TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-19a-3p
miRNA Sequence: UGUGCAAAUCUAUGCAAAACUGA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr511205 ------
NM_000024chr51351 --1219 1200
NM_000038chr521983 100 ----1236
NM_000068chr1911561 ------
NM_000084chrX86979 6291 4274 2446 2232 1089 1050 148 --15159 --
NM_000088chr1711331 --1151 --
NM_000089chr73769 759 264 --1312 --
NM_000090chr22903 735 ------
NM_000092chr294516 4460 4063 3995 3396 3215 1650 1301 1018 ------
NM_000093chr932393 2241 591 --12161 --
NM_000109chrX22127 1793 1283 1521 1573
NM_000111chr72253 90 1383 ----
NM_000112chr574926 4746 4472 3929 655 428 150 ----25204 90
NM_000125chr632607 998 222 --44222 3955 3815 3771 --
NM_000129chr631541 1152 1104 --1545 --
NM_000138chr15102488 2415 1885 1767 941 669 363 355 140 118 12540 11954 12082
NM_000141chr1031363 452 320 11068 ----
NM_000153chr1421128 335 --21167 664 --
NM_000161chr14------178
NM_000163chr542062 1677 1467 365 ----1840
NM_000165chr641650 1556 1274 630 1663 21383 501 11586
NM_000167chrX21435 716 11814 ----
NM_000168chr733375 3326 2394 ------
NM_000170chr91412 ------
NM_000176chr573572 2879 2818 1266 1019 955 783 1597 13876 --
NM_000183chr23337 328 86 --1143 --
NM_000189chr221757 864 ------
NM_000194chrX----3184 140 109 --
NM_000210chr252093 1719 1637 824 490 --22039 2022 1366
NM_000214chr2061514 1417 1140 586 436 383 ------
NM_000216chrX64017 3631 3169 2963 2878 910 131 23701 1015 14087
NM_000217chr1284534 3685 3253 2096 1565 435 152 95 --34844 3649 982 --
NM_000222chr441949 1909 1314 87 --11654 --
NM_000237chr8--11754 ----
NM_000240chrX21501 660 ------
NM_000245chr751841 810 678 669 105 ------
NM_000248chr392552 2334 2096 1114 1103 1085 976 966 286 1217 --21050 928
NM_000252chrX61393 1353 1275 1208 1159 70 ------
NM_000253chr43994 963 122 ------
NM_000259chr1576319 5871 5469 2237 2208 2130 1450 25886 1669 1607 --
NM_000264chr983244 3146 2996 2644 2438 2313 2097 425 --11258 1459
NM_000266chrX2701 189 1729 ----
NM_000267chr1773355 3216 3139 2870 2579 1189 830 --1979 1360
NM_000278chr1012317 ------
NM_000280chr115990 276 262 183 144 ------
NM_000282chr13--1197 2209 49 --
NM_000284chrX3485 468 149 --11859 1161
NM_000291chrX1381 1149 --1188
NM_000297chr431874 1844 595 --11678 --
NM_000298chr1138 1263 ----
NM_000304chr17----21076 820 --
NM_000314chr1042683 1218 1081 440 --22258 417 21228 657
NM_000319chr1211183 --11230 --
NM_000321chr1321724 356 ------
NM_000332chr6117008 6934 6928 5601 5315 5278 5232 975 900 381 46 36009 5147 4943 36811 4645 4633 11536
NM_000337chr565712 5282 2010 1654 631 477 --12261 24727 1803
NM_000346chr1792023 1992 1472 1428 1350 1330 762 715 378 ----1597
NM_000358chr52570 391 1404 ----
NM_000361chr2031671 1642 235 11758 --21690 433
NM_000362chr2223149 1002 23602 781 --11016
NM_000368chr943953 3297 593 428 132 24884 4458 --
NM_000378chr111366 1788 ----
NM_000390chrX42447 2286 1031 619 12749 ----
NM_000393chr251424 1361 1351 687 266 ------
NM_000405chr511283 --1150 --
NM_000408chr243400 2619 2258 185 --22894 256 22753 2382
NM_000430chr1773780 3464 2873 2699 2462 1107 714 ------
NM_000448chr1183125 3054 3045 2959 2762 411 56 32 ----1544
NM_000449chr11468 --2574 69 --
NM_000451chrX21996 1436 1824 11825 --
NM_000458chr171588 ------
NM_000459chr9--1833 1898 --
NM_000461chr3114583 4547 4444 3976 3773 3526 2948 1653 1575 505 185 14080 ----
NM_000474chr72667 655 ------
NM_000484chr2111076 1800 ----
NM_000486chr1243111 2488 2322 532 --23081 1025 --
NM_000489chrX33037 2494 2264 --1448 12744
NM_000492chr731200 373 261 ------
NM_000495chrX1453 1973 ----
NM_000503chr81744 2656 371 21774 1295 --
NM_000508chr42935 894 --1131 --
NM_000523chr221106 185 ------
NM_000527chr1952458 2244 2172 1975 818 1840 42346 2166 876 544 --
NM_000533chrX21742 1247 --11570 --
NM_000538chr1331631 581 158 11293 ----
NM_000553chr83597 576 402 ------
NM_000555chrX77862 6966 2516 2064 1969 1539 1204 26914 6728 26663 5648 --
NM_000572chr11110 ------
NM_000575chr21145 ----1206
NM_000596chr71200 ------
NM_000597chr2------1309
NM_000598chr711537 ----150
NM_000599chr243869 3824 3767 890 --24492 1042 --
NM_000609chr1072987 2972 2901 2609 2215 313 250 ----22131 129
NM_000610chr1162956 2703 2485 1219 1014 179 --11034 --
NM_000615chr1141953 649 533 194 1224 13003 --
NM_000618chr1236051 915 338 --3603 424 184 --
NM_000618chr1236051 915 338 --3603 424 184 --
NM_000633chr1875000 4862 4842 3861 3629 1723 493 ----1587
NM_000641chr19----11581 1390
NM_000683chr41525 ------
NM_000684chr10--2986 150 --1944
NM_000686chrX31563 526 394 ----1193
NM_000693chr1541581 1301 618 410 ------
NM_000701chr11250 ------
NM_000702chr122200 1859 ----11996
NM_000719chr1296666 6515 5854 5443 5297 5066 4981 1722 1543 46508 5834 5357 1081 21946 1376 31885 1811 380
NM_000720chr31127 ------
NM_000722chr71283 ------
NM_000724chr105720 567 454 186 124 1234 --1422
NM_000726chr21276 ------
NM_000739chr73182 172 95 ----1668
NM_000767chr191390 ------
NM_000780chr81241 ------
NM_000783chr101161 ------
NM_000785chr12162 ------
NM_000793chr1444059 3221 940 590 --14771 --
NM_000800chr541518 1360 162 124 ------
NM_000801chr204848 767 392 121 ------
NM_000806chr531497 1397 337 ------
NM_000810chr15----1117 --
NM_000811chr51576 ------
NM_000813chr565442 5081 4517 4481 4003 1902 23648 55 15238 14203
NM_000814chr1542568 1617 1507 264 ----11015
NM_000817chr221073 862 2934 198 ----
NM_000824chr41106 1955 ----
NM_000826chr452010 1947 1759 1678 1628 ----1419
NM_000827chr51402 ----12601
NM_000829chr1122063 783 --1934 --
NM_000831chr136144 6133 1966 15150 ----
NM_000839chr31467 ------
NM_000840chr71375 ------
NM_000844chr33980 840 791 --1402 --
NM_000855chr11----1351 --
NM_000859chr551541 1382 1354 501 433 ----11681
NM_000861chr361950 1919 1718 911 791 224 1690 21979 1738 --
NM_000868chrX61977 1960 1727 351 141 132 ------
NM_000872chr1031594 1143 437 21460 114 --1265
NM_000875chr1556909 5698 5668 5661 1043 16568 26495 1375 11190
NM_000876chr611075 ----11012
NM_000877chr253025 3004 2904 2820 2410 11083 23110 2959 --
NM_000883chr7----198 1658
NM_000883chr7----198 1658
NM_000885chr242068 1610 1505 848 ------
NM_000891chr1733639 3618 2441 13661 1848 21078 741
NM_000899chr1233803 847 229 --21648 336 14201
NM_000901chr472538 2275 2038 1756 894 764 689 --12404 1406
NM_000910chr431399 655 237 ------
NM_000912chr823494 2196 12595 ----
NM_000917chr10134 1202 ----
NM_000934chr172694 683 ------
NM_000938chr41163 ------
NM_000943chr52373 116 ------
NM_000944chr442029 1958 1936 411 ----1628
NM_000945chr251564 1370 806 789 602 --11581 21817 1625
NM_000950chrX52923 1313 1172 656 444 --23240 1360 --
NM_000956chr142927 313 --11079 --
NM_000958chr521313 1050 1449 ----
NM_000962chr932900 2705 298 --1368 --
NM_000965chr31277 1397 --21219 334
NM_000983chr141433 1224 154 26 21298 1137 ----
NM_001001132chr2131385 408 187 ----1311
NM_001001323chr1283168 2915 2848 2526 2174 2125 748 413 12182 12825 --
NM_001001331chr362602 1705 1087 910 837 620 42536 2506 1767 489 1565 12377
NM_001001344chrX52370 2038 1714 449 154 --2970 725 --
NM_001001389chr1162956 2703 2485 1219 1014 179 --11034 --
NM_001001390chr1162956 2703 2485 1219 1014 179 --11034 --
NM_001001391chr1162956 2703 2485 1219 1014 179 --11034 --
NM_001001392chr1153002 2749 2531 1060 225 --11080 --
NM_001001395chr1232753 380 371 12006 ----
NM_001001396chr124241 486 11150 34315 4277 3234 14132
NM_001001419chr5115067 4974 4818 4538 984 949 689 658 475 171 143 --1851 15213
NM_001001420chr5115067 4974 4818 4538 984 949 689 658 475 171 143 --1851 15213
NM_001001433chr20----2715 134 13181
NM_001001481chr843268 2645 2433 978 1595 --1853
NM_001001483chr111455 ------
NM_001001484chr1042245 1701 670 661 ------
NM_001001549chr772370 2308 2143 2115 2043 1784 383 --1401 12823
NM_001001550chr772370 2308 2143 2115 2043 1784 383 --1401 12823
NM_001001555chr772370 2308 2143 2115 2043 1784 383 --1401 12823
NM_001001556chr1521054 95 ------
NM_001001557chr8--11987 11630 --
NM_001001664chr283793 2905 1592 1561 863 372 302 141 12706 24106 3889 --
NM_001001668chr1913785 --13350 --
NM_001001706chr621154 1124 1239 ----
NM_001001740chr1125 ------
NM_001001740chr1125 ------
NM_001001852chr22------2943 757
NM_001001870chr173839 769 520 ------
NM_001001872chr142565 154 --2577 486 --
NM_001001890chr2123698 3490 11651 24257 530 --
NM_001001933chr13458 234 189 ------
NM_001001974chr1052026 2007 1956 1820 766 ----1565
NM_001001994chrX3454 134 107 ------
NM_001001995chrX31840 1760 1566 ------
NM_001001996chrX3454 134 107 ------
NM_001002033chr171804 --1300 --
NM_001002243chr22733 377 ----1758
NM_001002257chr21744 --2137 83 --
NM_001002258chr2--21873 1837 1163 --
NM_001002295chr104324 148 69 62 1281 ----
NM_001002800chr32142 60 ------
NM_001002838chrX31479 756 189 ----11870
NM_001002860chr1464477 3384 1612 1298 1070 196 54621 4503 3455 431 305 2390 298 --
NM_001002909chr173869 840 807 ------
NM_001002919chr24499 166 148 114 ------
NM_001003652chr1898265 7432 6899 6668 2771 2555 1148 1128 806 --32256 1771 1510 1371
NM_001003674chr1885286 5151 5139 4983 4549 584 345 162 12591 21447 790 12030
NM_001003675chr1885286 5151 5139 4983 4549 584 345 162 12591 21447 790 12030
NM_001003681chr2231959 1936 1751 --12121 11951
NM_001003688chr421136 44 --11098 --
NM_001003694chr32609 487 ------
NM_001003712chr1264006 3956 2647 656 514 322 --13649 --
NM_001003760chr653641 2697 2639 2392 1057 --1800 --
NM_001003792chr3------183
NM_001003793chr3------183
NM_001003800chr943471 3106 390 145 --2825 483 1994
NM_001003810chr41118 ----1699
NM_001003845chr2------1406
NM_001003937chr2------21583 1444
NM_001004019chr3198 ------
NM_001004065chr963319 1536 1471 1293 992 471 12421 11502 13085
NM_001004106chr5----1260 171
NM_001004196chr321226 230 ------
NM_001004308chrX11477 ------
NM_001004317chr633617 3390 3180 --13543 --
NM_001004329chr1241137 360 186 77 --31460 1251 1001 --
NM_001004360chr21207 --1254 1354
NM_001004720chr21945 11053 ----
NM_001004722chr211114 11222 ----
NM_001005271chr171885 11149 11024 --
NM_001005273chr171885 11149 11024 --
NM_001005335chr19181 1244 ----
NM_001005354chr123443 378 74 ------
NM_001005366chr123913 806 687 1927 1653 1310
NM_001005375chrY21324 376 --1525 11857
NM_001005404chr1784228 3765 3432 3144 1262 795 449 194 --13245 14444
NM_001005417chr1--1681 1580 1674
NM_001005463chr1072133 2108 877 826 792 609 287 --22370 2095 --
NM_001005473chr596628 6429 4597 4460 4433 4368 2488 2236 279 ------
NM_001005474chr341473 1395 1116 510 1553 --1199
NM_001005476chr21495 ------
NM_001005502chr1284990 4984 1529 1521 818 647 622 330 --14337 14738
NM_001005609chrX33832 2850 318 11531 ----
NM_001005739chr21819 1591 1355 --
NM_001005743chr1411073 --11312 --
NM_001005744chr1411073 --11312 --
NM_001005745chr1411073 --11312 --
NM_001005746chr21276 ------
NM_001005747chr21276 ------
NM_001005781chr2--2407 389 1242 --
NM_001005782chr23763 269 65 2856 838 1691 --
NM_001005849chr171194 2402 158 1479 --
NM_001005861chr34860 616 226 76 ------
NM_001005862chr171596 ----1459
NM_001006600chr571826 1778 1745 1660 1533 692 273 ----1126
NM_001006610chr166990 952 921 332 248 160 ------
NM_001006612chrX2396 300 ------
NM_001006613chrX2396 300 ------
NM_001006614chrX2396 300 ------
NM_001006617chr911355 11186 --11239
NM_001006619chr911355 11186 --11239
NM_001006620chr911355 11186 --11239
NM_001006621chr911355 11186 --11239
NM_001006626chr73182 172 95 ----1668
NM_001006627chr73182 172 95 ----1668
NM_001006628chr73182 172 95 ----1668
NM_001006629chr73182 172 95 ----1668
NM_001006630chr73182 172 95 ----1668
NM_001006631chr73182 172 95 ----1668
NM_001006632chr73182 172 95 ----1668
NM_001006636chr21899 --2703 370 --
NM_001006639chrX----2219 71 --
NM_001006640chrX----2219 71 --
NM_001006641chr921626 1190 ------
NM_001006642chr921626 1190 ------
NM_001006643chr921626 1190 ------
NM_001006657chr262659 2332 2066 1022 708 97 12907 1940 1137
NM_001006681chrX150 ------
NM_001006682chrX150 ------
NM_001006683chrX150 ------
NM_001006945chr11568 1130 ----
NM_001007023chr1444059 3221 940 590 --14771 --
NM_001007024chr1734294 3601 2694 --24345 4157 --
NM_001007025chr1734294 3601 2694 --24345 4157 --
NM_001007027chr111102 ------
NM_001007075chr431091 949 394 --1715 --
NM_001007097chr921269 317 24277 1504 24029 956 --
NM_001007102chr661645 1390 1274 531 339 247 --31567 1505 624 11633
NM_001007214chr12603 248 ----1409
NM_001007226chr172588 427 --21095 972 --
NM_001007227chr172588 427 --21095 972 --
NM_001007228chr172588 427 --21095 972 --
NM_001007229chr172588 427 --21095 972 --
NM_001007230chr172588 427 --21095 972 --
NM_001007237chr172852 2841 2621 2392 618 575 338 12540 1200 1480
NM_001007245chr72216 109 ------
NM_001007246chr211282 ------
NM_001007257chr131101 987 49 ------
NM_001007466chr635218 4547 58 --35091 4709 1689 --
NM_001007468chr221267 ------
NM_001007544chr1157 ------
NM_001007553chr121166 426 ------
NM_001007559chr184419 373 323 261 --11789 --
NM_001007565chr3177 ------
NM_001008220chr523913 3066 13973 ----
NM_001008225chr7144 --3596 588 64 --
NM_001008239chr1842860 2384 688 113 ------
NM_001008388chr41123 ------
NM_001008392chr323562 2934 ----12951
NM_001008405chr731455 463 90 1365 --1199
NM_001008408chr755843 5119 4528 2111 408 1491 --1536
NM_001008491chr232039 742 174 ----1522
NM_001008492chr232039 742 174 ----1522
NM_001008495chr842274 2002 560 349 1132 ----
NM_001008539chr865338 4532 4513 1824 1603 734 ------
NM_001008540chr2--191 ----
NM_001008541chr1022129 1472 12177 ----
NM_001008541chr1022129 1472 12177 ----
NM_001008564chr1372173 2090 1806 1690 1503 1430 87 11764 12143 21957 1898
NM_001008566chr221146 ----1138
NM_001008660chr1141272 543 519 335 ------
NM_001008707chr1461579 1560 1541 1376 716 545 1198 --1482
NM_001008723chr101412 ------
NM_001008738chr552374 2103 1793 870 451 ----11109
NM_001008860chr151754 ------
NM_001008892chr151754 ------
NM_001008894chr151754 ------
NM_001008925chr412962 --1294 --
NM_001008938chr111304 --1475 1159
NM_001009552chr82573 27 ------
NM_001009554chr484534 3467 3175 2931 1893 1863 1670 423 --13688 14770
NM_001009554chr484534 3467 3175 2931 1893 1863 1670 423 --13688 14770
NM_001009555chr441594 546 308 162 --177 --
NM_001009567chr101107 ----2640 501
NM_001009881chr11215 ------
NM_001009882chr11215 ------
NM_001009899chr3106501 6303 6209 5695 5418 4809 4139 4021 952 763 --56553 6545 912 817 770 --
NM_001009958chr71570 ------
NM_001009959chr242274 2239 2082 459 ------
NM_001009960chr732375 2233 1911 1717 12832 --
NM_001009993chr233071 1319 78 11442 13270 --
NM_001009994chr6193 ------
NM_001010000chr1833526 2493 757 ------
NM_001010844chr6124 ------
NM_001010853chr683246 3144 2912 2702 2259 678 346 181 11010 13065 --
NM_001010854chr141521 ------
NM_001010861chr112657 12279 32560 2163 977 --
NM_001010867chr155328 4609 2150 748 347 16073 ----
NM_001010888chrX104534 4239 3636 3471 3402 3388 972 874 582 95 13006 1292 33963 1818 1215
NM_001010891chr596593 6113 5251 4803 4497 4449 4250 1307 745 26729 1522 16350 --
NM_001010895chr92708 162 --11967 12084
NM_001010908chr101508 ------
NM_001010922chr173220 2953 2883 1699 1274 655 444 23753 1587 14114 --
NM_001010927chr62537 458 ------
NM_001010942chr1271268 1215 1074 1031 876 342 225 2506 294 --1162
NM_001010971chr1175 ------
NM_001010986chrX42290 2175 1819 908 ------
NM_001011515chr41254 --11054 --
NM_001011516chr41254 --11054 --
NM_001011537chr322274 1730 --12223 --
NM_001011551chrX260 34 ------
NM_001011553chr73975 955 661 1290 189 --
NM_001011657chrX21067 138 --11081 --
NM_001011658chrX31908 752 420 12119 ----
NM_001011663chr1011048 ------
NM_001011666chr796449 6343 6307 6301 4703 4680 4480 950 693 --14831 16563
NM_001011708chr212748 11808 12077 12535
NM_001011713chr144655 265 154 81 --151 168
NM_001011885chr1511730 --1366 --
NM_001012337chr3147 195 ----
NM_001012398chr1631061 853 295 ------
NM_001012420chr1572317 893 793 772 743 506 152 --12060 1316
NM_001012423chr1572317 893 793 772 743 506 152 --12060 1316
NM_001012426chr633377 3332 2714 ------
NM_001012427chr633377 3332 2714 ------
NM_001012514chr221085 92 --1975 --
NM_001012516chr221085 92 --1975 --
NM_001012732chr411228 ------
NM_001012751chr1031948 1616 318 --2654 625 --
NM_001012755chrX74896 4632 3330 1620 1352 565 124 44828 4266 1731 822 25053 4170 --
NM_001012756chr1952639 2529 2505 1155 998 ------
NM_001012759chr161104 ------
NM_001012761chr552616 1680 744 378 216 22396 148 ----
NM_001012762chr161135 ------
NM_001012968chrX92730 2387 1809 1766 1047 1010 860 555 253 ------
NM_001012977chrX2933 264 --1943 --
NM_001012980chrX1161 1234 ----
NM_001012989chrX2632 68 ------
NM_001013031chr1033388 2709 277 13418 --1981
NM_001013398chr711537 ----150
NM_001013406chr751366 1185 1117 322 38 1437 ----
NM_001013415chr421293 259 ----1523
NM_001013437chr181119 ------
NM_001013438chr31985 1213 ----
NM_001013439chr31831 159 ----
NM_001013620chr12107508 5924 5868 2694 2464 2111 1763 1530 1144 293 --26538 434 17562
NM_001013699chr12396 74 28 --1102 --
NM_001013703chr15--170 ----
NM_001013839chr1732540 1055 847 --12625 --
NM_001013843chr153887 323 297 --1658 --
NM_001014797chr1088227 7835 5235 3186 1896 1441 1090 757 28212 6335 35083 2136 1209 28201 5906
NM_001014809chr41882 --1345 1867
NM_001014812chr152318 184 ------
NM_001014972chr2180 ------
NM_001015045chr432207 2133 210 ------
NM_001015053chr1711572 ------
NM_001015508chr81490 ------
NM_001015877chrX53063 2511 1957 215 94 23096 2212 --1905
NM_001015892chr5150 ------
NM_001017368chr1722834 1966 --22385 798 --
NM_001017369chr411021 --11089 --
NM_001017371chr251352 405 202 192 154 ------
NM_001017395chr333512 2601 2582 ------
NM_001017405chr42881 208 --2901 177 --
NM_001017415chr11638 ------
NM_001017416chr11638 ------
NM_001017424chr121935 423 ----11286
NM_001017425chr121935 423 ----11286
NM_001017440chr777827 6680 5493 2768 1459 1031 165 17509 25253 1431 --
NM_001017920chr21120 ------
NM_001017922chr111126 --1137 11725
NM_001017923chr1441469 1071 260 183 ------
NM_001017928chr31248 ------
NM_001017962chr10134 1202 ----
NM_001017969chr9--1490 ----
NM_001017973chr5277 65 --1268 --
NM_001017974chr5277 65 --1268 --
NM_001017977chr1142 --1359 --
NM_001017979chr42597 277 ------
NM_001017999chr132170 744 432 ----1809
NM_001017999chr132170 744 432 ----1809
NM_001018000chr132170 744 432 ----1809
NM_001018000chr132170 744 432 ----1809
NM_001018001chr132170 744 432 ----1809
NM_001018004chr151228 ------
NM_001018005chr15--1152 ----
NM_001018006chr151228 ------
NM_001018007chr151228 ------
NM_001018009chr321122 374 --11191 --
NM_001018020chr151228 ------
NM_001018037chr92568 271 --21106 395 --
NM_001018038chr92111 22 --1209 --
NM_001018053chr131972 1719 683 --11645 --
NM_001018054chr131450 409 243 ------
NM_001018056chr93545 170 126 --1508 --
NM_001018065chr965900 5751 4642 2351 1470 1174 --26012 713 14062
NM_001018066chr965900 5751 4642 2351 1470 1174 --26012 713 14062
NM_001018067chr1105188 4945 4619 4514 3410 3326 1122 682 278 204 --25171 60 1448
NM_001018068chr1105188 4945 4619 4514 3410 3326 1122 682 278 204 --25171 60 1448
NM_001018069chr1105188 4945 4619 4514 3410 3326 1122 682 278 204 --25171 60 1448
NM_001018074chr573572 2879 2818 1266 1019 955 783 1597 13876 --
NM_001018075chr573572 2879 2818 1266 1019 955 783 1597 13876 --
NM_001018076chr573572 2879 2818 1266 1019 955 783 1597 13876 --
NM_001018077chr573572 2879 2818 1266 1019 955 783 1597 13876 --
NM_001018090chr1542194 1914 1873 226 --1470 --
NM_001018091chr1542304 2024 1983 336 --1580 --
NM_001018102chr1542194 1914 1873 226 --1470 --
NM_001018108chr1522163 269 ------
NM_001018115chr31637 ------
NM_001018159chr161130 ------
NM_001018160chr161130 ------
NM_001018676chr82478 320 ------
NM_001018677chr82478 320 ------
NM_001020658chr141636 1564 428 172 1260 11443 11421
NM_001020658chr141636 1564 428 172 1260 11443 11421
NM_001020825chr531047 354 293 --11351 --
NM_001023567chr156896 796 775 746 509 152 ----22384 316
NM_001024094chr573572 2879 2818 1266 1019 955 783 1597 13876 --
NM_001024218chr14--2729 693 ----
NM_001024226chr121122 999 ------
NM_001024227chr121122 999 ------
NM_001024228chr121122 999 ------
NM_001024380chr842386 2028 962 585 --12340 --
NM_001024381chr842386 2028 962 585 --12340 --
NM_001024455chrX32643 2096 1015 --145 1710
NM_001024457chr231124 559 468 1296 11310 --
NM_001024463chr151262 1938 ----
NM_001024647chr12117314 6862 6104 5521 5378 5103 4991 4738 4669 1314 118 13076 ----
NM_001024660chr311239 ----11409
NM_001024680chr231334 316 291 --1162 --
NM_001024688chr842159 1681 203 161 ------
NM_001024808chr1231968 1818 606 12785 --12835
NM_001024847chr352064 1721 1672 582 571 --2524 271 --
NM_001024947chr51971 --1814 1173
NM_001024948chr152977 2535 1403 732 446 13356 23349 2728 --
NM_001024956chr11115893 5593 5187 4898 4626 4520 4189 1426 1067 898 272 ----11166
NM_001025068chr331564 1304 538 ------
NM_001025069chr331564 1304 538 ------
NM_001025076chr1053883 2404 1303 1177 613 --22467 206 --
NM_001025077chr10105241 4796 4595 2661 2535 1971 1085 1062 845 257 --34811 1564 1314 --
NM_001025079chr373941 3788 2548 1548 1541 1274 1084 --23527 3061 23746 2728
NM_001025105chr541554 987 471 252 --11395 --
NM_001025108chr294045 3695 2902 1640 1507 1353 606 160 143 ------
NM_001025201chr22245 148 ------
NM_001025203chr211134 ------
NM_001025204chr211134 ------
NM_001025205chr3----1120 1428
NM_001025252chr843168 2620 2571 604 --13220 11161
NM_001025253chr843168 2620 2571 604 --13220 11161
NM_001025266chr354247 3884 1880 1751 207 13161 149 --
NM_001025356chr1252920 2808 2733 1177 737 ------
NM_001025366chr621899 1385 --11374 --
NM_001025366chr621899 1385 --11374 --
NM_001025367chr621899 1385 --11374 --
NM_001025367chr621899 1385 --11374 --
NM_001025368chr621899 1385 --11374 --
NM_001025368chr621899 1385 --11374 --
NM_001025369chr621915 1401 --11390 --
NM_001025369chr621915 1401 --11390 --
NM_001025370chr621899 1385 --11374 --
NM_001025370chr621899 1385 --11374 --
NM_001025579chr1741072 1054 1029 325 11019 ----
NM_001025580chrX83861 3839 3339 2866 2644 762 529 229 12809 --13534
NM_001025595chr441664 469 381 241 1119 31572 1044 297 --
NM_001025596chr112426 379 ------
NM_001025603chr11468 --2574 69 --
NM_001025777chr2----1201 --
NM_001025780chr931445 1083 89 1502 --1316
NM_001029858chr682963 2553 2421 2318 2254 1363 1095 299 171 33342 3053 354 1454
NM_001029863chr63875 344 80 ----11989
NM_001029874chr121315 --178 --
NM_001029875chr522420 641 ----22347 2240
NM_001029882chr12655 478 ------
NM_001029882chr12655 478 ------
NM_001029884chr662756 2482 2307 2156 180 103 ----1955
NM_001029989chr154943 300 248 146 ----1393
NM_001030002chr17------1323
NM_001030006chr1732435 323 191 11876 --1422
NM_001030007chr1673652 3297 2701 1555 1194 737 665 33547 3374 2526 23009 226 --
NM_001030055chr1454492 1505 1130 1101 739 13875 24014 1154 --
NM_001031623chr631356 1277 158 --1356 --
NM_001031679chr1243467 3057 291 172 ----1434
NM_001031681chr1722331 1543 --1595 --
NM_001031684chr231457 1030 935 11249 ----
NM_001031695chr2265339 4896 4084 3825 3626 1813 13859 23723 1188 25427 1332
NM_001031710chr72935 281 1835 ----
NM_001031711chr531443 1372 157 ----11364
NM_001031722chr61137 ------
NM_001031748chr123520 253 191 ----1546
NM_001031804chr1624376 1643 22695 357 23248 1162 --
NM_001031812chr551924 1567 1561 1541 682 12000 12245 1752
NM_001032279chr112400 112 --1388 --
NM_001032280chr611282 --11655 --
NM_001032282chr831311 1202 447 ----11293
NM_001032283chr123898 759 247 ------
NM_001032284chr123898 759 247 ------
NM_001032293chr17--1447 --1638
NM_001032363chr131851 239 171 ------
NM_001032363chr131851 239 171 ------
NM_001032393chrX2748 683 --1206 --
NM_001032394chr652549 2284 1788 384 180 ----12595
NM_001032395chr652416 2151 1655 251 47 ----12462
NM_001032999chr2044540 4343 3509 1532 ----24216 891
NM_001033002chr17199 168 --1273
NM_001033045chr223879 3818 --13671 1681
NM_001033047chr442659 2540 408 375 ------
NM_001033057chr331431 1338 492 --31827 1405 658 --
NM_001033059chr621434 192 ----1596
NM_001033081chr141867 1763 1752 162 ----21788 83
NM_001033082chr141867 1763 1752 162 ----21788 83
NM_001033087chr2012196 22458 1317 --12612
NM_001033112chr51135 ------
NM_001033503chr51447 ------
NM_001033506chr112410 338 ------
NM_001033507chr11715 21541 189 ----
NM_001033518chr72831 749 --1293 --
NM_001033519chr72831 749 --1293 --
NM_001033520chr72831 749 --1293 --
NM_001033521chr202250 136 ------
NM_001033522chr202250 136 ------
NM_001033557chr221363 1121 --172 --
NM_001033561chr17----2212 127 1201
NM_001033566chr173719 245 121 ------
NM_001033568chr173719 245 121 ------
NM_001033602chr132875 771 12695 ----
NM_001033659chr1731593 1370 1175 11210 ----
NM_001033723chr81622 --11859 1436
NM_001033756chr621833 1319 --11308 --
NM_001033756chr621833 1319 --11308 --
NM_001033925chr1021407 733 --1582 --
NM_001033953chr11170 ------
NM_001034841chr1684196 3878 3835 3518 1765 1393 731 488 --15487 --
NM_001034852chr1432071 1896 547 --2841 130 1378
NM_001035chr141261 1141 847 174 ------
NM_001035003chr451430 1282 1270 1225 356 --1181 --
NM_001035004chr451430 1282 1270 1225 356 --1181 --
NM_001035260chr101414 --21574 1290 --
NM_001035507chr2160 ------
NM_001037131chr2--11242 --11148
NM_001037132chr742149 1616 1542 1488 ----1543
NM_001037133chr742149 1616 1542 1488 ----1543
NM_001037164chr731976 391 366 1379 ----
NM_001037172chr321388 944 --1304 --
NM_001037174chr22623 31 22190 808 ----
NM_001037317chr112657 12279 32560 2163 977 --
NM_001037332chr522521 2385 11651 --12412
NM_001037333chr522521 2385 11651 --12412
NM_001037334chr1861867 1848 1728 672 391 253 1649 ----
NM_001037339chr141669 1308 586 411 ------
NM_001037340chr141669 1308 586 411 ------
NM_001037341chr141669 1308 586 411 ------
NM_001037341chr141669 1308 586 411 ------
NM_001037494chr121201 ------
NM_001037495chr121201 ------
NM_001037535chrX41487 1184 977 101 ------
NM_001037536chrX41487 1184 977 101 ------
NM_001037540chrX41487 1184 977 101 ------
NM_001037553chr2145115 4188 3752 3473 14056 --14454
NM_001037582chr431512 1445 375 176 ----
NM_001037738chr51285 ------
NM_001037872chr22169 63 ----2302 131
NM_001037954chr1123541 895 13263 1427 --
NM_001038493chr231546 1525 1363 11346 1964 --
NM_001038640chr154863 842 813 228 ----1384
NM_001038702chr541108 1098 664 244 ----12674
NM_001039091chrX31339 943 125 ----11092
NM_001039199chr2044189 3709 3338 661 ------
NM_001039465chr141151 1427 ----
NM_001039479chr141920 ----12439
NM_001039538chr273692 3658 2470 1476 494 288 195 --22522 261 --
NM_001039547chr3107836 7033 6951 5171 2943 2783 1792 1459 1276 233 ----26923 6817
NM_001039573chr171445 ----1422
NM_001039574chr1--1193 --1118
NM_001039577chr184063 3479 3461 1318 1076 954 765 638 --43903 1594 1493 399 --
NM_001039590chrX53818 3722 3367 2925 201 1820 ----
NM_001039591chrX53818 3722 3367 2925 201 1820 ----
NM_001039618chr1175346 4766 3793 3666 1992 1978 1679 21596 663 ----
NM_001039649chr131111 ----1314
NM_001039709chr2044540 4343 3509 1532 ----24216 891
NM_001039711chr12964 305 ------
NM_001039712chr12964 305 ------
NM_001039802chr141383 930 872 100 ----11156
NM_001039840chrX145886 4963 4794 4176 4003 3699 2409 2379 1838 1404 1391 823 774 673 --1199 31655 576 163
NM_001039888chr12318 101 ------
NM_001039937chr1363973 771 422 374 187 78 1460 23684 1095 --
NM_001040001chr652022 1966 1788 59 25 ------
NM_001040057chr721195 940 ------
NM_001040092chr82340 62 ------
NM_001040097chr7----1153 --
NM_001040098chr7----1153 --
NM_001040099chr7----1153 --
NM_001040100chr351289 1270 1200 1041 929 133 21122 793 1184
NM_001040135chr73819 788 123 ------
NM_001040142chr222224 468 11752 11591 --
NM_001040143chr222224 468 11752 11591 --
NM_001040152chr765114 4575 4329 3150 1871 750 ------
NM_001040153chr133757 249 167 1398 1915 --
NM_001040158chr52551 451 1381 ----
NM_001040159chr43441 293 119 ------
NM_001040214chr62944 503 12205 32384 2322 1631 --
NM_001040260chr41475 11064 ----
NM_001040261chr41475 11064 ----
NM_001040272chr932367 2242 364 11817 --12378
NM_001040284chr1655888 1262 937 793 536 35811 4629 62 11051 25287 478
NM_001040402chr482246 1230 712 276 203 196 102 75 22469 2292 23097 798 11160
NM_001040409chr22780 328 ------
NM_001040429chr1322209 645 12361 11424 --
NM_001040441chr164897 3467 1875 1867 1021 135 ------
NM_001040446chr542367 2186 1706 450 --11809 11827
NM_001040450chr1541854 833 712 636 ------
NM_001040453chr1541854 833 712 636 ------
NM_001040455chr1131329 357 312 --11356 --
NM_001040456chr71554 ------
NM_001040457chr71554 ------
NM_001040633chr72899 190 ------
NM_001040653chr342526 2357 730 297 ------
NM_001040665chr794831 4284 4276 4212 3758 1918 1624 1205 333 ----2831 244
NM_001040666chr71533 ------
NM_001040708chr821139 304 --1284 --
NM_001040709chr132523 2310 274 ------
NM_001040712chr942857 2445 2358 2204 --43020 3003 2946 1400 22908 715
NM_001041chr32137 94 ------
NM_001042355chr1641998 525 404 53 --23296 195 11453
NM_001042357chr1021473 380 --273 48 11202
NM_001042358chr1021473 380 --273 48 11202
NM_001042360chr1021473 380 --273 48 11202
NM_001042361chr1021504 411 --2104 79 11233
NM_001042363chr1021473 380 --273 48 11202
NM_001042364chr1021504 411 --2104 79 11233
NM_001042365chr1021504 411 --2104 79 11233
NM_001042387chr1021504 411 --2104 79 11233
NM_001042389chr1021473 380 --273 48 11202
NM_001042390chr1021473 380 --273 48 11202
NM_001042392chr1021473 380 --273 48 11202
NM_001042393chr1021504 411 --2104 79 11233
NM_001042395chr1021473 380 --273 48 11202
NM_001042396chr1021504 411 --2104 79 11233
NM_001042397chr1021504 411 --2104 79 11233
NM_001042403chr121410 ------
NM_001042404chr111917 --1631 1700
NM_001042412chr1641998 525 404 53 --23296 195 11453
NM_001042413chr963354 2829 2646 1569 777 170 13521 21119 619 23425 733
NM_001042424chr443264 2147 953 806 --1540 --
NM_001042425chr611282 --11655 --
NM_001042453chrX61666 1608 1575 378 191 111 11079 --11267
NM_001042473chr1031384 770 646 --1161 12051
NM_001042481chr1452633 2519 2385 2330 164 --12029 12238
NM_001042492chr1773355 3216 3139 2870 2579 1189 830 --1979 1360
NM_001042493chr621417 1383 --1315 --
NM_001042506chrX2933 264 --1943 --
NM_001042510chr832048 1376 572 ------
NM_001042511chr832048 1376 572 ------
NM_001042517chr132987 197 ------
NM_001042537chrX42216 1598 200 29 --163 140
NM_001042543chr431259 358 145 21597 507 --1398
NM_001042548chr22696 574 ------
NM_001042555chr1264618 4196 3832 3581 1257 922 1211 54057 3784 3680 969 27 14292
NM_001042576chr201183 ------
NM_001042599chr2107734 7329 7246 5955 5396 5244 5210 3152 2272 2146 12108 27014 1085 11431
NM_001042601chr342856 628 549 483 ------
NM_001042603chr1254731 4325 4128 1344 649 15235 1152 --
NM_001042604chr364723 4665 3742 3712 847 263 --21081 619 --
NM_001042616chr44586 500 165 88 ----1111
NM_001042646chr32655 172 ------
NM_001042749chrX71957 1924 1854 1838 1290 815 369 ------
NM_001042750chrX71957 1924 1854 1838 1290 815 369 ------
NM_001042751chrX71957 1924 1854 1838 1290 815 369 ------
NM_001043318chr1433752 2777 2579 13848 1671 --
NM_001044305chr611570 --11143 1314
NM_001044385chr244004 1531 1175 93 33543 3170 649 ----
NM_001044722chr551924 1567 1561 1541 682 12000 12245 1752
NM_001044723chr551924 1567 1561 1541 682 12000 12245 1752
NM_001046chr522795 2168 ----13007
NM_001048183chr153755 3702 2477 537 105 --1354 --
NM_001068chr3------178
NM_001071775chr1371745 1698 1607 1309 722 647 60 11387 ----
NM_001077628chr12725 597 ------
NM_001078chr13733 713 490 ----1261
NM_001079874chr152136 2126 1898 1622 667 --1606 --
NM_001083620chr452008 1945 1757 1677 1627 ----1418
NM_001084chr71296 ------
NM_001096chr171609 --1795 --
NM_001099678chr3126184 6120 5540 5501 5051 4979 3888 2424 1950 1629 1005 241 --26102 262 12257
NM_001100108chr147322 5274 5182 5109 --16593 11257
NM_001106chr3139783 9569 9272 9253 9181 8897 8796 7673 7642 6322 6157 6035 2759 --23678 1596 18888
NM_001109977chr42847 38 ----1736
NM_001113490chrX73503 2802 2763 965 876 816 432 12525 ----
NM_001115chr8131 ------
NM_001116chr1642890 873 513 58 --13020 12833
NM_001117chr1872527 2511 2314 2197 2143 2053 398 --11905 --
NM_001119chr421428 1413 11453 ----
NM_001121chr1041793 1206 750 736 146 --1681
NM_001122679chr511205 ------
NM_001123chr102605 290 ------
NM_001124chr112486 159 --1513 --
NM_001128chr1673652 3297 2701 1555 1194 737 665 33547 3374 2526 23009 226 --
NM_001149chr1011226 ------
NM_001151chr41184 1241 ----
NM_001153chr22945 198 --1879 --
NM_001156chr101245 1648 1465 1149
NM_001160chr1282834 2685 2641 2634 901 741 262 115 --22094 467 12257
NM_001167chrX86484 6372 5774 5649 4262 1755 1141 887 --36537 4998 2245 11310
NM_001173chr1454492 1505 1130 1101 739 13875 24014 1154 --
NM_001177chr1262443 2313 1751 349 256 135 11845 ----
NM_001186chr2152857 2558 2137 1264 504 22567 2388 11107 --
NM_001187chr211120 --1500 --
NM_001198chr61479 2649 78 1889 1302
NM_001200chr202356 307 1252 --1392
NM_001201chr453930 3337 666 312 246 13654 2856 89 --
NM_001204chr2117584 7495 7110 6040 5832 5802 5719 5173 2294 2167 1582 26422 2521 35022 209 39 26353 649
NM_001206chr963082 2922 984 773 763 321 ----23131 3042
NM_001211chr153340 307 300 ------
NM_001219chr75746 395 265 233 218 --21816 75 --
NM_001222chr10--1520 11899 --
NM_001233chr73754 628 208 --12309 1781
NM_001235chr11------1668
NM_001241chr252250 2148 1819 594 221 11868 1514 --
NM_001241chr252250 2148 1819 594 221 11868 1514 --
NM_001256chr1772963 2673 2182 2041 1963 928 458 12924 32863 2418 2215 --
NM_001257chr1621131 1081 --11389 --
NM_001259chr754643 4585 1880 1867 485 ------
NM_001260chr131345 ------
NM_001261chr9159 ------
NM_001270chr51880 ------
NM_001271chr1522870 1077 --12826 32508 1117 699
NM_001278chr102754 391 ------
NM_001282chr1732435 323 191 11876 --1422
NM_001284chr51433 ------
NM_001286chr132824 2772 2701 --12760 --
NM_001290chr43885 832 736 ----1985
NM_001298chr23967 915 246 ----11317
NM_001304chr1743777 2479 1347 134 2977 893 11301 1319
NM_001305chr71785 ------
NM_001310chr1222518 1917 12904 1307 --
NM_001313chr41882 --1345 1867
NM_001315chr642227 2047 1582 1510 ----12064
NM_001316chr201358 ------
NM_001324chr202250 136 ------
NM_001326chr111456 ------
NM_001329chr1041256 1006 345 97 --1662 --
NM_001330chr162984 321 ------
NM_001331chr11----12197 1255
NM_001332chr51440 11091 11145 --
NM_001346chr322548 2026 --11005 1455
NM_001356chrX11828 32273 1582 1540 --11750
NM_001357chr11222 ------
NM_001364chr1192924 2900 2889 1244 849 778 583 108 95 14212 ----
NM_001378chr2----170 --
NM_001380chr104987 971 761 323 ------
NM_001385chr81286 ------
NM_001386chr852350 1870 1734 1702 1653 ------
NM_001389chr211403 --1579 1434
NM_001390chr1863513 3369 3139 3071 3046 241 12799 11238 1420
NM_001391chr1811184 ------
NM_001396chr2142596 2146 1014 905 ----1375
NM_001399chrX33832 2850 318 11531 ----
NM_001400chr11867 --1264 11339
NM_001407chr31234 --1227 --
NM_001408chr1--11613 ----
NM_001412chrX43404 2810 797 637 ----23457 2893
NM_001416chr171459 ------
NM_001417chr1231885 1456 1402 --2704 157 11857
NM_001418chr111161 1575 ----
NM_001418chr111161 1575 ----
NM_001419chr1944156 1059 993 787 14134 44604 1175 87 23 --
NM_001420chr1932200 2084 604 --13165 --
NM_001423chr121590 --11950 --
NM_001429chr221314 --161 1689
NM_001430chr241509 770 238 74 1629 ----
NM_001432chr473935 3725 3651 3396 2717 2659 766 23520 1330 13638 --
NM_001438chr133401 1399 774 --23200 1058 --
NM_001440chr822788 1016 1425 ----
NM_001448chrX21279 299 ------
NM_001449chrX1845 ------
NM_001451chr1631369 1179 522 ----11330
NM_001453chr631529 1371 525 ------
NM_001454chr17--1237 ----
NM_001457chr3158 ------
NM_001458chr71619 ----1686
NM_001463chr24264 188 81 54 190 ----
NM_001483chr71765 ------
NM_001490chr942947 2742 502 485 --12563 --
NM_001494chr102655 92 ------
NM_001495chr81172 ------
NM_001497chr931905 720 226 ----21864 793
NM_001498chr661320 1085 1026 546 334 304 2324 256 ----
NM_001530chr142347 238 21084 466 ----
NM_001533chr19181 1244 ----
NM_001542chr172852 2841 2621 2392 618 575 338 12540 1200 1480
NM_001543chr524625 3529 ------
NM_001546chr6--1259 1193 11027
NM_001550chr72216 109 ------
NM_001554chr11587 ------
NM_001556chr821048 948 ------
NM_001560chrX32674 1861 364 ------
NM_001564chr41140 ------
NM_001584chr113465 210 110 --11041 1383
NM_001604chr115990 276 262 183 144 ------
NM_001609chr1053731 3517 1323 1127 853 --13474 13040
NM_001614chr17----2599 548 --
NM_001614chr17----2599 548 --
NM_001616chr263388 2971 2858 2384 668 437 13491 --1878
NM_001619chr11191 ------
NM_001634chr621434 192 ----1596
NM_001650chr1854123 4116 3680 3429 934 --12896 --
NM_001655chr1132127 523 387 --11417 --
NM_001656chr521680 629 --12036 152
NM_001658chr121122 999 ------
NM_001660chr32673 74 ------
NM_001663chr1462596 2085 947 665 336 223 --1446 --
NM_001668chr132100 1924 748 11717 ----
NM_001675chr22175 ------
NM_001677chr1--1921 ----
NM_001679chr33585 518 55 ----1735
NM_001682chr1292882 2629 2562 2240 1888 1839 1147 462 127 11896 12539 --
NM_001683chr362602 1705 1087 910 837 620 42536 2506 1767 489 1565 12377
NM_001684chr143958 1596 1581 203 1867 34032 3994 2951 13849
NM_001688chr11294 ------
NM_001689chr2--21873 1837 1163 --
NM_001690chr34789 484 468 362 ------
NM_001693chr8--1268 167 --
NM_001694chr16--1118 ----
NM_001695chr854272 3845 1599 1554 1038 11542 13254 13475
NM_001701chr951143 1106 1017 461 107 --21584 1461 --
NM_001706chr34804 700 690 373 ------
NM_001709chr1162287 916 686 667 300 54 ----1199
NM_001714chr12143 --1426 --
NM_001717chr1531497 1231 1188 ------
NM_001718chr621230 1106 --11089 --
NM_001722chr81247 ------
NM_001730chr1341527 1435 553 133 --11042 --
NM_001730chr1341527 1435 553 133 --11042 --
NM_001731chr122752 739 1885 1369 1852
NM_001742chr721321 1288 11739 --11833
NM_001743chr23409 213 66 135 1460 --
NM_001745chr531152 284 182 ------
NM_001748chr12737 80 ----1196
NM_001752chr111585 ------
NM_001753chr7----21563 244 --
NM_001754chr2123698 3490 11651 24257 530 --
NM_001755chr1622200 1541 21779 1734 3573 448 210 --
NM_001759chr1214163 --11694 11484
NM_001769chr12--1324 ----
NM_001777chr373941 3788 2548 1548 1541 1274 1084 --23527 3061 23746 2728
NM_001788chr73975 955 661 1290 189 --
NM_001791chr141383 930 872 100 ----11156
NM_001792chr182394 90 --3975 800 252 --
NM_001797chr161758 ----1661
NM_001798chr1231129 1117 1025 ------
NM_001799chr51102 ------
NM_001822chr22245 148 ------
NM_001827chr92275 267 ------
NM_001829chr43312 153 141 --1702 --
NM_001830chrX53742 3391 3186 1218 359 13311 2799 484 --
NM_001839chr11113 1272 ----
NM_001842chr91479 --1111 189
NM_001845chr1341384 1296 1281 137 ----11395
NM_001854chr141490 1293 577 433 11052 ----
NM_001858chr674282 4062 3890 3522 752 344 305 --34213 4197 3504 --
NM_001873chr41678 1586 ----
NM_001874chr1284990 4984 1529 1521 818 647 622 330 --14337 14738
NM_001881chr101114 ------
NM_001882chr54521 494 428 192 --1171 --
NM_001884chr51165 ----1383
NM_001885chr11121 ------
NM_001892chr541554 987 471 252 --11395 --
NM_001893chr171376 ------
NM_001894chr2211144 --11197 --
NM_001902chr1185 ----1405
NM_001903chr51218 ------
NM_001904chr35833 672 338 249 116 ------
NM_001918chr1119074 8668 8474 8449 7269 5869 1737 1226 997 539 106 18123 11320 18792
NM_001921chr411228 ------
NM_001924chr14558 172 60 36 ------
NM_001935chr22864 832 ----1298
NM_001938chr131499 598 89 --21727 354 --
NM_001946chr1221014 818 --1362 1414
NM_001949chr693247 3167 3027 2833 2760 2727 2446 894 769 --12382 12707
NM_001950chr162734 668 ----1761
NM_001954chr6------1752
NM_001957chr432262 870 793 --1308 --
NM_001964chr511059 1404 21108 274 1465
NM_001968chr44853 825 681 164 ------
NM_001969chr1442998 2987 2744 716 --22690 783 --
NM_001977chr41298 ------
NM_001980chr1232050 1991 791 12271 ----
NM_001981chr162298 1579 1555 917 756 401 --32312 1786 910 1548
NM_001987chr1233689 3130 432 ------
NM_001992chr53505 495 325 1124 ----
NM_001993chr131089 833 40 ----1255
NM_001995chr411327 11394 --11260
NM_001998chr3198 ------
NM_001999chr531493 1440 1210 ----11163
NM_002009chr1522409 828 1257 --12593
NM_002010chr131403 ------
NM_002015chr1361219 1076 904 701 423 333 22531 1017 22603 471 3953 711 662
NM_002017chr1121312 123 1255 --1981
NM_002019chr131785 ------
NM_002024chrX21754 760 21590 1439 --1186
NM_002025chrX108094 7908 7034 6271 6106 5834 2957 2071 1813 920 --29108 3446 --
NM_002027chr82478 320 ------
NM_002031chr62621 542 1558 ----
NM_002040chr2153128 3018 2792 2705 563 --12496 13041
NM_002044chr1521054 95 ------
NM_002049chrX1122 ------
NM_002051chr104324 148 69 62 1281 ----
NM_002056chr22283 60 ----1675
NM_002063chrX11099 ------
NM_002069chr721619 388 1555 --1544
NM_002074chr121672 459 1626 ----
NM_002076chr1233154 2769 329 12932 13171 --
NM_002077chr911437 ----1112
NM_002082chr5----1223 134
NM_002087chr17------1299
NM_002092chr464937 4476 4320 3916 3286 1591 14010 12034 21720 54
NM_002106chr41113 ----1324
NM_002107chr11383 ------
NM_002114chr6------1173
NM_002126chr1723894 741 24095 1584 1709 11455
NM_002128chr1342387 1967 875 141 ------
NM_002129chr43361 335 124 ------
NM_002130chr531551 1399 277 --1390 11444
NM_002137chr752229 2109 604 339 297 1484 ----
NM_002138chr41118 ----1699
NM_002139chrX1240 ------
NM_002140chr941181 1015 762 457 ------
NM_002146chr1761347 1235 1158 1101 950 401 ------
NM_002158chr263749 3245 2918 1276 1011 752 23829 3449 13401 --
NM_002165chr201323 ------
NM_002167chr1----1413 1489
NM_002182chr342765 2740 769 236 --12200 --
NM_002193chr231890 1477 398 --11463 --
NM_002199chr42945 61 ------
NM_002202chr52981 872 ------
NM_002203chr521123 60 13826 21522 289 23985 3588
NM_002204chr1711360 ------
NM_002207chr3155 ------
NM_002210chr253507 3258 2785 2767 423 --12902 --
NM_002214chr775362 4856 4543 3844 1332 866 616 21597 123 --15194
NM_002222chr341234 392 314 112 --2529 269 11139
NM_002226chr142902 227 ------
NM_002234chr121267 ------
NM_002239chr21902 --1252 --
NM_002240chr211559 ------
NM_002245chr12477 128 --1449 --
NM_002246chr221226 158 --1376 --
NM_002247chr1012119 1778 --1128
NM_002253chr421379 419 --11364 --
NM_002264chr353631 3301 2026 748 704 35001 4184 139 34960 534 119 --
NM_002267chr1352445 2426 2345 2272 153 ----12107
NM_002268chr331800 1643 1462 11479 --11572
NM_002270chr5125648 5636 5621 4749 4305 4092 3602 2192 2031 975 935 341 24849 3674 41989 1936 772 516 --
NM_002271chr1342275 2185 915 896 --12165 --
NM_002285chr294045 3695 2902 1640 1507 1353 606 160 143 ------
NM_002291chr72148 118 ------
NM_002293chr152794 1696 1018 755 260 ------
NM_002296chr151606 630 563 92 53 --1233 1660
NM_002310chr5105965 5892 5405 5355 2590 1821 1512 708 395 300 14560 14076 25124 1715
NM_002312chr13193 --1733 --
NM_002314chr72934 272 ------
NM_002333chr19140 1228 ----
NM_002334chr1121875 245 ------
NM_002335chr111197 ----1166
NM_002336chr1275079 4971 4899 4770 1049 261 226 --23629 242 31981 903 159
NM_002345chr123657 225 123 --1571 1499
NM_002349chr231423 1216 1067 --31411 1034 28 1242
NM_002350chr83974 502 76 ------
NM_002351chrX122 11557 11673 1169
NM_002354chr21125 1362 ----
NM_002355chr121498 --31364 258 140 11422
NM_002356chr642703 1085 881 856 12752 1321 22659 313
NM_002359chr1764309 1101 1094 603 200 31 --1255 --
NM_002374chr273692 3658 2470 1476 494 288 195 --22522 261 --
NM_002380chr84870 743 259 26 --1389 1340
NM_002381chr2--1422 2962 936 170
NM_002382chr142980 871 11271 ----
NM_002397chr562239 840 749 728 279 135 32079 232 216 ----
NM_002398chr211276 11429 ----
NM_002408chr142731 281 ----2708 312
NM_002428chr16--11446 ----
NM_002429chr1231025 529 492 ------
NM_002438chr101107 ----2640 501
NM_002449chr51438 11224 ----
NM_002469chr122395 363 ------
NM_002478chr112456 445 --1555 --
NM_002480chr1221175 490 41456 1082 359 34 ----
NM_002482chr1280 41 ------
NM_002485chr842159 1681 203 161 ------
NM_002499chr1562208 1831 863 641 630 581 177 --11527
NM_002500chr221249 1166 1820 2935 904 1455
NM_002508chr131846 1794 353 ----11965
NM_002514chr831163 319 301 21156 414 ----
NM_002515chr142670 75 1523 --1721
NM_002518chr241223 1145 1003 403 11077 11243 --
NM_002519chr1141435 214 169 112 --11319 --
NM_002523chr711153 ------
NM_002524chr121039 1001 ----1804
NM_002527chr12----1261 --
NM_002536chrX11297 ----1233
NM_002539chr22263 99 1272 ----
NM_002540chr92697 640 ------
NM_002541chr7----11030 --
NM_002542chr31250 ------
NM_002546chr81570 ------
NM_002547chrX42583 1652 198 126 13099 1706 --
NM_002568chr81322 ------
NM_002572chr11----195 --
NM_002574chr13261 254 218 ------
NM_002577chr343254 2657 541 460 --23345 289 --
NM_002578chrX3425 375 177 ------
NM_002581chr945699 2072 1124 476 34966 4204 235 14283 --
NM_002582chr161953 ------
NM_002585chr1----1390 --
NM_002589chr4--1126 ----
NM_002594chr2022058 770 --12287 --
NM_002595chr1241611 1534 1375 758 ----1196
NM_002600chr141669 1308 586 411 ------
NM_002607chr731262 1235 1220 ------
NM_002608chr2221548 1055 11352 ----
NM_002610chr283046 2953 2918 2722 2597 1122 181 41 13108 --12251
NM_002613chr1655068 4236 3808 3712 648 11211 13742 --
NM_002620chr4161 ------
NM_002623chr201706 ----1205
NM_002627chr10152 ------
NM_002628chr34910 884 392 145 1327 1211 1768
NM_002641chrX41756 1377 195 36 --21860 1413 --
NM_002643chr21162 ------
NM_002645chr1142717 2161 2005 101 1842 22432 326 --
NM_002655chr885064 4970 4956 4810 4244 1742 1392 109 13830 ----
NM_002656chr62926 900 --1196 --
NM_002657chr2063751 3696 3603 3273 2430 1198 13305 ----
NM_002662chr332074 1557 300 ------
NM_002663chr171525 ------
NM_002670chr331144 335 98 ------
NM_002687chr1471146 1015 362 178 160 103 35 ----1170
NM_002697chr11218 ------
NM_002699chr111466 ----11278
NM_002706chr21646 ----1153
NM_002709chr243171 2426 1451 1225 --12572 --
NM_002711chr71321 --1840 --
NM_002713chr11200 ----2996 984
NM_002714chr611100 ----11111
NM_002715chr54934 861 261 207 ----11165
NM_002718chr312315 ----177
NM_002719chr142981 795 12364 --12425
NM_002721chr91364 ------
NM_002731chr132611 1070 989 --143 --
NM_002734chr1732204 423 149 ------
NM_002736chr741601 850 745 574 11776 1232 --
NM_002737chr1736613 1226 706 --46636 6118 5432 1252 --
NM_002738chr1631122 1095 92 ------
NM_002740chr342517 1752 945 322 ----12648
NM_002742chr143686 292 176 ------
NM_002745chr2293611 3574 3492 3276 3229 1627 1100 797 741 --23586 478 --
NM_002748chr153886 350 27 11054 --1200
NM_002752chr51548 ------
NM_002758chr171366 ------
NM_002765chrX31339 943 125 ----11092
NM_002767chr171433 ------
NM_002779chr10----1218 1547
NM_002787chr72503 77 ----190
NM_002796chr1184 ------
NM_002800chr6132 ------
NM_002806chr142318 257 ------
NM_002811chr162397 31 ------
NM_002821chr61636 ------
NM_002822chr1231456 1383 107 ------
NM_002823chr23532 268 187 ------
NM_002824chr121473 ------
NM_002825chr73148 84 61 ------
NM_002827chr201492 ------
NM_002828chr183821 685 254 ------
NM_002833chr1521615 1534 ------
NM_002836chr20149 ------
NM_002837chr1274120 3597 3424 1479 1159 829 190 22848 175 11318 11443
NM_002838chr141180 242 121 59 1959 --2792 185
NM_002839chr942857 2445 2358 2204 --43020 3003 2946 1400 22908 715
NM_002840chr141228 1049 484 271 21620 1574 ----
NM_002841chr3130 --2225 179 --
NM_002843chr1123151 1280 33375 2789 468 1576 --
NM_002844chr641335 1189 335 69 11004 --21241 278
NM_002845chr182540 161 1449 1433 1112
NM_002848chr1231143 1024 109 --1864 --
NM_002852chr32574 552 --1142 --
NM_002855chr1113514 --13660 --
NM_002858chr111245 1496 11210 21225 1126
NM_002865chr8----1209 --
NM_002869chr1132080 1593 1578 ------
NM_002873chr5--1439 ----
NM_002874chr962403 2397 1841 800 456 245 --12318 --
NM_002886chr343629 1958 1003 227 21889 685 1104 --
NM_002892chr1431669 1304 298 ----21402 1346
NM_002894chr18----2188 156 --
NM_002895chr202973 699 1125 1877 --
NM_002897chr2------1110
NM_002902chr15------1569
NM_002906chr1152207 2137 1869 1828 67 22350 1999 ----
NM_002912chr62861 746 ------
NM_002922chr13661 602 562 ------
NM_002923chr1----1527 --
NM_002924chr12102 53 ------
NM_002941chr331089 603 347 --1321 11609
NM_002942chr331243 879 362 --1436 --
NM_002956chr122387 253 --3511 450 361 --
NM_002957chr912523 12396 11436 13503
NM_002958chr34860 616 226 76 ------
NM_002959chr134259 3738 264 11040 24402 1778 --
NM_002967chr191157 ------
NM_002968chr1621115 208 --1148 --
NM_002970chrX2137 79 ------
NM_002973chr121538 ------
NM_002977chr252980 2789 1060 566 430 --32471 1359 180 --
NM_002982chr172341 263 --1372 --
NM_002993chr421039 702 ------
NM_002995chr13813 259 119 ------
NM_002996chr1621981 531 ------
NM_002998chr841404 627 551 455 ----163
NM_002999chr2031469 782 642 ------
NM_003003chr171218 192 ----
NM_003009chr191374 ----1251
NM_003010chr1722235 1566 1444 ----
NM_003013chr41718 --2149 141 --
NM_003016chr1751940 1504 1455 552 456 11790 ----
NM_003017chr611279 ------
NM_003026chr911180 --1377 --
NM_003027chr152161 117 ------
NM_003028chr933353 3055 263 --13794 --
NM_003030chr331985 1806 257 1356 11541 --
NM_003031chr166990 952 921 332 248 160 ------
NM_003034chr1278129 7869 6860 5042 1224 837 225 15991 36526 781 97 11454
NM_003036chr11141 11171 ----
NM_003042chr332014 1833 401 11923 --1457
NM_003043chr374297 4213 4122 988 737 309 113 --23804 92 1215
NM_003045chr1364742 3602 3467 3138 1602 563 ------
NM_003046chr865338 4532 4513 1824 1603 734 ------
NM_003048chr242711 2314 2202 1029 11053 22702 1128 --
NM_003051chr111812 ------
NM_003054chr101199 ------
NM_003068chr831050 383 306 ------
NM_003069chrX--1274 ----
NM_003070chr91194 ----1779
NM_003073chr221267 ------
NM_003076chr12----21595 1153 --
NM_003077chr17----2316 192 1530
NM_003081chr2011187 1207 ----
NM_003088chr721109 1096 ------
NM_003093chr61181 ------
NM_003094chr131104 381 144 ------
NM_003095chr12186 ------
NM_003099chr15106558 6542 6422 4668 4350 2467 2168 2128 1891 1566 21594 1054 26514 2316 11921
NM_003106chr33898 397 386 ----1272
NM_003107chr611745 --22102 851 12332
NM_003108chr2127273 7138 5718 5319 5279 4606 4556 1470 1216 1138 843 352 26578 306 26903 6607 21186 980
NM_003111chr251352 405 202 192 154 ------
NM_003112chr7103233 3208 3058 2134 2122 2082 2003 1961 916 327 ----1882
NM_003113chr21138 ------
NM_003115chr1--2366 343 ----
NM_003128chr232072 705 547 11780 --12436
NM_003131chr612269 ----11405
NM_003133chr141001 930 291 130 1811 ----
NM_003135chr5165 --196 --
NM_003137chr632235 834 806 ------
NM_003152chr1731042 807 95 --11212 11220
NM_003155chr852546 2164 835 622 138 1819 22577 2519 --
NM_003156chr1121325 1050 ------
NM_003157chr32738 639 ------
NM_003161chr1732769 2535 889 12331 13483 --
NM_003162chr221093 147 --11123 --
NM_003173chrX1215 11386 2497 346 --
NM_003174chr101169 --1620 --
NM_003178chr3--22253 1740 32180 2144 1722 --
NM_003182chr71416 ------
NM_003182chr71416 ------
NM_003185chr203416 54 37 1879 1997 11256
NM_003187chr5150 ------
NM_003198chr11277 ------
NM_003199chr18125576 5325 5297 5273 5032 4433 4269 4091 1885 1462 371 107 15185 34961 4617 3486 --
NM_003201chr10--1641 --1872
NM_003202chr531846 1639 452 --1481 --
NM_003203chr241800 973 963 664 11789 ----
NM_003206chr6------1319
NM_003211chr1241439 432 206 192 --11136 --
NM_003217chr1212011 --1119 165
NM_003220chr611282 --11655 --
NM_003223chr161835 --1858 --
NM_003242chr352064 1721 1672 582 571 --2524 271 --
NM_003244chr18170 ----1102
NM_003246chr1531360 125 52 11627 --21998 1870
NM_003247chr641847 1683 1604 1426 ------
NM_003253chr2121654 703 21814 108 --1622
NM_003255chr1732635 1964 379 1903 ----
NM_003257chr1531054 985 259 1950 ----
NM_003262chr385306 4578 4166 3395 2086 1591 1155 89 --2970 612 --
NM_003269chr611302 11264 ----
NM_003272chr11264 ------
NM_003274chr2142634 2291 2051 1100 11035 1860 --
NM_003288chr201211 1186 21000 160 --
NM_003290chr191146 ------
NM_003298chr356134 5429 4867 4617 251 --36121 5590 646 13928
NM_003299chr12----1198 --
NM_003304chr33507 339 207 162 11371 --
NM_003318chr61290 ------
NM_003319chr22804 110 --1244 --
NM_003320chr1134442 3756 3103 --11430 14363
NM_003336chrX1292 ----11101
NM_003337chr561579 1059 292 231 215 181 ------
NM_003338chr104693 420 205 97 ------
NM_003339chr531379 1352 992 21594 155 11341 --
NM_003340chr431256 892 871 11204 ----
NM_003342chr174705 693 534 325 21029 108 13113 --
NM_003345chr163571 210 70 ------
NM_003347chr2211789 ------
NM_003348chr122622 430 --168 --
NM_003350chr82882 132 --1998 --
NM_003352chr23763 269 65 2856 838 1691 --
NM_003358chr91149 --1138 --
NM_003359chr421293 271 --11257 --
NM_003368chr11638 ------
NM_003369chr1112409 ------
NM_003372chrX2694 618 --1937 --
NM_003373chr1021984 1624 ------
NM_003374chr53611 304 40 ------
NM_003376chr621899 1385 --11374 --
NM_003376chr621899 1385 --11374 --
NM_003383chr93545 170 126 --1508 --
NM_003387chr252941 2684 2349 2337 285 ----22678 2194
NM_003390chr113779 289 79 --11090 --
NM_003392chr364347 4264 2928 1366 1319 644 ----11422
NM_003400chr22140 93 --1211 --
NM_003403chr144801 609 242 81 ------
NM_003404chr203736 295 170 1412 ----
NM_003405chr221665 ------
NM_003406chr841822 1604 658 606 ------
NM_003409chr181111 ----11110
NM_003410chrX63105 2920 2096 1015 829 24 ------
NM_003411chrY21154 695 --1680 --
NM_003412chr352791 2547 1962 1251 655 --53111 2604 595 541 462 --
NM_003413chrX61583 1261 803 634 598 581 ------
NM_003418chr31741 ------
NM_003423chr1962532 2300 871 706 511 392 31686 410 160 1420 --
NM_003452chr92872 742 --1900 --
NM_003453chr132252 110 ------
NM_003457chr17--1447 --1638
NM_003462chr131768 1448 92 ------
NM_003463chr662305 2197 2123 1338 1318 243 1662 1722 --
NM_003467chr2--191 ----
NM_003468chr284224 4014 1755 1445 775 282 270 207 11346 12650 --
NM_003472chr641310 582 213 181 --11339 1254
NM_003478chr1152925 2328 1102 1020 233 2370 195 22917 280 --
NM_003482chr1252685 2427 2389 2237 1808 ------
NM_003483chr1272844 2734 2006 1881 1822 885 201 12506 --11912
NM_003487chr171257 ------
NM_003488chr171639 --135 1701
NM_003489chr2142804 1204 953 715 ------
NM_003490chr2211051 ------
NM_003498chr1622520 32 ----12813
NM_003503chr141297 449 374 59 ------
NM_003505chr72301 289 11358 --11891
NM_003506chr851351 963 933 111 70 --199 --
NM_003507chr241952 1935 1902 146 --11588 --
NM_003557chr111591 ------
NM_003563chr172588 427 --21095 972 --
NM_003565chr1231742 1519 1412 ----1559
NM_003566chr1243267 1388 1237 531 1424 11035 12775
NM_003574chr1865805 5576 4254 1679 1151 699 24565 239 ----
NM_003580chr81548 ------
NM_003581chr21945 11053 ----
NM_003583chr1283417 3131 2698 2518 1267 835 706 115 13566 1739 --
NM_003590chr243860 757 560 376 44049 3073 3036 736 23404 3084 23476 398
NM_003592chr71396 ------
NM_003595chr221146 ----1138
NM_003597chr241509 435 339 193 --1846 --
NM_003603chr421387 785 --2676 436 31546 1523 1406
NM_003613chr15----1653 1640
NM_003615chr362939 1004 758 734 253 140 ----13633
NM_003617chr194931 4871 4565 3937 3817 1838 1528 1085 833 ------
NM_003618chr21114 11309 --1226
NM_003620chr175942 379 225 182 153 ------
NM_003622chr1242414 1826 1778 263 --1970 --
NM_003626chr1121035 374 11255 ----
NM_003628chr21495 ------
NM_003630chr61731 ----1708
NM_003631chr101119 ----1881
NM_003637chr121297 1130 157 ----
NM_003644chr1764662 4372 2513 519 488 306 11092 14456 --
NM_003645chr153218 212 105 ------
NM_003658chr11----1584 --
NM_003659chr21303 ----11204
NM_003660chr191273 --1658 --
NM_003663chr383352 3047 2473 1059 686 618 120 79 ----12963
NM_003668chr122270 228 ------
NM_003670chr331278 1212 94 ------
NM_003671chr963308 3023 2613 2468 613 506 ----13517
NM_003672chr11446 --1723 --
NM_003673chr17196 ------
NM_003686chr11262 ------
NM_003690chr21189 --1218 --
NM_003692chr91270 --1217 --
NM_003701chr132940 223 ------
NM_003705chr24669 350 275 226 2300 291 --2310 267
NM_003713chr141708 1680 1665 30 ------
NM_003714chr543083 2773 2346 637 ----12596
NM_003716chr31900 ------
NM_003718chr7--2209 137 1480 --
NM_003722chr362062 2011 1969 1855 1776 427 22566 1769 ----
NM_003728chr41594 --1219 --
NM_003741chr32381 78 ------
NM_003743chr232062 288 202 ----11956
NM_003744chr1411073 --11312 --
NM_003746chr121201 ------
NM_003749chr1321840 228 ----12143
NM_003750chr102863 225 ------
NM_003754chr111143 ------
NM_003759chr453658 3284 1662 961 469 1288 ----
NM_003762chr14482 446 353 345 1980 2994 945 --
NM_003763chr20----2715 134 13181
NM_003772chr1151191 1047 830 412 53 ----21233 185
NM_003778chr33701 133 47 ----1716
NM_003780chr1--1681 1580 1674
NM_003794chr34977 933 921 895 ------
NM_003797chr11----1163 --
NM_003799chr1884500 4124 3107 2885 2858 1476 1377 559 1795 2912 179 14511
NM_003800chr651878 669 627 534 69 ----11664
NM_003822chr153014 2982 2867 933 201 ------
NM_003825chr152990 576 1453 ----
NM_003829chr931168 277 201 ------
NM_003845chr12145 ------
NM_003850chr132542 160 --1183 --
NM_003858chr142617 509 --1501 --
NM_003861chr1431861 1099 733 --1404 --
NM_003862chr5------1112
NM_003870chr1512100 ------
NM_003872chr253027 2908 2722 1932 305 ------
NM_003873chr1072465 2237 2187 2139 982 614 464 --32345 1889 765 --
NM_003884chr341837 1820 1784 1277 1320 11584 --
NM_003885chr1732565 2026 1870 1188 12676 --
NM_003887chr231434 544 94 --22048 319 11663
NM_003905chr161130 ------
NM_003910chr71150 ------
NM_003913chr654303 3772 1297 1117 946 11167 13737 --
NM_003914chr131161 ------
NM_003919chr71204 --1180 --
NM_003922chr151309 1338 ----
NM_003927chr182964 230 ------
NM_003930chr732263 359 234 --12520 --
NM_003932chr2251760 1451 1313 1173 665 ------
NM_003934chr951100 505 343 81 60 11044 ----
NM_003941chr732525 2238 648 1499 22345 925 11807
NM_003947chr321242 850 --21314 1270 --
NM_003953chr141940 1078 777 204 --2635 259 --
NM_003955chr17------11568
NM_003958chr643359 2877 2607 1525 23052 3004 13942 --
NM_003966chr587144 5405 3112 2604 2191 2066 2022 1824 15354 17791 --
NM_003968chr32518 142 --1678 --
NM_003972chr1031159 1085 356 --1178 1324
NM_003980chr631098 594 493 1543 ----
NM_003987chr1012317 ------
NM_003988chr1012394 ------
NM_003989chr1012253 ------
NM_003990chr1012253 ------
NM_003992chr151234 ------
NM_003993chr1------1310
NM_003994chr1233803 847 229 --21648 336 14201
NM_004006chrX22127 1793 1283 1521 1573
NM_004007chrX22127 1793 1283 1521 1573
NM_004009chrX22127 1793 1283 1521 1573
NM_004010chrX22127 1793 1283 1521 1573
NM_004011chrX22127 1793 1283 1521 1573
NM_004012chrX22127 1793 1283 1521 1573
NM_004013chrX22127 1793 1283 1521 1573
NM_004014chrX22127 1793 1283 1521 1573
NM_004015chrX22127 1793 1283 1521 1573
NM_004016chrX22041 1707 1197 1435 1487
NM_004017chrX22127 1793 1283 1521 1573
NM_004018chrX22041 1707 1197 1435 1487
NM_004020chrX22127 1793 1283 1521 1573
NM_004021chrX22041 1707 1197 1435 1487
NM_004022chrX22041 1707 1197 1435 1487
NM_004023chrX22041 1707 1197 1435 1487
NM_004028chr1854123 4116 3680 3429 934 --12896 --
NM_004034chr101245 1648 1465 1149
NM_004040chr22936 146 1212 --2907 864
NM_004050chr14----11923 --
NM_004067chr721533 1179 ------
NM_004068chr3----1120 1428
NM_004071chr2188 ----180
NM_004075chr121187 --1430 --
NM_004081chrY21324 376 --1525 11857
NM_004086chr141557 ------
NM_004087chr321742 1623 11440 ----
NM_004093chr1333094 2941 2923 --22990 2731 --
NM_004096chr1041587 1573 829 802 --11663 --
NM_004098chr101887 --1503 --
NM_004100chr642353 2251 1970 828 11052 --21919 916
NM_004103chr8----1130 1818
NM_004109chr1111619 2852 136 1731 --
NM_004113chr351886 1653 514 500 453 --11440 --
NM_004114chrX21103 1069 ------
NM_004124chr1463573 3532 3147 969 923 187 --21387 248 --
NM_004134chr53485 137 107 ------
NM_004136chr1532755 2322 285 --1353 --
NM_004145chr19----2299 279 1601
NM_004156chr82573 27 ------
NM_004161chr24602 373 80 39 1558 --11234
NM_004162chr321167 1080 11261 ----
NM_004170chr921436 756 --1162 --
NM_004171chr11139151 8345 8194 7071 7001 6841 6690 6658 6606 6141 3838 2112 1376 26620 502 18303 13744
NM_004172chr512026 ------
NM_004180chr22508 248 ------
NM_004185chr13582 286 67 ------
NM_004199chr5277 65 --1268 --
NM_004200chr1133236 3125 3055 --1548 --
NM_004225chr841495 1388 997 966 --166 --
NM_004226chr2171 1239 --1302
NM_004228chr191134 ------
NM_004229chrX21869 180 ------
NM_004232chr1863818 3625 3209 2448 1371 26 13844 13756 --
NM_004235chr93841 804 796 ----2850 690
NM_004237chr52614 228 --1864 --
NM_004241chr103507 233 122 ----1769
NM_004242chr6179 --1350 --
NM_004261chr12718 248 ------
NM_004272chr521516 1343 186 21463 486 --
NM_004274chr1452691 2397 2199 1054 962 --12115 12102
NM_004279chr731812 320 156 ------
NM_004281chr10162 ------
NM_004286chr2232844 2167 962 ----1254
NM_004291chr51297 ------
NM_004293chr933803 2552 169 --2590 574 --
NM_004301chr3188 ----1111
NM_004302chr1212290 ----12814
NM_004311chr1032376 420 303 ------
NM_004323chr932413 436 215 12005 ----
NM_004327chr222998 911 ------
NM_004329chr1031016 442 429 ------
NM_004330chr1561093 1050 746 468 178 141 --1281 --
NM_004331chr842638 2424 807 253 12460 ----
NM_004338chr1885286 5151 5139 4983 4549 584 345 162 12591 21447 790 12030
NM_004342chr721939 76 ----1207
NM_004346chr431466 1154 35 ----11524
NM_004354chr4----1732 --
NM_004367chr641759 1540 222 208 ----11782
NM_004370chr652100 2019 878 607 417 ----172
NM_004380chr1621677 365 --150 --
NM_004384chr551924 1567 1561 1541 682 12000 12245 1752
NM_004386chr1921982 1762 --1353 1145
NM_004389chr22233 73 --1137 --
NM_004392chr1352344 1802 1039 217 45 12521 22395 1960 1637
NM_004395chr5--1212 ----
NM_004396chr17----1197 --
NM_004397chr1163700 3694 1675 1610 995 233 12934 31707 1484 206 --
NM_004404chr232039 742 174 ----1522
NM_004407chr451015 891 761 665 254 ------
NM_004411chr71277 ------
NM_004414chr2121488 1220 11014 21387 291 --
NM_004429chrX31429 115 103 ------
NM_004430chr842691 2452 2072 1996 --12700 --
NM_004432chr991890 1813 1624 894 844 787 525 242 90 22315 1879 12411 --
NM_004434chr1461579 1560 1541 1376 716 545 1198 --1482
NM_004437chr143484 3201 3006 287 ------
NM_004438chr243267 3008 1131 1071 --13306 --
NM_004439chr42144 47 ------
NM_004440chr651974 1965 1571 1427 712 ----11610
NM_004441chr331237 1213 944 ------
NM_004448chr171596 ----1459
NM_004454chr332094 1792 809 ----1404
NM_004457chr241610 1536 1230 337 ----11098
NM_004458chrX72292 2198 1990 1628 986 356 287 2894 562 42658 2567 1879 1038 1183
NM_004459chr1731419 805 771 1649 32039 1442 1327 11667
NM_004480chr143739 649 570 ------
NM_004482chr21900 ----1299
NM_004491chr1944304 4091 1519 1408 1332 --13777
NM_004496chr1441346 1181 865 384 ------
NM_004501chr154121 1043 902 673 451 13105 1318 21532 166
NM_004504chr282854 2217 1042 884 859 599 331 67 --1902 --
NM_004506chr6186 ------
NM_004516chr1941166 1071 1033 404 1267 ----
NM_004519chr8147 --1209 --
NM_004523chr1031201 503 475 ------
NM_004525chr21260 11358 1215 145
NM_004529chr911309 ------
NM_004537chr1241435 1136 618 134 --1195 --
NM_004538chrX1740 ------
NM_004540chr21--1123 ----
NM_004566chr1072555 2546 2307 2039 1956 1587 950 --1811 --
NM_004571chr2172787 2473 1291 1253 1012 871 108 --13093 140
NM_004578chr11861 ------
NM_004582chr11102 124 ----
NM_004583chr171735 ------
NM_004586chrX105438 5210 4267 4206 3582 1727 872 825 462 452 --15038 --
NM_004587chr201183 ------
NM_004591chr22416 159 183 ----
NM_004592chr121183 ------
NM_004593chr3--1278 1228 --
NM_004594chr16----1944 --
NM_004598chr552910 2597 805 181 67 1691 1824 2173 33
NM_004602chr2011453 ------
NM_004606chrX------185
NM_004612chr9114234 3943 3637 3357 3218 1773 1280 1004 635 576 118 --24016 928 --
NM_004622chr221925 626 ------
NM_004627chr212655 602 ------
NM_004631chr131450 409 243 ------
NM_004634chr32609 487 ------
NM_004637chr31532 ----1924
NM_004642chr123739 690 172 --3683 496 190 --
NM_004654chrY41052 204 154 144 ------
NM_004655chr1721270 1069 --1530 --
NM_004657chr221531 1291 172 --11140
NM_004660chrY31758 581 531 21524 1486 --11683
NM_004663chr1551528 1513 977 567 71 ------
NM_004684chr41328 ------
NM_004685chr1372946 2540 1067 683 581 409 179 --22690 255 --
NM_004687chr1721833 524 --21592 845 --
NM_004689chr141358 ------
NM_004690chr63658 315 33 ------
NM_004709chrX31678 1314 1191 ------
NM_004714chr191236 ------
NM_004715chr184712 200 151 119 ------
NM_004718chr23596 452 109 ------
NM_004719chr1262822 2200 1944 1906 1081 1014 --12487 --
NM_004721chr3----1308 --
NM_004725chr1031475 1041 314 --1342 --
NM_004726chrX74597 4407 3973 1999 1424 412 149 ------
NM_004730chr572022 1980 1932 1759 742 706 642 --12116 --
NM_004733chr31614 1564 ----
NM_004734chr1343063 1152 349 254 ------
NM_004736chr122105 766 --12152 --
NM_004737chr2211285 ------
NM_004741chr101303 ----1182
NM_004742chr321584 1340 --21599 245 --
NM_004744chr453887 2556 1310 951 331 1966 --12991
NM_004745chr865692 5642 5444 2375 2058 1095 22673 2459 11570 --
NM_004747chr1031599 1286 149 11355 11100 --
NM_004753chr1--1381 --1168
NM_004755chr1431002 881 33 --2814 399 1991
NM_004757chr41229 --1101 --
NM_004759chr132153 871 113 --21824 1696 --
NM_004760chr731602 363 300 --11855 --
NM_004768chr11402 ------
NM_004770chr81196 ------
NM_004772chr511521 ------
NM_004774chr1733068 1074 592 --1442 --
NM_004776chr2053315 3025 2713 2168 2038 --13226 13307
NM_004779chr531324 1218 203 ------
NM_004780chrX----2219 71 --
NM_004781chr131092 549 492 ----1201
NM_004781chr131092 549 492 ----1201
NM_004788chr11--12514 11685 --
NM_004792chr2----1185 --
NM_004794chrX1123 ------
NM_004796chr1431909 1901 1704 --12411 11846
NM_004798chr2053683 3608 2482 1248 131 --13387 --
NM_004799chr11423 --168 1433
NM_004800chr131195 ------
NM_004808chr1032700 2260 1271 11202 2629 159 --
NM_004815chr184369 3498 3177 1955 1216 891 605 96 21498 648 13213 --
NM_004822chr1733162 2764 2551 14029 --12942
NM_004824chr6----11363 11256
NM_004830chr63817 740 336 ------
NM_004831chr192970 432 ----11116
NM_004834chr253357 2119 2073 805 507 ------
NM_004836chr2----1607 --
NM_004839chr15----1598 --
NM_004842chr6----21547 719 --
NM_004844chr321122 374 --11191 --
NM_004849chr631356 476 325 --1179 11610
NM_004850chr21645 ------
NM_004857chr1474646 4246 3325 1650 870 537 489 --11831 --
NM_004859chr1742340 2330 2320 975 --21957 311 --
NM_004865chr61372 ------
NM_004866chr574835 4776 4678 3326 1687 1161 512 2988 374 23275 594 11815
NM_004867chrX1507 ----1475
NM_004871chr1734294 3601 2694 --24345 4157 --
NM_004874chr81501 ----1414
NM_004879chr111371 ------
NM_004887chr541114 1067 319 63 ------
NM_004888chr91436 ----1168
NM_004891chr21194 ------
NM_004893chr52551 451 1381 ----
NM_004895chr12528 487 ------
NM_004896chr101329 --21489 1205 --
NM_004898chr42987 601 1954 1917 11055
NM_004902chr203837 567 111 1712 ----
NM_004904chr796449 6343 6307 6301 4703 4680 4480 950 693 --14831 16563
NM_004912chr751366 1185 1117 322 38 1437 ----
NM_004921chr132370 373 213 11864 12236 --
NM_004922chr1011040 ------
NM_004927chr1121025 437 1147 --11465
NM_004937chr1722696 1908 --1960 --
NM_004938chr921268 471 ------
NM_004939chr22125 69 ------
NM_004946chr5----1420 --
NM_004947chr352234 1837 460 412 110 1323 12474 22265 526
NM_004956chr754031 1333 560 144 96 --31515 530 33 14447
NM_004958chr1----147 --
NM_004960chr16169 ------
NM_004961chrX31173 1068 402 ------
NM_004964chr11561 ------
NM_004965chr21182 149 ----
NM_004973chr641439 319 263 42 --31736 175 96 11120
NM_004976chr1125110 3615 ------
NM_004985chr1254485 4374 4279 3664 3315 23588 1366 14196 34311 3647 56
NM_004992chrX78353 8017 7831 6205 6194 2411 1106 15501 48446 5763 981 245 --
NM_004992chrX78353 8017 7831 6205 6194 2411 1106 15501 48446 5763 981 245 --
NM_004993chr1431156 311 121 ------
NM_004996chr1631749 1718 1664 ------
NM_004999chr654073 2781 997 862 540 14167 14338 --
NM_005010chr742149 1616 1542 1488 ----1543
NM_005016chr121106 ------
NM_005020chr7144 --1458 --
NM_005027chr19----11199 --
NM_005030chr16--1235 ----
NM_005045chr72964 815 1900 ----
NM_005054chr21512 --31684 1337 143 1160
NM_005056chr1254975 4569 4372 1588 893 15479 1396 --
NM_005057chr131879 664 335 ------
NM_005063chr1033847 3077 780 12968 13007 --
NM_005065chr1484667 3908 3895 3628 1504 1322 737 64 --45107 4000 1099 939 1952
NM_005066chr13759 131 73 ------
NM_005068chr641307 1270 1157 325 ------
NM_005076chr121147 143 12604 ----
NM_005077chr93464 438 375 --1417 --
NM_005079chr843168 2620 2571 604 --13220 11161
NM_005080chr221625 ------
NM_005087chr31831 159 ----
NM_005093chr2044540 4343 3509 1532 ----24216 891
NM_005095chr132262 1815 781 --11973 --
NM_005099chr131278 1087 942 ------
NM_005102chr22696 574 ------
NM_005104chr62781 623 ------
NM_005109chr312545 --1487 --
NM_005113chr141421 1141 --1440
NM_005116chr2083905 3064 1734 1109 1031 972 473 87 ------
NM_005121chr1763231 3165 3112 3058 646 618 23761 3202 1907 11538
NM_005124chr62311 68 1909 ----
NM_005126chr311691 --12172 12031
NM_005133chr112400 112 --1388 --
NM_005141chr4------151
NM_005151chr1861867 1848 1728 672 391 253 1649 ----
NM_005153chr163658 546 113 1774 ----
NM_005154chr15--2430 422 ----
NM_005156chr955313 5146 5012 4330 161 23882 1335 44724 4649 992 366 --
NM_005160chr22126614 6578 6156 5951 5651 5354 5205 4516 2211 2159 1498 1389 --11065 --
NM_005164chr1212145 ------
NM_005168chr241678 643 626 324 ------
NM_005171chr1251269 1251 1183 987 208 --31170 1115 358 --
NM_005174chr101107 ------
NM_005178chr191408 --1425 1128
NM_005180chr1041677 1423 657 119 1506 --11622
NM_005181chr81852 --1741 --
NM_005188chr1158011 7455 7404 3213 2631 --12083 16505
NM_005194chr201485 ------
NM_005197chr1486223 5388 5356 5208 4811 4022 1190 1165 15713 26090 3773 --
NM_005203chr10------2144 40
NM_005204chr104875 802 767 748 ----1700
NM_005207chr222742 178 ----1314
NM_005215chr183643 566 45 1588 ----
NM_005221chr7----1133 --
NM_005222chr72946 301 1935 ----
NM_005227chr11502 ------
NM_005233chr342574 2379 546 211 12537 --12303
NM_005235chr2107734 7329 7246 5955 5396 5244 5210 3152 2272 2146 12108 27014 1085 11431
NM_005239chr2162020 1499 618 455 370 141 ----1800
NM_005241chr331275 1167 1024 ----31330 397 203
NM_005242chr541392 1192 1132 536 131 1155 --
NM_005249chr141739 1779 147 --
NM_005254chr1531354 1039 1017 ----1470
NM_005256chr111331 1753 ----
NM_005257chr1831248 997 508 --21302 326 --
NM_005259chr241509 1471 1439 977 ------
NM_005271chr1031208 995 491 --11020 --
NM_005275chr61108 ------
NM_005277chr441838 1818 632 583 1449 1348 21868 1470
NM_005278chrX3454 134 107 ------
NM_005284chr6------1493
NM_005302chr71350 --1415 --
NM_005308chr103378 370 338 ------
NM_005310chr17------1323
NM_005311chr772370 2308 2143 2115 2043 1784 383 --1401 12823
NM_005313chr1531012 940 25 11381 --1287
NM_005316chr113857 724 152 21004 159 ----
NM_005324chr1761973 1337 324 99 74 28 1688 1105 --
NM_005328chr83521 502 23 ----1549
NM_005329chr1652289 2268 2048 502 251 ----12145
NM_005333chrX2175 80 --11005 --
NM_005339chr481605 1242 1189 1026 957 456 448 390 21172 1071 13576 14255
NM_005342chrX41908 799 406 338 1221 ----
NM_005358chr133706 657 409 11527 ----
NM_005359chr1865172 2249 1204 1113 852 563 --42551 1850 1360 1036 --
NM_005376chr11909 ------
NM_005378chr21711 ----139
NM_005385chr352689 2606 1061 281 33 1448 --12667
NM_005386chr201781 --1211 --
NM_005388chr941332 678 380 102 ------
NM_005392chr911455 ----21908 1473
NM_005399chr184262 3929 3889 3032 3014 1455 477 50 --21287 151 --
NM_005400chr222939 139 --22338 1916 22960 1026
NM_005402chr731834 1378 716 2577 495 ----
NM_005406chr1821333 1156 --11098 --
NM_005410chr52584 532 ------
NM_005413chr21412 ------
NM_005414chr31124 --1207 --
NM_005417chr2011878 11596 --12008
NM_005418chr114538 232 201 164 ------
NM_005433chr1832474 756 463 1141 1534 --
NM_005436chr1063288 3200 3000 2605 1161 340 23728 1492 21237 106 11276
NM_005437chr1021474 1260 --11460 1496
NM_005439chr12--130 ----
NM_005443chr42421 134 ------
NM_005445chr101215 ------
NM_005460chr52530 397 ------
NM_005461chr2031710 1623 1432 --2687 366 --
NM_005465chr111844 --1201 --
NM_005466chr143571 387 106 ------
NM_005474chr1711572 ------
NM_005476chr931367 1235 183 --1379 --
NM_005487chr2231959 1936 1751 --12121 11951
NM_005488chr222740 720 ------
NM_005493chr6------1774
NM_005494chr71112 ------
NM_005496chr32142 60 ------
NM_005499chr191613 --1536 --
NM_005501chr1711173 ------
NM_005502chr953214 2965 2095 1103 195 12745 53116 2892 2562 1035 58 11171
NM_005503chr1521122 220 ------
NM_005504chr12126583 6521 6449 6315 6213 5094 4128 2238 1465 690 118 69 --46068 5880 2178 294 24653 2644
NM_005509chr541498 1448 718 347 1361 ----
NM_005513chr331469 420 285 ------
NM_005524chr31232 ------
NM_005530chr1531331 973 246 ------
NM_005537chr132943 701 ------
NM_005542chr731830 1275 1268 --21932 1862 --
NM_005544chr23998 921 779 ------
NM_005561chr131836 1946 ----
NM_005563chr12689 242 --1609 --
NM_005569chr2221480 1256 11395 ----
NM_005570chr184857 800 414 135 ----1948
NM_005573chr54519 474 275 165 --1460 --
NM_005578chr344871 3949 1408 602 ----1241
NM_005593chr121124 ------
NM_005595chr12831 207 183 ----
NM_005596chr985934 5588 5351 4034 2095 1991 1322 1143 14540 65084 5050 4926 1623 1460 440 13983
NM_005602chr361209 1166 1082 860 328 143 ------
NM_005603chr1841871 1338 442 91 ------
NM_005604chr631913 1829 226 --1526 --
NM_005613chr131793 742 577 --22141 1511 --
NM_005618chr63555 435 225 ------
NM_005626chr1------145
NM_005627chr62994 881 1140 1796 1110
NM_005634chrX3275 249 115 ----1165
NM_005637chr184419 373 323 261 --11789 --
NM_005638chrX31547 1244 359 ------
NM_005639chr122595 319 ----1149
NM_005644chr12377 331 ------
NM_005647chrX2800 512 --23247 490 12730
NM_005648chr8------1149
NM_005650chr2211181 ------
NM_005655chr831311 1202 447 ----11293
NM_005662chr8----1395 1310
NM_005668chr544612 3906 1753 828 --31541 1299 980 --
NM_005676chrX1193 ------
NM_005688chr321263 228 --11128 1419
NM_005704chr121115 1103 ------
NM_005711chr5------1853
NM_005715chr62330 157 12543 22523 984 --
NM_005717chr131292 1199 338 ------
NM_005721chr241015 1002 913 273 1345 11078 --
NM_005725chr11951 1125 21752 132 --
NM_005730chr1223626 2980 ------
NM_005731chr22303 83 ----1130
NM_005734chr11------1168
NM_005738chr731976 391 366 1379 ----
NM_005746chr742647 2126 1779 708 2551 54 12477 2374 325
NM_005749chr171734 --1637 --
NM_005751chr74437 167 78 51 ------
NM_005754chr521033 119 1342 --1283
NM_005756chrX41543 1461 488 454 11384 ----
NM_005759chr264602 4488 4427 1810 1125 606 ----1202
NM_005776chr144790 713 568 269 ------
NM_005778chr31420 ----1437
NM_005779chr553662 3340 2710 2688 1051 ------
NM_005782chr17----1198 --
NM_005786chr184412 251 142 35 11228 1968 --
NM_005788chr111589 ------
NM_005795chr252412 900 522 330 198 --12343 --
NM_005797chr1121754 1676 ------
NM_005806chr2121268 1193 ------
NM_005808chr323562 2934 ----12951
NM_005813chr292587 2424 2323 2236 2195 2187 1017 251 74 ----1784
NM_005822chr61827 ----1837
NM_005826chr11119 --1485 --
NM_005828chr1765076 4615 3487 1509 480 39 14863 31877 569 116 --
NM_005832chr331297 585 82 ------
NM_005839chr11707 --142 --
NM_005840chrX87455 6229 5178 3075 2366 2183 1584 1000 12940 ----
NM_005841chr41959 ------
NM_005843chr21603 ----21911 1341
NM_005845chr1331564 1317 73 11279 11133 --
NM_005852chr171885 11149 11024 --
NM_005853chr162515 223 ------
NM_005859chr521462 399 ----1366
NM_005862chr31144 1398 ----
NM_005871chr1061070 911 787 322 237 155 ------
NM_005880chr1631637 1573 1405 11520 --2478 362
NM_005882chr42881 208 --2901 177 --
NM_005885chr53641 580 204 2601 268 ----
NM_005886chr161292 ------
NM_005896chr23536 263 104 ------
NM_005897chr131104 469 60 ------
NM_005898chr1142694 2539 1254 805 1235 ----
NM_005899chr1711301 11569 ----
NM_005900chr421136 44 --11098 --
NM_005901chr1898265 7432 6899 6668 2771 2555 1148 1128 806 --32256 1771 1510 1371
NM_005902chr1554553 4471 1506 1444 954 --11534 --
NM_005903chr5115067 4974 4818 4538 984 949 689 658 475 171 143 --1851 15213
NM_005906chr621548 1470 ----21642 431
NM_005910chr1742652 1642 1016 980 12610 ----
NM_005911chr23564 447 333 ------
NM_005920chr123547 1046 1304 1296 --
NM_005922chr61441 ------
NM_005923chr61556 1626 ----
NM_005924chr781170 1131 901 777 749 438 374 285 ------
NM_005927chr521161 1064 ------
NM_005930chr144846 723 682 136 1869 ----
NM_005933chr1132510 2491 971 --11916 --
NM_005934chr1912552 ------
NM_005935chr433679 3552 1676 ----34974 1486 45
NM_005937chr1764181 4110 3638 2813 2774 1421 --44129 1488 914 699 --
NM_005938chrX2379 301 --11305 --
NM_005941chr851630 1470 1440 1360 32 13288 ----
NM_005944chr321226 230 ------
NM_005955chr1115467 5450 5401 4921 4569 4073 3537 3503 2012 1580 365 --14897 11066
NM_005962chr1022129 1472 12177 ----
NM_005962chr1022129 1472 12177 ----
NM_005963chr17----171 --
NM_005964chr1721483 238 --11517 --
NM_005966chr252132 2020 1934 1678 1592 ------
NM_005968chr192201 45 --1170 --
NM_005969chr1111175 1249 --11203
NM_005977chr132801 285 ------
NM_005985chr203773 755 287 ------
NM_005986chr136993 817 632 585 486 352 ----2258 97
NM_005994chr17--1750 ----
NM_005996chr1251336 629 487 237 109 1995 ----
NM_005999chr161545 1489 362 265 121 57 11064 --2216 202
NM_006007chr973817 3335 1646 1076 1038 679 322 21426 1103 14085 14159
NM_006011chr1521341 1169 13838 14151 --
NM_006015chr121208 366 3882 875 487 ----
NM_006016chr612014 22224 1625 --11633
NM_006022chr1321067 359 1711 --1678
NM_006033chr1822172 508 11778 11610 11862
NM_006035chr1421257 110 1522 1976 --
NM_006036chr241977 1949 1897 1582 11648 12443 --
NM_006037chr293881 3850 3783 3672 3567 3473 3419 3131 1537 11667 44308 3718 1719 1425 --
NM_006040chr1611342 ------
NM_006047chr2062840 2634 2604 2586 600 256 23166 111 12992 --
NM_006060chr764279 3231 2713 1048 718 125 23026 1651 22965 2693 13756
NM_006063chr2--186 ----
NM_006067chr163970 832 746 ----1910
NM_006070chr3177 ------
NM_006079chr61205 1146 --1800
NM_006080chr752920 2648 2112 2091 472 1964 12408 --
NM_006094chr841923 1605 963 361 --32411 1739 950 1449
NM_006095chr454241 3418 1668 703 230 --23710 3135 --
NM_006100chr31220 --150 --
NM_006106chr1111033 ------
NM_006108chr1172008 1897 1795 1665 907 247 111 ------
NM_006113chr152136 2126 1898 1622 667 --1606 --
NM_006133chr11----12376 --
NM_006134chr2141368 1308 1285 46 2177 97 21300 561 --
NM_006135chr121398 524 --1381 --
NM_006141chr1622289 994 --12496 --
NM_006143chr121116 ------
NM_006147chr12463 376 2418 45 ----
NM_006153chr3--1625 ----
NM_006154chr1562393 2012 1078 717 525 191 22901 924 ----
NM_006155chr232039 742 174 ----1522
NM_006158chr821353 1299 --11528 --
NM_006161chr5----2660 244 1613
NM_006162chr1831752 1448 666 ------
NM_006166chr1252566 472 347 306 103 --2975 236 --
NM_006186chr241164 1001 917 891 ------
NM_006191chr122891 626 ------
NM_006194chr1421055 405 11238 1939 --
NM_006195chr941276 1044 168 82 1408 1966 --
NM_006196chr2197 ------
NM_006197chr822229 2222 ------
NM_006202chr1921601 1480 ----21581 633
NM_006203chr585226 3728 868 782 751 585 560 358 34142 482 385 25144 891 --
NM_006206chr452760 2370 2295 1930 1091 12245 12270 --
NM_006207chr81307 ------
NM_006209chr82340 62 ------
NM_006216chr21669 --1662 2678 99
NM_006218chr31281 295 84 ----
NM_006226chr231344 1142 333 11413 ----
NM_006228chr81383 ------
NM_006243chr131083 1029 42 1329 ----
NM_006246chr1421063 220 ----1512
NM_006247chr193150 128 119 --1316 --
NM_006251chr572980 2617 2483 2406 2306 74 28 1989 --1130
NM_006252chr1126006 5659 5609 5261 4689 2629 2604 1803 1624 1599 1368 30 26951 5643 37512 6291 823 1548
NM_006253chr1211287 ------
NM_006255chr1411139 1777 2749 693 --
NM_006256chr172557 2356 2302 2210 2102 515 186 ----21093 1040
NM_006264chr42574 555 ------
NM_006265chr811396 ------
NM_006267chr231606 563 173 ----11910
NM_006275chr2031530 251 200 ----122
NM_006282chr20144622 4581 4530 4514 4444 3205 1906 1675 1567 1494 1136 714 592 552 ------
NM_006283chr8104918 4124 4115 4094 3665 1925 1731 1513 340 95 24744 194 11919 23281 1205
NM_006287chr23471 148 128 --1547 1872
NM_006290chr61532 ----11879
NM_006292chr11--1234 ----
NM_006298chr631060 579 481 ------
NM_006300chr1932391 1937 1502 ------
NM_006301chr12--123 ----
NM_006307chrX2248 101 --1139 --
NM_006313chr121599 --11088 --
NM_006315chr484358 4281 4055 3283 2773 2738 1168 131 --23875 3501 --
NM_006317chr5----1332 --
NM_006321chr3--1329 ----
NM_006322chr133900 194 44 1945 ----
NM_006323chr42713 564 ------
NM_006330chr831164 115 97 ----11051
NM_006334chr91288 --188 --
NM_006335chr11211 ------
NM_006343chr22374 67 ----1310
NM_006345chr431401 998 316 ------
NM_006350chr5--199 ----
NM_006352chr121506 425 --32043 838 131 11483
NM_006357chr24481 453 374 182 ------
NM_006359chrX42216 1598 200 29 --163 140
NM_006362chr111214 ------
NM_006363chr203237 178 151 ------
NM_006364chr1451171 1165 310 156 112 --1845 --
NM_006371chr364961 4548 3775 1564 853 380 --1931 --
NM_006372chr61386 ------
NM_006373chr1721051 79 ------
NM_006375chrX31349 568 364 ------
NM_006379chr732158 387 303 12165 ----
NM_006380chr1794348 4319 3291 2998 1684 1658 1258 355 292 13751 197 --
NM_006386chr2272468 2428 2351 2170 426 300 227 ------
NM_006389chr1111354 ------
NM_006400chr122374 137 ------
NM_006401chr92362 64 ------
NM_006403chr681693 1406 1132 479 289 263 92 73 ------
NM_006416chr61257 --2700 45 --
NM_006420chr2043062 2208 658 330 2281 197 23209 2788 1963
NM_006424chr431797 1674 1665 --31791 1759 50 --
NM_006427chr141131 ----1171
NM_006449chr252095 422 271 158 89 11506 ----
NM_006451chr52751 738 ------
NM_006459chr1031563 751 435 --1563 --
NM_006460chr1741597 1469 489 374 21659 1181 ----
NM_006469chr131135 1121 625 21167 132 --2317 125
NM_006471chr18168 --193 --
NM_006472chr121298 369 ------
NM_006482chr1283417 3131 2698 2518 1267 835 706 115 13566 1739 --
NM_006483chr191236 ------
NM_006484chr191236 ------
NM_006486chr221113 ------
NM_006489chr142670 75 1523 --1721
NM_006494chr191137 ------
NM_006496chr151462 1403 1258 416 150 ------
NM_006497chr172766 684 1784 --1532
NM_006504chr1052888 2483 1050 107 50 12415 ----
NM_006520chrX1470 --1303 11303
NM_006526chr2061853 1688 1563 557 393 123 --41947 1652 1387 195 1320
NM_006527chr42762 88 --1190 --
NM_006530chr121433 1338 2348 151 --
NM_006534chr2053090 2380 1024 969 642 --12586 --
NM_006538chr254065 721 692 659 381 1850 14098 12733
NM_006540chr831422 1387 1213 ------
NM_006544chr14105864 4213 2444 2399 2258 1745 1625 1014 760 346 --34695 3989 3889 22365 1732
NM_006546chr1756299 5476 4053 1727 1199 11303 ----
NM_006547chr731999 1702 1510 --12052 --
NM_006557chr911394 --1304 --
NM_006558chr81450 ------
NM_006559chr1----11126 11098
NM_006560chr112426 379 ------
NM_006561chr1053883 2404 1303 1177 613 --22467 206 --
NM_006565chr161856 11031 11167 --
NM_006571chr81118 ------
NM_006572chr1773511 3412 3142 2177 1349 1138 468 ----12969
NM_006574chr3--173 1293 --
NM_006575chr142451 289 ------
NM_006577chr231046 366 260 ----2860 26
NM_006585chr212107 41 ------
NM_006593chr21767 2540 97 --1181
NM_006595chr1162069 1999 1825 289 210 191 --1630 --
NM_006599chr1668243 7609 6945 6849 2485 1970 17429 28171 2004 --
NM_006601chr1221065 710 --1717 --
NM_006602chr202817 158 --1337 1792
NM_006603chrX71957 1924 1854 1838 1290 815 369 ------
NM_006605chr221130 ------
NM_006606chr2022705 1969 1351 126 --
NM_006614chr363613 3595 3167 2487 1253 1069 31380 898 876 23473 3082 43004 2701 984 334
NM_006621chr111980 ------
NM_006624chr1042092 1933 1530 248 11853 1104 2729 141
NM_006625chr1----21024 203 --
NM_006625chr1----21024 203 --
NM_006625chr1----21024 203 --
NM_006626chr951878 946 302 77 33 --12455 --
NM_006628chr1584418 2945 851 721 491 411 344 114 --13605 1740
NM_006629chr1842553 2219 272 178 1842 ----
NM_006636chr22780 328 ------
NM_006644chr13----1257 --
NM_006646chr1353024 2842 1983 688 105 --12685 --
NM_006650chr523913 3066 13973 ----
NM_006654chr1264618 4196 3832 3581 1257 922 1211 54057 3784 3680 969 27 14292
NM_006662chr161262 ------
NM_006667chrX41060 50 38 31 ------
NM_006670chr61441 ------
NM_006675chr1253346 2678 2353 2116 583 ------
NM_006690chr2032347 1756 715 ----11739
NM_006696chr51239 1258 ----
NM_006700chr12----1803 --
NM_006706chr5145 ------
NM_006710chr22211 72 ----1751
NM_006711chr162762 118 1719 1789 --
NM_006713chr51123 ------
NM_006717chr952689 2413 2111 845 53 --22643 1286 --
NM_006718chr62926 900 --1196 --
NM_006721chr102605 290 ------
NM_006722chr392552 2334 2096 1114 1103 1085 976 966 286 1217 --21050 928
NM_006724chr61441 ------
NM_006726chr431054 839 145 11039 1934 --
NM_006729chrX64126 3463 2231 2207 250 149 15124 14117 --
NM_006731chr995805 5398 5255 4947 4361 3545 1603 1163 610 --11661 --
NM_006732chr1912067 --12075 --
NM_006734chr641578 1444 412 327 2510 232 --1298
NM_006735chr72346 310 ------
NM_006738chr1544500 4418 1593 1234 --23482 620 --
NM_006742chr1621972 760 ------
NM_006745chr411021 --11089 --
NM_006746chrX41487 1184 977 101 ------
NM_006747chr111153 ------
NM_006750chr1688092 6519 6079 5979 5551 2476 2117 1320 28032 6558 ----
NM_006751chr21145 ------
NM_006754chr721272 818 11145 --21080 396
NM_006756chr821516 50 11322 21285 578 --
NM_006758chr211134 ------
NM_006761chr17----1795 --
NM_006763chr142040 1862 1732 801 ------
NM_006765chr8------182
NM_006766chr852580 2514 2048 824 383 --12526 11659
NM_006775chr643013 2906 2264 2137 ------
NM_006777chrX42743 2699 2245 760 12864 ----
NM_006788chr1821912 1307 --32030 1801 1343 11691
NM_006791chr152542 463 170 ----
NM_006793chr103688 149 87 --1767 --
NM_006805chr541438 1194 1159 1086 ------
NM_006807chr1711257 ----1184
NM_006813chr62274 165 ----1338
NM_006822chr172287 216 ----1612
NM_006823chr841214 1183 497 241 1504 ----
NM_006826chr221036 330 11047 ----
NM_006827chr1483006 2654 1281 1038 948 750 222 32 12301 ----
NM_006838chr1231261 1208 654 ------
NM_006842chr111124 ------
NM_006854chr741606 1470 431 382 ------
NM_006857chr2381 69 62 ------
NM_006873chr233166 3107 861 ----13374
NM_006874chr431067 1031 60 ------
NM_006884chr331985 1806 257 1356 11541 --
NM_006885chr1653952 3097 2593 949 870 --11350 --
NM_006888chr1472925 1342 1099 913 553 353 238 12885 --12831
NM_006892chr2021321 1216 ------
NM_006892chr2021321 1216 ------
NM_006897chr12------1426
NM_006898chr22645 516 ------
NM_006908chr72540 373 --21493 47 --
NM_006912chr142554 960 563 254 1834 ----
NM_006914chr91441 11435 ----
NM_006915chrX72567 2477 2216 1880 1622 551 503 ----1528
NM_006918chr11115893 5593 5187 4898 4626 4520 4189 1426 1067 898 272 ----11166
NM_006920chr241692 1285 693 454 --2563 360 --
NM_006922chr262111 2011 1713 1021 436 324 ----11865
NM_006924chr1774256 4243 3598 1673 675 122 23 --12828 --
NM_006925chr141151 1427 ----
NM_006930chr531452 1241 750 ------
NM_006937chr171194 2402 158 1479 --
NM_006938chr18------150
NM_006939chr1431164 304 42 --1261 --
NM_006940chr1231775 1653 505 1693 1729 --
NM_006948chr2152488 2320 1994 843 773 12232 ----
NM_006951chr101777 ----1785
NM_006963chr1041278 480 470 309 ------
NM_006981chr91377 22979 2717 12256 --
NM_006982chr12--1256 ----
NM_006996chr131858 1833 1817 --1682 --
NM_006997chr10------1303
NM_007006chr1683503 3273 2961 2953 2416 2274 574 110 1812 12553 1232
NM_007011chr1566718 6278 6091 1361 784 214 14852 ----
NM_007013chr8133 163 1788 --
NM_007023chr21821 --1891 --
NM_007033chr13800 751 137 --11558 --
NM_007034chr131023 720 128 ------
NM_007038chr21156042 5612 5579 5566 5527 5394 5258 4986 4809 4618 1304 1267 1090 790 388 25632 4638 25446 1611 --
NM_007039chr1472265 1914 1892 901 653 484 258 1269 ----
NM_007040chr191776 ----1736
NM_007042chr31336 22412 368 1318 --
NM_007045chr63535 482 114 ------
NM_007050chr2058061 7769 7742 764 509 17806 26075 6026 --
NM_007052chrX2145 43 ------
NM_007054chr593880 2810 722 591 562 524 422 237 218 1192 12786 1387
NM_007055chr1021043 836 ------
NM_007064chr311239 ----11409
NM_007078chr1032846 2769 242 --13023 21173 175
NM_007084chr1341278 588 461 109 --2573 292 --
NM_007106chr1331998 991 891 12253 1362 11119
NM_007107chr312108 ------
NM_007114chr383243 2953 2649 2283 2089 882 758 359 22857 1176 ----
NM_007118chr53902 305 123 ------
NM_007124chr641819 1629 1537 290 1433 ----
NM_007125chrY2323 69 21326 562 ----
NM_007129chr133890 767 424 ------
NM_007139chr711122 2425 202 1435 --
NM_007145chr191930 --31233 151 51 --
NM_007158chr121166 426 ------
NM_007166chr1141272 543 519 335 ------
NM_007173chr1151910 1507 1476 692 309 --1553 2707 238
NM_007174chr1211482 --2278 241 --
NM_007175chr8103553 3525 3393 3291 2799 2742 2663 602 592 231 ----12550
NM_007178chr12--1442 ----
NM_007185chr11999 --1331 --
NM_007187chr132197 79 ----2360 22
NM_007191chr121689 --1617 --
NM_007200chr1544500 4418 1593 1234 --23482 620 --
NM_007203chr963319 1536 1471 1293 992 471 12421 11502 13085
NM_007207chr12300 95 ------
NM_007212chr131734 1556 781 --1866 --
NM_007214chr641295 892 478 41 11034 --133
NM_007217chr31159 ------
NM_007218chr8--1224 ----
NM_007231chrX32138 1788 270 1962 ----
NM_007235chr121426 ------
NM_007236chr151121 --21645 820 --
NM_007241chr172312 241 ------
NM_007246chr411082 --1905 --
NM_007249chr13159391 9346 8200 7981 7723 6970 5882 3121 3033 2551 2381 1748 1542 562 287 21789 296 12184 --
NM_007269chr11197 ------
NM_007270chr7199 --11478 --
NM_007271chr651748 1708 1697 1145 42 --11382 --
NM_007276chr721055 945 --1163 --
NM_007285chr161112 ------
NM_007324chr11423 --168 1433
NM_007331chr442489 2445 2247 1950 --12240 --
NM_007345chr1832158 1788 332 ------
NM_007347chr151347 21062 198 12198 --
NM_007358chr131984 581 236 ------
NM_007361chr141136 --1554 --
NM_007368chr1331519 1310 1100 ------
NM_007373chr1021463 116 11266 1579 --
NM_007375chr162464 2286 2166 2157 1840 1076 --32450 978 333 --
NM_012073chr521587 199 ------
NM_012081chr533772 3560 2961 23205 2444 --1488
NM_012082chr81274 --1315 --
NM_012089chr131504 1108 241 ------
NM_012090chr141200 1168 453 149 ------
NM_012093chr131040 999 258 --11170 --
NM_012095chr1043233 1279 735 209 ------
NM_012096chr363519 3502 3088 2523 468 313 --32814 1087 171 13768
NM_012097chr22623 31 22190 808 ----
NM_012110chr41271 ------
NM_012115chr61570 138 ----
NM_012117chr12------135
NM_012120chr622555 702 ------
NM_012124chr113738 347 295 ------
NM_012129chr722106 1644 12440 ----
NM_012130chr212231 109 ------
NM_012137chr152962 2719 2706 2215 2097 ------
NM_012141chr1363973 771 422 374 187 78 1460 23684 1095 --
NM_012153chr1141921 1729 371 311 12251 ----
NM_012156chr2052842 2583 1160 276 205 1508 22649 921 --
NM_012158chr131665 11635 --11756
NM_012164chr997447 7029 6976 6438 6430 6235 5204 2973 2147 --66811 5733 5328 4922 4640 234 --
NM_012175chr112887 774 ------
NM_012180chr41188 ----1224
NM_012183chr11612 1602 ----
NM_012193chr11105435 5093 4929 4741 4382 1663 1526 1111 939 897 --34706 996 777 --
NM_012197chr931358 1332 547 ------
NM_012199chr124380 568 --54511 2905 1001 919 819 --
NM_012207chr102931 79 1185 ----
NM_012214chr256171 4996 4978 2540 248 1284 15615 --
NM_012215chr1061461 716 668 604 598 546 --21603 1347 --
NM_012219chr343231 2428 1208 873 ------
NM_012223chr241229 990 447 41 ------
NM_012229chr1011236 ----1569
NM_012233chr22946 241 ------
NM_012234chr352547 2282 1319 770 76 ------
NM_012238chr1031679 435 283 41747 1643 1291 183 21547 692 --
NM_012242chr10------1309
NM_012243chr14761 340 304 174 166 ----
NM_012247chr103708 641 129 --1954 1878
NM_012249chr223382 2512 11398 --12808
NM_012250chr1121066 918 11314 ----
NM_012252chr765334 5234 4791 4419 1211 1148 ----15371
NM_012255chr20--2340 186 ----
NM_012257chr72857 343 1418 1834 21043 37
NM_012259chr621408 1083 1446 11399 --
NM_012262chr174520 4123 4011 3460 935 789 110 1970 55036 4691 3794 3441 1025 --
NM_012264chr2222036 1809 ----11974
NM_012264chr2222036 1809 ----11974
NM_012266chr921130 1120 ------
NM_012281chr72795 452 1756 1720 --
NM_012286chrX1530 ------
NM_012287chr384537 4424 3898 3728 3504 3356 3177 2901 11057 ----
NM_012289chr19------160
NM_012290chr22606 169 21530 1480 --11290
NM_012294chr743741 2917 924 679 12666 1619 13616
NM_012297chr421878 1693 11887 154 1940
NM_012300chr5--12376 42401 2054 1718 373 --
NM_012301chr71775 ----11943
NM_012302chr14484 364 341 185 1930 ----
NM_012309chr1134366 4150 3433 11702 33363 620 329 --
NM_012316chr175425 4018 3578 3433 2142 1659 538 --23865 327 1577
NM_012319chr183644 120 72 ------
NM_012323chr2231586 1058 435 ------
NM_012327chr1831305 511 190 ------
NM_012329chr1731423 564 496 179 11051 --
NM_012333chr141148 604 59 41 21530 641 1447 --
NM_012338chr7------1872
NM_012339chr101555 ----1574
NM_012342chr10------1165
NM_012345chr1351654 774 717 251 103 --11289 --
NM_012347chr672889 2657 2419 2290 2208 1945 1870 12877 2454 33 --
NM_012382chr534214 1776 798 ------
NM_012395chr793216 3049 2894 2654 2342 840 591 480 199 23343 2987 ----
NM_012399chr2221431 768 ------
NM_012411chr11136 ------
NM_012412chr73627 146 41 ------
NM_012413chr21455 ------
NM_012414chr12640 119 ------
NM_012416chr91800 --11266 --
NM_012419chr61261 --1441 --
NM_012421chr1--1418 ----
NM_012425chr1042744 2598 2407 481 12075 ----
NM_012426chr16------2365 319
NM_012428chr151384 1762 1735 --
NM_012431chr783632 3313 3304 3275 3235 1322 994 886 --186 --
NM_012432chr11334 ------
NM_012434chr641632 1178 1171 107 ------
NM_012446chr51517 ------
NM_012449chr7166 ------
NM_012454chr62537 458 ------
NM_012463chr1271249 1191 1149 1139 673 665 170 --1300 --
NM_012464chr422190 439 11870 2511 143 --
NM_012465chr1043269 3126 2233 911 ------
NM_012482chr11170 ------
NM_013229chr1282834 2685 2641 2634 901 741 262 115 --22094 467 12257
NM_013231chr1434119 3938 212 24083 274 ----
NM_013233chr211045 21470 437 --11376
NM_013237chr5167 ------
NM_013243chr1521240 212 ------
NM_013254chr12------139
NM_013261chr433591 2964 2941 11245 33527 3331 630 --
NM_013262chr63477 433 400 ----11317
NM_013279chr1112370 ------
NM_013281chr2021292 520 --1251 --
NM_013282chr1931141 1087 1027 ------
NM_013283chr53187 139 85 ------
NM_013286chr313799 1745 ----
NM_013293chr71260 ------
NM_013300chr122244 210 ------
NM_013309chr1552665 2320 2181 1720 652 --1337 1930
NM_013313chr2242870 2852 2714 941 --22794 2199 11405
NM_013320chr121122 ------
NM_013322chr711435 ------
NM_013326chr18153 ------
NM_013341chr212748 11808 12077 12535
NM_013354chr831462 1426 1146 11361 2977 429 --
NM_013368chr193615 411 152 ------
NM_013371chr11318 ------
NM_013372chr1532229 459 235 12243 ----
NM_013374chr382811 2649 2499 2290 2185 840 555 235 ----1432
NM_013377chr121128 3546 510 278 ----
NM_013381chr1221482 933 1722 ----
NM_013386chr1----11513 --
NM_013390chr961580 1425 304 273 213 207 1184 ----
NM_013396chr2141551 1353 1078 446 ----11429
NM_013423chrX----11013 --
NM_013427chrX----11013 --
NM_013436chr22673 161 1192 ----
NM_013437chr8161 --1869 --
NM_013438chr941588 1524 474 427 1727 1373 --
NM_013444chrX41034 900 749 330 1864 21079 438 --
NM_013446chr761429 1415 1270 1171 298 231 1556 ----
NM_013448chr141572 ----1250
NM_013450chr231091 982 393 --11161 --
NM_013943chr173020 2879 2586 1213 823 602 453 --199 1877
NM_013989chr1444059 3221 940 590 --14771 --
NM_013993chr6------1752
NM_013994chr6------1752
NM_013995chrX82502 2432 2420 2344 1866 994 606 474 --22412 402 --
NM_013996chr71416 ------
NM_013996chr71416 ------
NM_013997chr71416 ------
NM_013997chr71416 ------
NM_013998chr71416 ------
NM_013998chr71416 ------
NM_013999chr1721520 1340 ------
NM_014000chr1021984 1624 ------
NM_014003chr161407 ------
NM_014011chr242526 1863 958 428 ------
NM_014016chr321613 379 ------
NM_014021chr172800 2623 2320 2242 1138 968 762 12857 22471 2378 1495
NM_014023chr102151 119 --1590 --
NM_014028chr673145 2776 2519 2310 2106 1137 597 1481 1750 --
NM_014030chr1711203 ----1426
NM_014033chr1262298 2255 2165 1906 1527 302 --1607 --
NM_014039chr1141101 1039 525 505 ------
NM_014043chr32422 93 --1259 --
NM_014048chr1645109 4140 785 90 --25296 5123 35241 5171 813
NM_014051chr6169 ------
NM_014059chr132364 306 ------
NM_014066chr82361 311 ------
NM_014071chr20------1482
NM_014089chr1372173 2090 1806 1690 1503 1430 87 11764 12143 21957 1898
NM_014106chr1572720 2451 2190 2116 739 504 479 --12900 --
NM_014110chr11200 ----2996 984
NM_014112chr875314 4889 4367 2044 1629 1195 719 13716 42202 2011 1992 1351 --
NM_014141chr724002 274 ------
NM_014142chr10129 ------
NM_014154chr3--1204 31441 1431 213 --
NM_014155chr11127316 7171 6929 6147 6120 5889 2640 2354 1898 1823 1429 717 35980 1102 330 ----
NM_014178chr141169 1575 1589 --
NM_014181chr21753 --12928 1489
NM_014189chr421428 1413 11453 ----
NM_014190chr421780 1765 11805 ----
NM_014191chr1231050 982 727 1975 1422 --
NM_014212chr121813 ------
NM_014217chr121935 423 ----11286
NM_014223chr1----3731 577 549 --
NM_014231chr1232153 2006 570 --1156 --
NM_014232chr172517 194 --1321 --
NM_014232chr172517 194 --1321 --
NM_014233chr1732183 2099 2067 ------
NM_014240chr383917 3432 3081 1607 886 570 535 277 14069 33572 1459 794 --
NM_014243chr432130 1501 465 --11781 --
NM_014245chr31874 --1361 --
NM_014246chr2252258 600 522 483 416 1593 12005 --
NM_014250chr2231959 1936 1751 --12121 11951
NM_014264chr43648 492 463 ------
NM_014265chr81567 1783 2682 197 --
NM_014267chr113189 88 23 ------
NM_014268chr181443 1135 --11256
NM_014271chrX2243 164 1140 ----
NM_014278chr42380 349 ------
NM_014280chr11716 --1293 1166
NM_014283chr131284 1010 349 11134 ----
NM_014290chr91194 ------
NM_014294chr841079 512 483 122 ------
NM_014296chr341000 426 256 238 21350 1052 21121 523 --
NM_014299chr19------12153
NM_014300chr151306 --1130 1470
NM_014309chr2265329 4886 4074 3815 3616 1803 13849 23713 1178 25417 1322
NM_014313chr141461 1445 263 78 ------
NM_014315chr14134 ------
NM_014319chr1241406 574 390 88 31808 1421 1345 1244 1769
NM_014330chr19185 ------
NM_014332chrX2398 82 ----1140
NM_014333chr1132749 1772 1032 ----12524
NM_014345chr61828 ------
NM_014361chr111190 ------
NM_014372chr131581 1546 629 ----1494
NM_014376chr522521 2385 11651 --12412
NM_014380chrX160 --2208 166 --
NM_014382chr341640 535 367 25 --21770 1709 1551
NM_014393chr821725 1543 12254 1440 --
NM_014394chr1011160 ----3855 359 78
NM_014395chr441997 1447 1397 1357 ------
NM_014410chr181258 --1362 --
NM_014415chr3--141 41456 365 335 232 1626
NM_014417chr191943 1679 --1932
NM_014421chr462092 2077 2061 1851 1637 526 ------
NM_014423chr575559 5144 4999 3722 2138 1712 745 --21886 1169 25602 5189
NM_014426chr20159 --2536 488 --
NM_014431chr1031464 1381 1125 --11437 11684
NM_014432chr6--1340 ----
NM_014445chr342042 1825 1815 982 --1649 --
NM_014447chr441663 469 381 241 1119 31571 1043 297 --
NM_014454chr611027 ------
NM_014456chr102344 258 --1297 --
NM_014458chr131219 1114 311 --11333 169
NM_014470chr12------1547
NM_014491chr7------1734
NM_014494chr1621685 589 --22378 397 --
NM_014497chr2180 ------
NM_014498chr32302 131 ------
NM_014502chr111398 ------
NM_014515chr1231055 672 202 --1383 --
NM_014521chr231717 1246 1195 --1453 11159
NM_014522chrX------1654
NM_014548chr1531104 360 173 ------
NM_014552chr231469 567 183 ----11267
NM_014554chr1231418 190 170 --1714 22167 2031
NM_014563chrX31908 752 420 12119 ----
NM_014569chr71367 11221 1975 --
NM_014572chr1321248 351 ----1579
NM_014574chr1431452 1404 1385 1561 11194 --
NM_014577chr225821 686 613 304 58 --1918 --
NM_014585chr231252 1088 1052 --2417 62 --
NM_014587chr1621381 1319 --21354 303 11554
NM_014591chr1011335 --11310 --
NM_014607chr232112 1965 1537 1576 --1754
NM_014612chr911001 --1415 --
NM_014613chr523006 536 --12626 --
NM_014614chr211017 1979 11063 --
NM_014615chr1673425 3074 2991 1377 1093 819 783 --1976 --
NM_014616chr343309 2861 1305 110 23462 920 1833 12391
NM_014618chr9196 140 ----
NM_014620chr121534 ------
NM_014629chr82361 34 11285 ----
NM_014630chr1532654 1495 114 13678 1794 --
NM_014633chr112471 133 ------
NM_014634chr2242813 2796 1309 867 ------
NM_014635chr211200 --31662 1305 107 1124
NM_014636chr934118 3773 1666 14027 --21302 455
NM_014637chr821433 1168 --11303 --
NM_014653chr1232159 2123 1407 --11561 --
NM_014655chr112317 ----1529
NM_014659chr151262 1938 ----
NM_014660chr711090 --1280 --
NM_014661chr1063917 3874 3132 1464 1265 278 --13036 13154
NM_014667chr331839 959 125 --32444 483 163 --
NM_014670chr251610 1603 544 393 231 --1584 --
NM_014671chr731571 1462 1368 ------
NM_014674chr373936 3866 2716 2628 2500 1570 596 1160 22882 841 13763
NM_014675chr11496 ----1527
NM_014676chr141636 1564 428 172 1260 11443 11421
NM_014677chr841292 1224 1157 550 21304 160 ----
NM_014679chr111271 ------
NM_014682chr8102259 2205 2138 2103 578 560 273 257 126 117 1529 12123 12069
NM_014683chr1761489 1448 631 596 221 173 ----1765
NM_014686chr1942548 2292 1967 898 --22461 1997 --
NM_014689chr24631 546 168 49 ----1161
NM_014699chr162355 329 ------
NM_014700chr16--11268 ----
NM_014701chr1593367 3086 2826 2729 2101 1224 876 231 130 1751 2981 82 11054
NM_014702chr663081 2857 2777 497 462 307 --13366 11191
NM_014705chr741790 1738 1722 1454 1151 2760 263 11589
NM_014707chr732252 1972 389 --11813 --
NM_014709chr22179 59 ------
NM_014711chr163769 278 206 --1648 --
NM_014713chr22503 489 --1338 --
NM_014717chr191643 ------
NM_014720chr101240 ------
NM_014721chr6107275 5854 5591 5309 4714 2501 2264 1415 723 78 ------
NM_014725chrX----11113 11260
NM_014726chr1721316 1033 ------
NM_014727chr19--1224 ----
NM_014729chr852113 925 730 463 411 21878 1649 1707 169
NM_014730chr1245308 4543 989 297 --14291 --
NM_014730chr1245308 4543 989 297 --14291 --
NM_014732chr1675854 5722 5715 2092 1927 1062 252 --15178 --
NM_014733chr542229 1773 775 508 11573 11876 --
NM_014735chrX2342 326 --1796 --
NM_014736chr154968 325 273 171 ------
NM_014738chr172729 78 ------
NM_014739chr6113936 1610 1413 1120 961 791 700 224 186 112 39 13725 ----
NM_014743chr422443 2252 --1295 --
NM_014746chr254417 4310 3564 3282 710 --24278 3751 --
NM_014747chr124533 1530 24349 1499 ----
NM_014751chr861785 871 409 298 199 99 --12074 11994
NM_014752chr1121221 225 --1290 11546
NM_014755chr274272 2597 938 687 681 509 333 --22772 1058 1562
NM_014756chr111304 --1475 1159
NM_014757chr52438 431 11504 11526 --
NM_014761chr1621164 772 ------
NM_014764chr1211323 ------
NM_014765chr112651 22470 2250 22346 878 --
NM_014779chr31890 ------
NM_014781chr82487 415 1806 ----
NM_014787chr152257 2226 2185 1909 1813 --12096 --
NM_014791chr92304 232 ------
NM_014795chr241387 1360 923 305 --1944 1209
NM_014802chr122829 269 ----11030
NM_014803chr1032639 1802 1088 ----1803
NM_014807chr11----1645 --
NM_014810chr153596 3403 3307 3060 108 1231 33571 2669 987 11122
NM_014811chr94626 254 197 187 ------
NM_014812chr111917 --1631 1700
NM_014813chr12549 119 --151 --
NM_014819chr541916 909 236 165 1895 1363 --
NM_014820chr332058 1278 183 --11860 --
NM_014822chr42189 29 1221 1254 1623
NM_014824chr1142003 1350 795 580 --183 --
NM_014827chr111565 ------
NM_014828chr1422245 826 22419 1569 ----
NM_014829chr512226 --1607 --
NM_014830chr1243829 3820 1544 1517 23871 1325 12756 --
NM_014835chr2021615 1485 ------
NM_014839chr172475 2190 2113 1876 987 423 261 ----1810
NM_014840chr1243373 2761 2422 141 ----1957
NM_014841chr631340 952 238 ------
NM_014844chr1434151 3703 1683 ------
NM_014847chr11198 --1495 --
NM_014848chr1562758 2381 2349 1069 706 167 --1474 --
NM_014860chr262588 2411 1898 806 161 60 1314 22435 174 --
NM_014862chr1534122 2829 2671 ------
NM_014864chr154318 3088 1650 489 402 24304 3535 23469 744 --
NM_014872chr93550 331 258 12135 ----
NM_014873chr154740 1371 719 687 485 --24196 3863 11577
NM_014877chr17127483 7082 6422 6073 4803 3077 2958 1742 889 650 637 47 11180 67555 7224 6891 5326 266 185 14981
NM_014883chr432207 2133 210 ------
NM_014887chr13136 --1798 --
NM_014892chr62497 33 1151 ----
NM_014893chrY51831 1620 950 827 600 1896 --11474
NM_014897chr1773248 2849 2632 1010 968 586 236 12262 1371 12207
NM_014899chr573163 3086 2844 2798 2061 413 237 ----12544
NM_014900chr22364 287 ------
NM_014901chr512128 12003 22199 767 --
NM_014903chr1232429 2320 2311 22417 291 --12246
NM_014904chr1063949 3341 1626 1602 1468 390 ----23544 1280
NM_014905chr211740 1360 ----
NM_014906chr1723124 2660 12881 ----
NM_014912chr1093411 3320 2974 2739 2679 2614 2189 1334 1160 12495 33142 2966 226 --
NM_014913chr1831375 531 209 ------
NM_014914chr2--11242 --11148
NM_014916chr71484 2675 521 1607 --
NM_014917chr12750 699 ------
NM_014918chr1551580 1523 1255 1137 63 ------
NM_014925chr121226 1885 ----
NM_014926chr311008 ------
NM_014929chr23523 517 42 ------
NM_014932chr311387 ----11686
NM_014936chr692762 2262 1987 1082 763 492 438 396 316 --1899 --
NM_014937chr10178 ------
NM_014946chr232700 1173 312 13095 23055 2849 12947
NM_014947chr163057 3012 2612 2423 2144 1083 ----1262
NM_014949chr15999 986 889 365 110 ----1971
NM_014951chr1021924 1877 12579 ----
NM_014952chr1511947 ------
NM_014953chr1334112 351 323 --13323 --
NM_014962chr20102844 2685 2446 2431 2084 2058 1006 912 244 105 ------
NM_014964chr1732310 2138 641 --12456 1605
NM_014969chr12989 943 11028 1911 --
NM_014974chr1011298 11207 1676 --
NM_014978chr1021708 724 --11540 11859
NM_014982chr1435387 3398 1336 11406 1242 --
NM_014988chr41618 22117 2059 21931 205 1212
NM_014989chr631612 1528 1442 11539 31260 823 786 --
NM_014990chr1421294 327 --1857 --
NM_014991chr482948 2836 2629 2254 2107 769 405 315 1969 22793 941 13044
NM_014996chr361022 988 740 703 393 163 ------
NM_015000chr1232630 2369 694 12094 ----
NM_015002chr124885 404 327 21 21796 488 --12273
NM_015004chr3------1105
NM_015008chr333512 2601 2582 ------
NM_015009chr36773 671 643 244 129 86 --1701 --
NM_015011chr132442 387 ------
NM_015017chr11392 1947 1820 --
NM_015018chr6192 ------
NM_015020chr1643903 3114 2582 1292 ------
NM_015024chr811239 11270 ----
NM_015025chr222737 2524 --42576 1715 647 201 12673
NM_015026chr1264072 3995 3176 2991 2927 1062 1170 34703 1581 390 --
NM_015027chr1621809 649 ------
NM_015032chr1372164 2050 2026 1084 1066 420 414 --12127 --
NM_015040chr293399 3185 2912 2729 2602 2426 1315 739 404 1750 1176 --
NM_015042chr15--12853 33986 1385 502 13535
NM_015045chr1012248 --12215 --
NM_015046chr952456 2197 315 179 92 ------
NM_015055chr1152673 2251 1897 1123 337 12863 ----
NM_015056chr2162625 2563 2378 803 212 94 ----22422 39
NM_015061chr91796 1557 ----
NM_015062chr101209 ------
NM_015068chr743966 3427 3181 723 ------
NM_015071chr5--15109 36158 772 517 --
NM_015072chr14----1384 1438
NM_015074chr154821 4734 4085 1315 362 13652 14883 --
NM_015076chr684515 4243 3983 3889 2906 1224 1090 638 21012 942 21650 1324 1815
NM_015079chr1553265 2989 1022 809 376 12996 12298 12626
NM_015087chr1392676 2616 2410 2010 1958 653 577 255 185 --1442 --
NM_015090chr196242 6043 5403 4400 2274 1852 1330 482 33 --16056 15608
NM_015091chr142751 130 --1280 --
NM_015092chr1644001 3555 3244 1392 --14646 11317
NM_015093chr651846 1628 1547 1368 383 --11622 --
NM_015094chr2234563 3355 1463 ----13224
NM_015097chr341899 1740 818 142 --1282 --
NM_015115chr482246 1230 712 276 203 196 102 75 22469 2292 23097 798 11160
NM_015116chr1341655 1202 173 50 --21690 1138 --
NM_015120chr21264 ------
NM_015125chr191482 ------
NM_015132chr731655 446 223 ------
NM_015137chr862265 1969 1841 971 916 33 --11898 --
NM_015138chr151656 ------
NM_015141chr322158 2149 --22463 2198 12048
NM_015144chr1693866 3828 3219 2645 2498 1412 1094 941 497 23972 3295 ----
NM_015149chr121636 1577 21584 824 --1360
NM_015155chr1032107 1331 779 ------
NM_015156chr1413757 23260 2722 11452 --
NM_015157chr1121166 42 ------
NM_015158chr93756 665 618 1676 --1261
NM_015170chr842241 1816 1432 843 --1149 --
NM_015172chr151254 1109 457 201 192 11521 --11579
NM_015176chr141247 1086 710 201 --31207 661 213 --
NM_015178chr81449 --12726 --
NM_015180chr144919 743 589 311 ------
NM_015185chrX1428 --2881 813 --
NM_015186chr9151 ------
NM_015192chr2092951 2790 2768 2366 2330 2276 1985 511 30 1693 22004 760 --
NM_015199chr342536 1895 1180 263 ------
NM_015200chr452427 2165 2105 735 679 ----12472
NM_015206chr1543521 2841 2662 622 ------
NM_015208chr1893397 3076 2548 2535 1495 1282 774 659 239 1472 23527 1122 13766
NM_015209chr132170 744 432 ----1809
NM_015215chr193053 3038 3005 2230 2106 1172 1126 653 196 --1202 --
NM_015219chr1732540 1055 847 --12625 --
NM_015225chr962946 2597 2463 2119 712 392 --32644 1183 103 12745
NM_015231chr113233 93 25 ------
NM_015233chr132875 771 12695 ----
NM_015234chr631400 972 155 11126 11192 --
NM_015238chr51255 ----1477
NM_015247chr1641998 525 404 53 --23296 195 11453
NM_015251chr1652268 2227 2133 2077 164 --1145 --
NM_015252chr21115 ----1254
NM_015254chr833126 835 784 --23161 128 --
NM_015260chr1921557 280 ----21598 1350
NM_015265chr272393 2337 2042 2024 471 454 325 1177 ----
NM_015269chr11215 ------
NM_015271chr464192 4084 3364 798 289 38 ----24027 362
NM_015272chr1662009 1942 699 680 154 74 --1289 --
NM_015275chr1252093 1534 1439 331 324 ----1339
NM_015277chr1841319 461 78 50 --158 1688
NM_015278chr653210 2738 2111 1012 750 1456 --12472
NM_015282chr212750 1262 ----
NM_015284chr121325 135 ------
NM_015286chr1552343 1842 825 397 314 --1291 1679
NM_015288chr523619 2979 11485 13864 13672
NM_015291chr183477 3085 3034 2818 2611 1128 1089 1007 12873 23386 2420 --
NM_015294chr171216 2845 800 11146 1266
NM_015308chr114870 839 181 27 ------
NM_015310chr8148324 7671 7375 6876 6124 5874 5795 5661 5368 1938 1787 1300 296 200 16321 --12383
NM_015313chr1154700 4682 3978 3817 307 --24856 1157 --
NM_015314chr792600 2480 2466 2447 2402 1879 1679 672 286 ------
NM_015315chr553439 3252 2139 1129 1047 ------
NM_015317chr292793 1819 1795 1138 826 803 462 304 143 11124 --12351
NM_015321chr1934918 4209 1800 --24910 4902 --
NM_015323chr631670 1644 184 --11576 --
NM_015326chr122643 565 12414 12232 --
NM_015328chr722869 2392 --21916 274 --
NM_015329chr1952872 2809 2800 1833 752 ------
NM_015331chr12636 577 ------
NM_015335chr1232461 1815 1648 ----1335
NM_015336chr12102679 2525 2302 2202 2009 1975 741 687 640 418 ------
NM_015338chr2031648 740 338 ------
NM_015339chr2021015 821 1647 ----
NM_015342chr51122 ------
NM_015344chr821901 1521 --1346 --
NM_015347chr1242802 2736 2275 340 12333 32246 1908 255 --
NM_015349chr642945 2921 2910 2881 --32603 1004 924 --
NM_015355chr174503 492 359 144 --1331 22011 1746
NM_015358chr2131129 519 251 150 ----
NM_015359chr862947 2806 1132 852 673 154 ----12417
NM_015361chr25912 869 837 376 358 1321 1745 --
NM_015365chrX83861 3839 3339 2866 2644 762 529 229 12809 --13534
NM_015378chr152841 2466 1833 418 323 12195 12218 --
NM_015384chr51123 ------
NM_015387chr241998 1984 803 120 ------
NM_015393chr453558 1232 763 242 219 13827 13582 --
NM_015396chr321234 122 ----190
NM_015409chr1232697 2050 663 --22714 349 --
NM_015423chr1131291 423 206 ------
NM_015424chr11161 ------
NM_015429chr331109 928 273 ------
NM_015435chr831412 1061 595 --11425 --
NM_015443chr1731368 1199 1115 ------
NM_015446chr12537 35 ----11461
NM_015455chr543792 1486 1060 422 --64038 3174 649 621 495 225 --
NM_015458chr895252 5111 5081 4939 4629 3373 1015 953 905 25287 4647 ----
NM_015461chr182534 116 1205 169 1171
NM_015463chr21792 ------
NM_015464chr71898 --1223 --
NM_015475chr22873 135 ----11031
NM_015483chr7----1146 --
NM_015493chr1912236 1433 11869 --
NM_015496chr82265 214 ------
NM_015497chr152952 777 ------
NM_015507chrX3459 60 29 ------
NM_015508chr3152 1268 ----
NM_015509chr1211558 1184 11288 --
NM_015516chr1131291 1276 1256 ------
NM_015523chr112194 104 ------
NM_015530chr23628 397 263 --193 --
NM_015531chr111157 ------
NM_015532chr1542194 1914 1873 226 --1470 --
NM_015534chr121035 894 ------
NM_015535chr253825 1626 1227 415 223 11365 23531 2692 11442
NM_015542chr101221 --11123 --
NM_015550chr753501 3309 1181 930 677 --1541 --
NM_015554chr1592860 2803 2784 2262 2184 832 800 543 163 22709 2541 --11826
NM_015555chr631356 1277 158 --1356 --
NM_015556chr141179 ------
NM_015560chr352813 2576 2379 2156 218 ------
NM_015565chr2152233 1973 484 267 186 1331 12300 --
NM_015567chr1331134 1017 309 --131 11141
NM_015569chr1104224 3959 3507 1469 1194 954 941 580 242 223 14065 ----
NM_015570chr731492 523 166 --11290 1465
NM_015571chr652629 2293 1829 1765 579 21001 666 21782 1756 --
NM_015575chr273668 3626 3317 3081 915 565 539 --12415 --
NM_015576chr342526 1910 1876 551 ----12381
NM_015577chr521803 1688 ------
NM_015578chr1962002 1575 1499 1474 652 74 ------
NM_015595chr32924 347 --137 1187
NM_015602chr1----11344 --
NM_015605chr1021504 411 --2104 79 11233
NM_015609chr14951 515 123 69 ------
NM_015610chr72831 749 --1293 --
NM_015630chr25861 373 268 200 159 --1257 --
NM_015635chr931673 431 98 21871 206 ----
NM_015640chr1105188 4945 4619 4514 3410 3326 1122 682 278 204 --25171 60 1448
NM_015646chr1271268 1215 1074 1031 876 342 225 2506 294 --1162
NM_015678chr1381556 1472 1429 1360 1216 1161 532 468 --21374 677 2433 109
NM_015686chrX32484 2325 811 ------
NM_015690chr21585 ------
NM_015691chrX22390 118 1540 12924 --
NM_015695chr611566 ------
NM_015702chr2134 ------
NM_015711chr19----1769 --
NM_015714chr1----2365 298 --
NM_015850chr832165 1524 1516 --11679 --
NM_015866chr131101 987 49 ------
NM_015872chr121379 1359 ----11485
NM_015879chr1898002 7135 6733 6540 6435 5504 1873 589 229 11768 32756 595 141 1446
NM_015885chr111552 --1163 --
NM_015886chr854982 1712 1120 538 133 21724 1022 15345 182
NM_015888chr153313 3171 2700 1200 732 --2662 68 1627
NM_015898chr191301 ----12031
NM_015902chr83892 693 48 --2760 602 1641
NM_015906chr174249 3751 1507 1080 978 756 213 13859 21257 516 24550 3445
NM_015908chr7142 --178 --
NM_015913chr11771 --2737 597 --
NM_015914chr16--142 ----
NM_015916chr10125 ------
NM_015920chr152594 114 --1630 --
NM_015934chr21219 ------
NM_015955chr23422 369 329 2489 378 ----
NM_015960chr101372 ------
NM_015976chr1--1282 1108 --
NM_015986chr1741332 1070 495 139 ------
NM_015990chr431091 949 394 --1715 --
NM_015994chr144715 463 236 155 ------
NM_015995chr1555464 5453 4866 2112 63 25412 199 24336 322 --
NM_016003chr72831 749 --1293 --
NM_016009chr174787 4157 3591 833 674 153 40 11631 ----
NM_016019chr731019 396 320 ------
NM_016021chr662066 1952 627 290 237 97 --12036 --
NM_016022chr121117 989 ------
NM_016025chr161159 11582 ----
NM_016037chr12953 102 ------
NM_016040chr162552 1886 372 280 213 186 --21873 617 --
NM_016045chr2061581 1493 1451 1239 741 631 21250 420 1666 --
NM_016060chr1721113 207 ----157
NM_016061chr21173 --31340 1147 1024 --
NM_016072chr1241883 1584 525 422 --11915 --
NM_016073chr1531017 228 128 ----1271
NM_016076chr162051 376 310 191 147 92 2837 779 --12691
NM_016078chr1721123 888 --1339 11033
NM_016083chr673766 3333 3273 2967 1382 423 333 11187 --12926
NM_016090chr111320 1889 11071 --
NM_016096chr832048 1376 572 ------
NM_016097chr1831111 172 102 ------
NM_016100chr201362 ------
NM_016103chr51447 ------
NM_016107chr51485 1948 ----
NM_016123chr121478 --1983 --
NM_016126chr1122 ------
NM_016129chr41291 --180 --
NM_016131chr212202 12119 --22099 371
NM_016132chr1553271 3105 2941 2580 1027 ------
NM_016133chr221604 386 ----126
NM_016152chr31277 1397 --21219 334
NM_016166chr151190 ------
NM_016169chr1053296 3210 3138 2589 513 ----13104
NM_016185chr171804 --1300 --
NM_016192chr21105 ------
NM_016195chr102166 57 --1753 --
NM_016200chr71819 ----140
NM_016201chr31642 --21859 1465 11844
NM_016203chr72899 190 ------
NM_016206chr3168496 7913 7867 7673 7557 6400 6334 5883 3610 3447 2726 2702 2443 2181 403 379 18482 28475 1817 --
NM_016217chr643558 2262 1456 806 ------
NM_016221chr531640 1484 1462 11494 --11799
NM_016224chr632174 821 460 --1749 --
NM_016227chr131284 1010 349 11134 ----
NM_016230chr61403 --1176 184
NM_016231chr17289 63 1227 --11694
NM_016248chr1373948 3938 3811 1420 394 313 180 --13352 12826
NM_016252chr2168 ------
NM_016255chr643345 3330 3243 392 22403 859 12177 --
NM_016258chr1136 1613 ----
NM_016260chr287468 7239 6180 6013 5277 5093 1569 1308 --17506 16884
NM_016262chr62566 73 ----1549
NM_016269chr441186 1015 927 358 ------
NM_016270chr19----2490 338 --
NM_016271chr1861883 1835 1543 703 275 261 1353 129 --
NM_016275chr31138 --133 --
NM_016277chr641215 1164 281 243 --11501 --
NM_016279chr52505 378 ------
NM_016281chr1221177 1020 --11096 --
NM_016284chr163928 898 23 --1610 --
NM_016287chr152031 1726 1292 660 362 ------
NM_016289chr242116 875 772 738 1181 1346 1819
NM_016297chr243499 1037 315 184 ------
NM_016300chr31369 ------
NM_016303chrX2396 300 ------
NM_016308chr111335 2577 456 ----
NM_016312chr121432 ------
NM_016315chr271630 1618 1562 1483 318 247 43 --11204 11718
NM_016316chr22169 63 ----2302 131
NM_016322chr942116 2074 1282 1018 11094 21031 943 1762
NM_016338chr521173 66 ------
NM_016339chr17--31800 1437 1362 162 --
NM_016352chr711288 --134 11456
NM_016356chr682489 1901 1892 1060 740 655 310 200 --21975 256 --
NM_016359chr15155 ------
NM_016374chr121163 1152 21580 1231 128 21465 433
NM_016374chr121163 1152 21580 1231 128 21465 433
NM_016376chr1723906 1499 --23830 1454 --
NM_016377chr6----21547 719 --
NM_016395chr1541849 1793 1746 179 11577 11763 --
NM_016396chr1522798 391 --31008 102 94 --
NM_016423chr14------1325
NM_016424chr1741532 535 275 220 ------
NM_016436chr2092686 2605 2392 2384 2106 1008 641 602 573 --11067 1273
NM_016441chr211787 --11952 --
NM_016447chr71219 ------
NM_016451chr11----174 --
NM_016467chr231368 1319 304 ------
NM_016472chr1431498 1258 429 171 11226 1341
NM_016480chr51135 ------
NM_016486chr1----1195 --
NM_016488chr1211852 ----11874
NM_016500chrX1267 2104 72 ----
NM_016505chr13659 605 223 ------
NM_016507chr1733151 2904 1034 12673 ----
NM_016516chr21819 1591 1355 --
NM_016520chr92575 311 --1319 --
NM_016525chr91871 1883 1242 --
NM_016526chr1162520 2167 1854 1788 1595 269 ------
NM_016530chr1573837 3723 3146 2574 1356 1012 730 --11656 3383 348 296
NM_016531chr494128 3048 2739 2569 1235 1157 1043 846 468 --13703 --
NM_016542chrX61666 1608 1575 378 191 111 11079 --11267
NM_016544chr263532 3469 2557 544 188 128 13033 --13606
NM_016545chr12902 809 ----1870
NM_016557chr33704 361 287 ------
NM_016559chr351370 1304 1129 431 48 --1581 --
NM_016561chr161125 ------
NM_016569chr1251336 629 487 237 109 1995 ----
NM_016587chr721055 945 --1163 --
NM_016603chr521429 598 12232 2261 120 --
NM_016613chr462725 2597 2575 2226 730 558 --11968 --
NM_016620chr141277 425 407 331 2378 287 ----
NM_016621chr1154601 3518 3209 1231 1127 ------
NM_016623chr82535 248 1454 1519 --
NM_016626chr1821471 1460 11477 ----
NM_016628chr103736 236 176 --1760 --
NM_016631chr213701 240 59 ------
NM_016651chr143986 722 87 ------
NM_016654chr1531354 1039 1017 ----1470
NM_016733chr2221480 1256 11395 ----
NM_016819chr31557 ----1461
NM_016820chr3172 ------
NM_016824chr1041793 1206 750 736 146 --1681
NM_016831chr152326 2252 2004 1848 224 11780 1713 --
NM_016834chr1742652 1642 1016 980 12610 ----
NM_016835chr1742652 1642 1016 980 12610 ----
NM_016836chr2------1110
NM_016839chr2------1110
NM_016841chr1742652 1642 1016 980 12610 ----
NM_016936chr1651837 1697 1628 617 275 1878 ----
NM_016937chrX--1938 ----
NM_016950chr43441 293 119 ------
NM_016952chr1164009 3766 3353 1474 856 123 --23990 3095 23532 241
NM_016953chr295640 5563 5531 5366 4798 4503 4494 472 372 14740 11719 --
NM_017409chr12----2774 570 --
NM_017412chr83452 324 159 --167 --
NM_017420chr1473553 3441 3406 3216 3042 812 107 33175 3096 2716 11359 --
NM_017423chr452054 1796 1661 688 218 ------
NM_017426chr43692 623 454 1272 1425 --
NM_017437chr1452305 2160 979 162 88 --1350 11798
NM_017444chr831308 758 731 ------
NM_017447chr2144366 3682 3097 1503 13297 ----
NM_017452chr2011453 ------
NM_017453chr2011453 ------
NM_017454chr2011453 ------
NM_017455chr151384 1762 1735 --
NM_017457chr191134 ------
NM_017481chr111210 ------
NM_017488chr221451 1370 --11236 --
NM_017519chr621218 325 ------
NM_017522chr131450 409 243 ------
NM_017544chrX2905 22 ------
NM_017548chr352132 1995 1455 652 136 ------
NM_017551chr102912 241 1136 ----
NM_017553chr152843 96 11259 1974 11054
NM_017563chr365936 5336 4643 3963 1418 77 14957 26373 4267 36315 5592 5493
NM_017569chr13146 ------
NM_017578chr3147 197 ----
NM_017580chr1031706 323 211 --1488 --
NM_017582chr111810 --11268 --
NM_017594chr983197 3075 3007 2980 2372 1126 982 112 33322 2944 2667 22611 1015 --
NM_017596chr124272 1377 14640 14585 --
NM_017599chr1241297 677 640 435 ------
NM_017610chr1541493 1475 710 261 1820 1244 21624 272
NM_017628chr474215 4036 3393 3292 1044 220 25 ------
NM_017629chr12148 131 --1626 --
NM_017632chr43116 94 61 --1308 --
NM_017633chr653938 3400 3120 2388 1425 ------
NM_017634chr8--1670 ----
NM_017635chr1121517 1377 1270 ----
NM_017637chr9149439 7548 6989 3662 3631 3365 2709 2581 2436 2341 2135 2032 1139 391 39455 7478 2813 28159 1938 49367 8372 8170 1003
NM_017640chr61181 1614 1246 1643
NM_017643chr1732671 2638 243 12402 --1580
NM_017644chr3115069 4770 3834 2057 2007 1900 1557 830 392 260 250 15143 ----
NM_017645chr942667 2402 1102 194 ------
NM_017650chr745727 5156 2287 2245 35629 5109 407 35836 4298 2219 15813
NM_017651chr631049 347 263 11592 ----
NM_017654chr711457 ------
NM_017657chr22733 377 ----1758
NM_017658chr1484495 4415 3953 1668 1563 1481 681 43 --24439 1018 21850 1256
NM_017672chr1531338 1210 260 1921 ----
NM_017679chr17------1264
NM_017693chr1311592 ------
NM_017694chr211759 --11578 --
NM_017709chr133583 3393 461 ----24162 3956
NM_017714chr20--1702 1664 --
NM_017719chr342215 2114 732 652 12243 ----
NM_017724chr33633 560 126 ------
NM_017730chr3----1168 --
NM_017737chr141686 539 454 112 12065 22058 1437 --
NM_017738chr931208 1133 436 ------
NM_017739chr1183 ------
NM_017742chr1841875 1802 510 142 ------
NM_017749chr112937 841 ------
NM_017752chrX--11765 ----
NM_017753chr92757 141 ----41034 808 302 132
NM_017758chr1711488 ------
NM_017762chr1511908 1730 22304 125 --
NM_017768chr13380 227 207 ------
NM_017769chr1462780 2738 2624 2149 890 340 1744 ----
NM_017770chr622969 2789 --1126 --
NM_017772chr611740 1109 ----
NM_017778chr831534 1123 1090 --11101 --
NM_017780chr82833 317 ------
NM_017784chr321215 44 ------
NM_017789chr2------2307 58
NM_017798chr201110 --1164 --
NM_017799chr14----1657 --
NM_017811chr952764 2487 2288 1987 220 ------
NM_017813chr8105665 5516 5501 4553 2112 1735 1502 997 796 757 15557 2691 626 14046
NM_017822chr121269 ------
NM_017824chr103884 847 203 --12354 1356
NM_017831chr1861831 1689 1474 1284 295 40 11490 14634 --
NM_017846chr1293 28 ------
NM_017848chrX43253 1800 1660 730 --2659 531 --
NM_017849chr212447 ------
NM_017857chr11----1681 --
NM_017890chr81507 ----11711
NM_017893chr1011269 ------
NM_017896chr2053364 2453 490 161 115 ----23433 2417
NM_017902chr1055724 5069 3537 539 95 11463 ----
NM_017907chr111448 ------
NM_017913chr91142 ------
NM_017919chr934947 3884 3777 ----13956
NM_017922chr144663 596 274 263 --2543 239 --
NM_017925chr981849 1691 1370 1342 1303 735 276 155 11921 11825 --
NM_017933chr211031 --11636 --
NM_017938chrX92041 2010 1981 1888 1510 760 647 266 43 ------
NM_017943chr14------1787
NM_017944chr1153063 2234 1049 691 586 ----1968
NM_017945chr341398 464 60 21 --11086 1121
NM_017955chr141801 ------
NM_017958chr263032 2134 441 403 140 62 13026 ----
NM_017964chr231024 265 157 --173 --
NM_017969chr2------1177
NM_017974chr21510 --11039 --
NM_017987chr1031714 508 450 ------
NM_017988chr122885 866 ------
NM_017994chr722784 440 ----1155
NM_018011chr133424 103 47 ------
NM_018019chr17------1477
NM_018025chr19--182 ----
NM_018026chr11------11282
NM_018027chr1043286 3266 3253 1069 12705 --11149
NM_018031chr31205 1583 ----
NM_018036chr1494181 4173 3568 3470 3163 1757 1242 1218 594 ------
NM_018037chr13759 222 25 ------
NM_018043chr1131391 1142 288 11365 --1186
NM_018046chr551878 1735 1621 698 142 --31958 1718 1382 --
NM_018048chr1272029 1991 1617 1543 1321 110 25 ------
NM_018056chr11121 ------
NM_018061chr15359 320 226 170 154 ------
NM_018079chr24551 484 386 75 ------
NM_018084chr283354 3077 2991 2795 2600 2312 1046 262 ------
NM_018085chr1138007 7522 7488 7190 6095 5347 5116 1836 1415 919 865 611 55 --27592 7166 --
NM_018086chr221655 134 ----1648
NM_018098chr331212 355 293 1451 1827 --
NM_018103chr11275 ------
NM_018105chr83910 891 174 ------
NM_018112chr92768 176 --1859 --
NM_018117chr102559 182 --1693 --
NM_018120chr831003 557 84 --1457 --
NM_018121chr1022340 982 12295 32773 2656 2128 12602
NM_018124chr1631938 1608 723 --1127 --
NM_018126chr431467 1459 1227 11254 ----
NM_018131chr101846 --1260 194
NM_018133chr361931 1806 1652 1471 870 164 11908 ----
NM_018137chr1--11425 ----
NM_018142chr83237 211 202 ------
NM_018150chr11910 192 --182
NM_018151chr24812 754 165 105 1698 1613 --
NM_018155chr373379 2723 2682 2555 2155 1247 947 ------
NM_018156chr152841 2466 1833 418 323 12195 12218 --
NM_018157chr1253238 2686 2280 586 522 --12233 1885
NM_018159chrX61699 1340 1166 605 384 185 --1644 1311
NM_018176chr431548 1117 170 ------
NM_018177chr43308 60 37 ------
NM_018181chr1871730 1359 1269 368 245 199 72 --31300 1263 303 11904
NM_018182chr171668 --11411 --
NM_018184chr322023 721 31623 1534 313 1616 --
NM_018192chr3--1901 11046 173
NM_018200chr1522556 542 ----12092
NM_018206chr16----1766 1596
NM_018208chr111160 ------
NM_018211chr141941 1856 1660 423 11691 ----
NM_018214chr651225 1109 906 468 233 ------
NM_018227chr442457 2297 2203 840 ----12142
NM_018237chr10----1224 --
NM_018241chr41159 ------
NM_018243chr473684 3585 2808 1284 910 544 44 --2496 408 --
NM_018247chr632650 2421 2166 ----11023
NM_018254chr112147 --12159 22140 772
NM_018257chr2042546 2286 2199 1677 1220 ----
NM_018263chr22510 67 --22462 234 --
NM_018266chr32249 103 --1941 --
NM_018270chr203808 793 610 ------
NM_018287chr1011225 --2240 111 --
NM_018293chr322037 815 --22969 2887 21903 1154
NM_018299chr843268 2645 2433 978 1595 --1853
NM_018307chr173719 245 121 ------
NM_018312chr111215 41452 429 190 159 11603 --
NM_018313chr332690 778 110 --11648 1222
NM_018315chr421293 259 ----1523
NM_018317chr4------197
NM_018318chr121332 --1949 --
NM_018321chr5149 ------
NM_018323chr441793 1711 232 221 --1579 --
NM_018325chr921576 1454 11601 ----
NM_018328chr2--2423 372 ----
NM_018330chr101353 --11440 --
NM_018332chr1611355 --1198 --
NM_018335chr141488 1150 ----
NM_018348chr1621079 1038 --3326 115 58 --
NM_018351chr1274679 4283 1875 878 699 503 377 11158 24658 4215 --
NM_018361chr841062 600 338 303 1188 23280 1174 1642
NM_018362chr1184066 3911 3340 2606 2495 1553 1398 31 --21299 526 --
NM_018364chr174069 4029 3914 3413 3178 2981 609 12675 13389 13877
NM_018365chr151115 --3241 191 37 --
NM_018367chr1142219 957 766 355 ----12439
NM_018370chr1242284 2173 1536 415 ----1305
NM_018371chr841318 350 208 46 11591 11533 --
NM_018372chr11568 1130 ----
NM_018373chr1466048 6040 5586 5157 3976 1639 16228 16128 --
NM_018374chr755278 5246 1787 976 610 --1190 24378 1126
NM_018375chr1451611 1477 760 733 250 21783 103 ----
NM_018383chr241401 671 621 370 ------
NM_018387chr92515 115 ------
NM_018394chr351606 1548 370 303 108 1595 --1146
NM_018403chr354104 4042 3909 3722 1254 --13122 --
NM_018409chr41167 11020 --188
NM_018412chr71162 ------
NM_018413chr12188 ------
NM_018416chr1222074 2017 --32626 2566 934 --
NM_018425chr1012259 ----1441
NM_018429chr552263 1987 764 687 208 ------
NM_018433chr2----1579 --
NM_018434chr51146 ------
NM_018439chr1852613 2556 2113 988 387 ------
NM_018440chr897994 7802 6766 6491 3091 2911 2431 2119 2010 1592 ----
NM_018442chr1142 --1359 --
NM_018444chr842095 731 431 155 ------
NM_018445chr152469 223 ------
NM_018452chr6_random21369 282 ------
NM_018454chr15155 ------
NM_018457chr123443 378 74 ------
NM_018464chr103358 350 283 ------
NM_018469chr1741498 1459 1261 417 ------
NM_018471chr21403 ------
NM_018475chr42167 104 ------
NM_018482chr852073 1913 1670 1008 313 1864 --12274
NM_018486chrX1374 ------
NM_018489chr132346 2293 1908 12334 ----
NM_018490chr1141870 1654 1610 1588 11557 11535 --
NM_018553chr1741335 1246 1231 280 149 ----
NM_018557chr251491 337 291 184 57 --1610 11446
NM_018569chr421499 89 ------
NM_018584chr131196 1122 1076 1351 11066 --
NM_018638chr1235218 4347 1651 11143 11396 14974
NM_018640chr1232753 380 371 12006 ----
NM_018650chr132291 2170 2045 ----12183
NM_018652chr154863 842 813 228 ----1384
NM_018657chr3----1288 --
NM_018682chr75618 553 479 207 103 2600 91 ----
NM_018685chr72154 83 ------
NM_018686chr122241 235 ------
NM_018689chr1532621 2505 1880 12366 ----
NM_018693chr21108 ------
NM_018695chr571826 1778 1745 1660 1533 692 273 ----1126
NM_018698chrX21968 1470 1517 ----
NM_018700chr52456 241 11610 ----
NM_018704chr13846 675 145 ------
NM_018717chr422847 2352 1475 32823 2735 2382 22450 2213
NM_018724chr13428 215 157 1537 --1656
NM_018834chr53275 238 105 --1909 --
NM_018841chr123429 1063 1613 23718 2958 11578
NM_018844chr731697 705 332 1607 --1441
NM_018846chr72935 281 1835 ----
NM_018890chr72540 373 --21493 47 --
NM_018898chr532276 2101 40 ----21555 803
NM_018899chr532276 2101 40 ----21555 803
NM_018900chr532276 2101 40 ----21555 803
NM_018901chr532276 2101 40 ----21555 803
NM_018902chr532276 2101 40 ----21555 803
NM_018903chr532276 2101 40 ----21555 803
NM_018904chr532276 2101 40 ----21555 803
NM_018905chr532276 2101 40 ----21555 803
NM_018906chr532276 2101 40 ----21555 803
NM_018907chr532276 2101 40 ----21555 803
NM_018908chr532276 2101 40 ----21555 803
NM_018909chr532276 2101 40 ----21555 803
NM_018910chr532276 2101 40 ----21555 803
NM_018911chr532276 2101 40 ----21555 803
NM_018939chr51399 ----1221
NM_018945chr653598 3477 952 914 418 --1730 --
NM_018948chr121431 530 ------
NM_018953chr12------1530
NM_018955chr171139 ------
NM_018957chr221324 ------
NM_018963chr2121456 1369 1163 11238 --
NM_018970chr793093 3058 2840 2559 2503 604 451 207 141 12301 12879 --
NM_018975chr163816 151 89 ------
NM_018976chr1272604 2404 2024 1963 931 668 598 --32270 1933 443 --
NM_018977chrX11047 ------
NM_018979chr1242612 2585 2568 805 12542 12550 --
NM_018992chr1621358 636 --1661 --
NM_018993chr2071437 1430 1374 1325 1259 543 223 --11367 11465
NM_018999chr1074072 3352 3226 1534 1461 1208 67 --34474 3987 664 11709
NM_019001chr364723 4665 3742 3712 847 263 --21081 619 --
NM_019003chrX150 ------
NM_019004chr742241 2160 2090 1677 12019 32303 1998 193 11561
NM_019006chr151103 --1507 --
NM_019018chr51622 ------
NM_019024chr22101 22 ------
NM_019027chr442153 368 277 259 11003 --11018
NM_019028chr111455 ------
NM_019035chr431652 1276 101 --1207 --
NM_019042chr75826 816 160 123 107 11120 --1171
NM_019045chrX1843 ------
NM_019049chr1173 --1111 --
NM_019050chr452188 1900 1728 1710 684 ------
NM_019053chr101160 ------
NM_019071chr7----1271 --
NM_019074chr153999 919 72 ------
NM_019084chr10167 --1729 1905
NM_019091chr22869 186 --11164 --
NM_019094chr1273188 2949 2699 2519 1404 1170 813 --22819 133 --
NM_019096chr61891 11099 ----
NM_019114chr951603 843 492 374 358 ------
NM_019116chr1653605 3210 2961 1357 465 --13708 --
NM_019117chrX23458 138 11347 21360 992 --
NM_019555chr341796 1679 593 565 --157 --
NM_019558chr2--1329 ----
NM_019590chr1041135 1090 1074 349 1552 11174 11057
NM_019593chr2052425 1232 958 883 806 2783 711 33156 2495 445 --
NM_019596chr2152762 2123 1847 713 46 --21073 980 --
NM_019597chrX2748 683 --1206 --
NM_019600chr152638 45 --1202 --
NM_019605chr1180 --1506 190
NM_019610chr132187 1710 737 --11950 --
NM_019842chr62149 55 ------
NM_019843chr221358 2494 459 ----
NM_019852chr141108 ----174
NM_019857chrX21735 1681 ----1678
NM_019859chr1031625 1174 468 21491 145 --1296
NM_019860chr1031673 1222 516 21539 193 --1344
NM_019862chr1631749 1718 1664 ------
NM_019891chr111265 ------
NM_019898chr1631749 1718 1664 ------
NM_019899chr1631749 1718 1664 ------
NM_019900chr1631749 1718 1664 ------
NM_019903chr1041793 1206 750 736 146 --1681
NM_020066chr14852 805 768 228 1119 ----
NM_020116chr441779 1396 566 49 ------
NM_020120chr2----1201 --
NM_020122chr244931 3737 952 385 15944 25973 931 --
NM_020123chr1041584 1306 1179 1075 161 ----
NM_020132chr2145115 4188 3752 3473 14056 --14454
NM_020141chr121900 904 --11887 --
NM_020150chr10--11819 ----
NM_020157chr20------11019
NM_020159chr431214 322 282 11525 ----
NM_020168chr15----11355 1246
NM_020177chr543060 2234 1198 503 1476 23396 2297 --
NM_020178chr171926 1217 1479 1414
NM_020180chr1811156 11000 ----
NM_020182chr2053441 3200 3105 2542 456 --1617 22384 366
NM_020184chr232205 2138 1615 11774 --12190
NM_020190chr11448 --2464 23 --
NM_020193chr111437 1913 11340 --
NM_020194chr23251 158 58 1539 3609 436 243 --
NM_020198chr1731572 1291 1146 1457 ----
NM_020205chr122274 801 ----12470
NM_020214chr151238 ------
NM_020228chr1132590 2008 85 12505 12293 --
NM_020231chr32632 569 ------
NM_020232chr18------1186
NM_020240chr541108 1098 664 244 ----12674
NM_020242chr31453 ------
NM_020243chr222914 616 ------
NM_020245chr625124 4453 --34997 4615 1595 --
NM_020311chr24761 737 638 202 --1605 --
NM_020317chr12310 231 --129 --
NM_020336chr2033802 3627 348 13468 ----
NM_020337chr463165 2110 1219 992 439 219 12145 11171 11212
NM_020338chr1033658 3380 3096 ----13486
NM_020340chr672280 2272 1485 877 646 187 72 ----1222
NM_020341chr2042048 1546 444 433 --11332 --
NM_020342chr252352 700 596 105 66 12284 153 1608
NM_020346chr112516 217 2539 59 ----
NM_020357chr341184 1176 545 211 1285 ----
NM_020381chr621802 700 21947 1635 11314 --
NM_020382chr1221573 528 --1241 1253
NM_020383chr10128 ------
NM_020390chr374943 4395 3781 745 449 203 146 14778 23219 3076 11841
NM_020395chr4122 ------
NM_020403chr1351615 1373 530 258 156 ------
NM_020420chrY21324 376 --1525 11857
NM_020425chr621417 1383 --1315 --
NM_020428chr191807 11168 ----
NM_020429chr722898 1961 23083 2981 --11241
NM_020432chr71400 ----21827 687
NM_020440chr162970 2591 2472 2391 2085 654 ------
NM_020443chr177009 6642 5904 5423 5357 4339 1468 15606 ----
NM_020444chr53996 323 42 --1505 --
NM_020445chr73819 788 123 ------
NM_020449chrX1673 --1110 --
NM_020452chr122073 1351 ------
NM_020453chr441364 262 243 157 ------
NM_020455chr652549 2284 1788 384 180 ----12595
NM_020456chr1332306 1800 747 ------
NM_020463chr231468 1430 1336 ------
NM_020466chr653982 3452 3245 1704 51 13157 ----
NM_020473chrX41756 1377 195 36 --21860 1413 --
NM_020474chr1821496 1290 1347 11870 --
NM_020529chr141189 ----142
NM_020546chr542440 628 588 192 --12100 --
NM_020630chr101102 --1119 --
NM_020640chr311789 162 12306 --
NM_020645chr111657 ------
NM_020647chr81723 --11524 --
NM_020651chr261803 1292 615 608 529 319 --1105 --
NM_020654chr331538 440 307 ----11477
NM_020673chr20117652 7507 7376 7133 6136 5206 2864 2376 2140 328 303 11265 ----
NM_020689chr2041540 1353 625 555 21690 1520 11698 11079
NM_020693chr111484 ----1167
NM_020697chr811299 --2236 202 --
NM_020699chr175400 4320 4044 3627 3306 936 467 13542 14022 15181
NM_020711chr242274 2239 2082 459 ------
NM_020718chr16116470 6104 5516 5070 4468 4166 1861 1324 1261 960 539 36352 604 290 46128 5374 858 94 11705
NM_020724chr492289 2201 2000 1771 1721 926 500 454 400 12508 ----
NM_020726chr53547 207 88 ------
NM_020727chr2173982 3498 2792 1310 770 571 447 --24049 2879 13167
NM_020732chr621218 325 ------
NM_020734chr1263363 2749 2669 2062 503 447 12084 21065 636 1339
NM_020738chr241787 1628 367 205 --11528 --
NM_020742chrX62663 1897 1756 1016 891 614 1959 ----
NM_020747chr52260 128 ------
NM_020748chr1761811 1642 1591 1349 589 503 ------
NM_020750chr641475 1408 83 58 ------
NM_020752chr1042252 638 572 358 --1855 --
NM_020754chr31502 ------
NM_020760chr231763 777 586 --11987 11257
NM_020762chr123715 183 176 1301 ----
NM_020766chrX53025 1516 892 801 421 23340 2860 ----
NM_020769chrX1976 ------
NM_020770chr121043 884 ----1497
NM_020771chr621523 1095 --1408 --
NM_020772chr17118645 8139 7895 7660 7100 6831 6452 6102 5637 5331 1295 --1591 17126
NM_020774chr18105329 4120 2158 1613 1569 1436 1300 933 314 295 --24933 610 13888
NM_020779chr262659 2332 2066 1022 708 97 12907 1940 1137
NM_020783chr1882419 2405 2053 1987 1485 700 540 468 --1916 --
NM_020791chr1721080 139 ----11019
NM_020794chr131569 1525 1384 ------
NM_020800chr311404 ----1441
NM_020801chr542673 2528 890 660 ----1327
NM_020804chr621035 171 ----12602
NM_020805chr1821522 1512 ----21917 1749
NM_020806chr14--2729 693 ----
NM_020808chr121075 749 21009 838 --1864
NM_020809chr1142152 1510 700 79 --22211 1613 --
NM_020810chr143330 107 58 1717 1703 --
NM_020818chr141376 ------
NM_020819chr611155 11170 11124 --
NM_020825chr1631131 945 804 11010 13706 --
NM_020834chr141454 ------
NM_020839chr331143 998 592 1530 ----
NM_020841chr1264006 3956 2647 656 514 322 --13649 --
NM_020850chr1623287 2009 --13120 --
NM_020854chr182108 62 --1143 11579
NM_020856chr1941462 1423 1127 141 --21169 412 11008
NM_020858chr1542143 2118 1960 644 1419 ----
NM_020859chr43777 576 233 --12576 23108 1536
NM_020866chr1331009 828 252 --11106 --
NM_020868chr21207 --1254 1354
NM_020870chr432139 2117 225 ------
NM_020871chrX42494 686 627 559 ------
NM_020873chr3188 ------
NM_020899chr1712315 --11715 11009
NM_020909chr294049 3406 3302 3003 1636 1580 1089 437 96 --11437 34156 2892 1623
NM_020917chr1923369 580 --12788 12678
NM_020918chr1033430 3259 3054 13517 22811 1432 --
NM_020921chr1443640 3569 2708 642 12880 ----
NM_020922chrX31479 756 189 ----11870
NM_020935chr284542 4105 3801 3619 3409 2874 1616 586 ------
NM_020937chr142322 86 ------
NM_020940chr1052717 2337 2170 2034 1144 22554 226 ----
NM_020948chr1103460 3106 3077 2911 2448 2361 2268 671 583 160 1759 22692 1013 --
NM_020960chr924762 4747 --1161 --
NM_020973chr42242 181 ------
NM_020975chr1022030 1980 ------
NM_020981chr21108 ------
NM_020987chr1011226 ------
NM_020988chr1631255 252 93 ------
NM_020993chr1231968 1818 606 12785 --12835
NM_021003chr142280 187 1301 1704 --
NM_021005chr155919 908 900 841 257 --1428 --
NM_021007chr222224 468 11752 11591 --
NM_021009chr12162 ------
NM_021032chr351886 1653 514 500 453 --11440 --
NM_021033chr1353426 3379 2921 917 898 1317 11321 --
NM_021038chr343191 2159 1080 145 1739 12450 1213
NM_021069chr421387 785 --2676 436 31546 1523 1406
NM_021097chr222761 222 11004 22685 923 --
NM_021101chr352524 1796 1721 617 229 ------
NM_021103chr21216 ------
NM_021109chrX183 ------
NM_021109chrX183 ------
NM_021110chr82781 81 ----1739
NM_021111chr93916 408 78 --1550 --
NM_021116chr798874 7474 6487 6479 5521 3531 2747 1720 1082 38552 8192 5699 39065 8284 6599 --
NM_021129chr10197 ------
NM_021136chr143663 530 162 --1717 --
NM_021140chrX3400 237 77 1807 ----
NM_021144chr9--1341 ----
NM_021148chr741833 514 329 314 2348 108 32245 2120 358 --
NM_021151chr711072 ------
NM_021155chr1941140 880 740 408 ------
NM_021159chr421287 676 11700 ----
NM_021163chr742510 2361 956 753 ----23820 3664
NM_021168chr16------21623 329
NM_021180chr11778 ------
NM_021183chrX72563 2535 2492 2274 1735 644 478 --11878 159
NM_021189chr12935 262 177 1164 --
NM_021190chr131114 1074 871 ------
NM_021191chr1242021 1806 602 180 22388 291 11794 --
NM_021194chr11133 ------
NM_021202chr2012473 --12181 --
NM_021205chr112875 ------
NM_021215chr2032381 594 218 --133 --
NM_021222chr111425 --11447 --
NM_021237chr31233 ------
NM_021238chr1212016 --12051 11859
NM_021239chr1441049 340 331 115 ------
NM_021240chr92473 169 ------
NM_021242chrX1744 1835 ----
NM_021252chr1062015 1918 1904 1336 191 134 127 --1100
NM_021255chr1494071 4014 2658 1067 748 312 241 183 81 ----11413
NM_021260chr141237 ------
NM_021572chr63867 326 100 --2420 300 125
NM_021574chr222998 911 ------
NM_021619chr931099 1065 131 --11274 --
NM_021622chr1052026 2007 1956 1820 766 ----1565
NM_021627chr341194 1112 370 197 ----11100
NM_021629chr3114782 4565 3719 2045 1433 1107 1097 826 389 356 91 14268 24513 327 35067 4898 1020
NM_021639chr1----1759 --
NM_021643chr211168 ------
NM_021644chr102931 79 1185 ----
NM_021647chr484534 3467 3175 2931 1893 1863 1670 423 --13688 14770
NM_021648chr612217 --1305 --
NM_021724chr17--138 ----
NM_021738chr101169 --1620 --
NM_021785chrX2239 23 1230 1366 --
NM_021803chr4167 ------
NM_021813chr625586 861 ----14562
NM_021814chr631594 489 479 --1597 21444 385
NM_021818chr14129 ------
NM_021911chr565442 5081 4517 4481 4003 1902 23648 55 15238 14203
NM_021912chr1542568 1617 1507 264 ----11015
NM_021914chr1442058 1524 887 517 --11830 1969
NM_021935chr32937 144 --1973 --
NM_021940chr611570 --11143 1314
NM_021943chr6186 ------
NM_021945chr643557 3539 1382 561 --1652 --
NM_021946chrX1464 11456 ----
NM_021949chrX52665 2333 2009 744 449 --11020 --
NM_021950chr1132234 2005 597 --52227 1442 673 441 126 --
NM_021951chr93687 632 162 --180 --
NM_021954chr1363256 3204 3153 2360 2259 563 13378 ----
NM_021956chr621200 1186 ------
NM_021958chr11328 ------
NM_021960chr141900 782 687 100 ------
NM_021961chr11227469 7450 7402 7292 7262 7061 6942 6739 6262 6206 5955 5058 4926 4777 4611 4574 4524 2443 1615 838 787 512 --26314 657 --
NM_021964chr385913 5428 4966 4648 2310 1292 750 393 46514 4865 1165 322 1559 1743
NM_021970chr41532 ----1520
NM_021977chr631456 462 181 33861 3256 394 ----
NM_021979chr141419 ----1297
NM_021984chrX31173 1068 402 ------
NM_021987chrX31173 1068 402 ------
NM_021990chrX31173 1068 402 ------
NM_021998chrX31530 469 124 --11326 --
NM_021999chr131599 ------
NM_022037chr22936 676 1307 21002 354 1920
NM_022044chr22180 ------
NM_022048chr15116260 6166 5914 5711 5247 4912 4782 4474 4087 750 51 --26156 1954 --
NM_022051chr13599 460 144 --1178 --
NM_022060chr1421305 304 1241 11352 --
NM_022073chr1451565 1456 1220 331 120 ------
NM_022080chr2032430 2143 2105 2958 104 2669 373 12568
NM_022114chr164627 4619 3848 1670 674 581 --21688 555 --
NM_022118chr13182 --1185 --
NM_022121chr631191 974 278 ------
NM_022130chr521129 1078 --2148 86 --
NM_022137chr1432071 1896 547 --2841 130 1378
NM_022138chr61128 --2105 98 --
NM_022143chr721581 465 --1516 165
NM_022169chr112412 234 ------
NM_022173chr22936 676 1307 21002 354 1920
NM_022351chr833459 1334 387 11424 2820 519 --
NM_022353chr21196 ----1500
NM_022374chr21198 1141 --1354
NM_022456chr12117314 6862 6104 5521 5378 5103 4991 4738 4669 1314 118 13076 ----
NM_022457chr1125 ------
NM_022458chr752582 1940 1140 1039 495 23189 672 --32696 1215 956
NM_022459chr1365388 4788 4689 2137 1564 1177 11521 25035 1882 16132
NM_022465chr1252995 2848 2689 590 95 --13056 12506
NM_022474chr141898 12371 22767 934 --
NM_022476chr1631061 853 295 ------
NM_022477chr2041427 521 500 175 --1422 --
NM_022482chr2071820 1806 852 791 592 566 148 ------
NM_022494chr10--156 ----
NM_022496chr12----1454 --
NM_022497chr323652 693 12455 1122 --
NM_022552chr211001 ------
NM_022566chr153598 507 424 ------
NM_022574chr722109 1332 1673 11557 1546
NM_022648chr284625 4504 2839 1592 1454 1303 676 408 14582 ----
NM_022652chr1221014 818 --1362 1414
NM_022658chr1231343 1172 1043 ------
NM_022659chr81368 ------
NM_022716chr143028 2074 2016 1018 12799 13168 --
NM_022719chr2233466 2728 525 11503 13186 --
NM_022726chr641700 1624 1541 1367 1475 --11519
NM_022730chr2------11041
NM_022737chr1911313 ------
NM_022745chr152867 2196 1026 724 315 --1750 1295
NM_022753chr11177 ----1688
NM_022757chr31768 1121 --1986
NM_022758chr623248 662 ------
NM_022763chr353136 2097 1096 801 316 12966 --12833
NM_022771chr1221015 173 ------
NM_022776chr331405 366 77 1103 --1313
NM_022778chr111476 ------
NM_022780chr221303 27 --2491 263 --
NM_022781chr932417 2273 1007 1626 22455 130 13228
NM_022782chr12----283 40 --
NM_022802chr1041256 1006 345 97 --1662 --
NM_022818chr1611168 --21344 267 --
NM_022824chr511593 158 --1143
NM_022828chr531681 1485 210 ------
NM_022832chr4--1980 11832 --
NM_022838chrX1324 ------
NM_022841chr1552689 2585 1988 766 671 22270 1919 --22496 2455
NM_022843chr1341124 394 375 259 1408 ----
NM_022845chr1622154 1495 21733 1688 3527 402 164 --
NM_022893chr242855 2746 2431 290 12555 --11941
NM_022894chr231683 1262 1227 1641 1258 --
NM_022898chr1453876 3651 3067 2991 245 --44792 4486 4480 1399 --
NM_022900chr731108 278 240 11072 ----
NM_022902chr5161 ----1395
NM_022912chr21406 22460 422 12223 --
NM_022970chr1031363 452 320 11068 ----
NM_022977chrX72292 2198 1990 1628 986 356 287 2894 562 42658 2567 1879 1038 1183
NM_023000chr1431669 1304 298 ----21402 1346
NM_023001chr1431669 1304 298 ----21402 1346
NM_023009chr1----1671 --
NM_023012chr123138 103 92 ------
NM_023016chr222099 484 12330 22014 490 12774
NM_023037chr1321042 810 1295 ----
NM_023072chr1911032 ------
NM_023074chr191302 1937 ----
NM_023105chr832165 1524 1516 --11679 --
NM_023106chr832165 1524 1516 --11679 --
NM_023110chr832165 1524 1516 --11679 --
NM_023111chr832165 1524 1516 --11679 --
NM_023923chr153755 3702 2477 537 105 --1354 --
NM_023927chr531126 905 128 ------
NM_023929chr8--22219 2072 1421 1176
NM_023948chr7----1153 --
NM_024007chr583125 2977 2544 2337 1087 955 637 212 22952 2134 1536 --
NM_024015chr1711010 1894 ----
NM_024019chr451044 768 759 317 161 ------
NM_024052chr1743107 2221 2125 986 ------
NM_024054chr72340 333 ------
NM_024061chr71570 ------
NM_024069chr19----1683 --
NM_024071chr141611 --1562 --
NM_024091chr5293 39 ----1218
NM_024099chr111292 ------
NM_024117chr911355 11186 --11239
NM_024292chr19176 ------
NM_024293chr21208 ------
NM_024294chr623248 662 ------
NM_024295chr852050 2029 1686 809 416 21702 377 ----
NM_024297chr17------1548
NM_024312chr1221286 648 --2408 380 11575
NM_024320chr174887 661 172 150 ------
NM_024324chr221198 ------
NM_024325chr2021070 422 ------
NM_024330chr11114 ------
NM_024334chr331867 1835 658 11162 ----
NM_024336chr161328 ------
NM_024345chr975351 4519 2292 1776 1312 694 213 1815 21965 274 --
NM_024421chr183446 281 269 --1362 --
NM_024424chr111366 1788 ----
NM_024425chr111366 1788 ----
NM_024426chr111366 1788 ----
NM_024429chr72899 190 ------
NM_024491chr33602 58 51 ------
NM_024494chr13582 286 67 ------
NM_024511chr452259 1392 1165 792 487 ------
NM_024519chr161273 ------
NM_024524chr352883 2666 2660 2529 2100 13168 --12942
NM_024529chr111084 ------
NM_024539chrX21234 1189 11198 11084 --
NM_024541chr101725 ------
NM_024546chr1321227 895 --1938 --
NM_024548chr331167 262 124 ------
NM_024551chr122558 321 ----1603
NM_024551chr122558 321 ----1603
NM_024556chr11----1385 --
NM_024561chr13--11200 --11423
NM_024563chr511788 ----11713
NM_024567chr8------1170
NM_024569chr142017 1155 854 281 --2712 336 --
NM_024574chr41111 1339 ----
NM_024581chr61241 ------
NM_024582chr431102 929 227 --1391 --
NM_024594chr541817 1763 653 190 ------
NM_024595chr13944 383 64 --1101 --
NM_024610chr32324 106 ----1100
NM_024612chr1711086 --1362 11118
NM_024613chr831195 1154 210 --11350 --
NM_024624chr251333 647 530 486 349 ----1296
NM_024628chr331197 1083 325 11118 ----
NM_024631chr111228 ------
NM_024639chr632435 2320 2028 --1579 --
NM_024640chr14975 208 182 83 ------
NM_024646chr163894 3608 3073 2684 2545 352 --33553 3229 299 --
NM_024652chr151299 ----1821
NM_024659chr21899 --2703 370 --
NM_024665chr374254 4130 1519 1299 929 417 162 23684 3633 24673 3342 14473
NM_024674chr142254 1241 745 737 ------
NM_024680chr114507 498 461 198 ----1397
NM_024692chr241523 1505 1405 291 --11233 1321
NM_024700chr111201 --1794 1369
NM_024708chr15122 --139 --
NM_024721chr84908 665 302 210 11816 ----
NM_024725chr11------2826 89
NM_024740chr1164122 3935 3099 1524 219 92 --13690 --
NM_024744chr272222 2042 930 890 587 387 201 --1616 --
NM_024745chr162927 147 1158 --2448 43
NM_024749chr12788 513 12024 ----
NM_024751chr41448 ------
NM_024755chr153887 323 297 --1658 --
NM_024762chr193837 640 170 ------
NM_024769chr1141114 391 342 128 ------
NM_024770chr276006 4629 2267 1594 879 332 107 25681 1775 24826 4463 --
NM_024772chr12588 202 1427 ----
NM_024779chr121292 ------
NM_024811chr11146 ------
NM_024814chr71276 ------
NM_024824chr1431407 407 166 --11585 --
NM_024831chr83699 660 221 ------
NM_024834chr1031331 620 292 1595 ----
NM_024835chr171294 ------
NM_024837chr1541915 1904 640 501 ------
NM_024841chr1151999 951 927 200 37 1639 --1938
NM_024857chr173243 122 25 ------
NM_024881chr1972722 2422 1484 1023 940 919 295 --12590 --
NM_024896chr951766 1750 1677 514 81 12020 ----
NM_024899chr182455 129 158 ----
NM_024900chr442319 2070 1891 234 2146 86 ----
NM_024900chr442319 2070 1891 234 2146 86 ----
NM_024913chr711318 ------
NM_024915chr812009 2638 577 21864 971 --
NM_024930chr552830 2442 1838 781 84 32220 997 642 ----
NM_024941chr531168 365 65 --11397 --
NM_024944chr21131 ----1412
NM_024947chr399471 8593 8221 7470 6983 2946 2851 1371 1216 --39245 2825 1313 1645
NM_024949chr454412 4301 835 286 165 --1803 --
NM_024953chr1242626 2615 2582 2326 ------
NM_024969chr22620 574 1173 ----
NM_024979chr1311206 ------
NM_024989chr2147776 7369 5696 5372 5359 5222 5171 5051 2347 1450 1378 825 344 148 15848 1906 27933 6252
NM_024993chr21268 ------
NM_025027chr19--129 1397 --
NM_025054chr884159 3867 3398 3057 1323 1131 270 97 23531 1670 --32985 1683 1296
NM_025074chr473119 3048 2849 2291 2177 2146 555 12258 --12920
NM_025076chr21196 137 ----
NM_025106chr1--21877 1732 ----
NM_025107chr622006 239 ------
NM_025133chr22396 327 ----1266
NM_025134chr1662520 2444 1826 1817 1675 309 --1156 --
NM_025135chr18--