 239 --11080 --
NM_006206chr472673 2056 1936 1919 1892 529 330 --1301 --
NM_006241chr3----2723 264 --
NM_006256chr122631 2536 21108 210 ----
NM_006282chr2051843 1579 790 623 301 --24550 194 --
NM_006313chr1231269 483 372 ------
NM_006321chr321869 64 1402 1131 --
NM_006352chr151638 702 606 599 309 --1590 --
NM_006380chr1731570 426 55 13336 1108 --
NM_006389chr111167 --11242 --
NM_006390chr1221559 606 21276 234 --11645
NM_006400chr122340 271 --1116 --
NM_006421chr821050 116 11035 --159
NM_006469chr141543 1517 1420 460 ------
NM_006496chr131968 1233 575 ----2662 196
NM_006516chr121202 648 1587 --11639
NM_006524chr711111 --1284 31034 873 201
NM_006546chr1785495 5354 4142 1563 1430 1094 937 206 26474 5764 ----
NM_006599chr16138293 8125 8029 7754 6427 6366 6274 5764 5184 3140 2951 2852 914 --12020 --
NM_006609chr222986 2570 1667 --13010
NM_006624chr1012041 --12141 --
NM_006628chr1554316 4209 1708 268 186 --11487 --
NM_006629chr1822495 2309 ----161
NM_006675chr1263030 2561 2380 2234 327 295 --12436 --
NM_006698chr201168 175 --11075
NM_006713chr5----164 --
NM_006717chr952974 2954 2796 972 488 ------
NM_006734chr61591 ------
NM_006735chr7----1319 --
NM_006738chr1544101 3631 1717 262 13486 14580 191
NM_006743chrX------1767
NM_006750chr1658104 7731 4956 2614 1705 17561 16941 --
NM_006763chr131455 1384 834 --11418 --
NM_006777chrX42794 2727 965 402 ------
NM_006805chr511100 --11370 --
NM_006807chr1751341 1009 890 421 318 ------
NM_006896chr72904 64 --1404 --
NM_006908chr771457 1372 1242 1225 537 364 335 ------
NM_006912chr122058 195 12360 ----
NM_006939chr1441138 783 306 263 ----130
NM_006943chr2043207 2348 1298 516 --12709 --
NM_006996chr11526 --1498 --
NM_007008chr25838 629 382 262 145 ------
NM_007017chr5------1152
NM_007026chr171184 1451 1124 --
NM_007030chr5125195 5168 4918 4621 4517 4477 3537 3424 1448 1234 1116 26 --1284 14131
NM_007038chr21176087 6006 5783 5758 5380 5350 4788 4277 4003 3945 3932 1541 1146 252 172 111 49 1540 11001 --
NM_007047chr652499 2399 983 668 609 ------
NM_007106chr1362297 2012 564 484 138 73 --12531 1451
NM_007118chr54818 802 362 177 ------
NM_007125chrY31313 260 62 ------
NM_007146chr1742883 2860 912 235 21993 192 --1905
NM_007191chr123683 620 541 --1104 --
NM_007235chr12199 --185 --
NM_007236chr1522326 453 ------
NM_007249chr1388197 8059 6642 6435 2209 1448 1134 633 --1907 18034
NM_007276chr731024 827 174 --11107 --
NM_007331chr492726 2545 2222 2207 1924 308 95 55 27 --1381 --
NM_007345chr1822246 359 ----11649
NM_007373chr1061277 1262 1170 1119 586 26 21743 501 ----
NM_012069chrX42353 2263 550 161 --12417 --
NM_012090chr11798 --156 --
NM_012095chr1073243 1220 1163 701 572 531 280 11138 12963 --
NM_012104chr1152558 2430 2354 921 361 --1515 --
NM_012110chr4----189 --
NM_012193chr1133642 1051 325 24320 1302 1465 34490 4281 457
NM_012199chr184295 4131 3736 3452 1488 1338 762 277 2259 26 23888 3510 --
NM_012223chr22392 343 --11162 --
NM_012234chr373666 3620 2331 2284 1081 569 550 1696 33785 3057 536 --
NM_012238chr1031750 1666 441 --1513 --
NM_012257chr73695 117 44 --2901 387 --
NM_012266chr92427 128 188 194 --
NM_012281chr71730 --1400 --
NM_012290chr231541 638 314 ----11636
NM_012294chr773644 3132 2499 1591 1577 847 275 --13658 --
NM_012308chr1132025 1838 331 --1530 --
NM_012325chr203475 281 97 ------
NM_012333chr131251 388 293 --1645 --
NM_012384chr2022141 269 --1281 --
NM_012395chr733226 3009 1059 12455 12935 11218
NM_012402chr111152 --140 --
NM_012433chr2185 ----1226
NM_012479chr762755 2286 2181 1100 975 955 11998 1225 --
NM_013261chr443609 2980 1158 819 13082 --11492
NM_013279chr1142363 2085 1630 116 ----3157 84 64
NM_013281chr2021128 1085 ----191
NM_013346chrX----149 --
NM_013377chr12----2625 173 --
NM_013436chr23513 505 142 ------
NM_013438chr931731 1590 523 --11169 --
NM_014011chr232402 2182 1664 ------
NM_014023chr1052891 2399 2003 1884 989 --22946 2120 1288
NM_014246chr2252327 2260 1491 1456 229 ----21956 1912
NM_014251chr72827 598 ------
NM_014275chr54920 692 221 150 ----1321
NM_014283chr11259 2572 394 ----
NM_014331chr4127472 7324 7257 6679 6451 6142 3052 2888 1339 491 485 405 --26326 5767 --
NM_014351chr221234 1340 ----
NM_014363chr1321114 109 ----1384
NM_014372chr112017 1513 1458 --
NM_014379chr811049 1916 --1858
NM_014386chr51285 ------
NM_014417chr194867 777 708 182 --1365 1110
NM_014454chr611071 ----1769
NM_014456chr1051753 1186 528 432 357 ------
NM_014480chr191832 ----2314 230
NM_014517chr331859 1672 324 ------
NM_014584chr1431599 1077 1013 --1621 --
NM_014615chr1653111 2961 2646 1055 83 ------
NM_014647chr1642167 1960 419 39 21877 833 ----
NM_014660chr7------1323
NM_014667chr362191 2009 1810 1712 1594 757 ------
NM_014671chr73643 195 87 11212 ----
NM_014686chr1952503 2149 906 839 740 --22380 546 --
NM_014701chr1563047 2899 2802 2787 2561 84 --22137 861 --
NM_014707chr761529 681 643 452 182 141 ------
NM_014711chr1611978 --11430 --
NM_014730chr1264735 4579 3258 2070 979 404 15002 14969 --
NM_014737chr2034123 1478 889 ----1681
NM_014751chr832157 1584 1577 11530 --1717
NM_014764chr1221237 287 --1298 --
NM_014810chr133426 1248 25 1197 ----
NM_014839chr142229 2120 1018 974 --11860 --
NM_014848chr1532478 893 49 ----12205
NM_014872chr92563 26 11704 1583 --
NM_014897chr1723209 1231 ----12866
NM_014903chr123878 742 651 11714 ----
NM_014906chr1733272 3234 3190 --12998 --
NM_014917chr12626 245 --1341 1982
NM_014924chr1433025 2660 2180 12695 12651 --
NM_014926chr31279 --1320 --
NM_014932chr311704 1689 ----
NM_014943chr811155 1488 --1289
NM_014945chr551949 1517 1510 252 100 ------
NM_014947chr142930 2339 1986 1261 ------
NM_014951chr1082544 1785 1770 1755 995 978 884 33 ----1106
NM_014962chr2062740 2687 2528 2229 1836 924 ----11763
NM_014978chr1041769 681 637 263 ----11719
NM_014982chr1465421 4830 4276 4250 4211 3677 23292 55 1743 --
NM_014989chr631925 1806 1772 ------
NM_014990chr1411088 --21239 1207 1302
NM_014991chr411168 --13071 --
NM_014997chr722543 2397 ----129
NM_014999chr1231645 287 142 ----11527
NM_015000chr1271978 706 564 481 400 275 82 22175 240 ----
NM_015017chr131220 1149 822 ----11212
NM_015027chr1621641 117 --1697 --
NM_015033chr922739 574 13292 --1729
NM_015042chr1573808 3399 3327 2693 1388 1221 415 --2899 750 --
NM_015045chr1021916 1696 11715 11829 --
NM_015064chr1252768 2684 2596 2457 1127 12858 --198
NM_015082chr532447 73 52 --2758 128 --
NM_015094chr22124538 4511 4363 4222 3738 1420 723 519 513 505 388 294 13695 1346 --
NM_015097chr342347 2239 1952 1563 --11603 --
NM_015103chr33277 104 52 --1418 1871
NM_015110chr932316 1789 614 11763 1867 --
NM_015150chr3--1195 1794 --
NM_015155chr1083379 3187 3115 2993 2493 716 647 86 12463 ----
NM_015170chr831797 239 151 ----1428
NM_015192chr2062800 2354 2159 782 595 518 ------
NM_015196chr4----190 --
NM_015203chr1------146
NM_015205chr13124504 3865 3847 2092 1933 1586 1510 1422 1104 470 454 319 ----25002 1548
NM_015229chr172929 186 1220 --11181
NM_015252chr22940 897 --1796 --
NM_015272chr1652134 2011 1597 1538 456 ------
NM_015285chr1862395 2342 2283 1664 1602 335 --1423 --
NM_015286chr1572399 2247 2239 2231 871 694 200 11563 ----
NM_015288chr5103675 3315 3105 2360 1300 1046 539 422 337 163 --33324 3175 3121 --
NM_015291chr183493 3277 2890 2728 1050 702 530 401 ------
NM_015296chr1351252 484 478 324 199 ------
NM_015305chr1441757 1684 1342 335 148 ----
NM_015310chr897063 6768 6731 6095 5646 5491 3028 2275 2195 27947 2340 ----
NM_015313chr1153608 3478 3106 1575 1159 --1915 11337
NM_015315chr542136 1162 689 461 13225 --12150
NM_015326chr122417 763 12760 12672 --
NM_015331chr12436 62 188 ----
NM_015335chr1242550 410 267 125 --2758 494 --
NM_015339chr203973 103 83 ------
NM_015347chr1232672 1970 851 --2482 282 --
NM_015375chr154641 3926 3883 1365 349 ----11293
NM_015455chr563206 1160 1022 969 346 199 13490 ----
NM_015458chr8124941 4653 4533 4470 4249 1447 1369 1248 907 880 742 148 ------
NM_015460chr342102 805 787 185 --1249 --
NM_015475chr221042 825 ------
NM_015476chr182563 542 1610 ----
NM_015477chr153805 106 71 ------
NM_015483chr721128 272 --1765 --
NM_015493chr1921680 298 1424 1255 12119
NM_015554chr1552242 1996 1984 1071 328 --11830 --
NM_015568chr2064083 4021 3527 1561 954 944 1997 13700 --
NM_015569chr144195 3239 1804 598 --14308 --
NM_015570chr711162 11403 --11676
NM_015578chr1961412 715 570 382 118 59 ------
NM_015695chr631631 1416 396 11668 1592 --
NM_015713chr852916 2279 2255 1449 39 ----12265
NM_015831chr72607 301 2694 673 1259 1130
NM_015852chr733087 2328 2313 11131 11376 121461 1296 1047 963 795 627 543 459 375 207 123 39
NM_015886chr845560 5385 4334 1574 ------
NM_015904chr23333 99 41 --1174 --
NM_016018chr832627 2056 925 ----11015
NM_016061chr231510 1463 70 --11601 --
NM_016075chr1382459 2238 2122 1237 984 863 425 64 ------
NM_016083chr683778 3550 3496 3335 2653 1242 1064 639 1879 ----
NM_016132chr1562631 2592 923 900 233 156 ----2962 844
NM_016206chr3128211 7843 6789 3534 2810 1475 1431 664 518 180 64 52 ------
NM_016231chr1721496 1071 149 11630 --
NM_016257chr152984 2850 2837 2387 252 ------
NM_016308chr111887 11364 ----
NM_016424chr1731571 1396 199 1579 1411 --
NM_016436chr2032602 2113 589 12092 --1148
NM_016441chr241495 1483 429 136 21579 770 ----
NM_016467chr221086 76 ----1115
NM_016525chr92721 703 ------
NM_016604chr531122 163 152 --1933 21139 523
NM_016626chr1841709 1480 576 438 ------
NM_016631chr212903 131 ----1357
NM_017415chr554320 3402 3254 840 751 1384 --11128
NM_017542chr111489 21691 91 1607 --
NM_017580chr102624 303 ------
NM_017582chr12374 80 142 11492 --
NM_017610chr1521839 1692 11909 1554 --
NM_017629chr151827 1788 733 154 133 1230 ----
NM_017650chr776096 5235 5158 4939 4829 3702 1802 --1837 34352 2191 2097
NM_017672chr152478 23 --11012 --
NM_017693chr13------11621
NM_017742chr1831835 1255 287 11917 1357 --
NM_017757chr182479 265 --1155 1805
NM_017780chr83676 618 293 ------
NM_017799chr14--21563 282 ----
NM_017811chr952253 1922 1091 914 891 22879 1143 1424 --
NM_017824chr1022394 935 --12724 --
NM_017849chr252063 1170 1053 192 96 ------
NM_017944chr1173011 2870 2791 1089 839 118 65 ------
NM_018009chr12----1140 --
NM_018014chr21394 ----1221
NM_018019chr171441 1489 ----
NM_018028chr19----1158 --
NM_018061chr141631 1610 173 28 --11640 11153
NM_018084chr232740 2179 1257 1212 ----
NM_018085chr197594 6987 6896 6629 5413 5045 3108 139 66 16888 12147 --
NM_018086chr231865 1468 111 --1396 --
NM_018092chr1661684 1421 1174 626 252 66 11601 ----
NM_018121chr1022342 919 --1759 11020
NM_018157chr1222527 2245 12699 11258 --
NM_018184chr371846 1520 1362 618 415 409 139 ------
NM_018201chr972181 2089 442 279 222 149 139 11909 11743 --
NM_018214chr611143 --21327 946 --
NM_018260chr191473 --11075 5391 237 225 153 68
NM_018287chr1021178 1016 11007 --1302
NM_018293chr352693 2653 2166 908 832 --22552 875 --
NM_018325chr941635 1509 1215 45 --1184 --
NM_018362chr1143442 664 636 495 11189 --22566 1547
NM_018482chr83933 648 214 ------
NM_018489chr152044 1650 1460 288 270 ----12322
NM_018566chr165011 1827 1203 376 268 140 1484 14653 1858
NM_018650chr141714 1705 1449 68 ------
NM_018682chr74704 696 688 540 ------
NM_018717chr482493 2453 2288 2244 2231 2112 1904 504 32911 2605 858 --11055
NM_018898chr532145 1768 406 --11652 --
NM_018945chr633685 884 873 1332 12772 --
NM_018951chr741035 1015 853 43 ------
NM_018970chr722153 615 2861 351 ----
NM_018976chr1252039 1850 994 551 122 11085 ----
NM_018993chr2041483 1475 1422 956 ------
NM_019004chr732005 1819 1703 ------
NM_019045chrX1200 ----1633
NM_019063chr261917 1625 1580 704 397 382 ----1288
NM_019084chr1012339 ----22414 2179
NM_019114chr92663 450 12482 --11882
NM_019116chr1653710 2371 1373 1065 50 ----12715
NM_019593chr2053167 3041 2076 935 447 --12984 --
NM_019610chr121691 206 --12082 11492
NM_020123chr10----21085 108 --
NM_020144chr732099 1426 593 --11916 --
NM_020150chr1031563 903 179 12008 ----
NM_020177chr5103118 2635 2491 2400 993 608 334 122 67 24 11283 1157 --
NM_020193chr11----1519 1924
NM_020228chr1152454 2218 2212 909 288 1382 1145 --
NM_020307chr32330 136 --1384 --
NM_020310chr1772820 2690 2371 2138 955 830 723 ------
NM_020363chrY51847 1458 401 243 190 ------
NM_020390chr364587 3676 3660 3014 638 25 ----13466
NM_020432chr742166 923 620 160 --21963 675 11668
NM_020440chr193322 3203 2541 2326 2260 2240 1025 676 288 ------
NM_020456chr132468 35 11975 1679 --
NM_020466chr6104421 3985 3718 3247 1843 1349 1294 1173 694 159 11731 --13903
NM_020647chr832152 1484 323 --11895 --
NM_020689chr2071700 1475 1142 678 568 477 324 ----11129
NM_020697chr831283 227 33 ------
NM_020699chr1104024 3925 3856 3738 3545 1591 1465 875 198 93 12168 11856 --
NM_020718chr1686169 5218 4519 4508 4446 4136 860 228 ----16238
NM_020748chr1721609 251 --1713 --
NM_020760chr221807 1303 11607 --176
NM_020772chr1758676 7674 5429 1297 1281 38251 7446 387 ----
NM_020774chr1874979 4223 4172 1740 1537 896 643 13808 14305 --
NM_020796chr532567 2077 571 --22842 129 --
NM_020800chr3--1493 --1335
NM_020801chr541813 892 494 345 22262 2188 ----
NM_020805chr183509 501 437 ----11465
NM_020845chr1282483 900 884 571 471 461 360 87 ------
NM_020850chr1633171 3123 38 --23181 698 --
NM_020871chrX41812 726 159 138 --12372 --
NM_020919chr241239 1051 924 785 ------
NM_020927chr1622309 612 ------
NM_020935chr244159 3731 1618 32 1540 --14113
NM_020951chr19151 --1855 --
NM_021038chr352990 1162 960 265 193 ----1888
NM_021116chr7138913 8850 8544 8401 7817 7596 7261 7241 5923 2199 1207 844 288 12031 18156 --
NM_021155chr1942641 1986 1969 388 ------
NM_021190chr13465 375 36 ------
NM_021215chr2021633 829 ------
NM_021728chr143769 233 76 --2880 45 --
NM_021809chr2072294 1834 1750 771 711 572 165 --1105 --
NM_021813chr6103741 1472 1385 1244 926 863 831 240 140 70 --14887 --
NM_021914chr1491934 1832 1573 944 787 362 318 191 110 163 ----
NM_021947chr1741247 382 348 45 ------
NM_021952chr1------1163
NM_021961chr1167142 5185 2588 1564 1003 856 --12308 --
NM_021964chr3135446 5313 5208 5136 4861 4796 4410 4294 4101 2071 1197 363 318 --45941 4581 1639 29 14694
NM_022048chr1586392 5880 4323 4251 2107 2059 609 182 32079 1958 78 ----
NM_022062chr1141435 1389 359 22 --11863 --
NM_022103chr192241 142 1402 21008 986 --
NM_022114chr153828 3698 634 610 225 13584 ----
NM_022166chr16136360 6321 6290 6271 5975 5388 4811 4101 3870 2314 1835 534 221 15694 ----
NM_022459chr1376151 4533 4340 2299 1989 573 48 --34957 3991 2526 --
NM_022474chr1462816 2809 2788 454 418 73 ------
NM_022497chr373343 3286 3244 864 432 362 352 --23699 737 --
NM_022719chr22113692 3376 3217 3129 2689 1483 1377 1286 1061 717 600 33076 1263 132 ----
NM_022781chr952649 2602 2270 629 132 --1597 --
NM_022826chr241226 1039 1004 102 --21205 824 --
NM_022832chr441022 828 614 50 11620 12329 --
NM_022841chr1552514 2458 1696 250 28 ------
NM_022893chr232591 798 584 --22139 1135 --
NM_022897chr5--1416 ----
NM_022898chr1454489 4233 3563 1878 1180 --11527 --
NM_022912chr2------12993
NM_022918chr1112039 11631 ----
NM_023016chr221916 435 --11074 --
NM_023039chr52148 104 ------
NM_024046chr331077 824 87 --11192 --
NM_024122chrX------147
NM_024411chr2031044 1036 585 ------
NM_024529chr11243 11196 1984 --
NM_024586chr1------1133
NM_024594chr541204 728 282 85 ------
NM_024613chr821842 507 --1564 --
NM_024639chr632591 2155 295 1419 1511 --
NM_024670chr1041761 500 488 174 --1527 --
NM_024745chr16------134
NM_024771chr1111767 11992 1449 11695
NM_024824chr1431361 467 278 --1192 --
NM_024834chr1021616 80 11502 ----
NM_024896chr962508 1643 983 839 650 337 1477 --11652
NM_024947chr3189516 8801 8494 8189 7983 7937 7871 6939 5951 3767 3284 2866 2642 1148 765 557 230 139 27646 1988 66991 6396 5845 2561 197 119 19116
NM_024948chr101635 --191 --
NM_025040chr1932471 975 803 --11960 1497
NM_025057chr141531 1201 1188 --
NM_025074chr432288 849 779 --162 --
NM_025154chr721239 363 --141 160
NM_025160chr131397 1253 552 --13991 1440
NM_025179chr143985 3936 3302 1165 33368 1681 1423 154 24735 541
NM_025189chr192617 62 1769 1534 --
NM_025222chr332796 918 458 ------
NM_030576chr1752302 2229 1965 1663 641 11849 12287 --
NM_030613chr5------1309
NM_030623chr241732 1627 1559 542 ----11689
NM_030650chr253253 3041 2774 589 526 --1164 --
NM_030784chr63399 323 51 ----1421
NM_030806chr1167933 7835 7732 6587 6442 6394 3709 3648 3255 2430 1964 1505 1449 854 485 307 --39199 3597 671 39436 9140 2300
NM_030809chr1242481 2397 2146 797 1264 1622 --
NM_030949chr6----11449 --
NM_030972chr19------5715 573 153 141 71
NM_031426chr951986 857 708 604 74 ------
NM_031442chrX31109 939 769 11032 1444 --
NM_031445chr222347 1359 161 --1331
NM_031483chr2052692 2470 1262 1141 701 13419 ----
NM_031890chr2282749 2330 2305 1862 934 876 816 694 ------
NM_031935chr11886 ----1233
NM_031946chr7169 ----1422
NM_032042chr52833 196 12204 ----
NM_032121chrX22786 2533 137 --129
NM_032172chr73845 787 137 ----1731
NM_032199chr1063814 2688 1177 1059 931 518 --11166 11381
NM_032217chr41557 --11028 --
NM_032229chr134966 425 264 163 ------
NM_032239chr421379 960 --11363 1574
NM_032410chr811175 ------
NM_032440chr1011861 11189 22883 414 --
NM_032446chr533847 2711 766 129 23651 323 --
NM_032457chr442984 1356 1169 160 ------
NM_032458chrX52726 2593 2097 737 50 ------
NM_032466chr83535 425 156 1258 ----
NM_032491chr122993 99 ----1388
NM_032578chr1031331 1045 108 11558 ----
NM_032582chr1721865 623 --11758 --
NM_032594chr1431041 995 842 --11031 --
NM_032632chr143600 480 136 --11790 --
NM_032689chr1951636 1345 1288 1028 43 ------
NM_032859chr1353893 3243 2976 516 505 12964 --1164
NM_032900chr1063185 3158 2808 2747 1029 376 1168 ----
NM_032968chrX21678 556 ------
NM_032973chrY21672 556 ------
NM_032983chr733180 762 64 2855 91 ----
NM_033027chr331035 918 94 1425 ----
NM_033030chr2----1302 --
NM_033211chr541982 1837 524 459 ------
NM_033224chr711023 --21961 818 14936
NM_033225chr862986 2876 2106 2048 1947 130 --12815 --
NM_033449chr561984 1805 1723 1376 853 368 --11600 12039
NM_033505chr265958 5183 4697 2138 687 350 16624 1508 --
NM_033626chrX3735 617 176 --1541 11826
NM_052879chr1253855 3329 2950 2857 1008 --13359 11589
NM_052880chr2261369 1160 1108 979 397 288 --136 --
NM_052899chr5----2987 275 --
NM_052910chr1321614 1528 ----11489
NM_052932chr1122068 290 2844 633 ----
NM_053025chr31511 --11171 --
NM_053279chr872652 2622 2144 1895 783 504 325 --12519 --
NM_054027chr551443 590 565 176 23 11557 1162 --
NM_054110chr32960 240 ------
NM_057175chr432381 2298 793 22185 409 12241 --
NM_057749chr831346 1025 127 2343 249 ----
NM_058172chr471802 1705 1378 1230 597 260 241 ----11547
NM_058191chr211734 1783 ----
NM_078487chr953164 2982 2083 1050 1004 --22832 175 --
NM_080546chr911786 --12001 --
NM_080743chr622140 242 ----1671
NM_080927chr353141 2569 2474 2293 916 ------
NM_130446chr332725 1394 763 ------
NM_133459chr181240 21516 85 ----
NM_133468chr731855 156 48 ----1312
NM_133473chr1921486 331 --1498 2583 417
NM_138357chr1031521 696 688 ------
NM_138459chr642559 2270 1222 767 12599 --1797
NM_138468chr265640 5175 4592 2060 1912 276 ----11773
NM_138473chr1274698 4592 4520 3907 3473 3252 1572 1917 14848 13486
NM_138764chr19------128
NM_138773chr52845 133 --186 --
NM_139057chr1542805 1117 853 186 12925 --12877
NM_139126chr64933 754 661 139 ------
NM_139136chr12------1113
NM_139245chr331797 1750 1144 --151 --
NM_139279chr252856 2527 2248 1211 958 --1139 --
NM_139283chr1222305 555 ------
NM_144571chr496808 6748 5788 5089 4986 4272 2406 1287 1183 12062 --15734
NM_144664chr1112529 --1445 --
NM_144778chr1352620 2516 2050 608 55 1487 ----
NM_144992chr2172 ----1583
NM_144997chr171477 ----11417
NM_145117chr1132457 835 274 ------
NM_145175chr211257 --11214 --
NM_145260chr22659 124 1744 ----
NM_145307chr1031217 642 496 ----1979
NM_145313chr102428 92 --11264 --
NM_145735chr1352109 1978 1758 444 349 1857 ----
NM_145808chr753112 1012 483 211 54 12753 ----
NM_147128chr731531 292 162 ----11314
NM_148957chr1321753 1069 --12020 12630
NM_152253chr2274090 3994 3919 3151 3085 763 596 13762 11121 --
NM_152320chr121277 --1553 --
NM_152375chr122198 452 12588 ----
NM_152409chr562954 2932 2912 2766 2518 1067 13311 ----
NM_152447chr141296 157 1264 --
NM_152608chr122313 511 --1407 --
NM_152622chr553445 3163 2930 2492 980 182 ----
NM_152641chr1222064 56 1664 --1321
NM_152665chr11105 --1456 --
NM_152678chr342508 305 213 52 --1398 --
NM_152707chr103823 209 119 ------
NM_152722chr1151432 539 228 122 92 ----11866
NM_152740chr72487 25 --1769 --
NM_152745chr71108 1736 ----
NM_152780chrX1448 1111 1168 1951
NM_152787chrX53485 2827 2473 1143 793 11365 1719 --
NM_152835chr152099 1111 1074 981 844 11053 --11799
NM_152860chr1211499 11480 11148 --
NM_152890chr141196 881 379 109 --1356 --
NM_152914chr1774203 3886 3030 2874 1402 579 91 12779 ----
NM_153020chr661525 1287 1166 1079 461 85 11606 ----
NM_153042chr651460 656 588 356 168 --11189 --
NM_153252chrX----1113 --
NM_153605chr31520 --21276 341 21628 1603
NM_153634chr1231364 1087 448 11424 ----
NM_153810chr1085109 4322 3867 3375 3349 3342 1656 1101 --11719 147
NM_170665chr1294400 4032 3456 1690 789 775 682 477 323 --1102 24258 3831
NM_172070chr262234 2127 1740 1630 1612 499 --1811 --
NM_172071chr1106074 5487 5377 1885 1659 1508 1395 1371 833 640 25446 617 16509 --
NM_173074chr2------1112
NM_173468chr4105943 5734 4997 4840 3895 2186 2074 755 695 476 ----15046
NM_173469chr1521429 1241 --1245 --
NM_173475chr1621587 562 11721 11411 --
NM_173508chr141083 882 370 363 ------
NM_173510chr2242196 824 309 248 --12532 --
NM_173536chr463691 3394 1819 1733 907 786 11242 ----
NM_173552chr342099 1517 124 43 --1314 --
NM_173582chr1174624 4316 1887 1696 1688 68 26 12177 15065 --
NM_173595chr1274066 3513 3318 1523 1269 1209 552 14934 15036 --
NM_173632chr19--1861 22225 144 51312 724 488 229 63
NM_174890chr101129 ----1218
NM_175607chr31214 21295 112 --11210
NM_175709chr22--1332 13019 --
NM_175736chr12107561 6106 4938 1629 1621 1364 1264 1148 980 576 ------
NM_175854chr133981 342 146 1199 --1962
NM_175866chr141496 504 204 174 1444 ----
NM_175876chr122739 2012 11947 21064 1055 22815 190
NM_177424chr131981 1898 1401 1596 ----
NM_177968chr232233 1908 1540 ------
NM_178011chr1012077 1864 ----
NM_178177chr32525 323 --1784 1540
NM_178496chr3----11563 --
NM_178539chr1241687 594 381 40 ----11991
NM_178565chr841459 551 465 386 1303 179 --
NM_180989chr131425 1984 ----
NM_181457chr211246 ----1404
NM_181809chr173997 2641 1510 997 844 538 256 --1408 --
NM_182515chr1966666 6232 6142 4856 1428 319 --25785 488 4573 405 238 157
NM_182526chr14--11139 33138 527 218 --
NM_182527chr2242149 2131 2006 793 21759 1669 ----
NM_182765chr1052015 1693 374 365 300 --2752 502 --
NM_182767chr1211535 --2592 54 --
NM_183075chr472616 2423 2026 2017 1986 1154 930 11859 42902 892 549 146 --
NM_194286chr1265847 5345 4623 4516 4322 3842 25969 3821 25925 4993 --
NM_197941chr592902 2687 2506 2350 2281 2042 627 360 128 ------
NM_198066chr1462876 2813 2437 2199 368 120 ----1106
NM_198157chr2272573 2215 1810 1625 991 705 76 ------
NM_198256chr221576 408 11591 1379 --
NM_198273chr543086 2986 2905 834 ----1635
NM_198485chr341779 1739 392 249 ------
NM_198504chr34624 587 347 26 2942 169 ----
NM_198965chr12195 1108 1150 --
NM_199051chr1------1131
NM_203282chr19--163 --1220
NM_203301chr1451584 1519 633 588 413 ------
NM_203307chr191585 --1147 2316 232
NM_203446chr2172300 2230 1980 915 642 601 284 ----1794
NM_203459chr132577 2481 285 --12259 --
NM_203463chr274941 4198 4132 4119 1165 319 142 --13570 --
NM_206853chr674068 3433 3265 2583 498 239 218 --13632 --
NM_207015chr372129 2065 1583 1555 812 133 79 --2848 563 --
NM_207043chr132117 874 691 138 1937 --
NM_207303chr1063857 3851 3450 1249 1050 437 23024 860 34197 3776 2997 --
NM_207411chr843544 2253 536 196 2873 429 ----
NM_207445chr1552102 1878 1809 615 131 --1697 --