TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-200a-3p
miRNA Sequence: UAACACUGUCUGGUAACGAUGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000084chrX76501 5813 4899 1835 1180 1123 115 26751 4988 26724 4657 12383
NM_000210chr252127 1966 1925 1605 515 --42224 1876 1788 61 --
NM_000264chr953235 3215 3040 2842 2648 1970 11353 12798
NM_000332chr696916 6548 6249 5597 2812 1067 767 493 332 --35184 4905 1492 1876
NM_001001664chr253781 3685 3580 1651 1480 --21441 1372 13393
NM_001002919chr23578 549 190 ----1204
NM_001003712chr1253879 3546 2849 2696 924 --23159 60 --
NM_001005473chr574354 4163 2607 2251 1578 623 299 24948 228 ----
NM_001008408chr745897 4377 3986 2486 34438 2195 204 --25980 2121
NM_001008539chr844509 1607 340 309 1293 15297 11392
NM_001009993chr243763 2930 1282 733 1451 13349 24369 3498
NM_001039840chrX75648 5604 4675 4457 1990 1211 285 --1279 --
NM_001040284chr1645457 4587 2208 1690 14012 1345 15614
NM_001040665chr714404 13305 --23812 1395
NM_001042555chr1273667 3249 3023 1803 1778 1274 864 --1421 1567
NM_001100108chr147343 6695 2084 1757 --48173 3178 1819 871 18275
NM_001106chr3168622 8092 8053 7382 6358 6111 5975 3905 3552 3392 2851 2211 2172 2158 2121 583 --11900 --
NM_001256chr1771859 1074 982 685 612 454 98 --12929 --
NM_001271chr1542385 2140 872 434 13275 1364 12362
NM_002025chrX68251 6981 6721 3047 2599 185 --38624 7218 731 17280
NM_002092chr464950 3869 3819 767 591 124 13860 24987 348 --
NM_002310chr595474 5348 4507 4105 4028 1803 564 147 55 15593 ----
NM_002430chr2222005 578 12516 1818 1251
NM_002581chr934754 1843 243 ----21143 1115
NM_002655chr854868 4294 3840 3335 783 --13804 15267
NM_002731chr13713 384 332 --22746 38 1349
NM_002737chr1785741 5204 4658 4098 983 778 641 222 --1861 --
NM_003010chr1772411 2193 2171 2083 800 353 123 --181 1199
NM_003046chr844509 1607 340 309 1293 15297 11392
NM_003108chr287072 7059 6980 4537 2254 1797 1735 110 --12198 17230
NM_003112chr753090 2664 2233 613 158 ----12839
NM_003199chr1844681 1297 1191 486 11166 14911 15248
NM_003298chr354196 4092 4083 2375 2281 15887 25741 1885 11862
NM_003799chr1873927 3219 2938 1171 1159 470 399 21279 1197 1322 --
NM_004171chr1199640 9393 8254 7034 6222 2496 2328 414 353 --18189 --
NM_004337chr8168 --22198 178 11666
NM_004612chr964089 3803 1880 1300 718 125 --23400 1351 --
NM_004745chr874554 2147 1999 1953 1661 1231 721 ----15589
NM_005188chr1198224 7348 7290 6997 1912 1630 1608 647 523 ----18022
NM_005339chr473545 1061 593 386 296 286 233 23626 1438 ----
NM_005436chr1061576 1089 834 494 431 290 --2213 170 --
NM_005497chr1724655 2453 35889 3807 1883 21562 185 15045
NM_005596chr995400 4648 4559 2099 1995 1766 1381 807 683 ------
NM_005748chr1232568 2279 2251 ----1256
NM_005941chr823831 1499 24111 4060 22779 748 13469
NM_006094chr84514 365 334 39 --11554 11474
NM_006095chr41550 --22892 2799 24437 1064
NM_006544chr1466034 2277 1736 1260 1239 27 11986 34052 884 332 11482
NM_006599chr1696740 6516 5485 5367 2566 2350 1647 1466 1364 12309 ----
NM_006654chr1273667 3249 3023 1803 1778 1274 864 --1421 1567
NM_006948chr2121806 147 --12012 12246
NM_007249chr1399072 9049 9006 8002 7655 7479 7366 1994 763 29226 1505 23549 824 186
NM_007331chr472484 1977 1886 529 359 212 61 12125 ----
NM_012164chr936723 5452 4778 16246 14718 2482 256
NM_012214chr275986 5261 5184 4725 4421 3878 994 14760 15868 --
NM_012262chr144589 4567 4435 452 1591 44561 4169 1540 176 --
NM_012416chr9157 ----2773 151
NM_012479chr742520 2244 1070 473 12295 22552 1960 12497
NM_014991chr453171 2696 2192 895 714 1126 1793 12116
NM_015026chr1294039 3833 3653 3497 3212 1837 1437 383 201 12959 14151 13424
NM_015040chr223123 343 13041 --12438
NM_015310chr888067 6472 5627 5392 3116 2896 2237 1644 16909 ----
NM_015375chr154953 3826 1532 589 267 1366 --14758
NM_015576chr342704 998 572 538 --22616 547 --
NM_016217chr673580 3391 3379 2741 2298 630 478 1177 ----
NM_016260chr287403 6754 6019 4875 4857 2665 1798 153 16032 11087 1969
NM_017637chr999169 7315 6733 6080 2713 2476 2386 328 71 26477 979 11562 --
NM_017737chr152192 1674 1399 412 247 ----11570
NM_018440chr8118105 7272 6751 6089 5958 3181 2568 1240 992 523 39 --1776 --
NM_018490chr1141640 1567 1284 705 11833 21878 46 --
NM_018566chr184046 3657 3624 3319 1790 1071 499 169 --14955 --
NM_018638chr1265715 5301 4798 4002 1811 433 ----11666
NM_018947chr7125018 4969 4940 4680 4047 3179 3128 1904 1595 1380 1155 565 ----1985
NM_020673chr2034873 2914 212 --12599 16974
NM_020718chr16106045 5905 5059 4805 4760 4549 2407 2026 956 21 11102 ----
NM_020774chr1831383 1373 170 --25324 813 11025
NM_020841chr1253879 3546 2849 2696 924 --23159 60 --
NM_021038chr333154 938 45 ----1710
NM_021813chr695516 5381 4805 4542 4324 4265 3866 1587 1337 15812 1672 --
NM_022459chr1356313 4382 1895 1823 1322 2979 194 1394 15285
NM_024947chr3119193 8910 8518 8108 7603 7238 6265 6160 5852 3052 480 27707 5975 36836 2847 1424 16110
NM_025054chr874179 3714 3250 2592 1109 1032 417 ------
NM_030627chr583816 3514 3436 3134 2789 2707 1212 157 --11334 --
NM_030647chr766258 4780 4017 1872 470 289 ----12043
NM_030674chr1245655 5564 1277 670 --34394 4257 2290 14092
NM_030806chr1148144 7394 6860 6461 6293 6106 3044 2888 2246 2224 2085 2073 1202 1103 16801 42290 804 492 151 --
NM_032012chr955300 4455 1725 1257 1208 ----11244
NM_032047chr342192 1877 1669 965 1592 --12283
NM_032873chr1123412 1423 --33539 3030 559 12843
NM_033389chr1793910 3476 1308 1301 1209 890 833 152 143 --1568 --
NM_033505chr265808 5545 2223 1411 1146 374 --36574 5980 4183 --
NM_053043chr745897 4377 3986 2486 34438 2195 204 --25980 2121
NM_133646chr255511 3754 3659 3649 1255 14948 33404 3382 834 --
NM_138713chr1696740 6516 5485 5367 2566 2350 1647 1466 1364 12309 ----
NM_138714chr1696740 6516 5485 5367 2566 2350 1647 1466 1364 12309 ----
NM_152624chr577004 2837 2005 1572 1266 1215 89 --35535 2322 214 17106
NM_152999chr714404 13305 --23812 1395
NM_153029chr16103771 3661 2733 1165 1150 1081 711 542 379 109 13218 12824 --
NM_172071chr147356 6884 852 402 15293 34826 4754 783 --
NM_173214chr1696740 6516 5485 5367 2566 2350 1647 1466 1364 12309 ----
NM_173602chr1243428 3075 2679 2314 --23761 548 1951
NM_178585chr453171 2696 2192 895 714 1126 1793 12116
NM_181358chr173383 3071 2769 1584 1368 1239 694 --1174 11389
NM_182643chr84514 365 334 39 --11554 11474
NM_182762chr745834 4841 4558 849 15953 31275 1131 450 1358
NM_182948chr13713 384 332 --22746 38 1349
NM_194356chr1231644 360 21 ----1430
NM_198268chr173383 3071 2769 1584 1368 1239 694 --1174 11389
NM_198269chr173383 3071 2769 1584 1368 1239 694 --1174 11389
NM_199462chr154953 3826 1532 589 267 1366 --14758
NM_206909chr888067 6472 5627 5392 3116 2896 2237 1644 16909 ----
NM_207292chr333154 938 45 ----1710
NM_207293chr333154 938 45 ----1710
NM_207294chr333154 938 45 ----1710
NM_207295chr333154 938 45 ----1710
NM_207296chr333154 938 45 ----1710
NM_207297chr333179 963 70 ----1735