TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-19a-5p
miRNA Sequence: AGUUUUGCAUAGUUGCACUACA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr591338 1300 1284 1267 818 360 320 307 128 2384 229 ----
NM_000038chr521379 409 1645 --1668
NM_000051chr1193375 3097 3031 2962 2237 2224 1251 666 474 --22772 513 --
NM_000052chrX43183 934 771 150 63441 2964 476 462 403 80 ----
NM_000081chr141730 1686 592 146 31320 386 30 ----
NM_000084chrX126891 6432 5577 5085 1931 1905 1020 972 963 859 734 336 56812 5796 4703 4652 78 26738 5728 12237
NM_000090chr25757 348 234 118 96 1743 ----
NM_000092chr2104519 3843 3557 3454 3171 1790 1743 1395 534 473 31195 976 691 23338 522 11672
NM_000093chr962328 2307 2244 2174 785 474 21878 921 ----
NM_000109chrX52180 2075 496 312 83 32194 888 458 ----
NM_000110chr131186 841 157 2140 100 ----
NM_000129chr621231 73 1365 21264 520 --
NM_000138chr1532587 2113 1986 52660 2283 895 181 151 11683 --
NM_000161chr1471922 1843 1799 1636 1429 1256 254 11248 ----
NM_000163chr5102174 1907 878 872 706 493 485 346 143 42 176 --1514
NM_000168chr743309 3076 1133 1121 32713 2085 1333 ----
NM_000176chr5113685 3677 3224 2964 2496 2455 1408 1141 972 895 164 11352 33800 2910 1270 --
NM_000208chr19144748 4636 4615 4349 3476 3417 3339 2964 1759 953 898 678 552 389 34465 1456 431 ----
NM_000210chr242056 1449 619 380 32281 1743 782 --11773
NM_000214chr2041677 544 445 201 21371 665 ----
NM_000217chr12144952 4911 4569 4309 4166 3760 3278 1967 1724 837 804 502 297 256 74889 4086 1094 598 373 204 64 24669 816 1427
NM_000245chr73254 177 100 4883 868 433 399 11393 --
NM_000248chr3112743 2646 2638 2597 2177 1178 1135 786 633 565 276 12882 ----
NM_000252chrX41162 452 261 73 11183 ----
NM_000253chr43693 324 125 21035 932 ----
NM_000254chr193009 2797 2756 2270 2013 1908 1033 565 425 2944 302 22717 551 --
NM_000259chr15146114 5889 5834 5444 5431 5318 5281 4917 4512 3976 3947 2049 1400 811 26286 3937 11146 --
NM_000267chr17113499 3389 3066 2995 2728 2286 2263 839 709 519 256 32150 1345 247 1996 --
NM_000274chr102583 61 ------
NM_000276chrX4899 250 126 102 11831 12198 11618
NM_000278chr10----11515 --
NM_000288chr61357 ------
NM_000321chr13101735 1453 1234 1172 1150 702 644 511 489 269 11250 ----
NM_000332chr6147134 7123 6920 6739 5707 5347 5235 5096 4340 1900 1823 1292 1276 978 17107 21637 519 --
NM_000337chr5166334 6085 5863 5334 5207 5147 4982 4891 4643 4181 2319 2307 1958 1817 929 589 36250 1043 759 36095 2421 944 14051
NM_000351chrX94305 3830 3805 3789 3650 3317 2922 1581 322 53408 3396 1447 593 337 42775 1350 779 37 --
NM_000368chr9133932 3829 3341 3268 3246 3136 1794 1625 1459 1211 1016 984 74 148 43469 795 478 156 --
NM_000393chr22690 269 21849 1379 --21526 838
NM_000399chr104438 227 175 117 --21145 451 --
NM_000408chr253222 2344 818 346 135 22732 1225 ----
NM_000415chr121874 2811 234 --11006
NM_000430chr1763811 3329 3299 2950 1207 269 --12466 13737
NM_000439chr542084 1935 548 376 42197 2068 780 212 1338 --
NM_000441chr731969 838 619 284 42 31911 1735 183 --
NM_000452chr1391914 1843 1635 1576 773 606 345 328 91 2630 268 --11903
NM_000459chr91841 ------
NM_000461chr374597 4519 4495 3985 1704 357 310 24111 3120 24055 325 --
NM_000462chr1541632 1600 669 400 21207 24 1596 --
NM_000474chr71603 --2494 154 --
NM_000488chr1155 ------
NM_000489chrX83112 2635 2142 1282 1200 969 753 80 --21378 977 13205
NM_000493chr651000 965 897 177 70 1832 ----
NM_000508chr44853 673 365 342 1655 ----
NM_000522chr74385 186 48 21 1269 --1500
NM_000553chr82560 551 1637 ----
NM_000555chrX157865 7186 7093 6567 6501 5424 5224 4897 2491 2150 1983 1718 1457 1076 936 27391 2057 26455 258 16834
NM_000586chr4--2201 26 1256 --
NM_000609chr1072876 2601 1999 1171 841 718 699 11186 1436 1168
NM_000610chr1162462 2021 1165 1017 228 182 --22779 2649 12490
NM_000612chr1163414 2489 782 571 348 224 2302 156 13803 1480
NM_000615chr1172914 2566 2451 2254 775 551 23 41994 869 175 32 1498 --
NM_000618chr12196232 6158 6000 5911 5733 5709 4794 4533 4459 4155 2537 2405 2000 1858 1150 1045 945 642 193 56151 4757 4093 1573 1561 44644 1767 1290 883 1967
NM_000618chr12196232 6158 6000 5911 5733 5709 4794 4533 4459 4155 2537 2405 2000 1858 1150 1045 945 642 193 56151 4757 4093 1573 1561 44644 1767 1290 883 1967
NM_000627chr21234 ------
NM_000633chr18104845 4539 4098 3364 3291 3222 1883 282 92 34 13649 2982 186 24050 1484
NM_000641chr1941468 1384 1026 35 11440 11329 178
NM_000663chr1662638 2628 2479 2111 2043 545 --22884 2211 --
NM_000685chr33852 736 49 2578 188 1197 --
NM_000685chr33852 736 49 2578 188 1197 --
NM_000686chrX31247 1024 373 1407 --11568
NM_000688chr31111 ------
NM_000701chr11253 ------
NM_000719chr12145912 5875 5775 5730 5484 4965 4851 4272 1924 1821 1621 1457 1401 1327 14603 26271 4436 16156
NM_000793chr1485042 4624 4394 3622 1837 720 681 217 34720 3836 2004 --24265 1336
NM_000806chr561609 1209 542 321 225 217 ----1174
NM_000809chr4219043 8627 8348 8261 8042 7611 7396 7273 7199 7177 6183 5913 3254 2628 2614 1889 1625 1052 530 491 45 69303 9261 9089 3121 992 899 16003 27601 7456
NM_000813chr5165505 4999 4918 4894 4775 4510 4419 2253 2061 1964 1492 1446 1221 1191 793 211 53970 3682 3398 1295 560 --25424 3865
NM_000814chr15103776 3359 3032 2733 2705 2622 1689 1652 1321 544 33179 1417 1149 44173 3686 1612 936 --
NM_000824chr44967 743 721 134 3793 678 26 ----
NM_000826chr472604 2364 1681 765 692 546 361 42625 1694 327 102 ----
NM_000831chr1186109 5479 5132 5099 5034 4979 4695 4643 4535 4486 4451 4199 2521 2310 2147 1875 507 53 ----11726
NM_000838chr662675 2632 1730 1004 922 189 22206 265 1745 131
NM_000866chr381715 1556 721 586 545 536 494 196 177 --1620
NM_000868chrX52561 1993 1847 1615 570 12153 21003 541 --
NM_000875chr15116900 5961 5204 4983 4675 4477 4305 2284 1539 595 120 34787 2782 1972 16325 21625 163
NM_000877chr263010 2856 2624 2500 722 590 32834 2719 1910 2497 332 --
NM_000891chr17103504 3392 3386 3081 2444 2347 1145 1087 771 267 52835 2791 1336 529 65 2823 365 --
NM_000899chr12114282 3806 3701 3540 3531 3306 3039 2945 1428 879 492 64059 3974 3217 3191 1603 766 1851 --
NM_000901chr452541 2519 1854 511 412 --12337 11635
NM_000902chr3102982 2868 2702 2094 1001 937 737 703 597 477 43223 2269 2150 421 23066 320 --
NM_000910chr451437 646 505 248 201 1321 ----
NM_000926chr11179214 8907 8714 7744 7496 7421 7391 7063 6527 6458 2930 2726 1120 856 544 523 369 37247 6155 1596 79278 9207 8886 8707 6497 1585 448 21871 583
NM_000933chr2081680 1394 1364 1269 605 550 441 352 31498 1461 1164 1475 21715 1605
NM_000935chr331222 403 327 3382 199 115 1435 --
NM_000945chr221329 66 3561 442 407 --1435
NM_000950chrX51411 1094 863 702 384 42947 2337 1288 786 1321 22405 393
NM_000953chr1451365 1256 1083 682 649 --21519 1339 --
NM_000956chr144933 899 199 93 21140 1062 ----
NM_000959chr1113685 3100 3023 2697 2523 2492 877 864 809 417 40 12419 ----
NM_000961chr20103680 2767 2705 1327 940 837 499 403 232 217 --31516 1350 310 1624
NM_000963chr1102473 2404 1651 1556 892 877 773 755 657 581 12340 1335 --
NM_000965chr361294 841 297 284 113 63 2498 406 ----
NM_000983chr151287 1037 594 58 44 ------
NM_001001132chr2131415 411 232 1375 ----
NM_001001323chr1242270 2221 2052 146 1988 2631 452 22630 642
NM_001001331chr342577 2201 1775 996 1258 22053 1851 12250
NM_001001344chrX92591 1992 1933 1912 1851 1603 821 590 487 21040 573 1106 --
NM_001001389chr1162462 2021 1165 1017 228 182 --22779 2649 12490
NM_001001390chr1162462 2021 1165 1017 228 182 --22779 2649 12490
NM_001001391chr1162462 2021 1165 1017 228 182 --22779 2649 12490
NM_001001392chr1172508 2067 1211 1063 274 228 21 --22825 2695 12536
NM_001001395chr1252651 2534 2355 2130 859 62209 2024 2015 1755 1714 34 --12029
NM_001001419chr5115250 4718 4365 4347 3180 1482 813 726 563 478 210 41731 1691 1585 1289 1570 14455
NM_001001420chr5115250 4718 4365 4347 3180 1482 813 726 563 478 210 41731 1691 1585 1289 1570 14455
NM_001001433chr20103150 3126 3072 3044 2814 2046 1036 465 379 322 1657 1757 --
NM_001001483chr112396 136 1328 ----
NM_001001484chr1072436 2287 1801 808 664 454 37 52184 2035 2018 724 225 ----
NM_001001549chr732739 2717 361 ----11755
NM_001001550chr732739 2717 361 ----11755
NM_001001555chr732739 2717 361 ----11755
NM_001001664chr273954 3295 3062 1497 1429 375 85 22595 114 13748 --
NM_001001668chr1943761 2887 1254 73 63103 2912 1570 1094 1084 212 ----
NM_001001684chr1762397 928 806 559 411 268 ----11678
NM_001001701chr431637 1499 783 3919 852 738 1160 --
NM_001001890chr2134078 3770 3357 53960 3336 2922 1254 1119 1518 13008
NM_001001928chr22208112 7834 7725 7410 7120 6733 5572 5463 5197 3199 2879 2621 2234 2061 1525 1021 912 852 479 346 27715 6164 37778 2750 2043 1491
NM_001001933chr1--1225 1193 1163
NM_001001971chr1051078 1068 934 451 245 2894 497 ----
NM_001001974chr1032195 713 487 1216 --12054
NM_001002257chr2103002 2986 2894 2191 1335 1229 1048 1042 636 592 32782 959 846 --13489
NM_001002269chr94481 218 175 79 --1364 --
NM_001002860chr1453522 3480 3157 1868 905 23772 1332 34584 4481 928 13589
NM_001002909chr1732245 2165 799 1363 ----
NM_001003407chr10104703 4108 3882 3659 3426 3206 1754 908 803 687 2221 143 24463 590 --
NM_001003408chr10104703 4108 3882 3659 3426 3206 1754 908 803 687 2221 143 24463 590 --
NM_001003652chr18187962 7414 7248 7068 7047 7031 7015 6799 5807 5441 5303 3477 2504 2243 2056 2035 1426 262 57579 6580 5267 1812 771 --11171
NM_001003674chr18167073 6461 6333 6018 5568 5529 4292 2826 2325 2048 1514 1458 1392 1229 493 300 15978 1111 --
NM_001003675chr18167073 6461 6333 6018 5568 5529 4292 2826 2325 2048 1514 1458 1392 1229 493 300 15978 1111 --
NM_001003679chr172024 1910 1693 868 833 397 193 1304 ----
NM_001003698chr681974 1944 1561 1440 1329 1316 635 276 2716 294 146 11289
NM_001003699chr681974 1944 1561 1440 1329 1316 635 276 2716 294 146 11289
NM_001003712chr12154039 4009 3738 3682 3600 3118 3073 2828 2754 2575 2550 1506 1430 772 571 1419 33663 1149 1051 21604 519
NM_001003760chr673563 3178 2423 1148 934 121 79 53587 2954 2431 1436 591 --1207
NM_001003792chr351075 930 914 889 160 2817 277 11010 --
NM_001003793chr351075 930 914 889 160 2817 277 11010 --
NM_001003800chr963711 3188 3178 2952 565 193 23789 2453 42887 1431 1156 372 --
NM_001003805chr14194 ------
NM_001003945chr961931 1286 1261 618 606 39 11889 31916 1700 1583 --
NM_001004196chr361232 1183 445 400 123 108 ------
NM_001004308chrX71397 1320 1193 1177 1126 404 184 11461 21302 272 --
NM_001004317chr693987 3004 2825 2734 1489 1072 772 468 42 34532 1058 342 11818 12900
NM_001004342chr1115724 5458 4974 4816 4438 4012 2305 1955 1710 333 211 --24181 52 15635
NM_001004346chr42952 84 2268 204 163 --
NM_001004419chr12164622 4341 3892 3673 1751 1729 1590 1295 1191 1030 743 630 391 232 222 146 11256 33749 1041 88 --
NM_001004431chr172249 214 ------
NM_001005214chr11111 ------
NM_001005375chrY71793 1478 1403 571 561 424 42 ----1641
NM_001005386chr231701 1596 548 52370 2336 1943 1000 364 ----
NM_001005404chr1784155 3573 3464 3132 3068 1792 847 444 1254 23704 1708 --
NM_001005463chr1052501 2241 2146 1998 272 12161 --11793
NM_001005473chr5136610 6184 5884 5239 5122 2239 2194 1809 1794 1689 1389 461 268 46176 6083 5992 417 1213 14373
NM_001005527chr351345 1132 290 260 87 ----1455
NM_001005743chr141293 ----3360 343 72
NM_001005744chr141293 ----3360 343 72
NM_001005745chr141293 ----3360 343 72
NM_001005785chrY71793 1478 1403 571 561 424 42 ----1641
NM_001005786chrY71793 1478 1403 571 561 424 42 ----1641
NM_001005845chr861873 1530 1369 1311 1266 150 2510 500 ----
NM_001006600chr582464 1663 986 676 588 459 213 36 21639 558 ----
NM_001006605chr121122 103 2480 335 1782 1454
NM_001006605chr121122 103 2480 335 1782 1454
NM_001006610chr165993 924 271 85 37 ------
NM_001006623chr252606 2200 1804 861 582 1929 1940 179
NM_001006624chr11256 32031 1355 153 1277 --
NM_001006636chr251003 859 829 727 40 1846 ----
NM_001006657chr273026 2971 2662 655 590 386 30 23071 142 12869 --
NM_001007023chr1485042 4624 4394 3622 1837 720 681 217 34720 3836 2004 --24265 1336
NM_001007024chr1764268 4108 3944 3604 3107 1609 --24093 123 --
NM_001007025chr1764268 4108 3944 3604 3107 1609 --24093 123 --
NM_001007075chr441094 856 206 132 ----1147
NM_001007088chrX3837 190 165 11304 --1298
NM_001007097chr9114759 4520 4479 4008 1997 1802 1120 1001 964 401 291 13616 13985 1703
NM_001007099chr12288 255 2653 551 ----
NM_001007100chr12288 255 2653 551 ----
NM_001007102chr651296 1277 1101 440 101 161 --11526
NM_001007214chr191827 1715 1440 1420 1359 1268 665 382 196 --1394 --
NM_001007226chr174591 511 430 357 1149 --1333
NM_001007227chr174591 511 430 357 1149 --1333
NM_001007228chr174591 511 430 357 1149 --1333
NM_001007229chr174591 511 430 357 1149 --1333
NM_001007230chr174591 511 430 357 1149 --1333
NM_001007237chr16871 731 626 541 466 424 32859 1054 509 1570 --
NM_001007246chr2141953 1759 1490 613 --2503 446 --
NM_001007466chr6165098 4975 4474 4432 4386 4358 4182 3727 3600 3415 1886 1531 1311 507 501 338 1522 1211 --
NM_001007559chr1832059 675 541 31589 1455 580 --21488 804
NM_001008220chr563940 3184 2874 2442 1081 950 11424 13298 13439
NM_001008239chr1843786 3113 2441 1122 43850 3755 3674 3374 2692 332 23211 1074
NM_001008392chr343182 2368 1192 902 32653 2418 241 13312 --
NM_001008408chr796426 5571 5239 2460 2300 2128 2057 495 387 11476 179 15374
NM_001008495chr862063 710 603 381 154 110 1799 --22296 675
NM_001008541chr1061884 935 582 487 256 176 21932 103 --2416 34
NM_001008541chr1061884 935 582 487 256 176 21932 103 --2416 34
NM_001008564chr1332097 1721 283 21991 1737 1776 --
NM_001008660chr1141032 993 972 410 --31326 73 55 --
NM_001008726chr1441333 389 215 96 31184 1160 323 1312 --
NM_001008738chr572615 886 759 613 598 428 285 2877 461 12436 --
NM_001008801chr1931374 402 374 1219 2361 23 1305
NM_001008925chr4123413 3239 3000 2956 2782 1359 1207 919 868 848 789 615 33298 2485 41 12695 --
NM_001009554chr4224710 4645 4404 4384 3843 3486 3192 2934 2899 1906 1791 1595 1351 1205 1158 1130 1099 1080 831 719 302 211 24242 3914 ----
NM_001009554chr4224710 4645 4404 4384 3843 3486 3192 2934 2899 1906 1791 1595 1351 1205 1158 1130 1099 1080 831 719 302 211 24242 3914 ----
NM_001009555chr441746 1397 672 145 1582 --11239
NM_001009566chr141218 1184 1000 917 21236 1052 --1367
NM_001009881chr13510 477 103 ----1131
NM_001009882chr13510 477 103 ----1131
NM_001009894chr1241675 1123 305 155 1352 --11582
NM_001009899chr3186076 5421 5306 4968 4760 4747 4649 4370 4344 4300 4222 4104 4088 2586 2514 2361 788 680 32562 2484 405 15458 --
NM_001009959chr242085 485 431 227 11775 --11918
NM_001009960chr762792 2783 2669 2597 2113 406 22368 1089 ----
NM_001009993chr264070 3015 2772 1114 1052 431 21483 1343 3869 367 352 1782
NM_001010853chr673026 2663 2510 2352 2176 2115 102 22464 2288 ----
NM_001010861chr182567 2447 2344 2324 2228 555 275 224 41820 1105 1006 289 ----
NM_001010862chrX93056 2804 2430 2088 1318 931 923 885 120 --22468 628 --
NM_001010867chr195745 5125 4702 4445 4206 2480 2438 2307 1067 35679 4847 1930 ----
NM_001010888chrX113698 3391 3352 3093 3063 3047 2985 1740 1643 778 321 44452 3723 3223 249 --11196
NM_001010891chr5126068 5544 5523 4847 4621 4436 2063 2017 1476 1183 826 74 66923 5995 5898 5766 4773 4755 --24502 1871
NM_001010895chr942109 1908 1827 714 42101 1572 1400 507 ----
NM_001010923chr65596 439 163 147 128 1556 1345 --
NM_001010927chr63587 135 73 --1436 --
NM_001010934chr72297 157 ----1188
NM_001010984chr172473 2379 2198 832 323 245 171 22609 337 22274 1643 --
NM_001010986chrX72371 2166 1825 978 364 204 168 1695 22391 2294 --
NM_001011513chr473651 3626 3620 1604 1187 887 376 33685 3391 2808 11404 --
NM_001011515chr411120 --2200 76 --
NM_001011516chr411120 --2200 76 --
NM_001011537chr352075 935 802 531 277 42109 478 238 95 --22241 1722
NM_001011666chr7106536 5296 4607 4424 2437 2199 2186 1939 966 747 65389 5311 4021 2177 1688 821 14025 16319
NM_001011708chr282943 2739 2466 1942 1822 1014 817 417 1406 ----
NM_001012267chr951571 1450 1318 1249 595 ----11480
NM_001012393chr11164455 4412 4321 4100 3981 3970 3633 3591 1844 1539 1445 1407 1062 422 359 338 63481 3223 1863 1768 1251 1111 14230 --
NM_001012398chr16--1692 193 1858
NM_001012420chr1572959 2800 2642 2581 2575 673 320 12720 12868 --
NM_001012421chr91320 1281 2849 839 --
NM_001012423chr1562800 2642 2581 2575 673 320 12720 12868 --
NM_001012512chr18135 ----1103
NM_001012513chr18146 ----1114
NM_001012716chr18--1138 --1252
NM_001012751chr1041231 759 594 70 21766 111 --11456
NM_001012754chr1382009 1976 1936 1839 1692 871 551 299 ------
NM_001012755chrX74540 4508 3766 3550 1080 440 167 1902 33813 3460 1596 21767 681
NM_001012761chr572619 2550 2492 2066 1659 82 46 1842 --22670 2295
NM_001012968chrX52405 789 438 412 273 21984 684 --22578 2052
NM_001013031chr1083477 3011 2919 2411 1371 1150 1132 67 141 --1628
NM_001013399chr661144 1137 769 443 390 255 ----1143
NM_001013415chr441323 1183 1045 66 61473 1273 1177 1157 1054 424 31147 1021 263 --
NM_001013620chr12138419 8079 7820 7472 7276 7069 5405 2626 379 312 277 173 26 57775 5972 5303 3310 544 22748 417 --
NM_001013746chr751886 1775 1463 899 648 21485 1451 3577 493 413 --
NM_001013839chr1752608 2504 788 703 339 1473 1771 --
NM_001013843chr151607 ------
NM_001014380chr13115325 5052 4517 4484 3577 1897 1861 1836 1435 409 133 65424 5096 4067 3794 1814 1121 --11077
NM_001014434chr12870 85 ----1850
NM_001014797chr10258189 7931 7868 7776 7695 7478 7132 6894 6661 6619 6560 6522 5812 5507 5414 5105 3189 2679 2623 2540 2489 2377 2317 241 148 67469 6340 5996 3095 2994 580 31782 1094 458 26852 1722
NM_001015877chrX93052 2204 2186 1943 892 804 636 314 282 22860 910 21183 693 --
NM_001015880chr1071642 1154 577 523 401 214 123 ------
NM_001015882chr94826 755 162 143 1417 ----
NM_001015887chr361731 1635 530 274 165 115 --1548 --
NM_001017368chr1772278 2153 2064 985 290 130 116 1703 1190 12101
NM_001017371chr24938 322 186 98 21392 1205 ----
NM_001017395chr363102 3037 1390 355 336 204 33308 3118 259 23344 699 --
NM_001017424chr161810 1729 1562 1255 617 499 1116 ----
NM_001017425chr161810 1729 1562 1255 617 499 1116 ----
NM_001017440chr7187574 7365 6816 6453 5818 5443 5431 3256 3164 3116 2604 2301 2242 2036 1503 1269 1122 356 37802 5902 1245 45834 5006 1861 1780 --
NM_001017923chr1431530 378 174 1414 1368 --
NM_001017926chr891807 1756 1633 1386 1141 572 468 448 233 11847 ----
NM_001017928chr31226 ------
NM_001018008chr152113 55 1205 --1477
NM_001018037chr981454 1332 1136 1057 285 274 164 65 11422 --1181
NM_001018057chr1141434 1410 1026 417 --11077 --
NM_001018064chr951702 1619 1436 805 645 22026 1613 ----
NM_001018065chr9106072 5256 4710 4150 1920 1202 1149 379 263 158 44446 2194 501 176 25074 517 --
NM_001018066chr9106072 5256 4710 4150 1920 1202 1149 379 263 158 44446 2194 501 176 25074 517 --
NM_001018067chr1134909 4595 4524 4359 4353 3758 3413 3354 2090 989 983 933 52 41929 1317 1037 651 --14373
NM_001018068chr1134909 4595 4524 4359 4353 3758 3413 3354 2090 989 983 933 52 41929 1317 1037 651 --14373
NM_001018069chr1134909 4595 4524 4359 4353 3758 3413 3354 2090 989 983 933 52 41929 1317 1037 651 --14373
NM_001018074chr5113685 3677 3224 2964 2496 2455 1408 1141 972 895 164 11352 33800 2910 1270 --
NM_001018075chr5113685 3677 3224 2964 2496 2455 1408 1141 972 895 164 11352 33800 2910 1270 --
NM_001018076chr5113685 3677 3224 2964 2496 2455 1408 1141 972 895 164 11352 33800 2910 1270 --
NM_001018077chr5113685 3677 3224 2964 2496 2455 1408 1141 972 895 164 11352 33800 2910 1270 --
NM_001018108chr1572228 2166 1948 1683 759 747 564 ----11973
NM_001020825chr531160 1152 439 --21275 385 --
NM_001023567chr1582472 2351 2192 2024 1643 640 320 155 42515 2107 1676 49 ----
NM_001024024chr146976 897 853 690 310 111 1302 127 --
NM_001024070chr146972 893 849 686 306 107 1298 123 --
NM_001024071chr146944 865 821 658 278 79 1270 ----
NM_001024094chr5113685 3677 3224 2964 2496 2455 1408 1141 972 895 164 11352 33800 2910 1270 --
NM_001024372chr852279 1754 396 124 28 22145 1534 1234 --
NM_001024647chr12127133 5858 5263 5045 2802 2474 2425 2140 1600 891 389 331 27322 5801 45868 5525 4803 823 --
NM_001024649chr552977 2818 2397 469 52 22900 110 11809 1446
NM_001024660chr391692 1573 1137 675 384 309 260 229 171 152 156 --
NM_001024680chr251636 342 172 68 44 21309 665 1701 --
NM_001024808chr1282550 2483 2344 2337 2328 484 150 102 12052 42279 1975 1884 796 1196
NM_001024847chr371959 1836 1772 1675 830 433 146 1841 --32498 587 511
NM_001024855chr391561 1533 1225 1217 730 642 480 307 32 41926 1523 200 75 11842 --
NM_001024924chr41398 166 1164 --
NM_001024948chr153200 3155 2564 1318 493 33516 664 606 ----
NM_001024956chr11164662 4600 4532 4390 4061 3953 3770 3704 1851 1320 1096 1055 999 765 744 392 35071 4727 4226 25220 4481 --
NM_001025076chr1076011 5454 5437 4056 3779 2336 321 56146 5808 5416 1211 357 31851 1040 272 --
NM_001025077chr1097369 6812 6795 5414 5137 1679 873 848 188 87504 7166 6774 4629 2569 1715 1183 625 22398 1630 --
NM_001025079chr3123721 3070 1496 1446 1437 1370 1346 1160 1015 975 922 871 43979 3078 2536 175 ----
NM_001025081chr1851454 1421 1318 213 57 11577 ----
NM_001025090chr1851454 1421 1318 213 57 11577 ----
NM_001025092chr1851454 1421 1318 213 57 11577 ----
NM_001025101chr1851454 1421 1318 213 57 11577 ----
NM_001025107chr162508 2188 984 972 518 231 21882 266 --11874
NM_001025107chr162508 2188 984 972 518 231 21882 266 --11874
NM_001025108chr2113984 3745 3605 3422 3372 3099 3082 1177 1095 756 405 21583 220 ----
NM_001025201chr21554 --1561 1174
NM_001025233chr1272547 2409 2315 1960 873 824 339 2551 356 --12333
NM_001025252chr893138 2473 2419 2299 2172 1080 870 318 154 1765 ----
NM_001025253chr893138 2473 2419 2299 2172 1080 870 318 154 1765 ----
NM_001025266chr344924 4691 4346 1181 33604 1477 1295 14251 13635
NM_001025356chr1272843 2680 2298 1945 1040 202 162 32757 1861 50 1179 --
NM_001025580chrX94331 4212 4005 3937 3066 2725 1632 1605 1590 1772 1945 11167
NM_001025780chr971335 535 462 450 293 166 71 21401 348 --11619
NM_001029863chr673121 3104 2822 2298 2278 878 29 12163 23129 1247 --
NM_001029875chr572945 2497 2093 792 438 284 51 ------
NM_001029882chr14681 256 220 191 1270 ----
NM_001029882chr14681 256 220 191 1270 ----
NM_001029884chr652173 1040 576 121 50 32522 921 95 2843 632 --
NM_001029999chr183346 335 185 125 2856 225 1289
NM_001030006chr1762715 2483 2025 746 720 349 32146 2061 1804 42322 1779 1722 1017 --
NM_001030007chr1663891 3816 3052 821 380 352 13396 1844 --
NM_001030055chr14103792 3353 3232 1798 1526 1251 1143 684 237 113 33171 1882 1258 --11654
NM_001030059chr101333 ----1324
NM_001031679chr1293238 3213 3195 3009 2443 1405 1299 1175 62 23401 2373 --1411
NM_001031680chr182558 2245 1803 1740 1724 893 499 54 11925 22430 1569 --
NM_001031689chr91110 ------
NM_001031695chr22124917 4907 4602 4440 4331 4227 3629 3452 1200 445 264 92 23864 573 14814 15012
NM_001031710chr75778 748 299 217 197 1898 ----
NM_001031716chr22990 232 --1159 --
NM_001031804chr16134319 4230 3992 3944 3932 3699 3294 3158 3051 1194 1174 669 621 43764 3482 3110 1124 ----
NM_001031806chr1781949 1836 1479 1320 1269 545 368 47 1728 ----
NM_001031812chr562105 918 798 718 709 636 21727 221 --1744
NM_001032282chr851231 437 113 64 26 ----11134
NM_001032288chr20----11442 --
NM_001032999chr20135325 4726 4543 4458 4363 4264 3527 2124 2012 733 631 613 106 1623 1864 --
NM_001033030chr31205 ------
NM_001033031chr31205 ------
NM_001033032chr31205 ------
NM_001033044chr11336 51622 1579 1484 1241 647 --11588
NM_001033045chr2154387 4344 4301 4142 3919 3338 2968 1713 1639 1513 1272 994 427 306 126 23845 1754 31484 618 450 1187
NM_001033056chr11336 51622 1579 1484 1241 647 --11588
NM_001033057chr371615 1326 564 495 481 473 466 32133 2032 1928 ----
NM_001033059chr671920 1473 1318 674 353 117 28 11371 ----
NM_001033112chr54868 772 171 78 ------
NM_001033117chr394731 4515 4344 4206 3823 3357 3069 1001 640 44911 4534 1351 696 --1276
NM_001033518chr762571 2465 1782 861 730 252 22634 1114 1278 --
NM_001033519chr762571 2465 1782 861 730 252 22634 1114 1278 --
NM_001033520chr762571 2465 1782 861 730 252 22634 1114 1278 --
NM_001033578chr8102434 2247 2104 1987 1829 1562 724 519 421 157 ----22267 34
NM_001033659chr1721552 341 11298 11526 --
NM_001033723chr852274 1955 323 290 149 196 32442 2328 2191 1528
NM_001033910chr1102224 2088 1775 759 656 423 351 196 142 42 22206 96 ----
NM_001033925chr1061583 1513 1478 1432 657 374 ------
NM_001034841chr16125446 4733 4077 3861 3378 2197 1926 1899 1843 326 100 92 43471 947 925 402 15131 11227
NM_001034850chr53535 479 282 ----1361
NM_001034954chr10102683 2320 2134 2021 529 488 409 206 147 116 12469 1581 1991
NM_001034955chr10102683 2320 2134 2021 529 488 409 206 147 116 12469 1581 1991
NM_001034956chr10102683 2320 2134 2021 529 488 409 206 147 116 12469 1581 1991
NM_001034957chr10102683 2320 2134 2021 529 488 409 206 147 116 12469 1581 1991
NM_001035chr141104 815 495 32 11150 11315 --
NM_001035003chr411176 --21032 1019 11459
NM_001035004chr411176 --21032 1019 11459
NM_001035260chr1051437 1238 497 192 115 1570 ----
NM_001037132chr762055 2019 235 211 189 143 11942 --1826
NM_001037133chr762055 2019 235 211 189 143 11942 --1826
NM_001037164chr751928 1695 1505 369 308 3731 667 269 ----
NM_001037165chr798372 7570 6511 3377 3070 2923 2917 2857 2609 1339 11764 11547
NM_001037174chr272246 2202 2196 1689 1573 724 68 22126 1399 ----
NM_001037317chr182567 2447 2344 2324 2228 555 275 224 41820 1105 1006 289 ----
NM_001037332chr562572 2182 1868 958 563 339 11909 12592 11896
NM_001037333chr562572 2182 1868 958 563 339 11909 12592 11896
NM_001037339chr141672 669 283 87 21560 255 1149 1416
NM_001037340chr141672 669 283 87 21560 255 1149 1416
NM_001037341chr141672 669 283 87 21560 255 1149 1416
NM_001037341chr141672 669 283 87 21560 255 1149 1416
NM_001037533chr11328 ------
NM_001037535chrX41351 980 570 283 2342 120 ----
NM_001037536chrX41351 980 570 283 2342 120 ----
NM_001037540chrX41351 980 570 283 2342 120 ----
NM_001037553chr21135118 5100 4979 4254 3757 3740 1732 1436 1426 404 274 131 58 --25019 1982 15178
NM_001037954chr11102741 2646 2383 2361 2321 1094 901 616 444 75 22592 115 12394 --
NM_001038493chr251579 1196 536 521 447 1511 11387 --
NM_001039091chrX21085 109 11397 1437 --
NM_001039538chr283482 3404 2530 2442 1463 996 637 173 22415 1424 --23697 606
NM_001039570chr2294431 4306 3691 3276 3203 3192 3161 1431 229 33725 1052 748 11621 13556
NM_001039571chr2294431 4306 3691 3276 3203 3192 3161 1431 229 33725 1052 748 11621 13556
NM_001039577chr174523 3606 3584 1027 912 416 244 ------
NM_001039580chr4145048 4352 4270 4160 3734 3583 3471 1945 1756 1730 1657 1357 917 65 33217 1876 480 14006 --
NM_001039585chr1123942 3357 3280 2954 2780 2749 2598 1134 1121 1066 674 297 12676 ----
NM_001039590chrX154042 3890 3821 3164 2783 1179 1146 1065 1023 926 280 236 148 87 31 63749 2484 1196 915 784 438 13037 --
NM_001039591chrX154042 3890 3821 3164 2783 1179 1146 1065 1023 926 280 236 148 87 31 63749 2484 1196 915 784 438 13037 --
NM_001039618chr11155863 5792 5742 5722 5336 4892 4563 4415 4369 4282 4104 2288 2041 1682 1376 1265 ----
NM_001039709chr20135325 4726 4543 4458 4363 4264 3527 2124 2012 733 631 613 106 1623 1864 --
NM_001039762chr1082272 2202 1815 1504 831 273 233 72 32183 2064 1720 12298 --
NM_001039840chrX116006 5982 5722 5608 4366 4185 4022 3833 1929 1493 584 33809 1953 1189 11772 --
NM_001039844chr1073050 2873 2472 2425 2200 560 532 32336 1997 1005 ----
NM_001039937chr1373657 3539 2590 1612 976 406 62 34041 3411 1276 23016 1418 11302
NM_001040100chr321093 301 3981 940 287 --11275
NM_001040101chr451466 1112 1034 277 150 ----11143
NM_001040142chr252289 2024 1597 1557 397 21689 149 --12061
NM_001040143chr252289 2024 1597 1557 397 21689 149 --12061
NM_001040152chr7104448 3565 3137 1669 1475 1186 722 713 268 179 34280 3284 1977 14020 13953
NM_001040157chr432933 2774 2614 32197 2023 485 --12234
NM_001040159chr461448 1201 985 607 506 92 21519 243 21404 312 --
NM_001040202chr452192 1821 824 190 181 32566 1833 592 --12507
NM_001040214chr692224 2096 1471 912 905 746 688 472 84 2484 123 1133 1868
NM_001040272chr9112357 2230 1975 1837 1587 683 645 604 535 522 68 32351 2302 618 22207 881 --
NM_001040284chr16145027 4799 4466 4234 3962 3856 1806 1731 1343 796 735 290 208 173 23990 184 --13755
NM_001040402chr4103211 2996 2884 2473 2236 1980 851 666 336 82 ------
NM_001040424chr2162422 2000 770 676 289 28 12059 12338 12395
NM_001040429chr13103628 3478 2947 2591 2559 2301 1297 1242 1121 680 43257 3098 2675 424 12213 13499
NM_001040440chr51224 ------
NM_001040441chr1155345 4993 4900 4573 4305 3822 3665 3389 2009 1965 1760 1513 1306 990 906 34987 4220 1586 33975 1901 1047 --
NM_001040446chr532748 2626 190 --11756 1546
NM_001040450chr15102383 2026 2005 1942 1772 948 723 656 623 49 22601 2363 12749 --
NM_001040453chr15102383 2026 2005 1942 1772 948 723 656 623 49 22601 2363 12749 --
NM_001040458chr561875 1725 1496 1445 1408 309 11522 ----
NM_001040624chr892522 2501 1899 1844 1771 691 389 320 295 ------
NM_001040625chr892522 2501 1899 1844 1771 691 389 320 295 ------
NM_001040626chr892522 2501 1899 1844 1771 691 389 320 295 ------
NM_001040627chr892522 2501 1899 1844 1771 691 389 320 295 ------
NM_001040628chr892522 2501 1899 1844 1771 691 389 320 295 ------
NM_001040629chr892522 2501 1899 1844 1771 691 389 320 295 ------
NM_001040630chr892522 2501 1899 1844 1771 691 389 320 295 ------
NM_001040633chr71858 ------
NM_001040665chr794886 4525 4140 3445 3212 1706 754 344 287 34904 3776 3155 --13870
NM_001040697chr113572 471 410 ------
NM_001040708chr83335 94 88 1235 ----
NM_001040712chr9113544 3437 2912 2876 2557 2303 2207 869 573 298 272 33423 2888 139 21425 729 --
NM_001040875chr882659 2595 2225 1995 573 219 205 171 32570 2507 2453 ----
NM_001040876chr461813 1583 1336 648 621 71 11922 11176 1548
NM_001042355chr16114416 4138 4126 3830 1587 1568 1225 1217 920 784 24 24363 2162 --15250
NM_001042357chr1041507 1354 606 258 21181 218 ----
NM_001042358chr1041507 1354 606 258 21181 218 ----
NM_001042360chr1041507 1354 606 258 21181 218 ----
NM_001042361chr1041538 1385 637 289 21212 249 ----
NM_001042363chr1041507 1354 606 258 21181 218 ----
NM_001042364chr1041538 1385 637 289 21212 249 ----
NM_001042365chr1041538 1385 637 289 21212 249 ----
NM_001042387chr1041538 1385 637 289 21212 249 ----
NM_001042389chr1041507 1354 606 258 21181 218 ----
NM_001042390chr1041507 1354 606 258 21181 218 ----
NM_001042392chr1041507 1354 606 258 21181 218 ----
NM_001042393chr1041538 1385 637 289 21212 249 ----
NM_001042395chr1041507 1354 606 258 21181 218 ----
NM_001042396chr1041538 1385 637 289 21212 249 ----
NM_001042397chr1041538 1385 637 289 21212 249 ----
NM_001042404chr141527 1520 1499 1445 31737 1701 1264 --183
NM_001042412chr16114416 4138 4126 3830 1587 1568 1225 1217 920 784 24 24363 2162 --15250
NM_001042413chr9134047 3784 3751 3435 3407 3369 3137 2906 2895 2811 2782 2614 787 64099 3844 2776 1534 1525 482 1449 --
NM_001042440chr551994 1879 1671 1300 39 1689 --22054 727
NM_001042441chr551994 1879 1671 1300 39 1689 --22054 727
NM_001042442chr551994 1879 1671 1300 39 1689 --22054 727
NM_001042443chr551994 1879 1671 1300 39 1689 --22054 727
NM_001042444chr551994 1879 1671 1300 39 1689 --22054 727
NM_001042445chr551994 1879 1671 1300 39 1689 --22054 727
NM_001042446chr551994 1879 1671 1300 39 1689 --22054 727
NM_001042453chrX31617 1611 520 1481 ----
NM_001042473chr1021893 1826 --12184 --
NM_001042481chr14102612 2336 2195 1843 776 760 597 536 188 55 1877 1272 1215
NM_001042492chr17113499 3389 3066 2995 2728 2286 2263 839 709 519 256 32150 1345 247 1996 --
NM_001042494chr1583051 2983 2935 1198 731 671 304 160 53238 3045 841 603 221 12369 --
NM_001042495chr1583051 2983 2935 1198 731 671 304 160 53238 3045 841 603 221 12369 --
NM_001042496chr1583051 2983 2935 1198 731 671 304 160 53238 3045 841 603 221 12369 --
NM_001042497chr1583051 2983 2935 1198 731 671 304 160 53238 3045 841 603 221 12369 --
NM_001042510chr881988 1975 1689 1609 1571 279 163 104 ----1775
NM_001042511chr881988 1975 1689 1609 1571 279 163 104 ----1775
NM_001042533chr3113215 2677 2423 2287 1282 1063 850 796 763 218 59 33353 2888 628 12596 --
NM_001042537chrX72541 1801 996 792 689 286 32 --1990 --
NM_001042543chr4101577 1571 1556 1305 1162 1145 975 452 425 165 1639 ----
NM_001042555chr1284814 4803 4584 4101 3047 1831 1169 341 1501 14075 23695 1551
NM_001042599chr2137096 7047 5291 3155 2873 2823 2715 2037 1851 1472 760 737 721 12755 ----
NM_001042601chr382831 2780 2640 2539 2251 983 955 552 12606 --12273
NM_001042603chr1255245 4671 4437 4174 3548 24567 4518 24166 944 --
NM_001042604chr374808 4127 3976 3641 2983 757 745 2799 626 ----
NM_001042681chr152668 2307 704 92 86 --11919 --
NM_001042682chr152668 2307 704 92 86 --11919 --
NM_001042682chr152668 2307 704 92 86 --11919 --
NM_001042749chrX41623 818 516 501 31321 1249 308 1566 --
NM_001042750chrX41623 818 516 501 31321 1249 308 1566 --
NM_001042751chrX41623 818 516 501 31321 1249 308 1566 --
NM_001043351chr162303 2238 2138 1743 1656 692 11903 --1329
NM_001044305chr651621 575 474 373 28 11131 1272 21235 1116
NM_001044385chr273530 3411 2612 1560 1032 921 691 23675 271 ----
NM_001044722chr562105 918 798 718 709 636 21727 221 --1744
NM_001044723chr562105 918 798 718 709 636 21727 221 --1744
NM_001048183chr163742 1490 1292 1246 1141 806 13560 11269 1191
NM_001071775chr1361942 1693 1610 657 137 43 21894 1775 11313 --
NM_001076chr44503 366 339 136 1104 ----
NM_001076chr44503 366 339 136 1104 ----
NM_001079874chr181808 1606 1545 1469 1326 1308 420 211 --1253 --
NM_001083620chr472602 2362 1680 764 691 545 360 42623 1693 326 102 ----
NM_001099678chr3165937 4599 4414 4361 4288 2298 2133 2013 1941 1172 792 776 616 519 367 165 34558 275 135 46331 5004 4838 46 1768
NM_001100108chr1218389 8009 7973 7939 7840 7742 7415 7174 6947 6497 6479 6236 3297 3088 2881 2301 2182 1969 695 561 434 12819 36858 5739 344 --
NM_001104548chr11174 ------
NM_001106chr3199808 9140 8791 8783 8459 6689 6512 6176 3914 3511 3019 2283 1424 1414 1189 1070 911 785 88 33613 2768 1349 49523 7619 7470 276 12423
NM_001111chr162508 2188 984 972 518 231 21882 266 --11874
NM_001116chr1663078 3005 2738 2219 2122 1163 52110 1914 1066 704 44 12379 --
NM_001121chr1031469 1428 716 --11400 --
NM_001122679chr591338 1300 1284 1267 818 360 320 307 128 2384 229 ----
NM_001128chr1663891 3816 3052 821 380 352 13396 1844 --
NM_001146chr822313 849 22075 1624 --1353
NM_001148chr461950 1707 893 712 595 159 11896 1797 --
NM_001149chr1041163 920 150 82 1473 ----
NM_001160chr1252853 2837 1884 296 273 --12507 --
NM_001167chrX156760 5962 5171 5163 5100 4777 4147 2497 1736 1546 1516 1425 1291 1144 653 56300 5079 2155 1831 1123 65445 5279 4288 2522 1729 952 1669
NM_001173chr14103792 3353 3232 1798 1526 1251 1143 684 237 113 33171 1882 1258 --11654
NM_001174chrX72358 2111 2034 1891 1609 884 170 12265 ----
NM_001177chr1262229 1878 1804 1631 210 93 22188 882 1768 12168
NM_001186chr2173135 3079 2655 2535 1015 387 240 32944 2733 1231 ----
NM_001198chr6112417 2320 2053 1723 1609 1585 1495 951 941 821 188 32116 1752 965 198 --
NM_001199chr81245 ------
NM_001204chr2177762 7388 7227 6595 5976 5745 5353 3094 2894 2870 2782 1310 1152 746 315 157 56 126133 6082 5989 2427 2188 1815 1496 1200 1023 864 368 292 12560 --
NM_001206chr992566 2186 1227 1207 987 940 744 609 367 32487 2034 713 1533 12229
NM_001222chr1061890 1377 697 424 311 285 21425 112 11536 --
NM_001233chr7102253 2191 1898 1884 1774 1709 1607 1541 1505 822 22166 528 1850 --
NM_001241chr262375 2253 2078 2014 1638 311 2701 539 1329 --
NM_001241chr262375 2253 2078 2014 1638 311 2701 539 1329 --
NM_001256chr172631 194 31088 959 816 22400 2266 11838
NM_001259chr7176207 6138 6035 5580 5425 4970 4755 4661 4326 4083 4034 2346 2044 1106 677 651 185 55450 5361 3972 2223 570 15548 --
NM_001270chr56994 908 771 458 305 209 ------
NM_001271chr1563122 3105 2941 2648 2337 2167 --13238 --
NM_001282chr1762715 2483 2025 746 720 349 32146 2061 1804 42322 1779 1722 1017 --
NM_001284chr52146 29 ------
NM_001290chr41420 ------
NM_001295chr351366 1284 1177 1013 286 31535 1298 29 1228 --
NM_001304chr1783717 2839 2516 1504 1284 791 761 753 21242 1005 144 --
NM_001310chr1283007 2856 1931 1213 750 684 142 69 42320 1993 1048 669 --11922
NM_001329chr1051571 1368 1315 623 470 21497 367 21501 606 --
NM_001346chr3122758 2436 2147 2112 1835 941 887 835 591 481 303 42 1224 1138 --
NM_001351chr351775 1748 556 473 214 2698 595 1464 1546
NM_001364chr1194725 4617 4247 2992 1755 1518 1380 836 560 34787 1890 53 11907 --
NM_001386chr862385 2194 2083 1744 1500 237 12227 12457 12373
NM_001387chr5113135 2766 2507 2184 1250 996 659 267 58 35 29 ------
NM_001390chr1863485 2623 2387 2308 2279 1262 ----1513
NM_001391chr1831135 1120 363 ----1872
NM_001396chr2172828 2774 2704 638 353 300 162 --2129 77 21946 670
NM_001402chr641885 619 99 61 1539 21267 131 --
NM_001412chrX133264 2992 2675 2658 2339 1073 927 805 655 607 593 448 154 13559 12975 --
NM_001417chr1251925 1849 1764 312 67 2647 85 ----
NM_001419chr19124724 4543 3268 1899 1555 1449 1353 1328 1047 1009 873 367 ----13721
NM_001420chr1963014 2789 2756 607 558 551 23040 2783 ----
NM_001423chr1281813 1741 1636 1315 798 567 396 121 1462 --1467
NM_001429chr226994 979 814 165 52 29 1438 1869 --
NM_001438chr1103584 3440 3418 3358 3349 3237 2928 2922 2345 1402 12376 33017 2318 136 --
NM_001448chrX61738 1594 1472 1380 489 250 1628 --11186
NM_001449chrX91048 498 405 342 325 286 208 190 27 --1914 1821
NM_001453chr631735 567 76 138 2277 70 11434
NM_001455chr6134936 4917 4815 4589 3937 3745 3182 3162 1058 700 685 213 55 11248 1232 21003 33
NM_001460chr1133439 3411 3289 2556 1430 682 579 435 429 372 366 347 86 33576 2731 1093 --11375
NM_001482chr15----1904 1596
NM_001490chr9103433 2696 2673 2444 2334 1009 883 819 368 44 13395 33418 2490 343 --
NM_001494chr101733 ----1763
NM_001497chr9112153 2002 1953 1934 1726 628 564 552 456 284 267 12749 21100 994 --
NM_001527chr661162 1053 1022 762 700 658 11033 1191 --
NM_001542chr16871 731 626 541 466 424 32859 1054 509 1570 --
NM_001560chrX82655 2312 959 949 634 609 494 433 2803 254 22157 783 --
NM_001563chr64683 267 213 98 ----1235
NM_001587chrX4899 250 126 102 11831 12198 11618
NM_001608chr26912 887 848 840 325 183 1741 ----
NM_001609chr10144478 4420 3717 3379 3363 1763 1539 1518 1491 1304 1216 772 243 44 13246 11347 --
NM_001612chr11139 ------
NM_001616chr2113456 3008 2596 2373 2324 2270 1378 1029 871 639 92 11276 13219 --
NM_001621chr792975 2360 1220 1018 829 359 287 189 69 22329 279 --11052
NM_001621chr792975 2360 1220 1018 829 359 287 189 69 22329 279 --11052
NM_001627chr372434 2157 2109 2016 1772 979 484 1719 --22124 176
NM_001634chr671920 1473 1318 674 353 117 28 11371 ----
NM_001649chrX52049 812 751 523 121 22485 1583 --12154
NM_001650chr1893540 1466 1214 1175 752 730 515 320 30 33440 1311 715 1917 1426
NM_001663chr1462768 2545 2044 1882 843 754 22148 1063 21847 975 --
NM_001668chr161927 1893 1874 1637 1561 913 21909 250 21422 617 --
NM_001677chr12942 453 21140 186 11065 --
NM_001678chr1721831 1815 ------
NM_001679chr33837 597 521 ----1590
NM_001682chr1231984 1935 1766 1702 2345 166 22344 356
NM_001683chr342577 2201 1775 996 1258 22053 1851 12250
NM_001695chr894238 4158 4095 3788 3535 3524 3337 1117 533 54120 3211 1133 700 255 1814 --
NM_001701chr951519 491 338 291 142 1210 11110 --
NM_001706chr351035 766 404 303 261 2288 205 2331 269 --
NM_001709chr1182806 2618 2158 2113 1831 1782 1138 1042 52373 1775 848 487 392 --12737
NM_001730chr1371486 1449 1226 547 114 98 73 --11240 --
NM_001730chr1371486 1449 1226 547 114 98 73 --11240 --
NM_001742chr731816 614 269 11719 --1529
NM_001743chr24560 177 80 39 --1420 --
NM_001746chr552977 2818 2397 469 52 22900 110 11809 1446
NM_001748chr16784 720 359 186 165 95 1763 ----
NM_001750chr551994 1879 1671 1300 39 1689 --22054 727
NM_001754chr2134078 3770 3357 53960 3336 2922 1254 1119 1518 13008
NM_001759chr12115158 5134 3913 2006 1541 1447 1384 1299 786 273 261 35013 1557 501 --34472 3711 443
NM_001777chr3123721 3070 1496 1446 1437 1370 1346 1160 1015 975 922 871 43979 3078 2536 175 ----
NM_001792chr183747 417 322 3839 758 331 ----
NM_001797chr162144 115 2257 108 ----
NM_001822chr21554 --1561 1174
NM_001830chrX63423 3165 1608 1059 939 107 14048 23063 680 11116
NM_001845chr1341288 847 466 427 11212 ----
NM_001854chr13427 171 158 1359 1480 --
NM_001858chr6155086 4879 4614 4575 4266 3830 3167 1857 1378 1335 1192 1111 901 766 548 54480 3416 1449 978 693 ----
NM_001859chr962721 1173 1120 1062 879 475 33996 2672 1228 23833 2676 --
NM_001881chr102187 147 ------
NM_001918chr1239077 8910 8809 8356 7680 7401 7161 6253 6052 5685 3698 3566 3443 3419 3161 2124 2007 1740 1443 1374 591 288 278 88739 8501 8022 6875 6458 3276 2815 2238 48846 8526 6170 564 --
NM_001920chr123790 530 267 1723 138 --
NM_001924chr11379 ------
NM_001931chr1151122 1079 1060 1033 920 ------
NM_001938chr151511 652 383 335 169 1559 ----
NM_001942chr1871932 1900 1752 1464 1268 831 224 11658 1351 --
NM_001944chr1872337 2311 2286 2120 1679 1648 236 32414 2098 63 175 --
NM_001957chr462315 1922 1763 1543 897 141 1637 ----
NM_001963chr4----2511 80 --
NM_001964chr521210 942 1950 1362 1890
NM_001966chr3--1108 11076 1113
NM_001969chr14113628 2953 2888 2660 2637 2568 1575 1531 917 433 85 22768 1048 13481 --
NM_001977chr451631 1552 1335 1211 1151 11760 1145 --
NM_001981chr14920 836 133 78 11532 11690 --
NM_001987chr1294136 3995 3692 3223 3089 1413 1045 993 822 42866 1574 1391 1079 ----
NM_002006chr4185777 5354 5166 4954 4342 4223 4180 3993 1997 1646 1139 839 671 372 312 185 139 75 74916 1966 1801 1162 1000 932 496 25412 3661 14067
NM_002009chr1572375 2047 1034 781 636 236 75 1755 22205 247 22745 2074
NM_002024chrX82088 1988 1965 1881 1362 528 224 97 ------
NM_002025chrX169222 9083 8657 7408 6864 6494 3678 3498 3261 3249 2810 2390 2355 837 514 141 57094 7054 6560 5867 314 38711 3276 788 39311 7848 1740
NM_002031chr62624 226 2794 64 1720 139
NM_002033chr11124146 3880 3741 3238 2993 1459 1175 1091 885 617 309 287 23338 1522 33723 3665 1533 11053
NM_002040chr21103216 3201 3192 3003 2958 2651 2523 2315 595 570 13143 --22914 893
NM_002048chr951109 943 456 418 126 21349 332 ----
NM_002061chr131559 427 65 11619 11328 --
NM_002065chr11336 51622 1579 1484 1241 647 --11588
NM_002074chr171716 1586 1548 529 465 134 119 1214 --1405
NM_002076chr1273066 2547 2529 2358 1162 1069 89 22937 598 12069 --
NM_002086chr1741923 1868 1742 191 --21777 385 2106 44
NM_002091chr18135 ----1103
NM_002114chr61520 ------
NM_002126chr1773476 3114 3104 2628 1560 1308 420 23305 1058 33850 3542 3246 13517
NM_002128chr1382451 2350 2147 2076 1622 937 673 392 1746 ----
NM_002130chr561276 1247 1155 501 491 480 1602 31530 253 22 1537
NM_002137chr762342 2095 1554 853 234 147 32085 2054 70 1588 22114 910
NM_002139chrX4678 593 265 26 ----1172
NM_002158chr273427 3325 3124 2670 1097 525 58 1122 ----
NM_002187chr541119 1010 503 113 --2370 53 --
NM_002190chr631282 899 867 21046 31 31245 520 398 1825
NM_002192chr74645 587 159 32 1116 159 --
NM_002202chr551052 879 441 285 220 --1227 --
NM_002203chr5113998 3966 3372 3355 3240 3196 3023 766 746 734 579 43807 3597 648 494 13387 13301
NM_002210chr252326 1195 1010 134 86 32555 2266 820 12814 12542
NM_002214chr795751 5365 4722 4498 4243 1119 960 828 619 34232 4049 1695 --11700
NM_002222chr361271 1174 959 489 355 322 ------
NM_002229chr191479 ------
NM_002232chr111314 ------
NM_002245chr14464 245 94 88 ------
NM_002247chr1062122 1827 1652 604 356 178 12150 12221 --
NM_002264chr394666 4413 3880 3782 3618 2011 1623 722 217 21412 1277 11923 --
NM_002267chr1352384 1971 1699 910 851 32328 376 97 --1883
NM_002268chr371921 1868 1853 1839 1472 660 288 --1240 --
NM_002270chr5104858 4199 4068 3684 1943 1301 1290 1263 277 30 95268 4273 4018 3584 3550 1425 637 348 310 11193 --
NM_002271chr13142435 2362 2130 2097 2046 1958 1950 1806 1721 1686 1547 677 162 88 11561 11597 --
NM_002285chr2113984 3745 3605 3422 3372 3099 3082 1177 1095 756 405 21583 220 ----
NM_002291chr7------142
NM_002293chr182578 2442 2289 2208 1000 991 854 509 1949 1372 --
NM_002296chr14592 485 77 56 2712 26 ----
NM_002310chr5186468 5887 5765 5695 5057 4135 2240 2205 2005 1894 1733 1604 1408 1327 1240 1111 486 211 106565 6496 6317 5918 5782 5274 4907 4285 2421 2387 16511 35410 4746 314
NM_002313chr10104703 4108 3882 3659 3426 3206 1754 908 803 687 2221 143 24463 590 --
NM_002334chr1121947 1302 --11955 --
NM_002335chr11------1202
NM_002336chr1244974 4082 706 38 55087 3901 2016 279 193 --11167
NM_002345chr12--1675 1269 2600 448
NM_002349chr261683 1280 1224 426 326 214 1463 1408 --
NM_002356chr622870 2432 42819 2572 912 465 1885 --
NM_002374chr283482 3404 2530 2442 1463 996 637 173 22415 1424 --23697 606
NM_002385chr1851454 1421 1318 213 57 11577 ----
NM_002395chr651470 1326 441 344 312 11378 ----
NM_002397chr562126 2105 2000 819 767 138 2237 224 1283 1733
NM_002398chr231279 1233 47 11107 --21157 29
NM_002408chr147851 763 734 330 176 122 113 1689 ----
NM_002429chr1261580 1542 1467 1109 1063 375 11401 21071 151 --
NM_002449chr551091 894 830 821 311 --2442 337 --
NM_002451chr983659 3590 3519 2411 972 911 497 424 31067 191 145 ----
NM_002480chr1251383 1178 1136 946 220 --11315 --
NM_002481chr1127994 7459 7109 6822 5842 5765 5471 4934 2774 2397 1710 1126 56962 5614 5588 4861 2372 32316 1765 1353 --
NM_002486chr952180 1967 968 475 414 1285 ----
NM_002489chr7----1427 1310
NM_002501chr1983774 2789 1043 772 331 284 151 62 21633 408 1344 --
NM_002514chr831166 979 782 1840 21075 910 --
NM_002519chr1131412 940 217 1485 1243 1512
NM_002524chr1----11060 --
NM_002526chr631639 501 93 11476 --11524
NM_002538chr51631 ------
NM_002545chr11164455 4412 4321 4100 3981 3970 3633 3591 1844 1539 1445 1407 1062 422 359 338 63481 3223 1863 1768 1251 1111 14230 --
NM_002547chrX93613 3486 3315 3209 1490 1176 1125 712 286 12984 13391 1696
NM_002563chr341140 1054 871 714 2727 226 ----
NM_002567chr121290 ------
NM_002577chr393922 3752 3636 3545 2989 1381 589 516 163 33743 3414 3325 ----
NM_002581chr995235 3970 3531 2223 2160 1773 983 479 297 25010 4460 24304 653 --
NM_002595chr1251673 696 622 502 61 ----11296
NM_002600chr141672 669 283 87 21560 255 1149 1416
NM_002605chr152898 300 1984 1873 2275 101
NM_002612chr781562 1412 1336 818 636 587 429 420 61901 1759 595 557 129 96 1186 --
NM_002613chr1684816 4783 4535 3704 3636 3266 1975 186 15011 34857 3868 3463 14956
NM_002623chr203763 650 553 --2612 92 --
NM_002628chr32798 790 ------
NM_002641chrX31431 1425 1334 22007 1248 --11745
NM_002645chr112447 126 42533 2289 1944 482 --1350
NM_002647chr18------1326
NM_002655chr8115115 4631 4545 4330 3639 3274 3232 1333 1172 1103 654 75307 4918 4664 4350 3902 636 86 --11417
NM_002656chr62723 260 1409 11032 --
NM_002657chr2073178 1266 1201 1114 905 305 297 23798 3730 --12411
NM_002667chr63401 318 146 2482 226 11150 --
NM_002677chr8132764 2742 2508 2360 2171 2002 1109 989 547 328 263 128 71 42972 629 622 209 ----
NM_002687chr146962 925 222 196 112 41 21346 215 ----
NM_002703chr441644 763 314 104 21614 349 11570 --
NM_002709chr283509 3133 2775 2722 2520 2331 2253 231 13242 32650 2635 76 12872
NM_002718chr332610 1798 399 1488 22705 2189 --
NM_002719chr1442429 2284 2085 100 --1903 11944
NM_002731chr163044 2584 2041 1205 992 489 22522 1920 13167 --
NM_002736chr762201 1441 558 457 242 36 12217 21605 21 --
NM_002740chr332371 1052 213 32572 2238 1958 1949 --
NM_002748chr15--21250 432 --1225
NM_002760chrY146025 5846 5334 5282 4795 4655 4260 4189 3808 2111 1955 1515 157 112 34378 3819 3641 54703 4228 2300 1200 269 15078
NM_002765chrX21085 109 11397 1437 --
NM_002806chr142260 52 ------
NM_002825chr72595 123 2430 419 1499 --
NM_002834chr12104106 4062 3510 3280 2529 1379 1373 1090 833 80 13440 24044 152 --
NM_002837chr12104106 4085 3451 1134 1105 1095 1070 566 325 291 13885 --24125 795
NM_002839chr9113544 3437 2912 2876 2557 2303 2207 869 573 298 272 33423 2888 139 21425 729 --
NM_002857chr142660 2587 2510 1047 1310 32439 1684 60 --
NM_002858chr151248 411 381 76 64 2163 117 ----
NM_002869chr1151727 667 608 561 310 72247 2173 1492 798 733 459 219 --1478
NM_002874chr972074 995 975 957 900 779 217 1790 11672 1269
NM_002886chr3114929 4871 4111 3833 3255 1835 1489 1359 1055 643 324 24129 3214 24568 1367 --
NM_002892chr1461693 1644 1360 1321 635 174 2553 363 --11674
NM_002897chr25644 291 236 185 150 ----1711
NM_002906chr1142284 1792 912 810 21838 101 --11575
NM_002928chr161658 1177 1128 1017 276 105 ----196
NM_002940chr461813 1583 1336 648 621 71 11922 11176 1548
NM_002941chr391475 1439 1429 1224 497 378 308 297 260 1470 1553 --
NM_002955chr681974 1944 1561 1440 1329 1316 635 276 2716 294 146 11289
NM_002959chr164350 4339 2740 1659 267 133 44448 3773 3760 446 --12698
NM_002971chr331168 953 52 ----1799
NM_002977chr293387 2983 2435 2204 971 755 572 87 61 43484 3044 885 103 ----
NM_002979chr12288 255 2653 551 ----
NM_002994chr451761 1737 1727 1696 1254 21748 1704 ----
NM_002998chr871970 1783 1419 668 648 435 287 32201 146 50 --32181 2081 223
NM_003010chr1752303 1766 1654 871 325 22155 1617 150 --
NM_003012chr842428 2350 585 357 62211 1274 1001 826 720 315 22575 1189 --
NM_003013chr43780 649 642 1698 ----
NM_003017chr631346 1312 353 --1244 --
NM_003022chrX51232 1028 155 144 66 3903 874 823 ----
NM_003030chr361919 1833 1259 1229 494 466 --1334 1624
NM_003031chr165993 924 271 85 37 ------
NM_003034chr12218027 7898 7832 7644 7257 5794 5691 5388 2821 2012 1743 1402 1371 1217 1165 1106 999 805 539 364 235 47682 6101 2888 302 42370 1839 1015 144 22746 2535
NM_003037chr1151 1554 1606 1227
NM_003038chr292677 2335 1981 1858 1835 997 990 972 864 ------
NM_003042chr362163 2135 1862 1641 1587 375 32036 887 569 ----
NM_003043chr3134039 3673 3665 3650 1715 1665 1495 1386 1371 875 800 706 440 34048 3684 1333 1749 --
NM_003045chr1375002 4161 4105 3147 1941 1644 1518 2472 271 1321 --
NM_003048chr262570 2409 1780 636 593 292 1199 193 --
NM_003051chr171744 1489 1474 1408 600 514 201 1594 ----
NM_003070chr91168 ------
NM_003074chr362246 1634 1625 1451 473 61 22054 1589 --1681
NM_003081chr202418 42 --1355 1831
NM_003099chr15106444 6262 5807 4700 2041 1036 746 684 668 221 56168 5823 5177 1944 860 1658 --
NM_003106chr36773 728 400 201 168 70 ------
NM_003107chr682359 2119 2058 2039 1952 1748 408 314 ------
NM_003108chr2167276 7141 7100 7017 6835 6728 6648 5902 5892 5622 5282 5167 4772 1382 698 183 ----11488
NM_003111chr24938 322 186 98 21392 1205 ----
NM_003112chr793211 3193 2777 2330 1975 1218 1007 945 845 43174 2183 743 562 32829 2807 1196 --
NM_003114chr85810 668 208 90 72 1125 ----
NM_003127chr91301 ------
NM_003128chr282309 2084 2034 2017 1886 961 740 68 --1374 --
NM_003130chr731192 503 263 31350 863 435 1289 --
NM_003136chr142389 286 ------
NM_003144chr662218 2019 899 515 509 358 21674 1433 11808 --
NM_003150chr1782316 2114 1759 1524 820 668 545 25 ----11629
NM_003155chr862464 1989 1846 962 705 202 2796 308 ----
NM_003161chr17112538 1337 1230 591 459 382 374 287 177 85 33 22186 939 1449 1196
NM_003188chr64799 678 584 35 2310 249 ----
NM_003189chr163350 3271 2712 1004 800 212 23051 2734 11174 12917
NM_003194chr61411 ------
NM_003199chr18144117 3596 3499 3455 2272 2254 2200 1940 1345 1153 1000 722 540 149 44711 4475 992 35 25301 4654 44987 4809 4750 258
NM_003206chr61332 ------
NM_003212chr361191 1095 893 847 163 138 ------
NM_003216chr2293346 3231 3196 3020 2922 2581 618 381 219 23071 2548 12954 11154
NM_003221chr693858 3594 3293 3151 1532 1102 1000 902 133 13140 11260 11524
NM_003236chr2103107 3089 2766 2331 863 671 661 251 229 153 1754 ----
NM_003242chr371959 1836 1772 1675 830 433 146 1841 --32498 587 511
NM_003247chr642024 1952 777 761 --1746 1612
NM_003262chr374728 4467 3851 3755 3494 934 516 34878 867 751 ----
NM_003264chr45768 746 312 139 131 1504 1545 --
NM_003274chr2122958 2109 ----1468
NM_003275chr931153 614 443 41491 544 525 404 184 --
NM_003291chr13----1776 1756
NM_003292chr192137 2073 1682 887 815 640 512 236 146 ------
NM_003298chr3135977 5119 5066 4730 4635 4560 4414 4324 4305 2402 2060 1440 275 13904 --25505 1813
NM_003299chr121226 ------
NM_003304chr33342 210 113 11541 --1218
NM_003320chr1184024 3306 3293 1231 774 522 483 334 23161 2714 24446 4210 23855 756
NM_003326chr15835 488 411 171 24 --11849 1898
NM_003336chrX31117 371 222 ----1104
NM_003338chr1021676 40 21755 1633 --21580 149
NM_003339chr531420 1183 1029 21219 411 ----
NM_003340chr441251 1029 323 242 --1881 21261 536
NM_003344chr751554 1537 591 584 331 21187 83 ----
NM_003349chr20----11442 --
NM_003350chr83802 333 96 ----182
NM_003360chr4------189
NM_003372chrX6973 912 796 673 149 101 1960 1204 --
NM_003385chr24700 303 290 280 1212 --1984
NM_003387chr2122970 2745 2687 2586 2542 2379 2356 1948 1080 842 811 679 1607 ----
NM_003392chr3144242 4033 3463 3348 1338 1231 1186 901 782 723 554 468 443 253 33655 3480 493 ----
NM_003400chr22539 79 1784 1326 1869
NM_003403chr142537 153 ------
NM_003404chr2042050 1954 1351 178 21714 377 1307 --
NM_003406chr871825 1789 1686 695 582 531 330 11804 1309 1765
NM_003409chr1861394 1367 1083 896 519 457 ------
NM_003410chrX53003 2932 2642 2447 47 32773 2688 2133 12790 --
NM_003411chrY61787 1157 573 324 109 44 --1443 --
NM_003412chr3123029 2555 2057 1204 967 835 705 579 553 385 220 27 193 ----
NM_003413chrX61590 1435 501 226 155 96 21341 461 --11557
NM_003418chr33643 605 130 --1341 --
NM_003423chr1941752 718 514 267 2846 545 1130 --
NM_003426chr2231470 1318 438 1577 1581 11410
NM_003430chr1951701 1679 1314 1304 644 --2395 283 --
NM_003432chr51359 --1574 --
NM_003439chr783524 3179 3124 2926 2886 2345 1423 541 --33358 2510 1254 --
NM_003441chr471168 1015 850 361 287 236 117 --41098 505 449 203 1373
NM_003454chr1671531 999 401 327 149 122 103 ------
NM_003463chr682879 2764 1329 1228 1001 846 401 202 33082 2114 356 1794 --
NM_003468chr274250 3641 3615 3587 2973 2693 939 --11294 11649
NM_003471chr382188 1933 1470 897 760 549 497 360 1624 --11920
NM_003478chr1162967 2641 2058 2031 442 55 1809 11094 23361 817
NM_003483chr1292996 2752 2296 2182 1000 954 871 808 331 12515 --11827
NM_003489chr2141199 875 650 37 31256 1123 1019 33021 837 306 11138
NM_003505chr7141988 1895 1804 1704 1610 1350 1285 769 646 421 411 176 155 57 21504 1222 11229 --
NM_003507chr2101905 1843 1817 1307 1249 776 683 624 221 45 11686 ----
NM_003558chr91649 --2574 440 --
NM_003563chr174591 511 430 357 1149 --1333
NM_003566chr1283083 2884 2519 1240 1163 715 673 475 11086 1160 --
NM_003569chr62633 452 ------
NM_003574chr18155808 5680 5354 5291 5203 4647 4169 3771 1759 1682 1585 1566 686 592 502 45795 4755 2237 1074 ----
NM_003583chr1273757 3452 3134 2912 1325 1305 262 22536 569 --22765 629
NM_003590chr253929 3680 2775 1013 429 23152 3108 13125 --
NM_003603chr482052 1689 1449 870 590 396 309 250 ------
NM_003613chr15--1464 1247 --
NM_003615chr353076 2965 656 618 325 12467 13434 12435
NM_003618chr221319 421 11046 11172 --
NM_003620chr1731087 995 209 2710 700 ----
NM_003622chr1231799 730 231 1588 11699 --
NM_003663chr382988 2940 2911 2888 2244 504 144 110 33110 3006 1324 2206 167 --
NM_003671chr993061 2649 2531 1425 1372 657 649 419 93 23586 82 12575 --
NM_003672chr131861 1537 392 11345 ----
NM_003675chr101369 ------
NM_003677chr1232131 1721 1421 --32318 2154 266 --
NM_003679chr183424 2576 2539 2525 1067 512 464 48 --11141 13378
NM_003685chr193761 681 215 --1321 1317
NM_003701chr133990 753 424 2961 58 ----
NM_003713chr13353 285 33 21432 161 11740 11144
NM_003714chr592918 2868 2839 2823 2615 2549 2003 801 467 2785 70 ----
NM_003722chr392570 2323 2245 1823 1693 940 250 201 77 --1216 --
NM_003744chr141293 ----3360 343 72
NM_003749chr1362115 2090 1587 442 413 255 11978 --31987 1639 358
NM_003759chr4174297 4128 3842 3503 3448 3000 2941 1646 1404 1371 1346 1062 982 879 504 163 58 2403 303 12696 --
NM_003760chr14640 306 215 104 3816 597 222 ----
NM_003762chr161355 1316 449 213 183 97 --21466 910 --
NM_003763chr20103150 3126 3072 3044 2814 2046 1036 465 379 322 1657 1757 --
NM_003768chr151246 1143 481 448 351 --11370 11757
NM_003774chr1283372 3058 2827 2189 1197 534 393 335 23044 288 12101 --
NM_003783chr15977 876 448 160 98 2409 196 ----
NM_003787chr1821334 396 2318 295 ----
NM_003796chr192615 36 --1597 174
NM_003800chr652432 1755 1627 938 593 41689 932 860 379 ----
NM_003816chr831487 1144 983 3603 124 114 ----
NM_003821chr82456 173 ----1529
NM_003822chr163153 2920 2790 1036 1012 321 32245 790 33 12218 --
NM_003831chr1861739 1481 716 310 286 90 11662 ----
NM_003866chr43659 640 131 ----1731
NM_003872chr292988 2295 2201 1946 738 495 460 374 43 3896 708 256 ----
NM_003873chr1072430 2303 2289 2255 2205 499 346 ------
NM_003884chr321823 298 21849 527 1332 --
NM_003887chr241529 693 631 59 22086 1466 --1742
NM_003895chr2132026 1707 664 21554 121 --11786
NM_003910chr71153 ------
NM_003913chr6123704 3658 3568 3281 2863 2778 1737 1433 980 620 233 223 32978 1172 1067 23780 3155 --
NM_003916chrX61514 1345 1037 427 312 215 ------
NM_003927chr18--11009 --1311
NM_003930chr7102190 2143 1935 1819 1798 1755 1032 777 574 237 ----1658
NM_003932chr2231928 1922 513 2263 254 ----
NM_003939chr1073900 2810 2593 1481 1413 1239 391 13519 22931 1422 --
NM_003941chr772062 1633 1594 985 776 193 76 22043 1000 1739 --
NM_003953chr1112250 1948 1136 1095 890 792 688 679 60 38 30 ------
NM_003966chr5157211 6955 6751 6544 5783 5530 5507 5302 5205 5158 2819 2277 902 844 593 67743 7051 6907 6689 5562 1728 36805 5954 727 --
NM_003983chr1693944 3745 3634 3579 3411 3301 603 466 64 22946 521 34187 3925 50 --
NM_003987chr10----11515 --
NM_003988chr10----11592 --
NM_003989chr10----11451 --
NM_003990chr10----11451 --
NM_003994chr12114282 3806 3701 3540 3531 3306 3039 2945 1428 879 492 64059 3974 3217 3191 1603 766 1851 --
NM_004006chrX52180 2075 496 312 83 32194 888 458 ----
NM_004007chrX52180 2075 496 312 83 32194 888 458 ----
NM_004009chrX52180 2075 496 312 83 32194 888 458 ----
NM_004010chrX52180 2075 496 312 83 32194 888 458 ----
NM_004011chrX52180 2075 496 312 83 32194 888 458 ----
NM_004012chrX52180 2075 496 312 83 32194 888 458 ----
NM_004013chrX52180 2075 496 312 83 32194 888 458 ----
NM_004014chrX52180 2075 496 312 83 32194 888 458 ----
NM_004015chrX52180 2075 496 312 83 32194 888 458 ----
NM_004016chrX42094 1989 410 226 32108 802 372 ----
NM_004017chrX52180 2075 496 312 83 32194 888 458 ----
NM_004018chrX42094 1989 410 226 32108 802 372 ----
NM_004020chrX52180 2075 496 312 83 32194 888 458 ----
NM_004021chrX42094 1989 410 226 32108 802 372 ----
NM_004022chrX42094 1989 410 226 32108 802 372 ----
NM_004023chrX42094 1989 410 226 32108 802 372 ----
NM_004028chr1893540 1466 1214 1175 752 730 515 320 30 33440 1311 715 1917 1426
NM_004067chr731308 981 420 11202 --11564
NM_004079chr162942 2520 2463 2255 921 836 22407 551 22824 1113 --
NM_004081chrY71793 1478 1403 571 561 424 42 ----1641
NM_004087chr382000 1949 1917 1692 1373 277 265 215 1486 ----
NM_004090chr1783453 3175 2603 2100 1387 1193 686 53 23466 3446 12771 --
NM_004093chr1372914 2619 2397 2147 471 308 227 ----12030
NM_004094chr1452503 2044 1190 625 99 2901 148 11991 32826 2727 2370
NM_004098chr102957 44 185 11057 --
NM_004100chr682610 2424 2334 2309 2152 810 366 295 1668 --1316
NM_004109chr1172380 2197 1974 1954 1709 715 595 12298 21983 283 --
NM_004113chr3132067 1992 1889 1866 1804 1656 1347 802 647 261 243 181 145 21910 1522 1117 --
NM_004116chr21467 ------
NM_004124chr1473474 3187 2906 2488 1338 1222 1053 12388 32705 1347 144 --
NM_004133chr851795 1713 1674 863 652 42495 2276 712 354 1180 --
NM_004136chr1563236 2222 1074 848 362 298 23176 1093 22326 45 --
NM_004161chr241570 539 201 66 41386 1173 573 181 ----
NM_004169chr171167 --1320 1741
NM_004171chr11209580 9415 9318 9259 8775 7238 6110 6066 5883 5860 3872 3777 3581 3504 2736 2473 1128 858 575 311 69307 8965 8000 2861 2594 1120 37784 2371 1217 --
NM_004200chr1143223 3189 2704 2596 13092 13240 --
NM_004226chr21232 ------
NM_004229chrX3515 162 132 1533 21973 402 --
NM_004232chr1873349 3091 2436 891 247 123 85 32962 2710 464 ----
NM_004235chr92819 265 ----1724
NM_004236chr152533 125 1211 2467 79 1582
NM_004241chr105632 501 297 201 95 2722 194 ----
NM_004261chr15874 854 848 240 187 3729 405 342 ----
NM_004262chr471332 980 911 464 413 63 27 1442 ----
NM_004272chr541834 1494 1471 424 ------
NM_004274chr1442075 1166 793 553 --1247 12577
NM_004277chr641573 1094 1066 287 11712 ----
NM_004279chr732133 1562 774 42011 1796 1764 45 12034 --
NM_004281chr101447 ----1136
NM_004293chr9103386 3112 3027 2802 2627 2505 1275 536 435 382 42561 2544 1495 1237 1307 --
NM_004296chr14114011 3741 3561 3445 2497 1435 1201 1165 1155 587 562 33064 1120 859 12546 12663
NM_004301chr32330 259 ------
NM_004319chr163096 2913 2530 2089 311 124 23201 2076 1157 12258
NM_004329chr1051394 1207 334 274 38 ----1447
NM_004331chr872713 2497 2161 1976 682 426 399 2518 465 12444 --
NM_004337chr821687 342 32137 319 252 1269 --
NM_004338chr18167073 6461 6333 6018 5568 5529 4292 2826 2325 2048 1514 1458 1392 1229 493 300 15978 1111 --
NM_004342chr741782 1563 191 31 --32297 2153 1495 --
NM_004349chr831028 391 136 11091 149 1172
NM_004350chr182558 2245 1803 1740 1724 893 499 54 11925 22430 1569 --
NM_004367chr651560 1483 559 369 58 2397 260 21400 107 31764 1708 632
NM_004370chr662207 1782 1604 881 475 311 --12104 11581
NM_004379chr231701 1591 1250 31333 1229 71 1115 --
NM_004380chr1682386 2077 2063 846 811 655 422 375 --22650 1763 --
NM_004384chr562105 918 798 718 709 636 21727 221 --1744
NM_004392chr1372676 2561 2525 2312 1014 505 439 22421 825 ----
NM_004397chr11114293 4131 4057 3730 3618 3286 2899 2717 1404 754 363 23315 1306 1951 --
NM_004419chr1021107 1093 ------
NM_004432chr921760 176 21706 511 ----
NM_004437chr183498 3487 3358 3096 3082 2385 466 407 22701 1122 22705 60 --
NM_004438chr283297 3278 3270 2265 955 871 260 24 33109 1255 891 ----
NM_004440chr641918 1552 1386 41 --11575 --
NM_004447chr125746 737 716 362 182 21020 338 ----
NM_004450chr141386 ------
NM_004454chr352202 830 591 263 199 1562 1328 1298
NM_004457chr241683 1428 673 287 1667 --1157
NM_004458chrX82594 1993 1636 821 519 244 133 121 2439 316 ----
NM_004459chr17121962 1839 1422 746 529 520 408 288 242 189 104 37 129 11539 --
NM_004464chr483402 3204 3125 1590 1420 1347 835 154 23262 1695 --21387 227
NM_004480chr14--1103 --1654
NM_004482chr25830 786 219 91 49 3704 612 185 ----
NM_004485chr1104196 4159 1666 1626 980 812 502 257 223 212 --14206 --
NM_004491chr1984382 4329 4046 4029 3854 3266 130 72 43981 1001 661 574 22769 839 --
NM_004496chr1471013 958 387 192 163 74 48 ----1548
NM_004500chr1451826 1608 1436 748 378 2636 304 11548 --
NM_004501chr1114124 3926 3825 2633 2607 2576 1099 605 305 267 40 33855 1537 856 1663 --
NM_004504chr293007 2857 2574 2171 1878 954 768 466 203 12834 1161 --
NM_004506chr62718 42 --1483 --
NM_004514chr1793040 1170 919 911 538 339 195 179 129 1448 1861 1881
NM_004516chr1991155 1098 1086 1064 305 260 153 62 27 --11040 --
NM_004537chr1251506 1438 1223 602 315 --11345 --
NM_004549chr1141585 446 352 346 --21542 389 --
NM_004586chrX125000 4610 4532 3564 3525 3511 3492 1889 1435 1420 944 656 24811 1125 ----
NM_004588chr1153599 3268 3210 1511 1504 13316 32998 1218 587 --
NM_004598chr563217 2076 945 784 584 37 12378 ----
NM_004600chr141308 489 321 268 ----11035
NM_004602chr2011479 --11320 --
NM_004612chr9143840 3455 3309 3284 3192 1834 1223 838 709 625 507 492 338 261 23273 608 11669 --
NM_004613chr201370 ----174
NM_004619chr1102224 2088 1775 759 656 423 351 196 142 42 22206 96 ----
NM_004650chrX31351 685 536 11481 11820 128
NM_004654chrY51132 984 887 874 283 ------
NM_004660chrY32264 1973 1961 21994 389 ----
NM_004663chr1511099 ------
NM_004664chr12183 ------
NM_004666chr661404 1354 1071 537 474 267 11121 --31495 1276 1219
NM_004670chr1071642 1154 577 523 401 214 123 ------
NM_004673chr161573 1499 1255 1025 186 34 41413 1382 965 577 ----
NM_004685chr1372634 2616 2543 1847 904 691 349 32466 1989 245 ----
NM_004687chr1732091 800 321 11508 11700 --
NM_004717chr771051 1045 552 504 484 243 118 1175 1519 --
NM_004719chr124571 498 213 43 1587 --11786
NM_004725chr103596 538 232 144 11523 1963
NM_004726chrX105497 5482 5443 5366 4337 4231 1326 1187 755 353 ----34771 1168 122
NM_004730chr541849 787 348 115 2848 156 32155 650 25 11764
NM_004731chr1261385 1181 1175 638 558 515 ----11903
NM_004734chr1343132 2440 1155 759 12080 22007 228 32177 1237 184
NM_004736chr172160 1884 1790 1545 1518 689 474 31699 263 215 ----
NM_004742chr321325 286 11719 --1728
NM_004744chr463832 2449 1271 913 630 144 21542 1356 23524 1120 23617 1247
NM_004745chr8165775 5645 5150 4755 4462 4352 2691 2647 2140 1897 1862 1793 1786 1521 1434 1018 46273 6016 2260 2046 17019 --
NM_004760chr751679 1673 900 339 329 11538 1452 --
NM_004774chr1772647 2348 2123 1187 796 665 406 63146 3136 2808 2581 1215 1181 ----
NM_004776chr2063346 3028 2620 634 316 93 2818 248 12176 --
NM_004779chr561327 1181 1156 451 326 128 ------
NM_004788chr1152739 2659 973 327 26 --12253 --
NM_004789chr93406 398 137 ------
NM_004795chr1371602 1571 1541 1308 389 308 172 11553 ----
NM_004796chr1462153 1953 1770 463 455 92 32089 1779 665 22338 795 21784 1477
NM_004798chr20113634 2943 2585 1092 1013 729 721 397 264 97 64 --12785 --
NM_004804chr272780 2517 2113 1904 1759 1045 930 1205 1342 --
NM_004808chr1053410 3192 2898 2426 1056 22744 430 22466 1196 --
NM_004815chr133701 1863 878 43444 3203 3014 1503 ----
NM_004816chr9----2624 603 1519
NM_004824chr661471 1235 1008 526 250 199 21023 910 ----
NM_004827chr451387 1372 1304 487 444 31922 1901 189 ----
NM_004831chr1981030 973 682 264 252 215 176 40 1828 ----
NM_004834chr283431 2331 2103 1373 1053 919 818 429 22997 208 12916 13323
NM_004835chr33852 736 49 2578 188 1197 --
NM_004835chr33852 736 49 2578 188 1197 --
NM_004849chr641392 479 435 263 ------
NM_004857chr14174682 4649 4441 4198 3548 3295 3074 1424 1252 1190 1100 983 567 227 165 135 25 23495 1108 13329 --
NM_004859chr1763104 2595 724 583 443 166 1842 1468 --
NM_004862chr1631461 1234 211 11374 1153 11294
NM_004865chr61404 ------
NM_004866chr5114600 4175 3098 2014 1365 1235 1170 701 527 205 138 54665 3723 1840 1826 86 ----
NM_004869chr1871720 1463 686 484 418 323 262 31072 478 201 191 --
NM_004871chr1764268 4108 3944 3604 3107 1609 --24093 123 --
NM_004896chr1051352 1153 412 107 30 1485 ----
NM_004898chr462859 2002 1898 1814 1047 555 32475 1859 1062 12773 1594
NM_004902chr205690 609 556 295 204 1786 --1662
NM_004904chr7106536 5296 4607 4424 2437 2199 2186 1939 966 747 65389 5311 4021 2177 1688 821 14025 16319
NM_004921chr162303 2166 1773 694 207 174 2990 387 1749 1497
NM_004929chr831131 944 584 41144 1037 493 428 ----
NM_004936chr952792 2113 2067 1937 484 ----22905 222
NM_004941chr171154 ------
NM_004947chr362526 2468 2452 2280 2202 932 12363 ----
NM_004949chr1892131 1862 1813 1772 1553 716 290 190 58 11519 --11527
NM_004952chr1------1828
NM_004956chr7154604 4088 3761 3363 2989 2960 2832 1814 1747 1700 1693 862 853 541 53 33332 1733 1206 13794 12847
NM_004961chrX3626 309 278 ----21577 1092
NM_004966chr102641 197 --2652 162 --
NM_004972chr951108 272 189 145 122 144 ----
NM_004976chr11125138 4968 4653 4537 4463 3841 3270 1955 1689 766 471 151 --24303 1964 --
NM_004985chr1263750 3570 3065 2734 1753 1098 21275 589 11744 --
NM_004992chrX158151 7901 7510 6754 3356 2613 2467 1761 1527 1468 1357 1168 909 596 87 67958 7343 6318 5466 1878 1012 57863 7420 6766 5309 1752 126
NM_004992chrX158151 7901 7510 6754 3356 2613 2467 1761 1527 1468 1357 1168 909 596 87 67958 7343 6318 5466 1878 1012 57863 7420 6766 5309 1752 126
NM_004996chr1651755 1642 1578 1368 29 4226 146 135 107 ----
NM_004999chr6134176 4098 3900 3623 3490 3474 3261 3050 2763 1694 1219 338 220 43957 3088 391 346 ----
NM_005006chr271098 1040 682 348 317 213 88 11009 ----
NM_005010chr762055 2019 235 211 189 143 11942 --1826
NM_005032chrX2877 800 2243 22 --1675
NM_005036chr22208112 7834 7725 7410 7120 6733 5572 5463 5197 3199 2879 2621 2234 2061 1525 1021 912 852 479 346 27715 6164 37778 2750 2043 1491
NM_005044chrX84582 4402 4166 3856 3314 3174 3128 1404 31322 1300 912 186 24046 3597
NM_005054chr241778 682 284 204 21673 1354 ----
NM_005056chr1265489 4915 4681 4418 3792 151 24811 4762 24410 1188 --
NM_005057chr161713 1683 1376 740 530 519 195 11764 --
NM_005063chr10113684 3544 2996 1405 898 786 694 594 521 352 325 22355 434 ----
NM_005065chr14104970 4572 3784 3653 3604 2009 1089 1040 849 408 53436 3324 3285 2073 1870 21638 715 --
NM_005079chr893138 2473 2419 2299 2172 1080 870 318 154 1765 ----
NM_005093chr20135325 4726 4543 4458 4363 4264 3527 2124 2012 733 631 613 106 1623 1864 --
NM_005095chr152114 1998 1404 409 321 --21528 1367 --
NM_005109chr342510 1854 1797 1630 ----1672
NM_005116chr20104581 3993 3978 3664 3649 3182 2824 1803 1164 75 14293 13835 13354
NM_005121chr1743830 3393 220 26 33614 3506 379 1246 12553
NM_005126chr3102288 2230 2186 2114 2091 1677 1619 634 418 289 22061 897 ----
NM_005135chr1583051 2983 2935 1198 731 671 304 160 53238 3045 841 603 221 12369 --
NM_005156chr9175213 4952 4641 4302 4202 3940 3886 3825 3746 2069 2041 1941 1654 1585 781 79 27 25095 3841 149 --
NM_005164chr1242189 1956 1880 752 42130 2086 2073 493 --2245 111
NM_005168chr261634 1499 1253 1192 637 44 21745 1598 11667 --
NM_005171chr1231108 235 86 --11277 --
NM_005180chr1021661 1468 11091 2559 232 --
NM_005187chr1671453 747 718 482 452 191 182 ------
NM_005188chr11138331 7825 7473 6847 6320 5991 5608 3297 2759 2676 2567 2519 1780 58038 7140 2215 1108 827 26514 1941 --
NM_005190chr661144 1137 769 443 390 255 ----1143
NM_005197chr14145359 5173 5149 4784 3934 2363 1232 1193 1155 1124 999 400 291 276 12264 --25393 1116
NM_005207chr2273613 3495 2621 2384 1449 478 470 43583 2581 1069 393 12630 --
NM_005220chr1731119 429 50 --11424 21151 940
NM_005226chr972651 2525 2440 2376 2100 847 732 32119 2090 946 11748 --
NM_005228chr771702 1601 1053 667 620 255 234 ----1514
NM_005233chr352565 2053 1706 338 264 22516 322 11665 --
NM_005235chr2137096 7047 5291 3155 2873 2823 2715 2037 1851 1472 760 737 721 12755 ----
NM_005238chr1193448 3387 3347 2209 552 524 435 376 105 --22306 736 --
NM_005254chr1551325 1204 269 195 162 --1519 --
NM_005256chr111374 1789 --1937
NM_005259chr231299 1130 395 21322 34 ----
NM_005261chr82230 176 21003 830 1785 1910
NM_005271chr101783 ----1478
NM_005277chr461753 1675 1373 295 265 86 11353 11929 --
NM_005311chr732739 2717 361 ----11755
NM_005328chr81648 1577 --1166
NM_005339chr4103341 3124 2944 1245 820 788 312 304 259 237 24245 1351 --23172 2955
NM_005342chrX72507 2475 2372 2021 856 409 111 1420 --1720
NM_005349chr46648 410 221 181 169 46 ------
NM_005359chr18116122 5262 2050 1902 1536 1296 988 909 634 305 192 95814 4764 4476 4444 4206 864 554 169 53 24085 1127 24769 332
NM_005389chr67837 692 581 323 249 111 52 ------
NM_005399chr1124432 4060 3651 3553 3035 3003 1761 1303 1241 791 627 288 34021 2865 1419 11594 1800
NM_005400chr2123081 2907 2721 2711 2534 2470 1197 1119 1038 938 336 37 ----12888
NM_005406chr1841139 1132 494 424 1624 1484 --
NM_005417chr2011559 ------
NM_005433chr1882794 2559 2286 1851 1753 836 368 145 62824 2407 1808 1770 224 40 ----
NM_005436chr10123869 3756 3159 3127 2755 2608 1608 1010 826 549 389 343 23494 529 --33321 928 617
NM_005437chr1031322 1202 146 31409 532 339 --11449
NM_005445chr101218 ------
NM_005455chr151681 1462 1162 696 350 2304 239 ----
NM_005458chr972365 2246 1959 1675 293 70 41 11762 ----
NM_005475chr1293197 2512 2351 1307 1089 957 853 612 52 2569 415 ----
NM_005486chr177513 459 244 234 206 111 55 ------
NM_005497chr1795962 4130 3837 2399 2376 2032 1505 1057 1034 --55571 5229 2170 864 224 --
NM_005499chr19123 1246 2617 54 1505
NM_005502chr962957 2826 2161 806 395 169 23282 2535 23140 2480 --
NM_005504chr12145076 4902 4199 4010 2526 2486 2256 1854 1815 1394 1284 660 477 468 36634 5334 4211 24502 4302 --
NM_005520chr5------1503
NM_005530chr1561534 1095 459 443 150 140 21007 418 11335 --
NM_005542chr781963 1856 1841 1833 1717 1362 675 327 31676 487 308 ----
NM_005566chr113543 489 167 ------
NM_005570chr1851053 883 248 160 41 --11006 --
NM_005575chr52207 73 ----1348
NM_005578chr3115125 4582 4284 4276 3857 3675 3424 1898 1687 1266 940 11055 14089 14409
NM_005596chr9176427 6071 6033 5816 5507 4861 4628 4487 4439 4373 4133 3938 2385 829 207 100 58 44449 1615 1035 193 25650 2143 15614
NM_005603chr1852028 1751 1385 1329 393 136 21342 475 --
NM_005604chr662262 1916 866 533 400 157 32572 809 785 32430 506 345 --
NM_005607chr84776 725 401 236 ----1903
NM_005611chr1641278 1265 289 33 1440 1270 1414
NM_005613chr152177 1612 745 580 36 --21729 683 --
NM_005629chrX21027 177 1154 1469 1882
NM_005637chr1832059 675 541 31589 1455 580 --21488 804
NM_005639chr1231616 705 461 41865 1818 1222 673 --1617
NM_005647chrX73214 2188 1388 1377 340 193 81 32837 2178 1034 32633 1360 365 --
NM_005655chr851231 437 113 64 26 ----11134
NM_005662chr81405 ------
NM_005665chr1104846 4670 4505 3693 3203 3176 1738 887 361 330 34624 1174 459 34534 4137 1112 1241
NM_005668chr5114623 4615 4402 3161 3104 3082 1732 1454 1098 408 167 43316 1488 298 76 ----
NM_005669chr561977 1790 1685 1664 1549 929 ------
NM_005684chr11113 ------
NM_005694chr31124 ------
NM_005707chr1531187 879 831 --31160 1091 425 --
NM_005711chr54975 359 329 323 --172 --
NM_005715chr662747 2118 1070 403 333 67 52263 928 851 258 116 ----
NM_005717chr151305 1295 1230 1046 229 21136 61 1461 1495
NM_005722chr231701 1596 548 52370 2336 1943 1000 364 ----
NM_005725chr142086 1787 913 491 22071 1523 1597 --
NM_005737chr292428 2150 2029 1974 1124 738 471 148 127 ------
NM_005738chr751928 1695 1505 369 308 3731 667 269 ----
NM_005739chr1552355 2334 2009 407 332 52240 1851 1678 269 103 1219 --
NM_005746chr752495 1962 858 276 190 2518 315 ----
NM_005748chr12113151 2861 2521 2511 2491 2308 2174 2107 1381 1119 803 53466 935 769 693 647 --11339
NM_005759chr2124649 4366 4189 4145 3534 3197 2960 2906 1730 1645 1167 367 41263 1214 284 159 ----
NM_005765chrX--1722 --1299
NM_005779chr592624 2324 2276 1362 1124 1002 828 164 103 12909 --1515
NM_005802chr94799 245 175 156 3612 596 510 --1562
NM_005807chr14744 506 299 256 2494 149 ----
NM_005808chr343182 2368 1192 902 32653 2418 241 13312 --
NM_005813chr262561 2326 2058 605 419 99 1614 ----
NM_005822chr631998 1834 1610 21509 914 22075 658 --
NM_005828chr1795083 4056 3618 3578 3369 1920 1900 1138 994 13957 24812 3224 11631
NM_005832chr31141 1272 31364 1331 589 --
NM_005840chrX97172 6955 6908 6352 5506 5127 1849 1271 1145 77587 7038 6199 4864 4794 2567 1054 --156
NM_005843chr241882 1470 672 80 21846 1618 ----
NM_005853chr162518 374 ----1527
NM_005857chr141479 967 277 256 1178 ----
NM_005859chr541545 1410 503 160 1238 1403 --
NM_005862chr31362 1304 1851 --
NM_005863chr1061306 1254 1010 941 435 345 1262 1407 --
NM_005868chr781911 1859 1834 1768 890 793 589 417 32201 1577 79 ----
NM_005870chr1341145 1026 196 48 --2911 232 1349
NM_005885chr571276 1142 1130 1109 592 282 239 21590 1517 21692 378 --
NM_005898chr1183196 2590 2428 2007 1127 654 619 336 22709 2531 1667 31119 460 274
NM_005901chr18187962 7414 7248 7068 7047 7031 7015 6799 5807 5441 5303 3477 2504 2243 2056 2035 1426 262 57579 6580 5267 1812 771 --11171
NM_005902chr15164474 4220 4036 3979 3818 3801 3787 3685 3641 3543 3391 3323 1858 1840 1462 236 23617 609 1640 21449 273
NM_005903chr5115250 4718 4365 4347 3180 1482 813 726 563 478 210 41731 1691 1585 1289 1570 14455
NM_005907chr631710 1233 405 --1341 --
NM_005909chr5144326 3959 3812 3260 3188 2776 1521 1440 1229 1205 768 635 559 414 43932 1015 910 613 1226 --
NM_005910chr1784130 3872 3415 2830 2574 1319 774 175 ----12657
NM_005924chr751079 1048 934 890 813 2855 762 21019 1014 11119
NM_005933chr1132935 2141 837 154 1411 22171 1142
NM_005935chr4105304 5176 4046 3807 3746 3404 3370 3252 833 191 --21921 1113 --
NM_005941chr8163929 3886 3691 3662 3580 3425 3415 3166 2649 2579 1421 1225 1177 1097 932 279 93827 3196 1558 1134 924 670 527 459 62 ----
NM_005944chr361232 1183 445 400 123 108 ------
NM_005955chr1145284 5185 4903 4887 4769 4519 4274 4003 3378 2220 1459 1153 916 498 14423 13541 21184 724
NM_005957chr174501 4290 3787 3660 3533 3017 449 23032 1754 --1401
NM_005962chr1061884 935 582 487 256 176 21932 103 --2416 34
NM_005962chr1061884 935 582 487 256 176 21932 103 --2416 34
NM_005966chr241474 578 497 335 2168 124 ----
NM_005986chr134976 856 764 324 --1589 --
NM_005990chr562743 2733 2625 2116 570 346 1377 --22245 2171
NM_006007chr9154448 4350 3965 3905 3679 3404 3338 3148 1777 842 736 614 273 245 172 21710 299 33485 2924 630 --
NM_006011chr1584056 3616 1623 1577 1399 782 700 519 11557 21729 1345 21676 127
NM_006016chr642043 1848 1823 1757 162 12280 --
NM_006023chr101180 ------
NM_006024chr72354 39 --2607 268 --
NM_006036chr24989 982 900 74 41791 779 564 305 --11687
NM_006037chr253134 1510 1453 597 409 23516 395 --13815
NM_006041chr17166 ------
NM_006047chr2053446 3300 3251 1001 703 13009 33376 612 260 --
NM_006060chr773405 3035 3005 1123 938 848 227 44441 3253 506 344 ----
NM_006061chr661021 1014 858 356 317 203 2982 945 --11334
NM_006078chr221107 1209 --1233
NM_006080chr7122797 2745 2739 2692 2595 2121 860 679 642 499 490 424 1990 1357 --
NM_006095chr494066 4054 3953 3363 3323 3266 1133 956 510 11308 1483 11509
NM_006106chr1183116 3039 2697 2236 2227 861 250 126 22901 2483 12175 --
NM_006107chr171449 ------
NM_006108chr1152411 2286 2181 1948 925 1823 1836 --
NM_006113chr181808 1606 1545 1469 1326 1308 420 211 --1253 --
NM_006122chr1572771 2583 2207 1841 897 638 107 12359 21957 703 --
NM_006139chr261138 946 805 382 351 187 2661 504 ----
NM_006141chr1652274 2008 1854 1068 419 2919 580 21936 591 --
NM_006143chr121119 ------
NM_006154chr15102916 2891 2731 2704 2383 2238 2001 1023 727 53 22318 846 11171 --
NM_006159chr123437 162 72 --2629 190 --
NM_006164chr23426 143 120 --2345 108 --
NM_006166chr1232416 2164 598 --22301 1845 1537
NM_006167chr892270 2110 1661 1621 722 710 494 109 92 31751 1558 762 11819 --
NM_006180chr951702 1619 1436 805 645 22026 1613 ----
NM_006194chr1421058 190 1918 2409 340 --
NM_006195chr931169 376 332 --21109 111 --
NM_006197chr862144 1915 1789 1648 723 532 2906 156 ----
NM_006203chr5105501 5229 4776 4067 4038 3594 1793 955 647 124 1258 14104 1574
NM_006204chr10------2191 168
NM_006206chr4122922 2883 2777 2582 2503 2443 2026 1094 1077 979 864 339 32827 2681 738 ----
NM_006207chr81310 ------
NM_006212chr174983 4934 4438 3451 1097 1074 997 21155 150 25140 1446 --
NM_006224chr1731005 966 749 1524 --21024 34
NM_006237chr1372166 1741 1611 1483 1402 665 490 62226 2186 1704 1690 1410 471 ----
NM_006241chr362379 1711 606 257 239 101 12144 ----
NM_006243chr12435 64 175 ----
NM_006251chr563014 2825 2185 958 395 173 ------
NM_006252chr1177589 7091 6925 6604 6521 6205 5689 5359 5130 4990 4597 2089 1989 1328 1214 781 456 56912 4794 2252 862 158 ----
NM_006256chr152666 2501 2434 1943 1817 22796 1889 ----
NM_006282chr2063811 3651 1704 1497 1180 902 23873 1189 23856 1151 --
NM_006283chr894921 3384 3134 1928 1275 1166 1155 1118 1005 24456 645 23052 1505 --
NM_006300chr1952157 2020 1923 414 128 12366 21604 689 1856
NM_006306chrX205704 5672 5607 5552 5533 5483 5455 5374 5308 5294 5288 5196 4209 4061 2348 2309 1911 919 473 177 55477 4085 3705 2124 1826 11340 1380
NM_006315chr464537 4383 3999 1638 1123 654 83350 3310 3209 2912 1791 1605 1257 159 ----
NM_006323chr45767 705 578 494 142 ------
NM_006330chr881598 1581 1325 1278 1234 1215 562 420 11387 --1276
NM_006333chr21527 ----168
NM_006359chrX72541 1801 996 792 689 286 32 --1990 --
NM_006360chr11------158
NM_006366chr651323 942 538 366 311 ------
NM_006375chrX2655 258 1549 31862 1317 572 --
NM_006379chr7102053 1865 1818 1633 1539 1512 583 429 269 71 --1289 12337
NM_006380chr17124007 3840 3695 3325 2913 2707 847 677 329 295 155 67 34160 4126 3191 ----
NM_006386chr2262144 1622 945 912 230 201 12135 ----
NM_006390chr1261653 1548 1260 1205 534 331 21212 429 11241 --
NM_006393chr10124367 3424 3272 2846 2815 1696 1577 1556 1210 836 715 497 24407 1646 22952 1570 11658
NM_006413chr1031106 165 73 21056 154 --1939
NM_006420chr2083422 3381 3228 3087 1277 1248 404 37 13136 22242 303 --
NM_006421chr851173 1138 882 442 213 --1899 --
NM_006434chr10102683 2320 2134 2021 529 488 409 206 147 116 12469 1581 1991
NM_006449chr2101832 1660 1359 607 478 396 384 205 161 32 21694 187 2568 191 11775
NM_006451chr52368 73 1162 --160
NM_006457chr473651 3626 3620 1604 1187 887 376 33685 3391 2808 11404 --
NM_006460chr1761727 1641 1545 713 492 30 21287 419 1581 --
NM_006474chr11256 32031 1355 153 1277 --
NM_006482chr1273757 3452 3134 2912 1325 1305 262 22536 569 --22765 629
NM_006504chr1092904 1809 1033 885 719 635 350 336 53 42425 1120 746 574 12203 --
NM_006524chr721103 924 --6908 880 824 404 172 68 --
NM_006529chr4101664 1568 1562 1547 1296 1153 1136 443 416 156 21700 630 ----
NM_006532chr1931957 1347 46 --1399 --
NM_006534chr2073357 3093 1292 1002 645 339 303 32145 2096 232 13134 --
NM_006538chr294202 3971 3135 2780 2749 2724 1273 187 60 23180 821 1704 --
NM_006544chr14165897 5444 4959 4567 4400 2373 2302 2177 2153 1955 1748 1017 834 746 315 266 45904 1781 1067 141 1678 14164
NM_006546chr1756289 6251 6152 6139 46 26676 1585 --35585 4589 1765
NM_006548chr33635 346 210 --21190 356 125
NM_006561chr1076011 5454 5437 4056 3779 2336 321 56146 5808 5416 1211 357 31851 1040 272 --
NM_006571chr82281 121 ------
NM_006572chr1753365 1061 835 678 254 32771 2694 395 ----
NM_006575chr1431334 1171 522 ----1456
NM_006587chr421253 280 21285 235 --11126
NM_006591chr1141751 1545 265 193 ----1691
NM_006595chr1151844 1835 1731 1563 1478 --21488 239 22004 563
NM_006599chr16137741 7691 6481 6095 5469 5214 2907 2669 1326 729 615 259 144 68290 7451 6819 5416 2712 90 16920 11312
NM_006603chrX41623 818 516 501 31321 1249 308 1566 --
NM_006609chr242325 2139 948 922 12133 12487 --
NM_006614chr3103586 3457 3170 2528 1056 769 539 461 226 70 73303 1325 1170 1122 487 241 167 --1234
NM_006620chr6154746 4696 4368 4216 4194 4173 3962 3461 3432 3322 3088 1402 196 172 146 54108 3114 1593 1282 335 24319 1837 34893 4343 3976
NM_006624chr10101949 1936 1903 1760 1663 1533 785 386 192 76 3768 404 268 ----
NM_006626chr982319 2207 1916 1818 824 708 564 404 1904 ----
NM_006628chr1554654 3220 3087 1652 826 34601 4148 3747 21600 1017 1416
NM_006629chr1872818 2333 2238 2062 1977 749 52 --2731 203 --
NM_006633chr54796 252 129 120 ------
NM_006644chr132454 423 ----2550 515
NM_006650chr563940 3184 2874 2442 1081 950 11424 13298 13439
NM_006654chr1284814 4803 4584 4101 3047 1831 1169 341 1501 14075 23695 1551
NM_006667chrX61171 1063 975 959 355 329 2322 74 142 --
NM_006690chr202883 718 12379 11599 22257 1761
NM_006699chr182665 2586 2160 2035 1977 1773 974 714 1194 --11048
NM_006717chr933054 773 251 53392 3099 3077 2501 174 32602 849 131 --
NM_006718chr62723 260 1409 11032 --
NM_006720chr10104703 4108 3882 3659 3426 3206 1754 908 803 687 2221 143 24463 590 --
NM_006722chr3112743 2646 2638 2597 2177 1178 1135 786 633 565 276 12882 ----
NM_006726chr4143 2948 510 --2183 111
NM_006729chrX115480 5398 4758 4593 4558 1277 1005 213 113 45 38 44712 3767 1455 1222 1164 --
NM_006734chr621365 439 31012 419 186 --1386
NM_006738chr1544476 3376 1030 386 22985 747 23637 1188 13886
NM_006746chrX41351 980 570 283 2342 120 ----
NM_006750chr16147272 6917 6780 6755 5948 5655 3169 3030 2708 2524 1860 1418 1306 215 35428 417 246 36617 2421 1632 17923
NM_006751chr23724 388 191 21059 256 ----
NM_006755chr111134 ------
NM_006766chr872246 1998 1782 1015 802 336 273 ------
NM_006775chr692860 2469 958 843 667 593 561 518 427 --12867 --
NM_006777chrX92944 2543 2371 2326 2017 1063 701 646 245 ----169
NM_006805chr541705 1197 1186 1105 --2363 297 21400 1126
NM_006807chr1781363 1276 1203 310 288 280 258 251 21165 1144 ----
NM_006811chr206953 754 748 387 174 167 ------
NM_006813chr62591 111 ----129
NM_006815chr1241331 1003 559 347 --11155 --
NM_006818chr1----1317 --
NM_006828chr61549 --1467 --
NM_006832chr141728 --11094 --
NM_006851chr1232232 2160 786 51895 1788 1177 418 96 2486 265 11029
NM_006854chr751863 1324 457 140 66 ------
NM_006873chr2153549 2916 2546 2525 2517 2375 2333 2198 1311 990 735 653 624 153 56 33159 2186 431 13251 --
NM_006884chr361919 1833 1259 1229 494 466 --1334 1624
NM_006885chr1684120 3834 1639 1582 1183 1169 625 92 34098 3768 3284 --23641 3192
NM_006888chr1493338 2429 1275 1033 732 493 387 163 72 --1125 --
NM_006892chr205532 416 348 266 258 1404 11066 --
NM_006892chr205532 416 348 266 258 1404 11066 --
NM_006908chr751436 1128 1058 376 153 1318 --1467
NM_006912chr172570 2476 2010 997 929 911 804 3590 438 50 ----
NM_006916chr271413 1283 1142 398 260 147 134 --11199 --
NM_006918chr11164662 4600 4532 4390 4061 3953 3770 3704 1851 1320 1096 1055 999 765 744 392 35071 4727 4226 25220 4481 --
NM_006920chr241969 1582 1435 696 --12059 11659
NM_006922chr292511 2222 2088 1900 1821 691 534 368 279 22178 141 1879 --
NM_006924chr1784388 4034 3974 3142 1686 1200 1140 915 22857 583 21696 657 1927
NM_006930chr561754 1524 669 498 477 47 --11496 --
NM_006940chr1221656 242 21872 655 11747 11322
NM_006954chr1093352 3225 2616 2593 2456 2400 2120 649 176 42468 2239 1253 1066 33104 2391 1396 --
NM_006962chrX3837 190 165 11304 --1298
NM_006974chr1093352 3225 2616 2593 2456 2400 2120 649 176 42468 2239 1253 1066 33104 2391 1396 --
NM_006981chr972132 1869 775 494 343 131 61 22460 286 --1577
NM_007005chr941400 1276 403 90 1971 11458 --
NM_007006chr16103299 3232 2584 2283 1125 1037 747 715 150 25 13167 12345 --
NM_007007chr12124573 4357 4080 4016 3014 2936 1906 1766 1681 1585 824 746 34836 881 32 11282 13340
NM_007011chr15126084 5508 5461 5350 4808 4753 4264 4200 2072 1526 1515 522 35082 2748 2192 15217 --
NM_007013chr81904 ----1154
NM_007026chr17----1561 --
NM_007038chr21136077 5974 5774 5039 4989 4418 4082 2101 2023 1959 1812 264 138 44154 3784 1793 960 21547 291 14470
NM_007039chr1461978 1924 1902 1873 1844 1599 1621 12233 12154
NM_007042chr362140 1837 1633 964 568 504 ----1341
NM_007043chr121488 ----12023
NM_007050chr20237933 7461 7455 7342 6785 6554 6546 5743 5327 5031 4910 3057 2688 2314 2199 2118 2094 1998 1720 1645 924 767 255 27855 2675 14940 15669
NM_007054chr583858 3536 3476 2612 2564 1520 922 58 3955 356 72 ----
NM_007064chr391692 1573 1137 675 384 309 260 229 171 152 156 --
NM_007078chr10143066 2807 2656 2440 2278 2270 2165 2059 1021 579 308 262 231 208 --12795 --
NM_007106chr13102830 2613 2287 810 622 397 329 314 293 162 194 --12003
NM_007107chr341623 830 497 130 --32379 2302 2128 --
NM_007114chr393160 2540 2304 2197 2136 1278 944 492 121 22588 2078 12151 12613
NM_007124chr621663 365 --11827 21865 151
NM_007137chrX145487 5433 4765 4460 1974 1651 1553 1456 1238 1045 838 738 395 224 186 31932 872 335 45294 483 471 416
NM_007145chr194959 900 423 181 11263 --190
NM_007146chr1772264 2102 1890 281 261 76 31 31067 310 22 1371 22880 595
NM_007166chr1141032 993 972 410 --31326 73 55 --
NM_007172chr22123243 2937 2878 2577 2533 2233 2129 719 214 151 118 22 33085 2849 2352 13178 --
NM_007173chr11102405 2277 2029 2022 1938 1913 1836 574 527 157 ------
NM_007175chr853541 2802 2641 1176 595 53614 3263 2712 2619 1216 12522 --
NM_007195chr185194 169 163 143 131 33757 2291 507 --1981
NM_007198chr851358 1242 1214 1168 656 31641 1498 559 --1219
NM_007200chr1544476 3376 1030 386 22985 747 23637 1188 13886
NM_007212chr141694 903 740 669 --12238 --
NM_007218chr83649 259 58 1729 ----
NM_007222chr891807 1756 1633 1386 1141 572 468 448 233 11847 ----
NM_007249chr13209402 9117 8381 8249 7974 7916 7750 6908 6661 6269 6080 3783 3622 3538 2648 2537 2482 1090 941 536 78784 8698 7737 7473 3399 1980 970 1371 --
NM_007269chr13482 400 394 ------
NM_007276chr741066 1034 750 325 184 1803 --
NM_007287chr3102982 2868 2702 2094 1001 937 737 703 597 477 43223 2269 2150 421 23066 320 --
NM_007288chr3102982 2868 2702 2094 1001 937 737 703 597 477 43223 2269 2150 421 23066 320 --
NM_007289chr3102982 2868 2702 2094 1001 937 737 703 597 477 43223 2269 2150 421 23066 320 --
NM_007294chr1761015 955 406 282 255 221 21325 949 ----
NM_007295chr1761015 955 406 282 255 221 21325 949 ----
NM_007296chr1761015 955 406 282 255 221 21325 949 ----
NM_007297chr1761015 955 406 282 255 221 21325 949 ----
NM_007298chr1761015 955 406 282 255 221 21325 949 ----
NM_007299chr1761015 955 406 282 255 221 21325 949 ----
NM_007300chr1761015 955 406 282 255 221 21325 949 ----
NM_007302chr1761015 955 406 282 255 221 21325 949 ----
NM_007303chr1761015 955 406 282 255 221 21325 949 ----
NM_007304chr1761015 955 406 282 255 221 21325 949 ----
NM_007305chr1761015 955 406 282 255 221 21325 949 ----
NM_007345chr1861721 877 791 754 520 341 22106 419 --22163 62
NM_007347chr1592950 1048 1013 999 951 731 635 166 72 22938 757 1863 --
NM_007350chr12144632 4568 4427 4271 4169 3519 3178 3053 2983 2931 2831 1757 1367 541 34026 2864 709 --294 24
NM_007358chr161644 515 508 483 406 59 32017 1378 204 ----
NM_007361chr145144 86 77 71 42 --1439 --
NM_007373chr1041696 1533 634 347 1258 11724 1703
NM_007374chr14258 42 2529 397 ----
NM_007375chr162745 2131 2096 342 105 78 --11815 11848
NM_009585chr33852 736 49 2578 188 1197 --
NM_009585chr33852 736 49 2578 188 1197 --
NM_012062chr122903 39 2968 392 --2300 161
NM_012074chr143832 376 227 31094 429 216 1870 --
NM_012081chr5133678 3318 3061 2783 2521 2473 2307 1431 1099 1027 979 492 212 12907 12658 13189
NM_012084chrX------1467
NM_012092chr251948 1875 585 483 64 1207 --2373 316
NM_012096chr363581 2444 1365 1126 932 63 --23493 2892 --
NM_012097chr272246 2202 2196 1689 1573 724 68 22126 1399 ----
NM_012102chr152668 2307 704 92 86 --11919 --
NM_012104chr11113849 3651 3236 3202 2950 2873 2405 1185 648 634 522 23639 2388 --13795
NM_012104chr11113849 3651 3236 3202 2950 2873 2405 1185 648 634 522 23639 2388 --13795
NM_012115chr64608 562 470 424 1220 ----
NM_012120chr682580 2400 2186 1180 1002 992 985 806 22823 664 ----
NM_012129chr74731 394 322 61 --22488 579 --
NM_012137chr192846 2748 2467 2115 1923 1917 1017 253 125 --3661 526 32 --
NM_012141chr1373657 3539 2590 1612 976 406 62 34041 3411 1276 23016 1418 11302
NM_012153chr1162179 1913 620 561 348 296 132 11011 --
NM_012156chr2083239 3085 2479 2362 1250 1220 834 493 11264 22800 646 33078 539 516
NM_012157chr35954 868 365 201 126 --1783 --
NM_012158chr1361728 1620 1479 1451 516 292 1553 11805 --
NM_012164chr9157179 5654 4687 3027 2986 2976 2150 2054 2025 1900 1467 882 729 486 417 26487 1516 12822 35592 5578 1302
NM_012180chr43701 495 191 2694 229 1588 --
NM_012193chr11134863 4783 3415 2122 1955 1776 1538 1462 1279 1089 250 234 206 1610 --1441
NM_012199chr133111 1291 1253 14201 1804 1173
NM_012214chr2176028 5652 5267 4915 4848 4649 4396 4208 4089 4011 2368 2121 2098 1337 1087 980 870 36085 4105 676 ----
NM_012215chr1051978 1966 1492 1420 634 1121 1139 11987
NM_012223chr211039 2944 510 --2920 125
NM_012229chr1061358 1262 1118 926 239 201 ------
NM_012233chr221115 842 ----1410
NM_012234chr383775 3112 3062 3022 2769 1454 1188 51 13389 ----
NM_012238chr1091727 1248 1221 1156 526 463 256 131 63 11417 ----
NM_012249chr2113260 2618 2515 2390 2379 2355 1309 1035 298 121 104 11087 ----
NM_012252chr7135337 4833 4729 4461 4139 4099 3344 2135 1507 1314 952 342 195 44918 4335 3402 1048 ----
NM_012259chr641426 576 324 62 21209 1097 11348 --
NM_012262chr155246 5155 4458 3813 625 54735 2071 1917 945 643 11046 --
NM_012281chr792176 1589 1567 884 388 279 161 134 106 12455 --1342
NM_012286chrX174 ----1437
NM_012287chr384477 3874 3674 848 831 770 734 685 44067 2820 1140 157 --13925
NM_012288chr6155784 5666 5613 4134 3657 2069 2057 1932 1684 1624 1438 1030 915 505 119 35700 4993 3917 24841 835 --
NM_012294chr7104067 4016 3990 3684 3494 3368 2848 1185 220 144 62842 1326 1309 1140 321 121 23571 2870 --
NM_012297chr472370 2233 1820 1041 634 471 309 22281 2273 2987 971 11698
NM_012301chr721673 1487 22212 251 ----
NM_012302chr14993 447 390 128 21070 170 11165 1294
NM_012309chr11114764 4605 3944 3920 3690 3556 3413 3403 1555 1261 955 32001 1584 768 23867 3682 11473
NM_012316chr195667 5648 5006 4235 4215 3518 2225 2078 184 24368 502 25029 4314 --
NM_012319chr184888 845 718 422 --1862 --
NM_012325chr2041027 650 116 63 1436 11316 --
NM_012330chr1081606 1439 601 249 160 108 85 23 11323 ----
NM_012334chr5144288 4178 4155 4127 4062 3878 3845 3807 3378 3328 1893 829 655 220 34566 285 89 24342 1344 --
NM_012340chr201102 ------
NM_012382chr593554 1565 1380 851 821 657 288 223 107 23157 1056 13577 --
NM_012388chr1552627 964 744 346 286 12820 11250 12901
NM_012395chr783446 3153 2781 2740 2667 1310 894 192 21001 444 1164 --
NM_012399chr2292029 1941 1743 1638 809 688 574 343 335 11453 --11986
NM_012414chr17806 783 754 727 672 650 122 --1773 --
NM_012420chr1032179 427 384 22071 734 --11740
NM_012425chr1082549 2539 2499 2455 1865 705 566 242 21800 1044 21960 625 --
NM_012454chr63587 135 73 --1436 --
NM_012460chr141367 ------
NM_012463chr1211125 31157 456 354 ----
NM_012464chr431882 984 67 32039 1051 22 22399 167 --
NM_012479chr762482 2065 2008 1782 1024 816 1168 ----
NM_013229chr1252853 2837 1884 296 273 --12507 --
NM_013230chrY41627 1254 1236 1139 31488 409 264 11208 --
NM_013231chr1463428 2878 1329 780 494 299 64028 3968 3829 3762 3489 1340 --23719 434
NM_013233chr271447 1441 1048 914 531 178 152 --21103 118 --
NM_013235chr52835 355 --1922 1936
NM_013236chr2251254 1223 861 495 320 31123 1043 485 ----
NM_013243chr1571367 1291 1243 1177 1070 299 171 2152 61 11268 11203
NM_013253chr1141434 1410 1026 417 --11077 --
NM_013255chr7158276 8047 7504 7498 6998 6108 5761 5537 5411 2938 2811 1747 1682 1396 784 78304 7732 5972 5867 3144 2714 1587 33022 897 604 13041
NM_013257chr8102434 2247 2104 1987 1829 1562 724 519 421 157 ----22267 34
NM_013261chr4103255 3232 2998 1296 1182 905 655 468 453 210 23311 131 11342 --
NM_013269chr12164549 4268 3819 3600 1678 1656 1517 1222 1118 957 670 557 318 159 149 73 11183 23676 968 --
NM_013277chr1241103 1001 717 151 ----11055
NM_013281chr2041413 1353 550 434 ----186
NM_013286chr383749 3723 3539 3435 2869 1137 569 154 13504 23127 301 13665
NM_013293chr71553 ----1524
NM_013296chr12434 410 ------
NM_013302chr16133963 3709 3655 3428 3274 3086 3040 1710 1625 1537 1403 1114 118 54569 4411 1744 1667 1036 13373 1821
NM_013309chr1552340 2266 2130 871 174 22470 778 1882 --
NM_013313chr2233233 2694 1421 23320 809 1945 12924
NM_013316chr751053 1013 396 343 191 11072 ----
NM_013341chr282943 2739 2466 1942 1822 1014 817 417 1406 ----
NM_013354chr821479 1200 31417 1063 1055 1581 11431
NM_013372chr15113310 3242 2894 2836 2511 2120 1192 785 715 694 403 33124 739 65 12089 --
NM_013374chr352937 2652 2538 2523 1157 22839 1061 ----
NM_013381chr1262061 1675 926 797 541 447 --12419 --
NM_013386chr151581 484 300 185 93 ------
NM_013390chr951403 1210 697 679 188 11467 11268 --
NM_013396chr2161267 1222 1132 995 133 125 11446 1251 --
NM_013438chr91648 11369 --1546
NM_013943chr162938 2625 2324 950 709 85 21086 999 1337 --
NM_013956chr81150 --134 --
NM_013957chr81150 --134 --
NM_013964chr81150 --134 --
NM_013989chr1485042 4624 4394 3622 1837 720 681 217 34720 3836 2004 --24265 1336
NM_013995chrX62610 2289 2109 2076 221 202 42623 2179 2038 1794 1233 --
NM_014005chr593126 2578 2397 2352 2119 929 853 695 271 52380 2361 1219 1185 735 ----
NM_014011chr262339 2215 1923 941 641 579 1707 11964 --
NM_014016chr341517 1049 316 256 21336 362 2369 51 --
NM_014021chr153315 2202 1036 577 407 33169 2414 846 22832 821 13331
NM_014028chr673241 2843 2192 1019 933 600 260 1253 1909 --
NM_014034chr671467 1448 1362 1241 1097 995 50 187 --11200
NM_014039chr1161370 1054 1042 421 234 80 --1207 --
NM_014043chr36654 585 374 239 185 96 31541 1347 80 ----
NM_014044chr21168 --167 --
NM_014048chr1694798 4469 4043 3918 3310 3266 1467 1341 654 53511 1823 688 486 106 ----
NM_014057chr961215 1172 1035 232 167 147 1196 11552 11635
NM_014089chr1332097 1721 283 21991 1737 1776 --
NM_014106chr1562268 1966 1934 1859 875 202 22319 963 1383 --
NM_014112chr8145476 5259 5229 5217 4825 4721 4501 4094 3405 1198 417 338 250 235 13610 15070 13880
NM_014117chr1662069 1893 1677 243 196 73 22119 1800 22669 1025 12386
NM_014141chr775224 4859 4564 4533 1981 934 532 54973 4667 1946 1802 224 --24334 3741
NM_014155chr11147072 6050 5296 5100 4780 4629 4574 2577 2518 2482 1623 1130 243 170 35555 2009 531 15206 --
NM_014157chr1663862 3337 3054 929 531 464 43960 3503 2711 380 12783 --
NM_014181chr2112878 2668 2562 2532 2454 2067 1798 1019 802 771 79 22955 287 1757 --
NM_014191chr125985 376 274 184 37 --11070 189
NM_014217chr161810 1729 1562 1255 617 499 1116 ----
NM_014240chr3164163 4149 4019 3802 3224 3189 3162 3026 2578 1618 1526 1452 1427 1418 545 514 ----33943 2544 732
NM_014243chr461855 1771 1467 495 346 280 32165 1757 619 --21896 851
NM_014246chr2291927 1817 1444 1437 678 626 419 271 265 21951 824 ----
NM_014253chrX82549 2216 1857 1734 1020 1002 491 87 3694 225 50 1376 --
NM_014260chr6180 ------
NM_014267chr11----1713 --
NM_014294chr821277 515 31471 1045 220 ----
NM_014298chr161202 ------
NM_014305chr133510 199 145 1469 1582 --
NM_014309chr22124907 4897 4592 4430 4321 4217 3619 3442 1190 435 254 82 23854 563 14804 15002
NM_014313chr161560 1282 1107 452 336 266 --11394 --
NM_014319chr1231721 1709 645 11786 1432 11889
NM_014331chr4165318 4722 2875 2736 2663 2531 2122 2035 1821 1473 1247 1136 781 658 457 323 32976 930 50 17347 16559
NM_014333chr1162379 1948 839 390 286 151 22417 2013 ----
NM_014335chr1531378 892 338 2357 242 --11344
NM_014342chr1141300 595 383 328 11274 1373 --
NM_014363chr1341081 1074 1012 281 11163 --1219
NM_014376chr562572 2182 1868 958 563 339 11909 12592 11896
NM_014388chr1155543 5475 5460 5011 4953 4891 4851 4814 4627 4410 3766 1611 1598 1319 820 1980 33777 1685 473 --
NM_014392chr451466 1112 1034 277 150 ----11143
NM_014395chr441338 1243 626 541 31898 1766 1516 11260 --
NM_014421chr472067 1809 1306 858 840 684 90 31597 724 416 11487 1605
NM_014423chr575389 5147 4880 4299 4233 849 154 25229 895 14102 --
NM_014445chr351809 945 838 797 200 32370 881 305 ----
NM_014456chr1091866 1842 1222 592 561 448 402 369 350 1634 ----
NM_014458chr161222 1126 1013 355 187 158 --2448 297 --
NM_014494chr1672016 1943 1888 1579 1532 1461 820 1140 32096 611 356 --
NM_014495chr14595 495 464 196 1543 ----
NM_014504chr761767 1576 1559 1532 458 442 ------
NM_014517chr341824 1487 1421 1260 ------
NM_014521chr251708 1588 1444 1198 1182 11884 ----
NM_014547chr156757 517 271 255 154 72 1635 ----
NM_014547chr156757 517 271 255 154 72 1635 ----
NM_014548chr1551593 1485 1142 1075 620 21404 611 --21453 590
NM_014572chr1361426 1271 1259 1251 528 437 1229 ----
NM_014584chr1451492 1369 342 200 46 ------
NM_014585chr281255 1244 991 782 395 294 159 69 --1378 --
NM_014586chr21104818 4521 4048 3583 1781 1054 815 743 626 140 24236 1493 34289 3688 1513 --
NM_014607chr232021 1987 346 --1471 1800
NM_014614chr251487 936 313 299 91 1557 --1972
NM_014615chr16103080 2909 1380 1041 943 621 498 317 130 104 32483 572 547 21371 534 --
NM_014618chr9199 154 --169
NM_014636chr984019 3991 3842 3547 3309 1712 1562 550 11522 23447 993 --
NM_014666chr561296 910 898 892 208 183 11222 11182 --
NM_014674chr383939 3624 1537 1459 1438 1253 558 317 22759 1325 12720 13735
NM_014683chr1782091 2080 1591 1585 857 740 582 236 1611 11522 --
NM_014686chr1952573 2422 1626 712 591 1498 --1601
NM_014701chr151591 22133 578 23455 948 --
NM_014702chr673259 3059 2747 2586 1308 875 275 13198 12296 --
NM_014705chr7101898 1507 1497 858 726 610 305 216 176 125 2561 49 21858 524 22079 501
NM_014711chr1652107 1862 1686 416 46 21838 353 --12116
NM_014715chr11198 1634 --1917
NM_014717chr193827 573 245 ----1630
NM_014721chr6166220 5980 4864 4852 2504 2455 2370 2259 2078 1552 1248 995 985 676 292 191 86539 6066 5894 2918 1780 1481 1142 910 26986 6032 25013 4751
NM_014729chr872315 2277 2100 1467 822 785 714 2590 560 ----
NM_014730chr1265258 4207 4113 3990 2051 665 21724 1041 24592 4012 --
NM_014730chr1265258 4207 4113 3990 2051 665 21724 1041 24592 4012 --
NM_014732chr1655352 4591 3995 1298 844 45801 5539 5521 5116 34226 1614 641 --
NM_014733chr562190 2048 1955 717 492 46 12299 ----
NM_014739chr683955 2916 2785 1473 979 895 708 242 12995 133 --
NM_014743chr482774 2699 2399 2074 1996 869 767 569 33070 1241 83 22433 522 12665
NM_014746chr2124171 3903 3841 3792 3572 3529 3459 2948 1680 1350 837 476 24178 1330 --11435
NM_014751chr882002 1794 1788 1629 485 301 158 49 187 ----
NM_014755chr2133961 3669 3278 3132 3009 2745 2614 1652 1496 1155 908 728 374 12621 ----
NM_014765chr182659 2642 2599 2358 2320 1021 988 343 11645 12453 --
NM_014766chr732795 2363 88 23769 1243 1548 22955 64
NM_014781chr851255 1102 853 457 101 2874 840 ----
NM_014787chr192777 2591 2377 2203 2125 2063 494 468 368 21949 204 1239 --
NM_014803chr1092920 2514 2102 1130 1091 963 807 150 34 72974 2582 2525 1063 1021 947 290 ----
NM_014810chr173612 3135 3089 2411 2357 840 89 23189 2756 13407 13433
NM_014811chr91219 ------
NM_014812chr141527 1520 1499 1445 31737 1701 1264 --183
NM_014820chr33501 425 257 ----1678
NM_014822chr44560 428 270 239 --1588 --
NM_014835chr20102149 1715 737 706 672 637 606 385 278 87 1497 ----
NM_014839chr1102346 1727 1009 940 659 426 195 138 120 36 21750 371 --22195 969
NM_014850chr394731 4515 4344 4206 3823 3357 3069 1001 640 44911 4534 1351 696 --1276
NM_014864chr1124186 3858 3817 3332 3237 3222 2897 1726 1682 482 433 168 44341 3276 894 506 --43750 3397 1715 1655
NM_014872chr91308 --2402 335 --
NM_014873chr154392 4107 3025 753 106 21773 967 34436 4308 723 --
NM_014877chr17217755 7574 7543 7387 6715 6368 6262 5476 4730 2674 1984 1537 1529 1372 1252 1119 1098 965 852 558 202 11992 17460 16427
NM_014891chr721700 1316 31519 1208 1150 11505 1643
NM_014893chrY102180 1636 1463 759 603 536 500 346 129 54 11513 ----
NM_014899chr5103089 2595 2253 2125 1248 846 777 201 88 72 43186 2958 1003 185 21920 228 12300
NM_014900chr231122 970 896 1238 --1984
NM_014903chr1232279 1611 1524 31892 832 500 21648 144 --
NM_014904chr1052700 1611 1207 878 353 72886 2645 2505 1378 1241 1105 1013 13113 2939 627
NM_014905chr261993 1981 806 613 416 243 21866 186 ----
NM_014906chr17114130 3944 3551 3347 2800 2577 939 826 568 510 457 2876 84 1204 13649
NM_014909chr1493990 3948 3078 3066 1476 957 702 486 109 --22598 1508 13112
NM_014912chr1083404 2520 2277 1104 924 478 434 195 12812 23451 2422 --
NM_014918chr1551648 1034 325 304 250 1343 ----
NM_014920chr672674 2571 1281 1028 903 225 80 33787 3153 897 13730 --
NM_014923chr1332163 2151 1840 12292 11960 --
NM_014929chr2145 ------
NM_014932chr361566 1243 751 491 463 83 --1726 1519
NM_014936chr672172 1940 1148 613 357 198 45 62598 2227 2145 2110 1825 1793 12333 --
NM_014939chr1821559 547 ----2154 120
NM_014944chr141218 1184 1000 917 21236 1052 --1367
NM_014946chr2102969 2785 2714 2256 1149 903 843 694 677 260 1170 --128
NM_014947chr163115 2461 2168 902 516 120 12258 12480 12634
NM_014950chr1451456 1195 301 203 150 21533 1378 --1588
NM_014951chr1062096 1790 1749 778 442 349 22224 502 ----
NM_014953chr13104239 4192 3371 3088 3006 1679 1215 1162 581 209 2943 726 ----
NM_014961chr471955 1777 1693 1589 1486 890 53 11756 11412 12088
NM_014962chr2072918 2521 2457 2319 605 400 166 42737 2482 2276 420 --11921
NM_014978chr1071811 1362 592 461 356 310 221 --21258 1196 --
NM_014982chr14115082 5075 5069 3907 1868 1819 1769 1746 1478 1056 76 55418 5000 3535 3375 602 ----
NM_014988chr472782 1757 1083 793 530 405 73 --22175 691 1416
NM_014991chr4133221 3146 3114 2898 2444 2355 2326 2049 1107 1040 953 874 153 21262 687 11091 12771
NM_015000chr1242964 2447 2372 450 33121 3112 578 ----
NM_015004chr31112 ------
NM_015008chr363102 3037 1390 355 336 204 33308 3118 259 23344 699 --
NM_015009chr33837 813 626 ----1635
NM_015020chr1673906 3318 2672 2636 2564 2414 813 12628 12471 --
NM_015025chr261833 735 543 530 172 127 2746 308 --11666
NM_015026chr12114277 1728 1678 1592 1508 1501 1196 999 604 431 409 33024 1390 1127 --13608
NM_015032chr1332444 943 101 32462 2091 1891 12723 --
NM_015035chr20116355 6179 5250 4937 4698 2481 1740 1594 1394 514 202 1350 45535 2666 2053 653 22324 1131
NM_015040chr2113188 3009 2760 2648 2571 2286 2239 1358 1173 1150 699 11364 32929 1340 161 --
NM_015045chr1032187 1655 397 31782 909 833 --31691 1619 784
NM_015049chr252985 2427 1261 1205 1132 21144 312 31086 773 557 12516
NM_015051chr9133426 3309 3155 2942 2711 2566 1110 1044 763 698 417 257 155 43405 2432 2131 596 12910 --
NM_015054chr124519 446 340 150 1114 ----
NM_015055chr1152946 2654 2445 2254 684 32980 2842 376 ----
NM_015056chr2172660 2381 2304 2041 1746 1740 24 --11928 --
NM_015068chr763300 2417 948 521 327 38 33132 1388 829 12872 12805
NM_015071chr5176443 6062 5989 5622 5601 5585 5523 5319 5135 5077 4811 4540 4351 2307 1722 735 201 44166 4137 2551 540 34119 1816 258 --
NM_015074chr184987 4728 4694 4436 3052 1573 1200 1152 54106 3558 3162 1602 433 11340 13167
NM_015076chr6154495 4154 4022 3792 3746 3675 3042 1745 1616 1445 1411 838 445 355 105 13896 ----
NM_015077chr17114734 4468 3989 3889 3097 945 929 903 887 753 429 24332 4207 ----
NM_015087chr13112642 2571 2013 1001 814 806 562 507 475 262 30 32538 1704 538 --12621
NM_015090chr1146280 6224 5578 5224 4421 3920 1927 1833 1220 1086 880 495 485 64 24510 518 ----
NM_015091chr141320 ------
NM_015092chr1684659 4184 4104 3804 3787 3522 828 78 31483 1433 277 14060 --
NM_015093chr681787 1678 1504 1141 626 615 576 29 11259 ----
NM_015097chr341612 677 591 412 31918 492 387 1632 --
NM_015110chr972366 2241 2228 1769 940 185 90 31877 1560 169 21633 637 1680
NM_015115chr4103211 2996 2884 2473 2236 1980 851 666 336 82 ------
NM_015130chr441048 1018 883 549 --1436 1897
NM_015132chr751373 783 747 610 258 2354 117 ----
NM_015135chr71171 ------
NM_015137chr872539 2277 2167 1930 1786 829 419 1846 1462 --
NM_015138chr1592684 2447 2290 2022 1966 1905 1040 726 527 ------
NM_015141chr362671 2490 483 276 255 169 31969 1914 662 ----
NM_015144chr16103823 1582 1391 1060 801 572 206 180 64 22 22921 2532 12728 12782
NM_015149chr162058 2005 1894 1875 870 242 31928 1456 260 --1143
NM_015153chr62780 689 ----1128
NM_015155chr1053054 2837 1237 1222 1024 22272 711 13328 --
NM_015156chr1453988 3638 2999 2779 1274 23125 3067 --12650
NM_015170chr862244 1862 1558 1521 1469 88 12207 --2672 176
NM_015186chr91404 --1344 2146 99
NM_015192chr2082216 2077 2050 2039 1954 1118 1111 359 1264 --12156
NM_015200chr492605 2561 2201 1787 1753 892 567 197 62 22409 113 22530 2069 --
NM_015206chr15123873 3830 3673 3534 3455 3040 3032 2871 2674 2665 1259 1124 --12415 --
NM_015208chr18153931 3925 3687 3647 3593 3400 3311 3079 2867 2705 1489 1305 1181 752 442 53630 3297 3100 1174 593 73427 3341 2698 1499 1286 1079 617 23115 1273
NM_015215chr162683 2066 1972 1264 1112 134 21193 280 23124 3012 21242 237
NM_015219chr1752608 2504 788 703 339 1473 1771 --
NM_015230chr471604 1547 1445 1163 606 313 71 ----1562
NM_015236chr431487 538 31 3961 526 379 1453 21090 449
NM_015247chr16114416 4138 4126 3830 1587 1568 1225 1217 920 784 24 24363 2162 --15250
NM_015251chr1662230 2207 1777 701 290 57 2779 360 ----
NM_015263chr1531169 946 207 ------
NM_015265chr242027 1875 1720 237 22488 714 1909 124
NM_015267chr125867 526 495 253 107 31701 786 507 21603 260 --
NM_015268chr35613 578 454 296 275 ------
NM_015269chr13510 477 103 ----1131
NM_015271chr4104318 4139 3073 2681 1540 882 586 433 392 366 23451 1440 1547 22880 382
NM_015272chr1651956 1414 1347 1332 351 11869 ----
NM_015278chr6103426 3361 3060 2860 2394 2272 1015 982 818 706 22222 230 ----
NM_015285chr1832411 2031 1785 12574 22139 166 --
NM_015291chr152821 2685 1327 1131 988 22808 1392 12796 --
NM_015310chr8198315 7656 7378 7142 6378 6241 5912 5403 5377 5136 3353 3292 3017 1882 1813 1484 1282 1165 107 27867 1041 57895 6128 5963 3167 2907 38361 1891 42
NM_015313chr11114843 4289 3820 3420 3300 1933 1869 1121 958 494 471 23871 3294 21231 929 --
NM_015315chr583336 2799 2631 2497 1075 788 610 333 ------
NM_015317chr272637 2309 2212 2201 1927 901 730 22665 73 22677 114 1245
NM_015323chr681651 1599 1547 1349 576 511 413 104 2671 137 ----
NM_015326chr162860 2792 2500 2106 2046 146 32990 2977 1039 12113 --
NM_015335chr12122398 2381 2294 2286 2084 2002 1937 1862 1669 791 749 573 ------
NM_015336chr1252682 2673 2123 1860 363 2952 180 1881 32513 937 868
NM_015345chr652485 2165 1867 1037 599 3802 475 332 --21945 1888
NM_015347chr1292967 2835 2619 2550 2373 2145 921 809 498 1559 ----
NM_015349chr692948 2924 2362 2104 883 355 228 212 83 11160 42721 2140 764 692 --
NM_015350chr15549 485 379 174 30 ------
NM_015355chr1731943 1820 1633 1212 ----
NM_015365chrX94331 4212 4005 3937 3066 2725 1632 1605 1590 1772 1945 11167
NM_015375chr174175 4136 3869 3546 1317 249 228 11104 24385 1212 11828
NM_015381chr2211654 --1491 --
NM_015385chr10102683 2320 2134 2021 529 488 409 206 147 116 12469 1581 1991
NM_015387chr231447 323 267 11957 ----
NM_015394chr1262479 2125 1928 856 606 517 12470 --12304
NM_015396chr31125 1541 11238 --
NM_015409chr1262676 2540 2227 1959 778 93 32137 1980 130 137 12769
NM_015423chr1141600 1527 332 287 ------
NM_015435chr841298 1143 578 95 31156 1044 263 11055 1238
NM_015436chr4123232 3058 2819 2775 2601 1178 1026 738 687 667 608 434 23117 2304 12514 --
NM_015443chr171585 ----41495 1414 563 348
NM_015455chr563522 3116 1602 1489 1415 584 22508 1349 --13260
NM_015458chr8134759 4733 4636 4543 4164 3775 3729 1978 1530 1317 803 441 305 14676 45074 4808 4173 1433 --
NM_015460chr342137 1889 1373 554 21635 232 --11640
NM_015464chr741041 810 707 374 2386 316 ----
NM_015520chr332313 2024 630 42831 2730 2626 1908 ----
NM_015535chr284114 3996 3504 2975 1355 1244 1135 217 11565 33587 3138 599 13108
NM_015541chr331404 193 168 11292 11126 --
NM_015550chr772789 2467 2213 1403 1331 1325 933 42652 1294 896 499 1672 1946
NM_015553chr684958 4867 4756 1666 1311 868 781 63 ----1499
NM_015554chr1582940 2933 2589 2313 1003 990 727 141 --22847 2486 --
NM_015556chr141224 ------
NM_015564chr573146 2691 2658 2564 2365 608 355 33374 892 248 12454 11270
NM_015565chr2152207 2001 1671 1622 1413 --31987 1475 399 --
NM_015568chr20114235 4137 4104 4072 3843 3812 3265 3197 2808 1581 809 13346 23515 883 --
NM_015569chr1124788 4656 4259 3701 3463 3422 1897 1795 1636 1538 583 46 11226 13579 21866 742
NM_015570chr781495 1411 1250 437 398 247 128 72 1268 1354 --
NM_015571chr6112617 2591 2533 2324 2018 1647 1012 977 715 442 164 --11667 12136
NM_015575chr263655 3012 1208 1160 1084 116 32629 1289 475 ----
NM_015577chr531672 497 177 1440 --11504
NM_015578chr1981886 1861 1589 728 609 584 233 77 31877 1379 203 ----
NM_015605chr1041538 1385 637 289 21212 249 ----
NM_015610chr762571 2465 1782 861 730 252 22634 1114 1278 --
NM_015630chr26939 816 383 187 162 67 ------
NM_015635chr942128 900 652 629 21859 292 ----
NM_015640chr1134909 4595 4524 4359 4353 3758 3413 3354 2090 989 983 933 52 41929 1317 1037 651 --14373
NM_015641chr74386 92 86 64 11283 --1210
NM_015678chr1351739 1684 1676 497 471 21341 667 1478 --
NM_015687chr62533 186 1420 1195 --
NM_015691chrX52769 2719 2498 2287 121 12676 197 --
NM_015711chr193858 741 243 --1216 1634
NM_015840chr162508 2188 984 972 518 231 21882 266 --11874
NM_015841chr162508 2188 984 972 518 231 21882 266 --11874
NM_015852chr793550 2987 2474 2367 2262 1412 829 682 158 --71166 1082 662 578 494 410 74 13626
NM_015874chr46648 410 221 181 169 46 ------
NM_015878chr872247 2126 610 584 495 266 151 --11713 --
NM_015879chr18178129 7534 7407 6999 6875 6305 6159 5997 5417 3442 3274 3155 2416 1290 1173 736 432 77946 7645 6720 6293 5391 2389 643 38050 7715 2533 --
NM_015881chr1141434 1410 1026 417 --11077 --
NM_015886chr875684 5631 4892 4618 4391 541 271 12288 15118 13811
NM_015888chr173291 3267 3095 2391 2052 1290 1037 125 12684 12226
NM_015897chr191191 ------
NM_015904chr21552 ------
NM_015906chr1134240 4086 3999 3888 3425 3321 3155 1443 994 948 820 805 235 64639 4361 3510 1539 415 225 ----
NM_015911chr1----1651 --
NM_015912chr892535 2452 2438 1917 1640 993 909 818 417 ----12412
NM_015938chr341015 901 361 313 1160 ----
NM_015957chr11------1258
NM_015973chr11------1174
NM_015975chrX41802 1530 1349 135 21399 688 11281 --
NM_015986chr1761302 1220 1190 1134 179 153 21485 546 1968 --
NM_015990chr441094 856 206 132 ----1147
NM_015994chr144536 239 158 119 --1205 --
NM_015995chr15165503 5447 5288 5272 5224 5066 4890 4588 4342 4205 3581 2187 1671 1058 829 95 ------
NM_016003chr762571 2465 1782 861 730 252 22634 1114 1278 --
NM_016009chr184641 4133 3678 3236 3040 1822 333 217 44508 4487 916 884 21713 282 --
NM_016018chr862841 1921 1072 805 698 406 2969 48 12767 12614
NM_016021chr653037 3014 2679 2536 2347 12838 22240 446 --
NM_016023chr822133 1900 31691 544 362 1125 11621
NM_016025chr1651649 1540 1344 733 689 31763 319 142 11459 1790
NM_016026chr1471393 1103 932 500 147 89 64 --1112 --
NM_016040chr192566 2241 2186 1962 805 600 363 216 70 32537 1042 93 12224 11828
NM_016045chr2031681 1454 476 31542 357 154 ----
NM_016072chr12122187 2107 1904 1837 624 579 544 482 406 160 123 76 --1297 --
NM_016075chr1353036 2762 2298 2095 795 22489 420 22310 237 --
NM_016081chr44469 437 291 284 41665 478 335 133 --22263 1723
NM_016083chr683827 2593 1345 1330 1056 712 426 55 1702 1494 --
NM_016087chr761742 1464 1287 659 292 25 ----11185
NM_016096chr881988 1975 1689 1609 1571 279 163 104 ----1775
NM_016106chr14152 ------
NM_016121chr13947 456 89 1844 1734 --
NM_016123chr1251144 527 499 488 283 1154 --1461
NM_016131chr251857 719 666 439 296 ----161
NM_016132chr1562438 2330 1010 116 101 56 --13016 1337
NM_016142chr1141274 1091 342 317 21220 931 --163
NM_016144chr51516 ------
NM_016152chr361294 841 297 284 113 63 2498 406 ----
NM_016156chr1181992 1783 1461 636 547 540 443 329 --21893 1449 --
NM_016203chr71858 ------
NM_016206chr3238549 7240 7105 7020 6996 6807 6645 6190 5736 3613 3420 3071 2997 2758 2041 1536 1494 1324 1195 1097 524 474 164 38390 7057 5852 28377 3451 11277
NM_016220chr751886 1775 1463 899 648 21485 1451 3577 493 413 --
NM_016221chr552398 2099 1953 931 678 21906 483 ----
NM_016248chr13103747 2909 2733 2716 2659 2605 1515 824 577 238 23870 193 13460 1933
NM_016255chr692954 2895 2865 2549 2439 1202 1118 1074 871 53072 2299 2219 2106 365 11252 --
NM_016257chr1103141 2553 2252 1185 1121 705 698 633 239 184 22981 560 --12918
NM_016260chr2127460 7000 6372 6048 4926 2886 1952 1394 1284 1229 1165 983 65890 4820 4719 4680 2052 1435 46795 4684 1647 614 16625
NM_016269chr441117 969 272 221 21194 237 140 --
NM_016271chr1871886 1838 1546 1464 879 437 216 12319 ----
NM_016272chr2262416 2315 2275 1038 503 37 22740 1014 --1169
NM_016275chr361916 1032 540 249 162 51 22552 526 --22450 2414
NM_016277chr651453 1363 1271 619 408 1439 11445 --
NM_016281chr124391 308 271 217 11115 172 --
NM_016287chr151880 1567 1380 406 40 ------
NM_016289chr262156 1872 1728 1593 878 491 1712 --12084
NM_016297chr2113002 2782 2670 1434 1389 1365 764 466 202 64 53 53777 3091 1427 1411 1024 32878 1357 341 12790
NM_016308chr141627 769 652 482 --1300 1135
NM_016322chr952238 2052 1285 1156 133 ------
NM_016338chr56481 438 370 247 139 115 ------
NM_016353chr83950 449 125 31980 1787 671 1862 --
NM_016356chr652922 1983 538 488 35 --11091 --
NM_016357chr122841 67 1160 --11208
NM_016374chr131593 1058 511 1323 21494 1069 --
NM_016374chr131593 1058 511 1323 21494 1069 --
NM_016376chr1794049 3924 3867 3671 3413 3301 1591 1223 957 11349 ----
NM_016395chr1561971 1552 1509 1407 633 80 31957 1702 527 21879 396 --
NM_016396chr1582988 2698 2556 2451 2091 2026 1056 444 1206 12084 --
NM_016410chr9------132
NM_016422chr1172653 1946 1205 1131 1047 659 463 22507 312 12183 --
NM_016424chr1711954 21723 1257 --1184
NM_016426chr2232056 658 585 12116 --12203
NM_016436chr2021863 818 12729 12418 12691
NM_016448chr141482 531 329 140 268 43 ----
NM_016454chr15------1257
NM_016480chr54868 772 171 78 ------
NM_016488chr1261533 797 318 159 68 57 11325 1304 21984 477
NM_016513chr672674 2571 1281 1028 903 225 80 33787 3153 897 13730 --
NM_016530chr1553149 2985 1275 267 173 11462 12726 13868
NM_016531chr494181 4172 4032 4013 3764 3485 3294 741 144 34217 3392 1392 23825 863 --
NM_016542chrX31617 1611 520 1481 ----
NM_016559chr32568 184 21558 238 21374 435 --
NM_016562chrX51079 1060 419 266 251 11385 ----
NM_016577chr3114550 4495 4187 3887 3071 2869 1779 1635 1458 1329 784 1464 11056 --
NM_016587chr741066 1034 750 325 184 1803 --
NM_016598chr371517 1496 1407 1261 461 133 111 ----2578 97
NM_016603chr562042 1865 701 591 504 285 1147 ----
NM_016613chr452462 2155 1036 510 120 32541 1985 1076 1562 11027
NM_016620chr12371 247 1158 1995 --
NM_016621chr1193917 1660 1399 1335 1222 1120 484 199 99 34125 2976 53 177 --
NM_016626chr1831660 1652 358 41706 1119 455 344 ----
NM_016628chr103928 285 112 --2344 180 --
NM_016651chr1441167 974 126 60 ------
NM_016653chr241157 1108 914 172 1925 --21085 995
NM_016654chr1551325 1204 269 195 162 --1519 --
NM_016824chr1031469 1428 716 --11400 --
NM_016831chr172389 2226 2210 1486 817 796 38 1871 22418 1942 --
NM_016834chr1784130 3872 3415 2830 2574 1319 774 175 ----12657
NM_016835chr1784130 3872 3415 2830 2574 1319 774 175 ----12657
NM_016836chr25644 291 236 185 150 ----1711
NM_016839chr25644 291 236 185 150 ----1711
NM_016841chr1784130 3872 3415 2830 2574 1319 774 175 ----12657
NM_016929chr6124510 4394 4197 3761 3041 3021 2915 2909 1161 1035 206 33 33060 770 330 ----
NM_016946chr163436 2643 1258 1160 671 308 12747 1882 --
NM_016950chr461448 1201 985 607 506 92 21519 243 21404 312 --
NM_016952chr1194084 3980 3174 1642 1223 959 322 307 154 11079 ----
NM_016953chr2195414 5361 5308 5020 4974 4905 4218 4110 3960 3762 2424 2265 2061 2049 1996 1981 1330 1001 345 45400 5186 5157 2204 128 --
NM_016954chrX1233 ----1632
NM_017412chr841322 1206 951 886 2388 189 11254 1895
NM_017415chr574469 4289 3243 2811 1804 1390 599 1852 ----
NM_017420chr14103495 3155 3027 2781 2760 2498 1531 1455 1089 303 33709 2853 72 33410 2877 1285 --
NM_017423chr442157 1446 822 196 ----11735
NM_017437chr1431597 458 436 31633 446 302 ----
NM_017444chr821256 552 ------
NM_017447chr21114286 4240 4002 3556 3454 3325 2820 2775 1468 1263 647 74178 3807 3648 2945 2844 1722 308 21643 1111 --
NM_017452chr2011479 --11320 --
NM_017453chr2011479 --11320 --
NM_017454chr2011479 --11320 --
NM_017488chr271338 1147 1104 1098 312 205 147 21204 77 155 --
NM_017489chr851119 1102 913 277 90 11272 ----
NM_017516chr1121060 75 --1395 1207
NM_017548chr362172 1923 1572 499 292 267 22075 689 11596 --
NM_017551chr1042416 773 211 172 ------
NM_017563chr3106363 6259 6041 5821 5773 5607 5339 5004 2405 694 14192 35962 2253 1581 12236
NM_017580chr1072424 1514 1473 583 239 214 22 12180 11813 1508
NM_017581chr41322 2331 306 --1345
NM_017593chr42479 201 --186 --
NM_017594chr963070 2697 2531 2153 947 57 2739 317 12837 --
NM_017628chr494803 4004 1706 1513 979 643 336 254 173 35172 4343 4072 --13398
NM_017633chr653831 1265 693 681 244 33627 2759 46 53691 3681 855 619 150 --
NM_017634chr851935 1738 1731 441 30 21581 600 11464 --
NM_017635chr1121497 246 1385 1264 --
NM_017637chr9259446 9120 9091 8966 8933 8862 8297 7614 7472 7367 7050 6955 6837 5985 5897 5730 3650 3583 2396 1789 1432 1289 1182 988 412 47985 6816 2686 2163 --1560
NM_017643chr1742437 960 936 473 33136 1955 943 ----
NM_017644chr354630 1623 1294 112 102 34458 4051 143 ----
NM_017650chr7125653 5447 5029 4782 4690 4439 3840 3809 2439 2013 1289 670 44377 4347 4136 1999 11981 15965
NM_017655chr12625 366 11668 11307 1577
NM_017658chr14144678 4451 4280 3704 3444 3119 3034 2973 1861 1802 1793 1588 314 268 21679 485 11376 --
NM_017660chr1983333 2974 2307 1271 874 773 289 167 --1147 23324 2542
NM_017666chrX21977 845 21985 1802 11963 140
NM_017680chr921036 696 --1370 --
NM_017709chr184329 3476 3245 2892 1661 1607 593 480 1727 14265 --
NM_017712chr1955516 5208 4554 1373 394 46354 5790 2078 1036 55016 4847 4680 4541 1265 --
NM_017719chr372153 1568 924 909 902 600 432 2793 439 ----
NM_017730chr33616 564 558 ------
NM_017736chr1692823 2434 2251 1072 1001 783 556 408 226 43199 3078 2599 1229 22214 934 22626 2179
NM_017752chrX31942 1411 735 3205 188 119 --11961
NM_017754chr6144816 4200 4132 4123 4009 3473 3319 3107 1807 1332 1267 1259 1050 377 13763 --1192
NM_017761chr141259 1049 594 104 --11329 --
NM_017762chr1572450 2403 2379 2343 1926 875 401 ------
NM_017769chr1472679 1097 711 619 316 266 200 23025 2878 12153 --
NM_017770chr6112953 2664 2613 2466 2438 910 902 673 387 220 61 32315 1876 1828 1535 32779 2755 935
NM_017779chr132766 2618 1988 52031 1708 969 767 140 12297 --
NM_017780chr85775 682 640 121 32 2782 690 ----
NM_017785chr53551 425 396 ------
NM_017794chr91309 ------
NM_017799chr1491897 1779 1227 751 745 645 631 101 45 21866 1364 1189 --
NM_017801chr362645 2280 2116 716 79 67 22049 805 ----
NM_017811chr982585 2422 2063 2031 1201 851 433 90 22914 459 --1317
NM_017813chr8105132 4986 4457 4372 3966 3606 1864 1776 1520 1447 24322 3683 34496 2283 167 --
NM_017824chr1062382 2302 850 598 585 293 22317 971 11756 --
NM_017831chr18104040 3602 3290 3196 3155 1918 1141 726 382 98 1878 43859 3808 3516 1597 --
NM_017847chr12622 278 22228 93 22272 2045 11947
NM_017848chrX44694 4360 3938 733 22872 1289 --34094 3965 3100
NM_017850chr141543 986 549 347 21145 378 --11005
NM_017918chr4----1120 --
NM_017919chr9155756 5381 4986 4911 4600 4058 3544 1912 1886 1339 1306 1149 871 569 449 25449 3629 11211 --
NM_017925chr971858 1812 1732 1615 1410 1357 1284 1384 ----
NM_017935chr43506 123 116 1201 1154 --
NM_017938chrX72204 1598 1513 573 298 247 78 31864 1355 772 1226 11986
NM_017943chr1421056 1046 ----149
NM_017944chr1173137 2446 2043 620 496 391 234 --1343 --
NM_017952chr293946 3899 3612 3597 3314 3176 1649 1477 548 24173 1186 --14151
NM_017964chr24929 916 831 160 ------
NM_017987chr1062045 1908 1596 539 401 186 ------
NM_017993chr13----1267 1310
NM_017994chr752699 2676 1065 850 449 13019 11089 --
NM_018027chr10143325 3214 3146 3076 2813 2640 2629 2473 2106 2086 1127 1047 1040 49 22745 2576 --23291 2592
NM_018036chr14104309 3302 2838 1720 1394 1300 1198 1111 899 720 33457 682 148 --22888 434
NM_018043chr1181206 1105 459 417 291 274 241 190 --1393 --
NM_018045chr172703 2596 1022 692 586 246 128 32565 1104 460 ----
NM_018046chr551888 1810 462 450 168 --1303 --
NM_018047chr54945 369 235 48 ----1729
NM_018084chr2113336 3138 3013 2630 2091 904 598 498 423 227 171 42592 2057 2034 94 13175 --
NM_018086chr241850 620 103 53 11232 --31862 1775 556
NM_018098chr331228 936 196 ------
NM_018100chr653188 2526 2153 1264 145 --11306 2658 25
NM_018105chr84360 340 304 153 21017 204 ----
NM_018120chr841423 1304 280 174 1960 ----
NM_018121chr1083203 2735 2725 2566 990 835 486 263 22792 705 1421 --
NM_018126chr421155 308 11247 ----
NM_018131chr10198 2593 270 --1332
NM_018133chr371885 1655 615 273 259 235 214 11419 ----
NM_018142chr8------1216
NM_018147chr31205 ------
NM_018155chr3103232 2808 2236 844 681 569 413 318 246 27 1671 12170 --
NM_018157chr1283092 2621 1236 603 458 411 328 229 21254 81 ----
NM_018159chrX21580 286 21183 498 11077 1403
NM_018164chr124292 286 80 38 ----1318
NM_018167chr1481007 860 651 325 233 203 115 73 1139 ----
NM_018179chr124480 173 101 85 1450 --1156
NM_018191chr132257 96 12174 11699 --
NM_018200chr1562626 2230 1871 1634 885 344 22150 980 11841 --
NM_018206chr165576 526 496 288 263 ------
NM_018214chr62924 909 21140 1071 --21055 988
NM_018225chr9115298 5113 4291 4243 4152 1885 1200 1189 1118 885 846 13443 34431 3995 336 15217
NM_018227chr442641 2119 826 599 42486 2381 320 165 12413 --
NM_018246chr892868 2785 2532 2335 2127 899 835 757 102 1247 32428 1029 957 --
NM_018254chr12643 477 11813 12346 1631
NM_018257chr2042484 2313 1869 208 1299 --12256
NM_018261chr41398 166 1164 --
NM_018263chr251905 1644 823 371 243 12482 1208 11652
NM_018279chr1273045 2983 2677 2662 2624 1845 669 --194 --
NM_018287chr1061335 508 431 407 272 264 21235 527 ----
NM_018290chr451201 867 809 517 462 31121 982 94 ----
NM_018293chr372994 2910 2838 2523 1126 866 199 52244 1146 1054 645 139 12098 12761
NM_018302chr462278 1899 1597 717 585 271 31954 706 637 1768 --
NM_018312chr1151371 869 601 433 180 12183 ----
NM_018313chr372693 2563 2507 2316 539 393 241 12388 --1783
NM_018314chr115724 623 562 147 67 1108 ----
NM_018315chr441323 1183 1045 66 61473 1273 1177 1157 1054 424 31147 1021 263 --
NM_018318chr124871 692 335 281 2139 57 1848 --
NM_018323chr461714 1491 1188 1163 729 99 21604 54 --11321
NM_018327chr2051789 1731 1662 1458 727 1742 21270 595 11301
NM_018330chr1061687 1602 1390 1234 590 146 ----1393
NM_018340chr16134398 3718 3641 3520 3371 3065 1988 1207 1185 908 714 706 441 23744 176 31798 1260 970 1454
NM_018361chr8103996 3835 3512 3439 3160 2806 1479 1307 516 220 23458 3124 21531 718 1605
NM_018362chr1173993 2983 2473 1584 929 716 203 42784 2589 1500 1092 --1790
NM_018364chr174072 3289 1525 1353 745 279 171 ------
NM_018368chr6----1247 --
NM_018371chr85497 353 235 193 174 21561 1107 ----
NM_018374chr765249 5181 4065 3875 2024 1865 45143 1482 1094 601 1614 14800
NM_018375chr1471894 1614 1576 1470 1425 763 149 11551 --1566
NM_018388chrX21208 971 1195 11105 2252 130
NM_018394chr341416 1283 1167 589 1407 --11320
NM_018403chr3124133 3964 3788 3596 3349 2628 1624 1316 948 894 474 373 ----180
NM_018407chr83415 366 360 11108 ----
NM_018409chr4153270 3099 2586 1233 989 976 939 883 871 769 596 526 515 375 264 22254 783 --1747
NM_018427chr1631510 437 203 11104 11484 --
NM_018429chr542648 2610 2275 1914 170 --187
NM_018440chr8198614 8232 6979 6836 6594 6466 6264 5921 5709 3438 3313 3249 2447 2373 2307 2084 1399 850 496 45816 1419 1247 866 47616 6770 6409 3152 16846
NM_018448chr1231170 921 103 --1214 1404
NM_018452chr6_random83438 1345 1298 864 765 431 71 25 2616 351 ----
NM_018469chr1761168 1126 995 959 365 223 21512 1271 2333 208 --
NM_018482chr85895 692 586 416 225 21965 734 144 21687 570
NM_018489chr182340 2025 1930 1911 623 560 395 281 3828 582 193 --22153 1579
NM_018490chr1151766 1597 736 590 39 1610 ----
NM_018566chr1114841 4701 4061 3833 3403 3393 3310 1974 1347 752 127 21232 710 --24914 3200
NM_018584chr161079 911 468 312 209 62 ------
NM_018590chr1021595 181 138 --11495
NM_018593chr62767 267 ------
NM_018638chr12125515 5399 4932 4691 4621 3824 3747 1168 906 728 465 231 32190 1872 1455 ----
NM_018640chr1252651 2534 2355 2130 859 62209 2024 2015 1755 1714 34 --12029
NM_018650chr161850 1613 779 613 548 156 1274 ----
NM_018660chr862961 2946 2730 416 234 83 22531 1925 --12709
NM_018682chr7----2622 487 --
NM_018685chr7----1162 --
NM_018695chr582464 1663 986 676 588 459 213 36 21639 558 ----
NM_018698chrX61723 1566 1538 1377 293 184 21599 1292 2664 611 1395
NM_018704chr172068 1592 1443 1362 849 429 341 1440 --11498
NM_018710chr84423 409 200 124 ----11307
NM_018717chr472797 2673 2489 2261 1044 795 657 11972 1118 --
NM_018833chr61103 161 1414 1142
NM_018834chr53663 376 165 1833 ----
NM_018837chr207941 890 849 770 689 355 244 ------
NM_018846chr75778 748 299 217 197 1898 ----
NM_018847chr951811 1692 1587 559 328 1712 11606 --
NM_018890chr751436 1128 1058 376 153 1318 --1467
NM_018898chr5121886 1832 1705 1627 855 849 611 491 273 231 176 128 12331 12111 --
NM_018899chr5121886 1832 1705 1627 855 849 611 491 273 231 176 128 12331 12111 --
NM_018900chr5121886 1832 1705 1627 855 849 611 491 273 231 176 128 12331 12111 --
NM_018901chr5121886 1832 1705 1627 855 849 611 491 273 231 176 128 12331 12111 --
NM_018902chr5121886 1832 1705 1627 855 849 611 491 273 231 176 128 12331 12111 --
NM_018903chr5121886 1832 1705 1627 855 849 611 491 273 231 176 128 12331 12111 --
NM_018904chr5121886 1832 1705 1627 855 849 611 491 273 231 176 128 12331 12111 --
NM_018905chr5121886 1832 1705 1627 855 849 611 491 273 231 176 128 12331 12111 --
NM_018906chr5121886 1832 1705 1627 855 849 611 491 273 231 176 128 12331 12111 --
NM_018907chr5121886 1832 1705 1627 855 849 611 491 273 231 176 128 12331 12111 --
NM_018908chr5121886 1832 1705 1627 855 849 611 491 273 231 176 128 12331 12111 --
NM_018909chr5121886 1832 1705 1627 855 849 611 491 273 231 176 128 12331 12111 --
NM_018910chr5121886 1832 1705 1627 855 849 611 491 273 231 176 128 12331 12111 --
NM_018911chr5121886 1832 1705 1627 855 849 611 491 273 231 176 128 12331 12111 --
NM_018945chr683665 3461 3408 2677 2603 1082 448 55 22768 830 ----
NM_018947chr794978 4840 4706 4360 841 738 403 304 144 132 13423 --
NM_018948chr1--11356 --21042 101
NM_018958chr15114037 3536 3364 2937 2892 2751 1499 1327 1239 576 127 52774 484 409 310 211 34002 3616 1447 1385
NM_018970chr783024 2968 2656 2252 2049 804 454 200 42593 2531 568 428 ----
NM_018972chr882659 2595 2225 1995 573 219 205 171 32570 2507 2453 ----
NM_018976chr1292849 2705 2691 2244 2135 1071 1039 216 139 1633 11894 2913 404
NM_018979chr1252299 842 727 579 329 ------
NM_018999chr10124895 4814 3954 3395 3229 1713 1230 1097 1040 645 586 425 24766 601 1461 11773
NM_019000chr53535 479 282 ----1361
NM_019001chr374808 4127 3976 3641 2983 757 745 2799 626 ----
NM_019004chr752403 2266 1584 699 241 --12231 11476
NM_019022chr1893107 2909 2540 2135 1064 430 316 222 176 42245 2001 1170 252 --1665
NM_019027chr442476 2385 2156 2011 --42633 1637 1043 542 --
NM_019028chr112396 136 1328 ----
NM_019041chr6112503 2478 2282 2196 2153 1859 1790 1734 909 545 174 22161 421 22444 965 --
NM_019044chr264353 4114 4079 3548 3358 1652 14440 23594 478 23378 409
NM_019071chr71618 ------
NM_019072chr563947 3144 2769 2649 2609 384 34051 3376 201 --33825 2823 317
NM_019080chr1311116 11560 --11146
NM_019087chr591690 1396 1372 1183 660 580 443 364 84 1424 ----
NM_019091chr22189 44 11107 --1122
NM_019094chr12113867 2514 2333 1237 1189 816 495 462 365 198 179 23496 1141 32775 2422 718 --
NM_019114chr942559 1737 1663 1610 32175 2135 873 12299 --
NM_019117chrX113353 3036 2818 2805 2423 1279 698 611 582 276 170 33448 951 888 ----
NM_019555chr341569 622 568 310 --11271 11507
NM_019556chrX31390 1232 377 3598 517 275 --1174
NM_019590chr1051116 1014 581 493 355 2529 317 11139 1424
NM_019596chr2172359 2191 1171 992 653 553 505 32068 971 317 1739 --
NM_019605chr1------1157
NM_019610chr161438 779 706 687 602 26 21978 350 1488 22092 176
NM_019857chrX91320 711 561 522 505 499 330 182 65 ------
NM_019860chr1031532 305 127 21068 167 --286 58
NM_019862chr1651755 1642 1578 1368 29 4226 146 135 107 ----
NM_019885chr272729 2484 2474 2009 1952 619 155 22766 2680 11898 1473
NM_019898chr1651755 1642 1578 1368 29 4226 146 135 107 ----
NM_019899chr1651755 1642 1578 1368 29 4226 146 135 107 ----
NM_019900chr1651755 1642 1578 1368 29 4226 146 135 107 ----
NM_019903chr1031469 1428 716 --11400 --
NM_020066chr151033 819 355 231 50 1262 ----
NM_020069chr11139 ------
NM_020116chr471616 1524 1422 1316 1304 1256 110 2737 432 ----
NM_020119chr793405 2905 2848 2756 2628 2474 1086 862 56 33436 3363 1331 ----
NM_020122chr2124154 3827 2392 2373 2125 2037 1831 1145 564 469 462 248 55776 4977 3898 3792 2399 23762 442 --
NM_020123chr1051537 1494 1099 83 67 --11340 --
NM_020132chr21135118 5100 4979 4254 3757 3740 1732 1436 1426 404 274 131 58 --25019 1982 15178
NM_020144chr731358 1303 58 ----1218
NM_020148chr1873021 2934 2102 878 804 493 329 42178 2015 1926 1900 12953 22928 594
NM_020182chr2093248 3137 3108 2663 2450 1392 370 254 191 32709 889 577 13034 2912 49
NM_020184chr262141 1881 1853 560 552 236 12290 ----
NM_020189chr8----147 --
NM_020193chr1131147 175 29 2166 120 --1355
NM_020198chr1741627 1415 603 514 1559 ----
NM_020200chr1041110 947 823 793 1870 --11124
NM_020204chr12870 85 ----1850
NM_020205chr193144 2793 2124 1050 932 397 376 353 168 13508 ----
NM_020228chr1172555 2323 1999 839 748 553 508 22207 212 --11621
NM_020245chr6165004 4881 4380 4338 4292 4264 4088 3633 3506 3321 1792 1437 1217 413 407 244 1428 1117 --
NM_020307chr31291 ------
NM_020336chr2063716 3081 1504 1167 404 82 33652 3543 1192 --158
NM_020337chr4103168 2949 2691 2449 2428 2105 1274 1027 836 405 31013 696 491 --1724
NM_020338chr1052771 2692 1376 1140 1049 1157 13560 13101
NM_020340chr63581 560 140 21642 572 ----
NM_020341chr2082036 1884 1708 1368 640 547 361 84 21685 77 127 --
NM_020346chr1181723 1173 398 347 290 246 173 123 31576 1486 137 1365 --
NM_020363chrY71793 1478 1403 571 561 424 42 ----1641
NM_020364chrY71793 1478 1403 571 561 424 42 ----1641
NM_020369chr7126 ----1134
NM_020374chr1291717 1523 1470 1312 430 393 267 84 28 1420 --11452
NM_020390chr3124734 4712 4346 4175 3348 3038 2973 1894 1645 703 630 78 14532 --11634
NM_020420chrY71793 1478 1403 571 561 424 42 ----1641
NM_020429chr783001 2373 1977 1895 941 837 805 596 33068 2824 422 179 12363
NM_020432chr742215 1812 711 582 42335 2151 2128 425 --1298
NM_020443chr1186985 6775 6633 6513 5512 5399 4860 4847 4669 4661 4453 2326 2001 1786 1624 694 563 556 46498 5077 1572 347 26674 37 --
NM_020453chr461893 1564 1424 265 229 75 11586 1247 --
NM_020457chr16------1671
NM_020463chr251501 1040 371 245 121 31415 1196 227 ----
NM_020465chr1631278 723 95 1617 --21776 155
NM_020466chr6134966 3631 1873 1707 1521 1430 941 711 682 377 284 126 79 84845 4605 4242 4228 1825 1647 1566 144 24828 1935 --
NM_020473chrX31431 1425 1334 22007 1248 --11745
NM_020474chr1861821 1703 1499 1469 139 85 32054 542 306 ----
NM_020546chr5113147 3048 2629 2616 2573 2139 1041 950 305 213 24 --13032 --
NM_020640chr352219 1588 683 443 132 22080 398 12065 --
NM_020647chr842289 1731 821 747 42204 2071 1476 711 1259 --
NM_020651chr2111840 1729 1554 1504 1467 1423 1226 532 381 183 162 1129 ----
NM_020673chr20167345 7285 7159 7118 7049 5533 4969 4952 4928 4841 2899 2776 2572 1754 1202 118 56943 6863 5408 4721 2000 --12041
NM_020676chr33923 669 178 2226 204 --1295
NM_020686chr1662638 2628 2479 2111 2043 545 --22884 2211 --
NM_020689chr2021738 1543 ------
NM_020699chr1145170 4511 4328 4299 4077 3988 3658 3446 1260 939 913 734 565 155 --21280 1246 1120
NM_020704chr762320 1910 1676 1584 914 792 11838 ----
NM_020711chr242085 485 431 227 11775 --11918
NM_020718chr16116511 6066 5387 5186 4475 4206 1310 1207 739 178 72 66609 5886 4358 4277 1932 483 --1225
NM_020727chr21133943 3579 3243 3220 2949 2811 2637 1539 1418 1410 1243 1008 900 43777 2717 425 80 1560 12480
NM_020734chr1262741 2480 622 208 65 26 31269 896 682 137 --
NM_020738chr261159 1121 420 268 222 134 11112 11632 --
NM_020748chr1741594 1494 720 416 1119 ----
NM_020755chr63408 287 233 11260 11063 11093
NM_020766chrX124425 3799 3542 3049 3020 1697 858 804 675 628 367 316 13413 --23717 1125
NM_020771chr631538 553 52 11252 1300 --
NM_020772chr17118156 6703 6387 6343 6201 6166 1775 1346 1196 1064 884 67671 6984 6822 6287 3461 1644 48053 6603 6381 1027 26836 805
NM_020774chr18115488 5171 5018 4796 4630 4510 3966 1750 1673 1254 164 54132 3977 2024 1160 148 24606 965 --
NM_020776chr1862645 2422 2195 1997 1890 79 12545 32549 2226 923 --
NM_020779chr273026 2971 2662 655 590 386 30 23071 142 12869 --
NM_020781chr793003 2629 2403 2051 580 518 391 260 53 21948 841 ----
NM_020783chr182703 694 --12045 --
NM_020786chr1661929 1517 1481 1311 818 606 1497 ----
NM_020792chr352513 2277 930 809 534 11792 --22771 196
NM_020794chr151282 1184 1137 971 286 ------
NM_020796chr593041 2887 2659 2498 1927 1909 1188 999 550 ----1459
NM_020800chr361514 962 502 388 149 137 21118 330 --1217
NM_020801chr5112464 2456 2297 2281 2271 2232 1926 1716 1066 424 224 31834 457 276 --22476 799
NM_020802chr11103093 2864 2842 2794 2340 1275 1246 982 523 495 1176 22524 2228 --
NM_020805chr1851700 1551 1245 290 106 51808 1615 1380 714 432 ----
NM_020810chr1492946 2783 2751 2585 2562 2345 2219 1354 1202 42990 1185 1058 220 11262 1980
NM_020824chr103579 267 31 ------
NM_020826chr11103715 3554 3478 3232 3014 2819 2274 1395 681 325 22627 2286 --1167
NM_020830chr252885 2282 1111 841 480 23309 348 2736 241 --
NM_020841chr12154039 4009 3738 3682 3600 3118 3073 2828 2754 2575 2550 1506 1430 772 571 1419 33663 1149 1051 21604 519
NM_020844chr8197580 7325 7243 6873 6492 6296 5832 5567 4854 2545 2385 2361 1555 1138 1096 798 722 433 367 31844 944 605 47631 2891 930 773 14976
NM_020858chr1592242 1813 1613 1578 956 930 848 771 151 22419 80 --12080
NM_020860chr431143 908 364 2834 756 1446 --
NM_020861chr641181 1041 357 72 21232 308 1435 --
NM_020871chrX42401 2309 2175 965 2910 546 22016 1983 --
NM_020886chr114488 347 214 183 --11193 --
NM_020890chr33442 430 424 1404 ----
NM_020899chr1752116 2108 1881 1557 796 22556 577 12436 --
NM_020909chr2103275 3064 3032 2997 1639 1478 1127 988 139 103 31628 995 975 14043 --
NM_020917chr19153957 3818 3416 3410 3278 3262 2626 2515 1446 1385 1258 1098 1015 712 310 43656 3077 1408 39 ----
NM_020918chr1073638 3368 3101 3037 3008 2552 1312 --1710 13590
NM_020921chr1493343 3273 2809 2223 1256 1125 405 345 94 23289 2500 12685 --
NM_020927chr1662094 2033 1573 468 338 242 2786 717 12408 --
NM_020935chr283812 3267 1506 1251 895 589 531 374 24224 1368 14576 13279
NM_020937chr144598 311 273 205 1229 ----
NM_020940chr1092903 2789 2603 2364 2236 1158 420 130 33 22869 474 11119 --
NM_020948chr183463 3422 3372 2699 2424 1384 1032 592 22512 460 --23111 1050
NM_020960chr9105024 4886 3090 1949 1921 1898 1477 927 528 521 54913 4573 3684 1545 1286 --11117
NM_020975chr1051983 1918 1684 1340 403 21361 737 11456 --
NM_020977chr461950 1707 893 712 595 159 11896 1797 --
NM_020987chr1041163 920 150 82 1473 ----
NM_020993chr1282550 2483 2344 2337 2328 484 150 102 12052 42279 1975 1884 796 1196
NM_021007chr252289 2024 1597 1557 397 21689 149 --12061
NM_021032chr3132067 1992 1889 1866 1804 1656 1347 802 647 261 243 181 145 21910 1522 1117 --
NM_021033chr1392543 2421 2240 1036 920 743 657 561 86 53466 2836 2504 2334 645 2637 78 12151
NM_021038chr393398 3063 2955 2831 2814 2579 1323 1083 799 42935 1189 1131 131 33120 2568 597 --
NM_021064chr681705 1604 686 659 581 469 133 34 ------
NM_021069chr482052 1689 1449 870 590 396 309 250 ------
NM_021072chr5122615 2055 1862 1797 833 809 767 693 418 367 147 24 --32232 2033 915 --
NM_021079chr1783075 2464 2203 1265 1130 972 717 107 1700 33116 1341 117 --
NM_021083chrX62421 2315 1382 1245 754 648 43514 2861 2685 747 12640 --
NM_021090chr2274987 3988 3957 3621 3451 851 828 33518 3188 1990 11620 --
NM_021097chr273103 2872 2261 2222 488 440 153 32315 2161 1109 1741 --
NM_021102chr191403 ------
NM_021116chr7128636 8258 8066 7393 7068 6318 5752 2736 2166 1892 1416 371 1813 37409 6512 1012 --
NM_021120chrX41966 1163 994 315 --22366 278 12153
NM_021146chr13954 885 712 ----1377
NM_021148chr752264 1568 624 260 23 32512 2158 657 ----
NM_021163chr7133153 3099 3036 2996 2808 2547 2379 1316 1280 673 359 193 70 53164 2913 1250 1176 1045 53371 2689 614 306 182 23236 1386
NM_021167chr782346 2243 2204 2057 1972 1801 1739 995 32353 1860 1103 2894 422 12763
NM_021183chrX92501 2495 2443 2120 1898 944 547 481 41 --199 --
NM_021190chr141339 1019 980 417 11107 ----
NM_021191chr1242559 2499 1908 801 1667 1570 --
NM_021201chr1151890 510 263 221 184 12015 11703 --
NM_021205chr192867 2776 2669 2535 2152 533 495 354 204 ------
NM_021222chr131384 348 128 ----2953 913
NM_021239chr1451252 549 485 334 311 1963 ----
NM_021252chr1061602 1561 802 720 164 137 2579 221 1507 --
NM_021255chr1494017 3507 3143 2875 2679 1142 911 757 326 1193 ----
NM_021269chr194813 346 333 244 142 2429 96 1181
NM_021572chr641036 1012 189 103 51192 1127 1118 931 174 --11164
NM_021622chr1032195 713 487 1216 --12054
NM_021629chr394643 4568 3836 3664 3636 3449 3267 3091 180 31645 1203 1136 14196 --
NM_021638chr4104872 4778 4767 4675 4361 4307 4271 2007 1006 181 1636 23709 1723 --
NM_021643chr251416 533 337 178 99 1311 11375 --
NM_021647chr4224710 4645 4404 4384 3843 3486 3192 2934 2899 1906 1791 1595 1351 1205 1158 1130 1099 1080 831 719 302 211 24242 3914 ----
NM_021648chr662407 2358 2322 2225 2021 154 1891 --1477
NM_021728chr145823 786 622 312 251 --1710 --
NM_021813chr6195780 5654 5303 4992 4919 4905 4633 4618 4502 4215 4056 3828 2213 2008 1230 1105 664 518 485 45366 5057 4883 4522 35073 4078 1717 1960
NM_021815chr2122749 2649 2633 2511 2376 2298 1942 1178 1140 1010 586 120 52992 2833 2782 2618 38 ----
NM_021911chr5165505 4999 4918 4894 4775 4510 4419 2253 2061 1964 1492 1446 1221 1191 793 211 53970 3682 3398 1295 560 --25424 3865
NM_021912chr15103776 3359 3032 2733 2705 2622 1689 1652 1321 544 33179 1417 1149 44173 3686 1612 936 --
NM_021914chr1482383 2348 2152 1655 1619 919 858 323 22458 245 21555 891 21924 1584
NM_021935chr31997 ------
NM_021940chr651621 575 474 373 28 11131 1272 21235 1116
NM_021942chr43908 783 93 1599 ----
NM_021947chr1761259 1170 1044 975 859 477 2886 520 1208 --
NM_021949chrX102886 2287 2228 2207 2146 1898 1116 885 782 39 2868 179 1401 --
NM_021950chr1172237 1567 1547 1498 600 492 243 ------
NM_021954chr1393633 3621 2832 2681 2582 1358 958 669 58 73543 3497 3471 3233 1162 1015 893 ----
NM_021956chr681553 1534 1459 1451 1163 1109 516 409 11221 --2555 96
NM_021961chr11197405 7265 7064 6695 6213 6156 5808 4834 4826 4754 4558 4544 2892 1070 1020 974 486 448 223 44883 4747 2946 2296 11907 35496 1856 1674
NM_021963chrX--2209 102 1511 1774
NM_021964chr3166172 6042 5839 5648 5641 5351 5002 4458 4064 1725 1300 963 856 809 666 137 1679 24083 1073 14626
NM_021977chr693139 2947 2737 2484 2460 1519 1289 906 713 43357 2984 2506 1312 42707 2693 1201 58 23907 3429
NM_021980chr1041371 517 255 26 1878 --11096
NM_021984chrX3626 309 278 ----21577 1092
NM_021987chrX3626 309 278 ----21577 1092
NM_021988chr20----11442 --
NM_021990chrX3626 309 278 ----21577 1092
NM_022041chr16102565 2426 2364 1988 1882 910 576 432 394 301 42129 2086 935 726 1810 --
NM_022048chr15116302 6173 5890 5578 4267 4043 2030 978 726 415 386 34882 4827 1084 ----
NM_022049chr121666 1248 21452 265 21522 1279 --
NM_022091chr662001 1752 1723 788 435 206 --11047 11762
NM_022104chr201243 ------
NM_022114chr164526 4158 3837 3444 1539 284 13579 --23532 711
NM_022118chr133406 101 85 ------
NM_022121chr64987 771 460 319 21052 890 ----
NM_022130chr531387 1303 122 --1486 --
NM_022133chr821448 110 21519 659 --193
NM_022136chr212106 62 --1250 --
NM_022143chr751184 610 527 468 366 2319 167 --11172
NM_022145chr52641 30 1248 1130 --
NM_022154chr451209 465 452 361 286 ----1919
NM_022166chr16176338 6248 6178 5890 5462 4434 4196 4072 3935 3829 1997 1808 1052 876 842 498 441 46233 5083 963 161 35326 979 342 16162
NM_022336chr252244 1986 1604 725 570 32305 2212 1572 ----
NM_022340chr353557 3132 2960 1180 342 1446 12934 11256
NM_022351chr8133804 3679 3505 3396 2706 2464 1192 983 901 267 251 140 59 2891 841 13315 23081 41
NM_022442chr20----11442 --
NM_022444chr771738 1336 1284 611 476 142 64 21394 1220 --11200
NM_022456chr12127133 5858 5263 5045 2802 2474 2425 2140 1600 891 389 331 27322 5801 45868 5525 4803 823 --
NM_022459chr13125775 4555 2278 2090 2052 2032 1721 1594 860 403 255 41 15684 22141 1558 --
NM_022465chr1252599 2435 1991 972 730 12618 12353 12988
NM_022474chr1462839 2826 532 279 81 44 22556 703 ----
NM_022476chr16--1692 193 1858
NM_022482chr2082103 1923 1864 1809 744 465 107 95 --2856 636 1773
NM_022550chr5----1149 --
NM_022552chr291300 1267 1234 1157 923 891 378 241 179 3135 74 64 ----
NM_022716chr123152 2563 32928 2250 120 32613 170 124 --
NM_022725chr1151941 1903 1602 153 47 1327 ----
NM_022726chr681489 1435 1412 1282 1257 1136 445 81 21251 241 ----
NM_022735chr151649 625 459 150 40 21539 295 --1744
NM_022753chr1102641 2485 2405 2313 2161 1899 1893 349 324 116 22633 307 ----
NM_022756chr151482 947 598 305 218 ----11457
NM_022763chr393104 2921 2477 2397 2328 2280 2151 1070 570 --1170 --
NM_022776chr341643 1600 1008 234 --1162 11484
NM_022781chr962574 2155 2122 2038 1268 296 11098 12850 --
NM_022802chr1051571 1368 1315 623 470 21497 367 21501 606 --
NM_022826chr2--41214 1081 820 392 --11201
NM_022841chr1572653 2471 2239 2092 333 125 84 22446 740 1612 --
NM_022843chr131292 ----11265
NM_022875chr52431 215 192 1456 --
NM_022877chr52431 215 192 1456 --
NM_022893chr282870 2698 2121 2051 1945 1051 932 744 22987 691 --12815
NM_022898chr1494805 4692 3879 3829 3224 1919 1741 1721 674 24087 1546 24333 1648 34501 4452 1689
NM_022901chr941372 1336 273 31 186 11295 --
NM_022910chr1631278 723 95 1617 --21776 155
NM_022912chr293016 2867 2588 2057 1157 1075 808 587 54 12119 22433 1057 --
NM_022913chr5170 ------
NM_022918chr11112177 2053 1962 1938 1931 1847 1639 1509 1334 797 573 ------
NM_022977chrX82594 1993 1636 821 519 244 133 121 2439 316 ----
NM_023000chr1461693 1644 1360 1321 635 174 2553 363 --11674
NM_023001chr1461693 1644 1360 1321 635 174 2553 363 --11674
NM_023016chr282880 2334 2263 2179 751 533 342 27 ------
NM_023075chr18129 ----2778 151
NM_023923chr163742 1490 1292 1246 1141 806 13560 11269 1191
NM_023929chr8102774 2682 1888 1854 1823 1074 960 250 152 140 11785 --188
NM_024007chr5113143 3128 3039 2286 2154 1260 931 754 687 436 144 11185 11272 --
NM_024012chr751195 1168 1060 261 134 11051 11149 2885 348
NM_024052chr1762803 1107 798 81 44 30 32722 1073 132 1625 --
NM_024055chr5141 2597 465 --1544
NM_024086chr1763773 3608 3559 2415 633 68 33528 2733 881 22714 648 --
NM_024090chr471794 1739 1703 1414 666 519 124 21751 98 ----
NM_024292chr19179 ------
NM_024295chr832074 1654 747 11946 31852 537 239 11980
NM_024345chr9124697 4192 3959 3937 3707 2398 2017 1727 1384 1107 596 439 45459 4258 2436 2265 --35328 4858 4095
NM_024408chr173562 3460 3366 993 938 235 151 23231 1424 1527 --
NM_024416chr961215 1172 1035 232 167 147 1196 11552 11635
NM_024423chr18134296 4267 3999 3913 3262 3049 2861 2800 2782 1438 1218 859 196 33312 2651 404 23383 730 --
NM_024429chr71858 ------
NM_024503chr11417 ------
NM_024511chr443284 1008 957 948 1874 --13397
NM_024512chr373556 3449 2888 2681 1237 1171 1041 13388 1460 12663
NM_024519chr16----1313 --
NM_024524chr342922 2677 1279 700 33223 1103 1048 12823 --
NM_024539chrX61140 1129 840 448 254 44 11148 ----
NM_024551chr1252175 2098 1847 1742 101 22483 526 1279 1336
NM_024551chr1252175 2098 1847 1742 101 22483 526 1279 1336
NM_024561chr1361381 1233 1030 944 898 36 11139 11104 --
NM_024569chr1102327 2025 1172 967 869 765 756 137 115 107 ------
NM_024595chr131239 453 393 --1161 1273
NM_024596chr8144761 4496 4216 4095 3918 3796 3491 3286 1757 1590 1312 1110 527 76 44819 4682 4390 3382 64665 4288 3856 3761 1027 45 1820
NM_024607chr894513 3021 2831 1709 1661 1565 1329 726 536 24536 3682 13744 --
NM_024613chr821626 1334 --1337 11159
NM_024646chr153927 3364 2812 870 673 23592 1009 ----
NM_024659chr251003 859 829 727 40 1846 ----
NM_024665chr3114441 4431 3718 3645 3552 3260 3241 952 729 157 52 33360 1805 1156 11194 1308
NM_024674chr162991 2980 2509 2066 2011 529 12716 22698 1245 --
NM_024692chr241224 728 511 157 21691 210 --11510
NM_024702chr173619 437 218 ------
NM_024704chr2041105 769 300 281 21057 420 2930 780 --
NM_024713chr1551291 608 546 386 112 2489 40 ----
NM_024721chr842142 459 182 83 32157 1787 428 21676 472 --
NM_024725chr112858 757 2314 130 --1116
NM_024744chr252225 1034 779 133 76 42416 1888 1043 341 11822 1767
NM_024745chr1621037 765 1165 1345 21092 29
NM_024749chr161664 1552 907 726 419 23 32182 1861 1565 ----
NM_024751chr411495 2775 346 11469 1170
NM_024755chr151607 ------
NM_024769chr113320 204 178 11135 31139 980 453 --
NM_024770chr2236421 6251 6068 6043 5994 5956 5944 5777 5405 5319 5303 4849 4717 4692 4385 4268 2527 1991 1173 1023 723 339 27 46463 5837 5560 1136 24676 746 12424
NM_024814chr72378 279 1115 ----
NM_024817chr15135833 5120 4917 4818 4024 4017 3964 3874 3791 3655 2163 1631 845 45140 3743 3679 1221 ----
NM_024818chr351438 1349 1229 1201 80 1517 ----
NM_024824chr1491595 1458 1299 1183 1073 1060 663 74 22 ------
NM_024834chr1091869 1807 1667 1631 1547 1349 803 243 54 --1583 --
NM_024835chr171281 --3400 365 96 --
NM_024837chr1581918 1766 1709 1703 1519 1452 1228 90 21281 225 ----
NM_024852chr11449 ------
NM_024884chr14134399 3949 3758 3728 3351 3112 1828 1584 1435 1183 584 337 309 11574 23468 431 13652
NM_024915chr852212 472 433 122 79 12588 12421 12436
NM_024930chr562580 2416 2182 2173 97 27 42566 2309 718 271 ----
NM_024939chr1681637 1616 1605 1594 1565 1389 1093 111 11172 1606 --
NM_024941chr591483 1458 1405 1371 1095 433 122 68 43 11439 --11136
NM_024947chr3219273 9003 8884 8635 7956 7791 7619 7107 6888 6873 6557 5882 3217 3138 2949 2607 2220 2188 1598 1204 202 98733 7700 3803 3390 2501 2490 2104 1448 26 11406 27221 1328
NM_024949chr4124440 4426 4049 3963 3441 3237 3197 1498 1415 1102 289 56 13185 24864 4276 --
NM_024953chr1292238 2132 2113 1727 1124 1023 518 100 65 12468 ----
NM_024989chr2146930 6716 6360 5755 5591 5534 5418 5293 2093 1762 1342 1213 617 90 47625 7270 6769 6034 12786 15500
NM_024991chr10102683 2320 2134 2021 529 488 409 206 147 116 12469 1581 1991
NM_025054chr8144013 3898 3786 3777 3525 3391 3190 1275 924 778 763 601 549 27 53771 3627 3356 1639 1238 44060 3402 3089 1313 11557
NM_025073chr194260 4240 3825 3405 3359 2946 678 460 355 21349 781 33283 2926 1805 --
NM_025107chr692242 2192 2151 2120 2080 2042 1855 808 324 1817 --1157
NM_025133chr24918 817 407 194 31036 861 52 --1780
NM_025134chr1671640 1597 929 733 688 398 223 32182 2138 1688 ----
NM_025154chr741439 1380 1366 1187 11482 --1308
NM_025160chr163826 2945 2864 1152 1050 650 22714 1526 ----
NM_025179chr1124638 4585 4069 3772 3598 3470 3283 1713 1510 1459 707 646 24611 400 2726 663 23842 3154
NM_025184chrX3900 688 352 2217 165 1869 --
NM_025191chr163468 2991 2713 695 332 190 33248 2939 479 13481 --
NM_025208chr1162506 2178 1964 1814 1767 649 42289 1854 450 371 1832 12372
NM_025221chr411176 --21032 1019 11459
NM_025235chr1052265 835 488 327 116 2363 49 1399 --
NM_030621chr1484172 3996 3988 3751 3584 2741 1165 116 51007 299 159 36 24 14067 11082
NM_030623chr231677 1393 652 2393 91 1111 1175
NM_030625chr10101794 1739 1731 1675 1605 558 366 208 142 121 22370 374 12122 --
NM_030627chr5134161 3355 3234 3125 2604 1616 1253 1208 1086 1073 846 826 762 --1600 23243 1544
NM_030629chr1641940 1773 1767 507 31845 1357 46 ----
NM_030631chr142192 124 3699 686 674 ----
NM_030647chr7115467 5371 5211 5060 4839 4829 1915 1753 1618 1486 1278 35096 4650 4408 35190 5017 4943 --
NM_030648chr485536 5507 5366 4507 4472 1559 1237 1098 55617 4002 3704 1141 1123 23792 3779 --
NM_030650chr274136 3907 3604 3594 3576 3348 1599 23105 1384 ----
NM_030664chr1072436 2287 1801 808 664 454 37 52184 2035 2018 724 225 ----
NM_030674chr1265768 5714 3991 1476 853 839 24592 2000 14474 24802 149
NM_030751chr1051651 1579 771 512 125 3194 151 144 ----
NM_030751chr1051651 1579 771 512 125 3194 151 144 ----
NM_030755chr1463092 2335 2084 2011 1196 501 1148 --12275
NM_030773chr20181 21513 39 21828 683 --
NM_030777chr2042395 2246 1640 148 32266 1883 1621 ----
NM_030786chr161576 1440 1288 1182 53 38 21374 582 --1191
NM_030799chr582163 1517 1420 714 703 512 389 339 42095 2048 1558 779 12062 --
NM_030806chr1299125 9074 8997 8976 8681 8386 7664 7298 6768 5846 3603 3323 3213 2876 2320 2026 1833 1803 1725 1663 1517 1436 1098 1038 827 235 170 109 74 58817 8638 6145 2523 1910 33490 2812 281 37973 6607 3763
NM_030809chr1252431 2206 1809 517 221 31762 335 73 1361 --
NM_030816chr173479 3465 3098 3061 2757 2614 2266 31439 1006 368 33360 3047 2985 13113
NM_030881chr2262144 1622 945 912 230 201 12135 ----
NM_030885chr331690 1578 74 1850 1247 --
NM_030918chr184366 3878 3661 3541 3478 1202 1143 80 1772 14239 14646
NM_030920chr141879 1625 1598 543 21814 301 ----
NM_030939chr64974 882 763 172 2740 114 21151 1009 --
NM_030945chr592196 2043 1962 1950 838 828 538 442 319 52381 2160 1760 529 192 ----
NM_030962chr1151492 581 405 397 24 --1300 --
NM_030964chr563226 2607 1478 1119 1090 1023 32616 978 297 12992 --
NM_030979chr132374 314 --2111 90 --
NM_031216chr1832249 800 601 31809 405 261 12280 --
NM_031243chr762342 2095 1554 853 234 147 32085 2054 70 1588 22114 910
NM_031268chr1684816 4783 4535 3704 3636 3266 1975 186 15011 34857 3868 3463 14956
NM_031271chr881513 1387 1381 1269 466 270 260 137 21723 1320 ----
NM_031275chr113617 608 472 ------
NM_031292chr1271515 1255 1229 376 309 281 211 2655 477 11149 --
NM_031296chr432469 614 216 32440 2142 2065 12457 --
NM_031314chr1451826 1608 1436 748 378 2636 304 11548 --
NM_031371chr131593 1058 511 1323 21494 1069 --
NM_031371chr131593 1058 511 1323 21494 1069 --
NM_031372chr441700 1336 316 104 1125 ----
NM_031409chr651560 1483 559 369 58 2397 260 21400 107 31764 1708 632
NM_031411chr5121886 1832 1705 1627 855 849 611 491 273 231 176 128 12331 12111 --
NM_031418chr1152768 2166 1790 484 248 12069 --12325
NM_031426chr992411 2346 1812 1086 869 845 831 734 242 --12305 12097
NM_031427chr14135979 5159 4884 4508 3976 2148 1927 1603 1255 1118 863 510 176 54684 959 396 283 118 12292 11127
NM_031431chr1361503 400 344 199 159 143 1192 ----
NM_031435chr12153116 2927 2726 2278 1318 932 819 788 703 662 582 529 502 410 78 33404 2698 1194 ----
NM_031439chr861721 1433 1196 625 524 316 21849 1528 ----
NM_031442chrX72977 2359 2004 1154 889 614 22 188 ----
NM_031449chr752254 2087 1931 1819 1607 2621 116 1244 12215
NM_031453chr1062104 2079 1850 855 256 75 ----1270
NM_031461chr872049 1945 1883 1445 800 402 68 21585 164 11613 --
NM_031468chr7187574 7365 6816 6453 5818 5443 5431 3256 3164 3116 2604 2301 2242 2036 1503 1269 1122 356 37802 5902 1245 45834 5006 1861 1780 --
NM_031469chr6103560 3543 3416 3355 3134 2789 1457 998 646 491 23739 3492 11190 --
NM_031483chr2052832 2711 206 81 32 --43014 2902 563 464 --
NM_031844chr1114124 3926 3825 2633 2607 2576 1099 605 305 267 40 33855 1537 856 1663 --
NM_031845chr283482 3404 2530 2442 1463 996 637 173 22415 1424 --23697 606
NM_031847chr283482 3404 2530 2442 1463 996 637 173 22415 1424 --23697 606
NM_031849chr5121886 1832 1705 1627 855 849 611 491 273 231 176 128 12331 12111 --
NM_031850chr33852 736 49 2578 188 1197 --
NM_031850chr33852 736 49 2578 188 1197 --
NM_031857chr5121886 1832 1705 1627 855 849 611 491 273 231 176 128 12331 12111 --
NM_031860chr5121886 1832 1705 1627 855 849 611 491 273 231 176 128 12331 12111 --
NM_031882chr51432 ------
NM_031889chr471920 1285 351 260 233 83 69 11949 1337 --
NM_031890chr2263055 2401 1978 1944 831 415 1846 11204 --
NM_031892chrX5998 982 768 272 108 172 1232 --
NM_031911chr4112706 2683 2396 2214 864 795 596 379 296 177 129 2985 141 11877 --
NM_032012chr975164 4782 4548 3784 875 679 120 63742 3526 2053 1806 1356 192 44809 4100 1523 103 --
NM_032041chr892522 2501 1899 1844 1771 691 389 320 295 ------
NM_032042chr582839 2665 2197 1844 1032 754 558 540 32652 761 181 ----
NM_032047chr342352 1661 243 89 1918 --32398 1497 495
NM_032049chr33852 736 49 2578 188 1197 --
NM_032049chr33852 736 49 2578 188 1197 --
NM_032102chr1182898 2773 2581 2379 2096 1928 1249 266 31962 1129 395 22285 167 --
NM_032105chr1138127 7592 7242 6955 5975 5898 5604 5067 2907 2530 1843 1259 59 57095 5747 5721 4994 2505 32449 1898 1486 --
NM_032116chr13115325 5052 4517 4484 3577 1897 1861 1836 1435 409 133 65424 5096 4067 3794 1814 1121 --11077
NM_032121chrX52797 2221 322 315 184 --21048 287 1577
NM_032128chr43806 768 668 1204 --1975
NM_032132chr13235 199 122 1430 ----
NM_032144chr231583 519 160 31349 650 308 --2561 327
NM_032146chr32475 77 ------
NM_032160chr18113868 3291 2842 2827 1741 1554 1396 1185 1063 733 551 23934 3208 --1824
NM_032186chr12371 247 1158 1995 --
NM_032199chr10103855 3168 2905 2635 1154 856 551 428 349 27 ----12567
NM_032208chr2113361 3316 3220 2687 2646 2616 1453 1367 749 551 272 22244 945 13624 12412
NM_032228chr1173524 1231 420 224 172 63 57 22341 94 1735 --
NM_032239chr431078 592 224 11124 1966 --
NM_032250chr91320 1281 2849 839 --
NM_032281chr1963014 2789 2756 607 558 551 23040 2783 ----
NM_032288chr352075 935 802 531 277 42109 478 238 95 --22241 1722
NM_032291chr141861 1664 1211 720 21968 1809 21822 1339 --
NM_032303chr93351 319 46 1638 ----
NM_032312chr23761 696 640 1144 197 --
NM_032321chr233212 958 65 22521 2256 1944 --
NM_032333chr102679 227 1180 --1169
NM_032352chr1481380 1323 1198 1026 1013 546 448 68 11293 ----
NM_032373chr10185831 5739 4563 4253 3760 2073 2040 1976 1779 1617 1536 1501 1199 1099 1022 717 343 253 55477 4266 3841 2239 1007 24393 4353 --
NM_032379chr115876 858 720 190 132 1598 1317 --
NM_032383chr351223 999 836 493 237 ------
NM_032435chr162299 2233 2113 1785 1680 501 21938 728 --1232
NM_032438chr651296 1277 1101 440 101 161 --11526
NM_032439chr1041407 645 320 156 31285 296 123 ----
NM_032445chr1552316 2044 2031 880 606 42615 2338 499 245 --1823
NM_032446chr563329 2950 1447 911 678 43 33741 2817 1387 42648 2556 2515 290 --
NM_032457chr4133820 3503 3173 3089 2979 2867 2693 2417 1023 588 115 60 23 33376 796 73 177 22656 354
NM_032458chrX93382 2534 2516 2273 1222 1134 966 644 612 23190 1240 11023 --
NM_032471chr66977 970 922 454 395 285 1750 ----
NM_032499chr1561473 1371 1178 1165 646 525 ----11105
NM_032520chr161201 ------
NM_032521chr2062718 2674 2617 2563 2254 743 23031 204 12836 12492
NM_032539chrX1642 ------
NM_032547chr43472 353 56 1539 11000 --
NM_032557chr45977 893 384 167 35 --1809 --
NM_032560chr1461081 983 866 732 81 69 ------
NM_032582chr1771848 1794 1608 1243 480 382 71 1132 ----
NM_032622chr441452 1012 184 110 31360 1281 270 ----
NM_032682chr353647 3218 2879 2819 737 13127 22470 1242 --
NM_032778chr3113215 2677 2423 2287 1282 1063 850 796 763 218 59 33353 2888 628 12596 --
NM_032804chr1082400 2389 2016 1752 1699 986 793 483 52334 2242 1934 1706 327 --1928
NM_032859chr13113534 3195 2504 1527 1211 1041 1001 806 578 206 45 11064 --32772 2757 2617
NM_032866chr1543193 2982 2585 2197 22610 337 12572 --
NM_032871chr1151735 1427 1336 468 128 31979 1793 1474 --11862
NM_032873chr11143984 3874 3494 3444 3216 2857 1594 1485 1470 1427 1386 946 772 356 33552 709 691 --1785
NM_032900chr1073510 2905 2884 2853 1460 121 35 33074 2830 852 179 --
NM_032918chr1251094 829 405 393 326 21053 72 ----
NM_032932chr1785971 4367 4117 2289 1909 1417 338 299 11817 32245 1035 431 15792
NM_032943chr115876 858 720 190 132 1598 1317 --
NM_032968chrX93899 3749 3724 2894 1326 1289 1056 1026 50 44133 1275 915 533 22824 1473 --
NM_032969chrX93899 3749 3724 2894 1326 1289 1056 1026 50 44133 1275 915 533 22824 1473 --
NM_032973chrY93891 3741 2889 1326 1289 1056 1026 807 50 44125 1275 915 533 22819 1473 --
NM_032975chr1863485 2623 2387 2308 2279 1262 ----1513
NM_032978chr1831135 1120 363 ----1872
NM_032979chr1831135 1120 363 ----1872
NM_032980chr1863485 2623 2387 2308 2279 1262 ----1513
NM_032981chr1831135 1120 363 ----1872
NM_033012chr133990 753 424 2961 58 ----
NM_033014chr961215 1172 1035 232 167 147 1196 11552 11635
NM_033020chr1134240 4086 3999 3888 3425 3321 3155 1443 994 948 820 805 235 64639 4361 3510 1539 415 225 ----
NM_033055chr141001 461 438 410 ------
NM_033081chr2031351 1091 1016 ------
NM_033083chr363379 3230 3018 2945 458 82 --150 --
NM_033132chr1382310 2023 1958 1778 809 782 603 413 22094 1639 ----
NM_033133chr17133809 3712 3495 3399 3345 3003 2700 2507 1430 408 286 243 143 12527 2898 389 33576 2576 775
NM_033135chr1162506 2178 1964 1814 1767 649 42289 1854 450 371 1832 12372
NM_033138chr741782 1563 191 31 --32297 2153 1495 --
NM_033139chr741782 1563 191 31 --32297 2153 1495 --
NM_033140chr741782 1563 191 31 --32297 2153 1495 --
NM_033143chr483733 3535 3456 1751 1678 1166 485 203 13593 --21718 558
NM_033157chr741782 1563 191 31 --32297 2153 1495 --
NM_033161chr92706 74 32010 460 380 --11895
NM_033181chr683827 2593 1345 1330 1056 712 426 55 1702 1494 --
NM_033224chr7268104 7929 7326 7269 6854 6405 6335 6197 5962 5566 3241 2957 2806 2780 2451 2275 2060 1916 1139 1048 704 628 346 254 223 129 67581 7099 6265 5880 5339 3210 17965 13029
NM_033225chr8103041 3017 2943 2898 2802 2756 2686 2407 1022 632 22115 1243 22256 1044 --
NM_033254chr31545 ------
NM_033272chr22380 118 --1159 --
NM_033274chr572559 2549 2530 2472 2450 399 362 22881 2439 --23570 1436
NM_033285chr884090 3091 2943 2933 1615 1249 973 385 22793 1522 11136 --
NM_033290chrX73155 3074 2551 2530 2494 2390 1381 33789 3169 142 13440 1576
NM_033305chr981454 1332 1136 1057 285 274 164 65 11422 --1181
NM_033331chr993061 2649 2531 1425 1372 657 649 419 93 23586 82 12575 --
NM_033360chr1273871 3691 3186 2855 1219 80 71 21396 710 11865 --
NM_033389chr1794727 3576 3532 3432 3038 3018 1933 902 45 44373 4110 1488 665 1204 --
NM_033401chr161345 ------
NM_033402chr8151 ------
NM_033407chr14620 496 427 32 1573 2608 593 --
NM_033425chr11102741 2646 2383 2361 2321 1094 901 616 444 75 22592 115 12394 --
NM_033426chr1482919 2809 2256 2055 1873 1150 663 76 12098 12073 1280
NM_033430chr4104178 4057 3191 3124 2647 1647 1516 987 928 283 23232 866 12629 31670 710 628
NM_033437chr4104178 4057 3191 3124 2647 1647 1516 987 928 283 23232 866 12629 31670 710 628
NM_033505chr2146759 6602 6453 5896 4993 4352 4197 1953 1642 1448 890 334 223 198 2987 347 56126 5515 5281 5113 244 --
NM_033512chr852249 635 594 490 452 32971 2753 2533 32779 1988 1945 --
NM_033551chr583336 2799 2631 2497 1075 788 610 333 ------
NM_033631chr183776 3478 2623 2457 1451 1146 900 542 13540 --23802 99
NM_033632chr441323 1183 1045 66 61473 1273 1177 1157 1054 424 31147 1021 263 --
NM_033637chr1073900 2810 2593 1481 1413 1239 391 13519 22931 1422 --
NM_033656chr21185994 4963 4839 4681 4589 3900 3817 2294 2231 1980 1775 1752 1514 1399 828 765 303 261 55227 4857 2161 2051 206 14330 --
NM_052832chr882409 2387 2030 837 648 542 386 219 12744 ----
NM_052834chr1832411 2031 1785 12574 22139 166 --
NM_052847chr1983150 1357 1344 1277 488 435 337 125 1108 ----
NM_052851chr1332055 390 160 22218 2093 1519 11730
NM_052862chr141546 1454 545 104 3964 604 275 ----
NM_052867chr1321516 346 2597 581 21128 1011 --
NM_052879chr12114111 4010 3995 3446 3245 3080 1154 853 841 416 163 23852 1254 32863 683 497 1917
NM_052885chr12104955 3718 3562 3241 3128 3044 1489 1473 1296 1038 54234 4199 3354 3020 1634 13780 1837
NM_052886chr832086 587 91 12035 1657 --
NM_052896chr151027 581 562 384 219 1471 --22264 276
NM_052906chr22105020 4903 4563 4065 3505 3123 2008 1808 1008 250 11284 --13481
NM_052907chr1293303 1429 1350 1343 1283 1255 1175 929 141 64177 2871 1204 1159 1077 196 24016 1447 --
NM_052917chr272298 2115 2067 1359 1162 805 504 52220 1179 236 191 121 --1248
NM_052918chr1083676 3210 3118 2610 1349 1331 266 218 2240 167 --1827
NM_052932chr1152329 2203 1950 1572 590 52298 1693 598 559 79 11862 --
NM_052937chr862639 2324 2044 868 630 263 22378 684 22698 833 --
NM_052966chr1113322 3298 2989 2843 1175 1020 796 768 708 489 125 33883 3628 1230 13279 --
NM_053006chr221118 ------
NM_053016chr9157681 7375 7212 6662 5919 5565 5540 5451 3119 3065 1799 1736 1293 1054 599 57938 7230 1970 1358 954 76859 6399 5756 5650 2924 1381 458 --
NM_053023chr1143220 2899 1064 798 1542 --1979
NM_053024chr331120 1112 989 1185 --1980
NM_053043chr796426 5571 5239 2460 2300 2128 2057 495 387 11476 179 15374
NM_053064chr1452592 1227 709 585 290 72771 2660 2106 2058 2030 983 334 ----
NM_054016chr162054 1867 1838 1344 717 673 21993 1973 ----
NM_054016chr162054 1867 1838 1344 717 673 21993 1973 ----
NM_054016chr162054 1867 1838 1344 717 673 21993 1973 ----
NM_057168chr761742 1464 1287 659 292 25 ----11185
NM_057175chr482111 1867 962 780 768 708 622 338 2724 324 2885 577 --
NM_057178chr1772278 2153 2064 985 290 130 116 1703 1190 12101
NM_058170chr151636 1214 1131 354 279 21465 109 --21144 114
NM_058172chr451394 1311 659 621 436 31227 368 354 ----
NM_058237chr144922 830 302 134 11073 --129
NM_058241chr262275 2153 1978 1914 1538 211 2601 439 1229 --
NM_058241chr262275 2153 1978 1914 1538 211 2601 439 1229 --
NM_078483chr573345 2754 2716 2547 967 250 195 1666 11252 13909
NM_080546chr982025 1768 1583 1462 680 467 360 152 22049 42 ----
NM_080617chr202727 157 --1260 1760
NM_080629chr13427 171 158 1359 1480 --
NM_080630chr13427 171 158 1359 1480 --
NM_080645chr662207 1782 1604 881 475 311 --12104 11581
NM_080654chr1131363 1088 1027 31066 1004 225 11330 --
NM_080666chr1441333 389 215 96 31184 1160 323 1312 --
NM_080671chr211464 ------
NM_080743chr662362 1606 654 496 375 250 --21888 1594 --
NM_080759chr1372676 2561 2525 2312 1014 505 439 22421 825 ----
NM_080760chr1372676 2561 2525 2312 1014 505 439 22421 825 ----
NM_080764chr2233289 2468 1040 2189 61 ----
NM_080792chr2041699 683 655 271 1882 --12294
NM_080821chr2072351 2315 2305 2046 685 327 147 52358 2159 1945 456 272 21609 487 --
NM_080832chrX71674 1664 1646 1595 1343 471 184 --1135 --
NM_080867chr14155119 5106 4947 4604 4476 4347 4259 4214 3980 3453 1631 1294 757 576 406 44553 1201 777 109 24842 4724 14033
NM_080872chr894054 3701 3578 3213 3040 2899 1045 453 281 13408 23895 2889 1162
NM_080874chr461472 1444 579 444 130 38 ----21670 1263
NM_080927chr353294 2940 2894 2876 2422 33369 1132 25 23018 958 11338
NM_100264chr103928 285 112 --2344 180 --
NM_100486chr102285 112 --2344 180 --
NM_130387chr331265 1057 269 --2845 398 --
NM_130391chr9113544 3437 2912 2876 2557 2303 2207 869 573 298 272 33423 2888 139 21425 729 --
NM_130392chr9113544 3437 2912 2876 2557 2303 2207 869 573 298 272 33423 2888 139 21425 729 --
NM_130393chr9113544 3437 2912 2876 2557 2303 2207 869 573 298 272 33423 2888 139 21425 729 --
NM_130435chr1092904 1809 1033 885 719 635 350 336 53 42425 1120 746 574 12203 --
NM_130436chr2172828 2774 2704 638 353 300 162 --2129 77 21946 670
NM_130438chr2173405 3351 3281 1215 930 877 739 --42260 2212 706 654 32523 2256 1247
NM_130439chr1061884 935 582 487 256 176 21932 103 --2416 34
NM_130439chr1061884 935 582 487 256 176 21932 103 --2416 34
NM_130809chr553114 2877 2182 2173 1244 1560 ----
NM_130811chr202418 42 --1355 1831
NM_130838chr1541632 1600 669 400 21207 24 1596 --
NM_130839chr1541632 1600 669 400 21207 24 1596 --
NM_133170chr20237933 7461 7455 7342 6785 6554 6546 5743 5327 5031 4910 3057 2688 2314 2199 2118 2094 1998 1720 1645 924 767 255 27855 2675 14940 15669
NM_133264chr17103890 3879 3851 3831 2851 2803 2614 1076 718 472 33857 3180 2472 ----
NM_133329chr251185 538 504 190 120 2307 150 11640 --
NM_133334chr465334 4132 2553 2414 1314 819 36329 6301 1994 22157 1576 11145
NM_133371chr572468 2438 1836 945 173 107 60 42392 1502 375 156 ----
NM_133372chr572615 886 759 613 598 428 285 2877 461 12436 --
NM_133433chr55693 647 187 79 50 1720 --1725
NM_133445chr973064 2759 1329 1001 577 410 216 22545 734 --23259 855
NM_133477chr463031 2420 2116 2054 1299 454 32577 2271 2234 1355 --
NM_133478chr262297 2002 1890 1870 940 23 31580 529 55 1365 --
NM_133484chr21131 ------
NM_133493chr684162 3747 3706 3552 3380 3024 1826 240 54085 3370 3016 1713 870 ----
NM_133496chr1124435 4321 4278 4017 3981 3565 3461 3410 1380 1215 1019 449 52790 1258 1166 1035 65 24232 3725 --
NM_133503chr123790 530 267 1723 138 --
NM_133504chr123790 530 267 1723 138 --
NM_133505chr123790 530 267 1723 138 --
NM_133506chr123790 530 267 1723 138 --
NM_133507chr123968 708 655 1901 1216 --
NM_133631chr391475 1439 1429 1224 497 378 308 297 260 1470 1553 --
NM_133646chr2125194 5148 4778 4182 3486 1381 1336 1178 755 712 658 94 34198 1446 1355 14471 --
NM_133647chr1583051 2983 2935 1198 731 671 304 160 53238 3045 841 603 221 12369 --
NM_134442chr231701 1591 1250 31333 1229 71 1115 --
NM_134447chr192615 36 --1597 174
NM_138270chrX83112 2635 2142 1282 1200 969 753 80 --21378 977 13205
NM_138292chr1193375 3097 3031 2962 2237 2224 1251 666 474 --22772 513 --
NM_138333chr922466 2408 ------
NM_138357chr1051797 1460 336 163 30 21197 123 ----
NM_138371chr121268 ------
NM_138391chr16896 884 845 686 245 203 --1993 --
NM_138395chr23899 772 30 ------
NM_138423chr1541964 1710 384 41 2370 321 11659 --
NM_138426chr71446 21916 961 32537 735 201 1780
NM_138459chr6103436 3344 3309 3037 2857 2416 2361 1435 1375 1119 174 ----
NM_138468chr296311 6260 5492 4402 2372 2177 1788 746 714 65568 5532 4553 4524 632 293 21626 1127 --
NM_138473chr1244884 1957 1919 824 64078 3444 1438 1319 886 502 11307 11337
NM_138492chr511074 11162 11509 11064
NM_138494chr762792 2783 2669 2597 2113 406 22368 1089 ----
NM_138576chr1494805 4692 3879 3829 3224 1919 1741 1721 674 24087 1546 24333 1648 34501 4452 1689
NM_138621chr294202 3971 3135 2780 2749 2724 1273 187 60 23180 821 1704 --
NM_138638chr1482383 2348 2152 1655 1619 919 858 323 22458 245 21555 891 21924 1584
NM_138694chr693555 3411 3177 3053 2584 2304 1392 696 37 23721 955 ----
NM_138703chrX4451 364 306 60 1354 ----
NM_138713chr16137741 7691 6481 6095 5469 5214 2907 2669 1326 729 615 259 144 68290 7451 6819 5416 2712 90 16920 11312
NM_138714chr16137741 7691 6481 6095 5469 5214 2907 2669 1326 729 615 259 144 68290 7451 6819 5416 2712 90 16920 11312
NM_138731chr14114100 3137 3056 3017 3002 2924 1185 1166 421 379 81 12876 --11070
NM_138779chr131204 ------
NM_138782chr562159 1693 1642 1605 537 248 2771 475 ----
NM_138811chr761067 989 478 288 40 24 ------
NM_138927chr214852 732 267 253 ------
NM_138931chr351035 766 404 303 261 2288 205 2331 269 --
NM_138959chr196784 6402 6150 5427 5019 4785 4130 1628 1620 24224 2292 15228 25043 4705
NM_138970chr1462153 1953 1770 463 455 92 32089 1779 665 22338 795 21784 1477
NM_138971chr11113849 3651 3236 3202 2950 2873 2405 1185 648 634 522 23639 2388 --13795
NM_138971chr11113849 3651 3236 3202 2950 2873 2405 1185 648 634 522 23639 2388 --13795
NM_138972chr11113849 3651 3236 3202 2950 2873 2405 1185 648 634 522 23639 2388 --13795
NM_138972chr11113849 3651 3236 3202 2950 2873 2405 1185 648 634 522 23639 2388 --13795
NM_138973chr11113849 3651 3236 3202 2950 2873 2405 1185 648 634 522 23639 2388 --13795
NM_138973chr11113849 3651 3236 3202 2950 2873 2405 1185 648 634 522 23639 2388 --13795
NM_138994chr161345 ------
NM_139045chr91168 ------
NM_139048chr341216 874 835 261 2952 292 ----
NM_139182chr471604 1547 1445 1163 606 313 71 ----1562
NM_139207chr1242180 2112 1897 629 --12019 1483
NM_139244chr6--1863 --1671
NM_139246chr972296 2175 599 542 248 84 37 1404 2831 77 --
NM_139276chr1782316 2114 1759 1524 820 668 545 25 ----11629
NM_139279chr2153576 3458 3388 2745 2283 2277 2256 2232 966 760 698 639 410 389 115 1852 13084 22570 78
NM_139283chr1232323 806 353 31894 1806 552 1796 --
NM_139321chr20134131 3525 3273 3229 2749 1686 1594 1288 1276 1136 991 874 350 43888 3546 2700 125 ----
NM_139323chr2042050 1954 1351 178 21714 377 1307 --
NM_144498chr20102149 1715 737 706 672 637 606 385 278 87 1497 ----
NM_144570chr1673050 2559 2544 2385 1967 1141 401 22319 358 23039 433 --
NM_144571chr4156768 6714 6646 5486 5289 5032 5013 4669 4524 2694 1460 1045 274 210 22 46900 6374 2193 327 16306 26292 6287
NM_144583chr261825 1361 1243 428 206 94 31790 613 535 ----
NM_144590chr1072883 2255 1900 1835 1138 951 565 22968 1057 22214 843 --
NM_144599chr15105413 5343 5314 4882 4788 4473 4395 1865 1589 1155 54632 4380 4103 563 296 11048 --
NM_144600chr1681609 1368 1357 1339 1275 1035 479 80 1121 11145 --
NM_144609chr1771371 1290 927 350 161 143 88 11046 1505 --
NM_144632chr261923 1504 773 673 568 287 143 ----
NM_144658chrX2299 117 --1330 --
NM_144664chr1162149 2036 825 651 631 182 1946 --1170
NM_144710chr251496 1286 1065 350 242 51313 1206 944 926 467 ----
NM_144721chr452145 2122 1851 1050 167 42799 1014 875 429 22443 1830 12244
NM_144767chr1544476 3376 1030 386 22985 747 23637 1188 13886
NM_144775chr1784015 3987 3966 767 344 292 165 28 --34374 4058 402 1461
NM_144778chr1342370 2229 534 348 22490 1915 1553 --
NM_144949chr262339 2215 1923 941 641 579 1707 11964 --
NM_144963chr81252 1464 22039 455 --
NM_144967chrX31050 871 202 ----1767
NM_144973chr1295364 5207 4800 4243 4026 3486 2051 1197 682 13410 55197 1888 1427 1375 150 21209 1149
NM_145011chr1041550 838 464 226 42204 1469 337 44 1324 1246
NM_145013chr1142983 2112 481 193 22209 620 12733 11139
NM_145052chrX2950 324 21078 214 11047 --
NM_145055chr1843786 3113 2441 1122 43850 3755 3674 3374 2692 332 23211 1074
NM_145115chr721655 300 --41868 1551 729 318 --
NM_145117chr1182884 2819 2422 2416 2122 1264 1243 417 ----1767
NM_145176chr673425 3285 3112 3005 2300 1322 453 73535 3351 3084 2329 466 427 39 --2772 614
NM_145185chr1951845 1493 1399 1366 1357 21988 1330 ----
NM_145206chr10133099 2837 2275 2019 1287 1203 924 853 737 433 152 143 61 21269 282 ----
NM_145207chr474982 4452 4292 4132 3497 3269 466 35325 2102 1682 1101 15079
NM_145244chr441713 1510 444 265 21793 199 145 --
NM_145251chr1491597 1535 1437 515 406 357 281 83 75 ------
NM_145259chr2166909 6592 6482 6215 5574 5121 4322 2838 2630 1824 1531 1434 891 883 861 363 46236 5856 2598 1380 35359 4363 716 26507 1683
NM_145263chr482211 1953 1656 915 892 668 443 272 1308 ----
NM_145266chr5----1114 --
NM_145306chr101536 ------
NM_145307chr10143404 3368 3354 3230 2870 1747 1327 1308 1239 1067 304 218 188 32 34693 1344 1169 --11133
NM_145320chr772789 2467 2213 1403 1331 1325 933 42652 1294 896 499 1672 1946
NM_145321chr772789 2467 2213 1403 1331 1325 933 42652 1294 896 499 1672 1946
NM_145322chr772789 2467 2213 1403 1331 1325 933 42652 1294 896 499 1672 1946
NM_145331chr64799 678 584 35 2310 249 ----
NM_145332chr66947 826 732 183 129 95 1397 ----
NM_145333chr66947 826 732 183 129 95 1397 ----
NM_145341chr1091866 1842 1222 592 561 448 402 369 350 1634 ----
NM_145686chr283431 2331 2103 1373 1053 919 818 429 22997 208 12916 13323
NM_145687chr283431 2331 2103 1373 1053 919 818 429 22997 208 12916 13323
NM_145690chr871825 1789 1686 695 582 531 330 11804 1309 1765
NM_145698chr1021893 1826 --12184 --
NM_145735chr1362225 1746 1031 790 487 383 12609 --1537
NM_145753chr351033 610 527 155 123 21233 141 --1203
NM_145759chr1102224 2088 1775 759 656 423 351 196 142 42 22206 96 ----
NM_145799chrX42886 2373 744 637 23136 678 12566 --
NM_145808chr7103136 2399 2363 1243 1186 1003 805 668 280 186 1288 --12913
NM_145912chr2294749 4739 4095 3974 3740 3186 3157 1343 1108 --44323 1897 593 267 --
NM_147156chr1071508 1329 1185 1089 585 562 553 11273 --11386
NM_147166chr73671 663 653 2819 67 ----
NM_147175chrX72018 1915 1371 726 465 388 37 2711 590 11820 1182
NM_147181chr411176 --21032 1019 11459
NM_147182chr411176 --21032 1019 11459
NM_147183chr411176 --21032 1019 11459
NM_147188chr1561449 598 572 392 313 225 --11388 --
NM_147189chr852286 2122 2098 1878 376 1780 22280 255 --
NM_147223chr262444 2433 1621 523 312 152 ----1422
NM_148170chr11195601 5407 4723 4455 4359 4211 4164 4120 4070 4062 3980 3904 2096 1699 1149 883 162 107 28 12082 34055 296 156 --
NM_148174chr872247 2126 610 584 495 266 151 --11713 --
NM_148918chr171167 --1320 1741
NM_148955chr15106444 6262 5807 4700 2041 1036 746 684 668 221 56168 5823 5177 1944 860 1658 --
NM_152222chr1151735 1427 1336 468 128 31979 1793 1474 --11862
NM_152230chr10185 ------
NM_152261chr1252198 1868 1732 1637 219 1946 1497 --
NM_152263chr1165233 4911 4783 4600 4533 4087 3883 3743 2115 1759 1682 1607 897 315 226 131 24656 608 14277 15296
NM_152265chr121629 1365 21613 206 21517 1477 11225
NM_152275chr241798 1697 635 29 21656 340 --12152
NM_152277chr541950 1890 1534 430 1183 ----
NM_152280chr183501 2922 2375 2294 1072 995 804 782 31404 1065 124 --12689
NM_152284chr83731 148 142 ------
NM_152291chr471062 939 406 364 339 261 160 3873 221 174 159 1980
NM_152330chr14102612 2336 2195 1843 776 760 597 536 188 55 1877 1272 1215
NM_152332chr1462668 2343 484 355 234 208 22365 2118 ----
NM_152352chr1892888 2610 2312 856 779 462 282 135 63 12099 12979 --
NM_152354chr193653 217 97 ----132
NM_152375chr1102651 2388 2015 1797 1779 749 648 322 243 210 --22204 31 --
NM_152387chr251129 1119 757 64 42 31103 1029 283 ----
NM_152388chr273530 3411 2612 1560 1032 921 691 23675 271 ----
NM_152391chr2--1765 --11011
NM_152400chr432126 218 156 21821 371 --11349
NM_152407chr573282 3155 2931 2648 1151 673 281 33239 2544 239 23209 3195 --
NM_152409chr573608 1439 1388 1218 976 408 56 23092 2547 11351 --
NM_152414chr85564 128 51 35 24 1119 --1381
NM_152418chr841833 1815 340 322 ------
NM_152420chr94797 494 217 68 ------
NM_152423chrX61596 1569 1198 1183 129 75 ------
NM_152424chrX64562 3706 3176 1216 1131 68 44447 3570 1286 848 ----
NM_152433chr114370 338 66 55 31452 168 95 ----
NM_152437chr1262272 2036 1838 795 537 32 ----1111
NM_152453chr151174 ------
NM_152519chr2112054 2009 1977 1771 1700 1573 1349 720 705 557 141 41829 776 568 491 ----
NM_152528chr2------191
NM_152529chr2154387 4344 4301 4142 3919 3338 2968 1713 1639 1513 1272 994 427 306 126 23845 1754 31484 618 450 1187
NM_152538chr361731 1635 530 274 165 115 --1548 --
NM_152542chr4102199 1853 1770 1389 872 866 698 659 563 370 11347 ----
NM_152549chr51224 ------
NM_152556chr762108 2000 1896 1820 786 217 32567 2406 835 ----
NM_152581chrX61516 1498 1461 1367 1011 68 11042 ----
NM_152588chr1251467 1458 337 106 62 31856 1373 254 11226 --
NM_152594chr1531994 1672 221 11860 1133 1441
NM_152610chr11109 ------
NM_152613chr2271245 1022 948 834 461 187 39 ------
NM_152622chr5102572 2450 2305 2158 1399 1087 918 700 369 341 33376 3158 620 ----
NM_152624chr5107411 7273 6978 6345 6173 5034 4959 2241 1966 590 67365 6994 6582 4572 2113 1339 ----
NM_152629chr9134047 3784 3751 3435 3407 3369 3137 2906 2895 2811 2782 2614 787 64099 3844 2776 1534 1525 482 1449 --
NM_152636chr11112927 2913 2901 2555 2411 2389 2163 1133 1106 1093 100 22766 1243 ----
NM_152641chr1262784 2250 2056 1931 803 423 1828 22570 344 --
NM_152678chr362489 2368 894 855 677 366 ------
NM_152682chr451619 1335 1313 1127 59 1104 147 21671 1376
NM_152687chr57973 961 880 849 167 155 65 ------
NM_152699chr363755 3728 1385 959 390 376 23543 3329 --13461
NM_152701chr731676 1346 31 31381 221 69 1634 --
NM_152705chr1341439 321 192 154 1281 11362 --
NM_152724chr1082549 2539 2499 2455 1865 705 566 242 21800 1044 21960 625 --
NM_152729chr651329 1176 1009 197 78 --1386 --
NM_152734chr6114658 4271 3792 3530 2091 1671 1532 1332 946 639 504 33940 3828 1900 --25233 1059
NM_152745chr7--11174 --1135
NM_152749chr75412 349 335 276 234 --11115 --
NM_152754chr7113591 3551 3357 3092 3001 2414 1435 1303 1293 212 165 32913 776 119 23694 1025 --
NM_152756chr573881 3875 3457 3396 350 263 96 53498 3373 1664 572 175 --13971
NM_152758chr852554 1941 879 825 763 12721 --32263 536 453
NM_152774chr742112 891 443 180 31662 271 77 ----
NM_152787chrX73801 3768 2984 2904 1021 906 593 1804 22461 851 13963
NM_152793chr7115046 4969 4907 4404 3139 1838 1763 1642 1553 1411 685 44024 3344 670 159 24882 3937 21676 1522
NM_152826chr15106444 6262 5807 4700 2041 1036 746 684 668 221 56168 5823 5177 1944 860 1658 --
NM_152829chr74386 92 86 64 11283 --1210
NM_152835chr142799 2038 743 699 --22382 2178 1676
NM_152836chr821448 110 21519 659 --193
NM_152837chr821448 110 21519 659 --193
NM_152838chr2053446 3300 3251 1001 703 13009 33376 612 260 --
NM_152866chr1172237 1567 1547 1498 600 492 243 ------
NM_152903chr1392907 2297 2070 1827 1002 927 604 456 429 32447 2095 412 12715 --
NM_152924chr15126084 5508 5461 5350 4808 4753 4264 4200 2072 1526 1515 522 35082 2748 2192 15217 --
NM_152989chr1221656 242 21872 655 11747 11322
NM_152999chr794886 4525 4140 3445 3212 1706 754 344 287 34904 3776 3155 --13870
NM_153013chr572328 2196 2177 2063 848 838 380 1456 --2912 668
NM_153042chr62543 259 31424 1386 1238 31835 1544 109 1663
NM_153050chr2274987 3988 3957 3621 3451 851 828 33518 3188 1990 11620 --
NM_153051chr2274987 3988 3957 3621 3451 851 828 33518 3188 1990 11620 --
NM_153182chr3113215 2677 2423 2287 1282 1063 850 796 763 218 59 33353 2888 628 12596 --
NM_153188chr5104858 4199 4068 3684 1943 1301 1290 1263 277 30 95268 4273 4018 3584 3550 1425 637 348 310 11193 --
NM_153207chr12113883 3636 3397 2829 2820 2718 2615 1595 1580 1473 986 33999 2793 1319 1560 --
NM_153223chr541444 1273 1028 58 41146 1055 503 278 1120 --
NM_153234chr562765 2724 2156 642 248 172 22518 858 --22339 2198
NM_153235chr662097 2047 1631 788 734 610 3854 246 121 11989 1143
NM_153262chr173052 3023 2482 859 327 298 125 31288 999 402 22803 1247 12622
NM_153332chr843113 3104 2677 405 23242 106 21034 302 12691
NM_153343chr482325 1898 850 708 501 110 57 43 22057 1516 11675 --
NM_153346chrX111933 1919 1686 1403 1376 1278 792 616 476 372 78 11864 11362 1504
NM_153365chr472800 2670 905 898 824 295 233 62554 2502 2303 2272 737 463 22158 702 --
NM_153367chr10102951 2862 2804 2788 2780 1475 1290 842 425 274 23849 2754 13486 --
NM_153456chr13135932 5640 4566 4510 4340 4249 4055 3862 3833 1979 1897 628 584 44106 2474 2236 1050 21481 1472 --
NM_153464chr197748 691 679 657 285 261 121 --1633 --
NM_153607chr562984 2872 2763 627 308 204 33179 808 163 --22256 284
NM_153613chr151159 ------
NM_153616chr1592242 1813 1613 1578 956 930 848 771 151 22419 80 --12080
NM_153617chr1592242 1813 1613 1578 956 930 848 771 151 22419 80 --12080
NM_153618chr1592242 1813 1613 1578 956 930 848 771 151 22419 80 --12080
NM_153619chr15123480 3051 2851 2816 2405 2275 1389 1182 1164 734 700 562 33657 1318 582 --13318
NM_153645chr22123243 2937 2878 2577 2533 2233 2129 719 214 151 118 22 33085 2849 2352 13178 --
NM_153649chr162303 2238 2138 1743 1656 692 11903 --1329
NM_153686chr442487 2466 2185 430 21784 1768 --2796 382
NM_153689chr242252 2116 1982 432 22158 766 12133 11664
NM_153690chr33818 805 714 1856 ----
NM_153702chr41274 ------
NM_153706chr51264 ----192
NM_153712chr2123520 3431 3153 2794 2682 2392 1315 888 859 792 521 118 1598 13812 --
NM_153756chr152004 757 735 467 345 21289 355 1792 --
NM_153759chr291300 1267 1234 1157 923 891 378 241 179 3135 74 64 ----
NM_153810chr10145026 4990 4847 4329 3773 3586 3561 3314 3112 1242 434 341 309 111 35106 480 163 33120 1521 1135 13895
NM_153831chr84776 725 401 236 ----1903
NM_170606chr761807 1257 1188 641 493 366 --1737 --
NM_170665chr12114100 3953 3860 3503 3323 3020 1126 937 675 384 165 34029 1687 832 14172 --
NM_170686chr793003 2629 2403 2051 580 518 391 260 53 21948 841 ----
NM_170709chr8102434 2247 2104 1987 1829 1562 724 519 421 157 ----22267 34
NM_170710chr452999 2697 2671 689 679 62756 2712 837 576 313 162 21123 955 --
NM_170731chr1182806 2618 2158 2113 1831 1782 1138 1042 52373 1775 848 487 392 --12737
NM_170732chr1182806 2618 2158 2113 1831 1782 1138 1042 52373 1775 848 487 392 --12737
NM_170733chr1182806 2618 2158 2113 1831 1782 1138 1042 52373 1775 848 487 392 --12737
NM_170734chr1182806 2618 2158 2113 1831 1782 1138 1042 52373 1775 848 487 392 --12737
NM_170735chr1182806 2618 2158 2113 1831 1782 1138 1042 52373 1775 848 487 392 --12737
NM_170745chr6122 ------
NM_170751chr661471 1235 1008 526 250 199 21023 910 ----
NM_170752chr661471 1235 1008 526 250 199 21023 910 ----
NM_171998chrX82547 2096 2032 1983 1946 1592 576 537 21959 23 ----
NM_172069chr242386 1758 653 195 31836 662 413 --1183
NM_172070chr262216 2206 731 650 509 140 11545 11713 1480
NM_172071chr1126289 4661 4648 2983 2854 2846 2692 2155 2046 1411 1265 963 47122 6599 1592 466 17175 --
NM_172103chr682610 2424 2334 2309 2152 810 366 295 1668 --1316
NM_172105chr682610 2424 2334 2309 2152 810 366 295 1668 --1316
NM_172127chr441570 1564 608 478 31719 1585 1393 1585 1272
NM_172128chr441526 1520 564 434 31675 1541 1349 1541 1228
NM_172159chr382188 1933 1470 897 760 549 497 360 1624 --11920
NM_172160chr382188 1933 1470 897 760 549 497 360 1624 --11920
NM_172169chr1061890 1377 697 424 311 285 21425 112 11536 --
NM_172170chr1061890 1377 697 424 311 285 21425 112 11536 --
NM_172171chr1061890 1377 697 424 311 285 21425 112 11536 --
NM_172173chr1061890 1377 697 424 311 285 21425 112 11536 --
NM_172218chr85810 668 208 90 72 1125 ----
NM_172337chr145823 786 622 312 251 --1710 --
NM_172344chr251185 538 504 190 120 2307 150 11640 --
NM_173060chr551994 1879 1671 1300 39 1689 --22054 727
NM_173061chr551994 1879 1671 1300 39 1689 --22054 727
NM_173063chr551994 1879 1671 1300 39 1689 --22054 727
NM_173075chr481667 1579 1508 1439 1246 658 535 475 21289 700 ----
NM_173083chr141151 991 925 875 11044 11237 --
NM_173177chr21527 ----168
NM_173198chr972132 1869 775 494 343 131 61 22460 286 --1577
NM_173200chr972132 1869 775 494 343 131 61 22460 286 --1577
NM_173214chr16137741 7691 6481 6095 5469 5214 2907 2669 1326 729 615 259 144 68290 7451 6819 5416 2712 90 16920 11312
NM_173355chr23712 243 163 1302 ----
NM_173359chr351932 1754 1655 1622 1362 1615 ----
NM_173454chr152898 300 1984 1873 2275 101
NM_173468chr475366 4990 4833 1994 858 766 286 24343 2229 --1414
NM_173469chr1531376 496 474 --1622 1613
NM_173470chrX92698 2110 2090 804 719 458 412 260 124 3656 240 68 ----
NM_173471chr361086 970 953 358 351 244 1843 ----
NM_173473chr1072248 2175 1837 1679 737 608 573 --32328 627 43 --
NM_173495chrX122363 1820 1038 901 861 763 738 556 448 408 375 43 42229 959 729 191 ----
NM_173496chr1082781 2634 2567 2413 1168 1020 819 754 2881 199 2889 226 --
NM_173500chr155410 376 231 111 83 ------
NM_173503chr171134 ------
NM_173510chr2242952 2747 2338 1077 12091 ----
NM_173511chr253628 3500 3464 1139 397 43839 2730 300 215 --13660
NM_173531chr1963803 2706 2690 924 910 344 42423 762 504 212 199 11495
NM_173536chr4155124 4915 4206 3365 3354 3181 2068 1430 1249 1159 1027 979 728 710 639 13202 1205 13542
NM_173545chr281963 1653 669 534 381 318 299 253 11713 21557 435 --
NM_173552chr352358 2206 1926 1668 51 1155 1763 12081
NM_173562chr662800 2437 616 404 300 280 --23353 2727 22981 327
NM_173576chr1081765 1443 791 711 605 581 434 314 2827 230 21432 806 31747 1644 1639
NM_173582chr11146162 6103 5223 5078 4921 4690 4408 2290 1856 1675 1104 803 439 364 55837 4468 1120 1072 656 26021 4843 25786 2224
NM_173591chr122875 355 1153 2310 175 --
NM_173595chr1274561 3659 3439 1966 1487 921 252 34623 3777 1481 12092 24654 613
NM_173602chr1293477 3462 3456 2978 2560 1186 955 887 874 41452 1210 1113 152 --1534
NM_173626chr172569 547 ------
NM_173642chr1148600 8148 7636 7073 6865 6407 6183 3257 1830 1751 1719 1396 1260 328 18137 17442 --
NM_173647chr241147 1128 811 326 --1964 1364
NM_173654chr342294 2184 1726 23 31757 1473 121 --21978 945
NM_173667chr542398 390 317 181 21713 166 11853 --
NM_173676chr65876 614 570 298 222 1677 1653 1860
NM_173683chr871465 1443 1247 677 240 98 65 2620 423 21580 520 --
NM_173694chrX72437 2232 1891 1044 430 270 234 1761 22457 2360 --
NM_173698chrX81991 1965 1909 1772 1497 1369 1294 236 ------
NM_173797chr541294 1269 1010 955 --1470 --
NM_173808chr194451 4008 3852 3735 3659 1315 1199 760 691 64367 4359 4143 1384 1209 497 21767 1465 24206 3633
NM_173812chr1251299 1205 1062 998 404 11323 11263 --
NM_173822chr241666 1409 395 61 32151 2117 153 ----
NM_173825chr392893 2803 995 924 769 682 263 232 98 22772 2358 23107 490 --
NM_173829chr5136197 5794 5675 5609 4981 4470 4271 2109 1914 1076 645 314 48 15829 15064 12392
NM_174887chr172358 126 ----2107 33
NM_174902chr1171716 1670 1643 1505 1378 1206 493 21770 299 11622 --
NM_174907chr31115 ------
NM_174911chr853953 3871 1248 1167 589 11072 13409 --
NM_174916chr1592373 2358 2086 1724 935 827 455 406 60 122 ----
NM_174929chr752254 2087 1931 1819 1607 2621 116 1244 12215
NM_175061chr742152 1848 865 422 41432 698 429 275 ----
NM_175607chr351595 1485 1231 1083 354 2245 168 --21612 483
NM_175612chr351595 1485 1231 1083 354 2245 168 --21612 483
NM_175623chr12127133 5858 5263 5045 2802 2474 2425 2140 1600 891 389 331 27322 5801 45868 5525 4803 823 --
NM_175624chr12127228 5953 5358 5140 2897 2569 2520 2235 1695 986 484 426 27417 5896 55963 5620 4898 918 69 --
NM_175625chr12127228 5953 5358 5140 2897 2569 2520 2235 1695 986 484 426 27417 5896 55963 5620 4898 918 69 --
NM_175629chr291300 1267 1234 1157 923 891 378 241 179 3135 74 64 ----
NM_175634chr831028 391 136 11091 149 1172
NM_175635chr831028 391 136 11091 149 1172
NM_175636chr831028 391 136 11091 149 1172
NM_175733chr1142060 1787 1363 682 2559 38 --11753
NM_175736chr12117429 6141 6072 5698 5062 5043 2020 1833 1729 1010 597 57558 5241 2758 2030 1191 --16898
NM_175747chr65879 782 309 215 186 ----1433
NM_175748chr1452168 2156 1481 470 376 12180 --12044
NM_175768chr681757 1738 1663 1655 1367 1313 1095 613 21425 107 --1300
NM_175848chr205532 416 348 266 258 1404 11066 --
NM_175848chr205532 416 348 266 258 1404 11066 --
NM_175849chr205532 416 348 266 258 1404 11066 --
NM_175849chr205532 416 348 266 258 1404 11066 --
NM_175850chr205532 416 348 266 258 1404 11066 --
NM_175850chr205532 416 348 266 258 1404 11066 --
NM_175859chrX91320 711 561 522 505 499 330 182 65 ------
NM_175876chr1112491 2194 2165 2099 2073 1914 1739 699 375 304 201 32382 2312 671 --11049
NM_175907chr1862816 2496 2246 2105 441 199 2826 112 11148 --
NM_175910chr1981928 1880 1759 974 393 309 224 140 1927 6892 813 729 561 477 57 --
NM_175920chr52207 73 ----1348
NM_175921chr564325 3868 3636 3188 982 41 1145 1462 --
NM_175931chr1671453 747 718 482 452 191 182 ------
NM_176824chr451376 505 417 371 185 1212 ----
NM_177414chr13353 285 33 21432 161 11740 11144
NM_177422chr11449 ------
NM_177438chr1484172 3996 3988 3751 3584 2741 1165 116 51007 299 159 36 24 14067 11082
NM_177452chr1481915 1881 972 601 304 197 187 56 21767 1742 --12513
NM_177454chr23589 238 232 1657 ----
NM_177531chr861166 1137 1064 974 869 73 2831 171 ----
NM_177538chr2116776 6516 5449 3207 2991 2817 2769 2681 2163 1250 334 58015 6956 5687 1193 512 47853 5617 1473 1068 15739
NM_177553chr111374 1789 --1937
NM_177925chr1262411 2291 1982 1910 370 40 22015 898 ----
NM_177966chr361438 1296 727 105 73 53 ----1237
NM_177972chr1184024 3306 3293 1231 774 522 483 334 23161 2714 24446 4210 23855 756
NM_177974chr1541964 1710 384 41 2370 321 11659 --
NM_177976chr32475 77 ------
NM_177985chr272246 2202 2196 1689 1573 724 68 22126 1399 ----
NM_177989chr32330 259 ------
NM_177990chr2082036 1884 1708 1368 640 547 361 84 21685 77 127 --
NM_177996chr2083239 3085 2479 2362 1250 1220 834 493 11264 22800 646 33078 539 516
NM_178006chr1332055 390 160 22218 2093 1519 11730
NM_178007chr1332055 390 160 22218 2093 1519 11730
NM_178010chr1221656 242 21872 655 11747 11322
NM_178011chr10133285 3232 3130 3071 2715 2566 2221 2180 300 288 267 107 57 33032 856 96 22156 1065 1532
NM_178042chr32330 259 ------
NM_178120chr261401 1018 465 358 343 269 1333 11209 --
NM_178123chr231058 867 432 1103 --11031
NM_178127chr111462 --1100 --
NM_178140chr572649 2513 2417 2276 872 803 659 ----1606
NM_178151chrX157865 7186 7093 6567 6501 5424 5224 4897 2491 2150 1983 1718 1457 1076 936 27391 2057 26455 258 16834
NM_178152chrX157865 7186 7093 6567 6501 5424 5224 4897 2491 2150 1983 1718 1457 1076 936 27391 2057 26455 258 16834
NM_178153chrX157865 7186 7093 6567 6501 5424 5224 4897 2491 2150 1983 1718 1457 1076 936 27391 2057 26455 258 16834
NM_178154chr14--1103 --1654
NM_178155chr14--1103 --1654
NM_178156chr14--1103 --1654
NM_178157chr14--1103 --1654
NM_178313chr241842 1529 464 79 11520 1247 --
NM_178426chr152027 1993 1974 1737 1661 22009 350 21522 717 --
NM_178427chr161927 1893 1874 1637 1561 913 21909 250 21422 617 --
NM_178483chr20183 ------
NM_178509chr1743771 3151 2736 537 74164 3990 3898 3751 2561 1085 1065 23704 154 23978 1644
NM_178566chr941839 1763 610 551 --11346 1639
NM_178584chr251496 1286 1065 350 242 51313 1206 944 926 467 ----
NM_178585chr4133221 3146 3114 2898 2444 2355 2326 2049 1107 1040 953 874 153 21262 687 11091 12771
NM_178586chr1442429 2284 2085 100 --1903 11944
NM_178842chr1572080 1843 1445 688 422 249 146 11629 ----
NM_178868chr3153 --1349 --
NM_180989chr13112499 1984 1955 1694 1678 661 628 436 292 155 110 1975 ----
NM_181077chr1552185 2022 1641 320 155 32100 1674 49 ----
NM_181265chr452999 2697 2671 689 679 62756 2712 837 576 313 162 21123 955 --
NM_181291chr143777 635 225 ------
NM_181310chr661683 1477 1170 699 600 394 11743 --21852 453
NM_181349chr783001 2373 1977 1895 941 837 805 596 33068 2824 422 179 12363
NM_181351chr1172914 2566 2451 2254 775 551 23 41994 869 175 32 1498 --
NM_181358chr184243 4085 3635 3324 1432 1316 1177 142 --2912 624 14160
NM_181361chr31141 1272 31364 1331 589 --
NM_181443chr2072918 2521 2457 2319 605 400 166 42737 2482 2276 420 --11921
NM_181458chr261470 1453 1083 506 485 26 1288 ----
NM_181481chr18167073 6461 6333 6018 5568 5529 4292 2826 2325 2048 1514 1458 1392 1229 493 300 15978 1111 --
NM_181482chr18167073 6461 6333 6018 5568 5529 4292 2826 2325 2048 1514 1458 1392 1229 493 300 15978 1111 --
NM_181483chr18167073 6461 6333 6018 5568 5529 4292 2826 2325 2048 1514 1458 1392 1229 493 300 15978 1111 --
NM_181504chr5143594 3338 2977 2617 2537 1371 1120 1000 974 532 407 295 101 62 23927 3077 ----
NM_181521chr16147077 6664 6286 5731 5416 5151 2109 1811 1804 1492 958 779 314 118 46591 6554 1023 817 37115 2663 2040 --
NM_181523chr5143594 3338 2977 2617 2537 1371 1120 1000 974 532 407 295 101 62 23927 3077 ----
NM_181524chr5143594 3338 2977 2617 2537 1371 1120 1000 974 532 407 295 101 62 23927 3077 ----
NM_181575chr2195 ------
NM_181581chr73846 819 716 --1916 --
NM_181644chr15628 353 175 127 21 ----1420
NM_181659chr2073357 3093 1292 1002 645 339 303 32145 2096 232 13134 --
NM_181659chr2073357 3093 1292 1002 645 339 303 32145 2096 232 13134 --
NM_181670chr1251083 1020 503 470 133 1461 1190 --
NM_181672chrX21454 719 1737 --12030
NM_181673chrX21454 719 1737 --12030
NM_181702chr82230 176 21003 830 1785 1910
NM_181705chr5124961 4665 4160 3943 3682 3675 3523 2191 1025 885 252 62 25074 4776 24084 3598 14267
NM_181706chr11112182 2175 2151 2142 1999 1952 1943 1610 1602 562 112 1285 ----
NM_181714chr651987 1727 1639 1416 710 21908 1817 --11609
NM_181723chr82926 855 3560 360 169 --12296
NM_181762chrX31117 371 222 ----1104
NM_181777chrX31117 371 222 ----1104
NM_181780chr392128 1954 1919 1484 511 394 256 232 221 21397 462 --11813
NM_181782chr642141 1705 385 153 ----12235
NM_181784chr232525 1026 668 32363 1985 579 --1697
NM_181787chr863747 3301 1356 1270 855 42 2967 731 12936 --
NM_181794chr66977 970 922 454 395 285 1750 ----
NM_181795chr66977 970 922 454 395 285 1750 ----
NM_181836chr541900 1774 654 527 12568 ----
NM_181838chr531420 1183 1029 21219 411 ----
NM_181861chr1252853 2837 1884 296 273 --12507 --
NM_181868chr1252853 2837 1884 296 273 --12507 --
NM_181869chr1252938 2922 1969 381 358 131 12592 --
NM_181886chr441251 1029 323 242 --1881 21261 536
NM_181887chr441251 1029 323 242 --1881 21261 536
NM_181888chr441251 1029 323 242 --1881 21261 536
NM_181889chr441251 1029 323 242 --1881 21261 536
NM_181890chr441251 1029 323 242 --1881 21261 536
NM_181891chr441251 1029 323 242 --1881 21261 536
NM_181892chr441298 1076 370 289 --1928 21308 583
NM_181893chr441251 1029 323 242 --1881 21261 536
NM_181897chr332610 1798 399 1488 22705 2189 --
NM_182314chrX2655 258 1549 31862 1317 572 --
NM_182481chr2181319 1140 464 399 144 116 105 75 1430 ----
NM_182482chr2181319 1140 464 399 144 116 105 75 1430 ----
NM_182485chr483228 2884 2431 1293 1096 526 178 81 1150 11265 1409
NM_182503chr6205352 4901 4883 4742 4614 4220 4131 4057 4049 4040 4030 3821 3772 3709 1767 950 813 806 705 629 45512 4954 3659 580 --11166
NM_182515chr19145768 5377 4951 4869 4673 4456 4186 2384 2067 2012 1355 1072 524 164 25880 5624 64811 1054 608 356 273 111 15410
NM_182522chr351345 1132 290 260 87 ----1455
NM_182551chr2103002 2986 2894 2191 1335 1229 1048 1042 636 592 32782 959 846 --13489
NM_182569chr17196 --1565 --
NM_182641chr17121962 1839 1422 746 529 520 408 288 242 189 104 37 129 11539 --
NM_182646chr483228 2884 2431 1293 1096 526 178 81 1150 11265 1409
NM_182664chr182423 727 464 357 267 87 63 48 11637 ----
NM_182697chr751554 1537 591 584 331 21187 83 ----
NM_182703chr1571285 1107 1084 943 494 441 271 1516 1927 --
NM_182717chr1071550 1415 1067 605 477 303 220 2396 343 ----
NM_182720chr1071550 1415 1067 605 477 303 220 2396 343 ----
NM_182721chr1071550 1415 1067 605 477 303 220 2396 343 ----
NM_182722chr1071550 1415 1067 605 477 303 220 2396 343 ----
NM_182723chr1071550 1415 1067 605 477 303 220 2396 343 ----
NM_182734chr2092463 2324 2297 2286 2201 2056 606 186 42 2511 53 --12403
NM_182756chr25527 475 129 73 42 ----162
NM_182762chr7106159 5801 1889 1883 1746 931 708 701 381 197 75772 5204 5134 4693 4358 2416 1646 15294 14812
NM_182765chr1051675 924 310 161 102 190 --1395
NM_182767chr1241642 1293 658 193 21398 572 --21421 529
NM_182789chr52368 73 1162 --160
NM_182797chr2081700 1414 1384 1289 625 570 461 372 41518 1481 1184 40 1495 21735 1625
NM_182830chr1462044 2019 1963 1733 1713 1431 21748 349 1890 --
NM_182835chr14152 ------
NM_182848chr1381531 1498 1217 1179 1006 233 97 59 --1653 --
NM_182853chr1071550 1415 1067 605 477 303 220 2396 343 ----
NM_182898chr7106536 5296 4607 4424 2437 2199 2186 1939 966 747 65389 5311 4021 2177 1688 821 14025 16319
NM_182899chr7106536 5296 4607 4424 2437 2199 2186 1939 966 747 65389 5311 4021 2177 1688 821 14025 16319
NM_182907chr6112417 2320 2053 1723 1609 1585 1495 951 941 821 188 32116 1752 965 198 --
NM_182931chr7----2622 487 --
NM_182943chr331222 403 327 3382 199 115 1435 --
NM_182948chr163044 2584 2041 1205 992 489 22522 1920 13167 --
NM_182964chr1182884 2819 2422 2416 2122 1264 1243 417 ----1767
NM_182976chr1152 1715 1178 --
NM_183004chr14113628 2953 2888 2660 2637 2568 1575 1531 917 433 85 22768 1048 13481 --
NM_183011chr1071550 1415 1067 605 477 303 220 2396 343 ----
NM_183012chr1071550 1415 1067 605 477 303 220 2396 343 ----
NM_183013chr1071550 1415 1067 605 477 303 220 2396 343 ----
NM_183075chr472044 833 806 345 330 76 28 32354 2107 1883 ----
NM_183079chr2041276 1178 979 239 2324 312 ----
NM_183227chr651453 1363 1271 619 408 1439 11445 --
NM_183323chr52368 73 1162 --160
NM_183376chr1552446 2406 1808 238 117 21997 420 22463 1768 --
NM_183397chr2064408 3887 1142 967 787 359 --11812 15015
NM_183416chr152028 797 542 406 152 1143 ----
NM_183419chr841298 1143 578 95 31156 1044 263 11055 1238
NM_184234chr205690 609 556 295 204 1786 --1662
NM_194247chr2124339 4328 4009 3805 3561 2924 1242 1111 736 438 213 112 24553 1225 12767 --
NM_194282chr4113108 3018 2828 2602 2447 2385 2344 2330 2035 1961 886 1364 ----
NM_194283chr5134025 3962 3880 3742 3464 3426 3153 3044 3000 2923 2653 1155 136 44169 2700 229 170 --23812 3016
NM_194286chr12196163 5444 5269 4943 4673 4401 4311 4288 4264 4181 4084 4038 4025 3910 3863 2389 2003 1819 543 56211 4989 4756 2032 760 25300 4470 --
NM_194298chr1041465 1387 274 91 1512 1110 --
NM_194301chr1431079 443 408 1323 ----
NM_194313chr951933 1779 1549 676 101 51985 1902 1856 1822 394 ----
NM_194314chr1165510 5315 5270 5222 4515 4329 4216 3565 3482 2218 2080 1681 1227 953 594 179 44933 3673 1508 120 11194 11624
NM_194328chr962574 2155 2122 2038 1268 296 11098 12850 --
NM_194329chr962574 2155 2122 2038 1268 296 11098 12850 --
NM_194330chr962574 2155 2122 2038 1268 296 11098 12850 --
NM_194332chr962574 2155 2122 2038 1268 296 11098 12850 --
NM_194434chr18155808 5680 5354 5291 5203 4647 4169 3771 1759 1682 1585 1566 686 592 502 45795 4755 2237 1074 ----
NM_194442chr14592 485 77 56 2712 26 ----
NM_194463chrX61140 1129 840 448 254 44 11148 ----
NM_197941chr5103074 2831 2360 1006 821 788 647 512 380 148 12477 ----
NM_198081chr662740 2590 1929 838 832 140 32563 2020 34 126 --
NM_198087chr1671531 999 401 327 149 122 103 ------
NM_198088chr1671531 999 401 327 149 122 103 ------
NM_198128chr1871886 1838 1546 1464 879 437 216 12319 ----
NM_198158chr3112743 2646 2638 2597 2177 1178 1135 786 633 565 276 12882 ----
NM_198159chr3112743 2646 2638 2597 2177 1178 1135 786 633 565 276 12882 ----
NM_198177chr3112743 2646 2638 2597 2177 1178 1135 786 633 565 276 12882 ----
NM_198178chr3112743 2646 2638 2597 2177 1178 1135 786 633 565 276 12882 ----
NM_198181chr1582953 2838 2569 2408 2349 2343 2321 254 42515 2484 2248 36 --12270
NM_198212chr7102215 2153 1860 1846 1736 1671 1569 1503 1467 784 22128 490 1812 --
NM_198215chr1051078 1068 934 451 245 2894 497 ----
NM_198268chr184243 4085 3635 3324 1432 1316 1177 142 --2912 624 14160
NM_198269chr184243 4085 3635 3324 1432 1316 1177 142 --2912 624 14160
NM_198270chrX143423 3319 3241 3181 2832 2615 2295 2137 1362 1097 882 280 36 28 33091 411 68 1425 --
NM_198273chr5102450 2438 1067 1025 591 474 420 350 219 89 31971 600 407 23108 3034 --
NM_198281chr4103266 3229 2988 2674 2405 1162 572 419 404 67 22623 2505 191 12781
NM_198291chr2011559 ------
NM_198329chr351438 1349 1229 1201 80 1517 ----
NM_198336chr791875 1768 1753 1745 1629 1274 724 587 239 31588 399 220 ----
NM_198353chr41401 ------
NM_198390chr1641940 1773 1767 507 31845 1357 46 ----
NM_198391chr2041413 1353 550 434 ----186
NM_198400chr15102916 2891 2731 2704 2383 2238 2001 1023 727 53 22318 846 11171 --
NM_198401chr871663 1541 1443 567 468 427 326 --11653 192
NM_198439chr114370 338 66 55 31452 168 95 ----
NM_198465chrX92939 2523 2023 2013 1026 861 688 429 118 21111 838 11145 22686 2677
NM_198485chr392564 2141 2071 1829 1667 721 555 479 214 ------
NM_198503chr151864 1769 1547 433 331 21688 640 ----
NM_198549chr143024 2877 2405 397 22533 1263 33322 2601 1235 --
NM_198565chr31217 ------
NM_198581chr271398 946 856 469 429 236 130 11957 27442 5962 --
NM_198595chr4104872 4778 4767 4675 4361 4307 4271 2007 1006 181 1636 23709 1723 --
NM_198793chr3123717 3066 1492 1442 1433 1366 1342 1156 1011 971 918 867 43975 3074 2532 171 ----
NM_198794chr1431334 1171 522 ----1456
NM_198829chr751436 1128 1058 376 153 1318 --1467
NM_198859chr3135116 4965 4510 4443 4025 3623 3188 1510 1504 1023 900 825 389 21060 678 14191 --
NM_198880chr33616 564 558 ------
NM_198896chr1151727 667 608 561 310 72247 2173 1492 798 733 459 219 --1478
NM_198900chr12117429 6141 6072 5698 5062 5043 2020 1833 1729 1010 597 57558 5241 2758 2030 1191 --16898
NM_198901chr731192 503 263 31350 863 435 1289 --
NM_198904chr561744 1431 792 365 243 227 41561 1541 602 289 11389 --
NM_198935chr2073063 2865 2797 2675 2336 1993 1159 12853 12585 12410
NM_198947chr1171058 1024 288 255 206 133 48 ----1672
NM_198991chr186642 552 243 197 108 23 ------
NM_199000chr752308 2048 1991 1474 332 11481 11686 --
NM_199003chr871042 624 588 437 163 156 136 21301 488 ----
NM_199039chr441094 856 206 132 ----1147
NM_199040chr12113867 2514 2333 1237 1189 816 495 462 365 198 179 23496 1141 32775 2422 718 --
NM_199072chr783195 2763 2662 2386 2279 2126 1025 27 23070 3034 ----
NM_199132chr1931374 402 374 1219 2361 23 1305
NM_199144chr20----11442 --
NM_199166chr31111 ------
NM_199169chr2093248 3137 3108 2663 2450 1392 370 254 191 32709 889 577 13034 2912 49
NM_199170chr2093248 3137 3108 2663 2450 1392 370 254 191 32709 889 577 13034 2912 49
NM_199171chr2093248 3137 3108 2663 2450 1392 370 254 191 32709 889 577 13034 2912 49
NM_199188chr12114111 4010 3995 3446 3245 3080 1154 853 841 416 163 23852 1254 32863 683 497 1917
NM_199189chr53663 376 165 1833 ----
NM_199190chr12114111 4010 3995 3446 3245 3080 1154 853 841 416 163 23852 1254 32863 683 497 1917
NM_199203chr20----11442 --
NM_199229chr281549 1413 1283 1142 398 260 147 134 1598 31774 1199 685 --
NM_199320chr462868 2548 2140 1928 1059 82 42273 2237 2226 344 ----
NM_199320chr462868 2548 2140 1928 1059 82 42273 2237 2226 344 ----
NM_199324chr493750 3542 2588 2491 1429 1271 843 245 83 3516 298 148 ----
NM_199421chr14155119 5106 4947 4604 4476 4347 4259 4214 3980 3453 1631 1294 757 576 406 44553 1201 777 109 24842 4724 14033
NM_199436chr2102969 2785 2714 2256 1149 903 843 694 677 260 1170 --128
NM_199437chr1172555 2323 1999 839 748 553 508 22207 212 --11621
NM_199438chr1172555 2323 1999 839 748 553 508 22207 212 --11621
NM_199439chr1172555 2323 1999 839 748 553 508 22207 212 --11621
NM_199454chr164526 4158 3837 3444 1539 284 13579 --23532 711
NM_199461chr10143614 3520 3375 3298 3022 2966 2772 2601 1441 1371 1264 651 431 235 13577 32714 1242 459 12816
NM_199462chr174175 4136 3869 3546 1317 249 228 11104 24385 1212 11828
NM_199482chr231447 323 267 11957 ----
NM_201263chr1122121 1905 1745 1733 1542 1497 1472 729 641 389 115 46 21933 1887 11291 11838
NM_201266chr292988 2295 2201 1946 738 495 460 374 43 3896 708 256 ----
NM_201269chr12371 247 1158 1995 --
NM_201278chr1181992 1783 1461 636 547 540 443 329 --21893 1449 --
NM_201279chr292988 2295 2201 1946 738 495 460 374 43 3896 708 256 ----
NM_201281chr1181992 1783 1461 636 547 540 443 329 --21893 1449 --
NM_201428chr1131644 1280 1217 137 ----
NM_201429chr1131644 1280 1217 137 ----
NM_201430chr1131570 1206 1143 ------
NM_201545chr131510 1156 973 41312 1060 955 33 21281 343 --
NM_201559chr6134936 4917 4815 4589 3937 3745 3182 3162 1058 700 685 213 55 11248 1232 21003 33
NM_201591chr461753 1675 1373 295 265 86 11353 11929 --
NM_201592chr461753 1675 1373 295 265 86 11353 11929 --
NM_201613chr129900 860 853 817 305 262 197 167 59 3887 869 129 ----
NM_203282chr1961827 1436 725 365 325 115 1658 ----
NM_203283chr46648 410 221 181 169 46 ------
NM_203284chr46648 410 221 181 169 46 ------
NM_203327chr20104581 3993 3978 3664 3649 3182 2824 1803 1164 75 14293 13835 13354
NM_203341chr15947 927 921 313 260 2802 415 ----
NM_203342chr183498 3487 3358 3096 3082 2385 466 407 22701 1122 22705 60 --
NM_203343chr183498 3487 3358 3096 3082 2385 466 407 22701 1122 22705 60 --
NM_203350chr151576 1357 661 591 245 2199 134 ----
NM_203372chr241683 1428 673 287 1667 --1157
NM_203390chr871595 597 551 515 446 297 54 11645 11461 --
NM_203394chr1272298 2153 1766 1026 921 656 512 42202 1873 1788 663 12396 --
NM_203406chr5102700 2520 2509 2443 1119 846 647 293 275 219 52806 2616 2224 901 488 2978 614 --
NM_203434chr941151 1089 158 65 --11237 --
NM_203446chr2142836 2517 179 34 22364 931 --12596
NM_203451chr136932 561 508 386 361 216 22113 1666 22192 397 1631
NM_203454chr16942 383 369 279 242 186 41303 1081 512 344 ----
NM_203458chr183496 3448 3264 3204 2607 1330 835 658 1901 ----
NM_203459chr1102572 2113 1973 1813 1778 1593 855 587 107 91 21904 27 --21955 173
NM_203463chr2144540 4430 4075 3408 3246 3212 3092 1973 1559 1529 1509 1412 437 29 54342 1905 1825 1702 125 1426 24019 1083
NM_203504chr472370 2233 1820 1041 634 471 309 22281 2273 2987 971 11698
NM_203505chr472370 2233 1820 1041 634 471 309 22281 2273 2987 971 11698
NM_203506chr1741923 1868 1742 191 --21777 385 2106 44
NM_205846chr511074 11162 11509 11064
NM_205860chr163153 2920 2790 1036 1012 321 32245 790 33 12218 --
NM_206594chr1103584 3440 3418 3358 3349 3237 2928 2922 2345 1402 12376 33017 2318 136 --
NM_206595chr1103584 3440 3418 3358 3349 3237 2928 2922 2345 1402 12376 33017 2318 136 --
NM_206853chr6134027 3990 3717 3588 3097 2935 2842 2721 1455 612 426 299 141 11074 11193 --
NM_206854chr6185288 5251 4978 4849 4358 4196 4103 3982 1873 1687 1560 1402 879 781 681 570 430 101 33342 1139 893 1797 11000
NM_206855chr6196253 6216 5943 5814 5323 5161 5068 4947 3983 2525 2367 1844 1746 1646 1535 1395 1066 834 666 34307 2104 1858 11762 21965 74
NM_206866chr2173135 3079 2655 2535 1015 387 240 32944 2733 1231 ----
NM_206876chr283509 3133 2775 2722 2520 2331 2253 231 13242 32650 2635 76 12872
NM_206907chr563014 2825 2185 958 395 173 ------
NM_206909chr8198315 7656 7378 7142 6378 6241 5912 5403 5377 5136 3353 3292 3017 1882 1813 1484 1282 1165 107 27867 1041 57895 6128 5963 3167 2907 38361 1891 42
NM_206927chr115876 858 720 190 132 1598 1317 --
NM_206928chr115876 858 720 190 132 1598 1317 --
NM_206929chr115876 858 720 190 132 1598 1317 --
NM_206930chr115876 858 720 190 132 1598 1317 --
NM_206938chr1151890 510 263 221 184 12015 11703 --
NM_206939chr1151890 510 263 221 184 12015 11703 --
NM_206940chr1151890 510 263 221 184 12015 11703 --
NM_206943chr21234 ------
NM_206963chr32142 126 ----173
NM_206998chr11129 ------
NM_207015chr341658 956 396 49 11976 --11621
NM_207032chr2051540 1024 498 292 250 --1483 1202
NM_207033chr2051448 932 406 200 158 --1391 1110
NM_207034chr2051448 932 406 200 158 --1391 1110
NM_207043chr172305 2111 1597 861 804 527 326 12357 1887 --
NM_207044chr172305 2111 1597 861 804 527 326 12357 1887 --
NM_207047chr172305 2111 1597 861 804 527 326 12357 1887 --
NM_207111chr772757 2718 2584 2101 2061 524 32 ----12621
NM_207116chr772757 2718 2584 2101 2061 524 32 ----12621
NM_207292chr393398 3063 2955 2831 2814 2579 1323 1083 799 42935 1189 1131 131 33120 2568 597 --
NM_207293chr393398 3063 2955 2831 2814 2579 1323 1083 799 42935 1189 1131 131 33120 2568 597 --
NM_207294chr393398 3063 2955 2831 2814 2579 1323 1083 799 42935 1189 1131 131 33120 2568 597 --
NM_207295chr393398 3063 2955 2831 2814 2579 1323 1083 799 42935 1189 1131 131 33120 2568 597 --
NM_207296chr393398 3063 2955 2831 2814 2579 1323 1083 799 42935 1189 1131 131 33120 2568 597 --
NM_207297chr393423 3088 2980 2856 2839 2604 1348 1108 824 42960 1214 1156 156 33145 2593 622 --
NM_207303chr10134118 4031 3930 3665 3600 3558 3359 1357 1192 1175 964 484 332 11207 --13498
NM_207304chr1342257 2116 421 235 22377 1802 1440 --
NM_207325chr1971740 1599 1579 1449 773 721 177 12007 --11977
NM_207366chr772221 1635 850 595 560 245 230 21823 1790 1420 --
NM_207396chr151888 1640 1410 655 48 --21434 731 --
NM_207406chr4166328 5666 5395 5349 5135 4766 4759 4722 4618 4455 4414 1731 1292 706 477 87 ----14428
NM_207577chr1192613 2514 2408 2373 1834 1124 668 477 91 --1308 --
NM_207647chr962598 1854 822 541 490 207 32502 2320 595 ----
NM_207660chr1491595 1458 1299 1183 1073 1060 663 74 22 ------
NM_207661chr1491595 1458 1299 1183 1073 1060 663 74 22 ------
NM_207662chr1491595 1458 1299 1183 1073 1060 663 74 22 ------
NM_212460chr751928 1695 1505 369 308 3731 667 269 ----
NM_212554chr1041627 1266 634 145 11649 --1498
NM_212558chr9113913 3874 3787 3650 3135 2962 1255 634 324 309 284 1839 14030 --
NM_213589chr2114883 4526 4446 4318 4288 4153 3670 1704 1621 1127 1062 34244 2244 1500 25356 4736 --
NM_213651chr151581 484 300 185 93 ------
NM_213662chr1782410 2208 1853 1618 914 762 639 119 ----11723