TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-200a-5p
miRNA Sequence: CAUCUUACCGGACAGUGCUGGA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000084chrX96845 5699 4847 4754 4490 2387 1717 371 246 --24512 1699 --
NM_000809chr499170 8866 7707 7389 6821 5641 3546 3446 1296 49218 8285 7919 7507 28289 1377 --
NM_000813chr5104016 1996 1226 867 727 477 396 379 188 68 25499 4697 ----
NM_000814chr1594042 2968 2935 2741 2644 1467 1253 1136 946 34019 3112 932 ----
NM_000875chr15126924 6785 6643 5671 4709 4699 4687 4435 2567 2442 2277 1078 ------
NM_001003652chr18128199 7799 7755 6750 6504 5789 2994 2912 2424 1934 1411 846 27826 7185 28236 1198 --
NM_001004317chr6114063 4019 3942 3896 3818 3633 3453 1772 1530 883 236 1206 ----
NM_001005473chr576592 6506 5614 2387 2255 1373 31 11672 26155 4931 1799
NM_001009554chr473636 3590 3377 1558 1543 812 116 ----23513 321
NM_001009554chr473636 3590 3377 1558 1543 812 116 ----23513 321
NM_001010853chr653088 2128 2096 973 200 33049 2500 527 --13097
NM_001011666chr765743 5529 1132 528 413 389 35704 5257 4063 14117 15262
NM_001013620chr12118313 7709 7287 6861 6139 6019 5927 5666 5641 2957 158 47463 5167 3343 1224 36839 2139 1639 16624
NM_001014797chr10117337 6260 6051 5697 5311 5238 2648 2086 1729 1129 1123 22473 234 26103 5465 --
NM_001018065chr966003 5262 4125 1871 1564 1336 --15095 25806 5176
NM_001018066chr966003 5262 4125 1871 1564 1336 --15095 25806 5176
NM_001025077chr1084688 4582 2942 2771 2664 2495 1308 1261 25083 1948 1580 --
NM_001025580chrX54069 3989 1305 190 151 --13289 34251 1716 473
NM_001032394chr662797 2510 1921 1895 1886 48 22128 1750 --11908
NM_001032395chr662664 2377 1788 1762 1753 1019 11995 --11775
NM_001039547chr3127643 7606 7079 5739 5439 5319 5117 3227 2879 2582 196 58 1574 --16538
NM_001040665chr794543 3816 3193 1410 895 524 483 399 121 --14416 1994
NM_001042355chr1684250 4097 4025 3949 3496 3407 3322 2089 1628 11493 11393
NM_001042412chr1684250 4097 4025 3949 3496 3407 3322 2089 1628 11493 11393
NM_001042599chr2137000 6962 6854 6454 5588 4913 2861 1833 1653 1361 1345 565 278 37455 2775 1205 36598 5230 2438 26617 2155
NM_001100108chr1148120 7541 6662 6451 6314 6277 5677 5314 5304 3273 3245 2280 1892 1456 27610 1733 ----
NM_001106chr3138963 8900 8217 6622 6486 6417 6353 6280 6197 2704 1818 881 810 --29199 1484 --
NM_001167chrX126476 6279 5153 4487 1871 1695 1409 1400 1348 1188 499 115 ------
NM_001204chr2116997 6709 6113 5489 5255 5093 4901 2922 2477 2170 358 22148 1663 ----
NM_001527chr6104707 4387 4037 3900 1901 1100 1014 907 626 620 13551 ----
NM_001918chr1148700 8163 7820 7376 7034 6915 6144 3593 2786 2060 1160 1131 1015 526 33197 1119 778 28623 1584 --
NM_003034chr12148077 7404 7232 6713 6181 5701 5245 5174 3135 3083 2763 1603 1544 1505 ------
NM_004171chr11159237 7847 7837 6794 5933 3267 2641 2311 1748 1650 1575 1481 869 775 670 16458 27429 3065 --
NM_004748chr1583582 3312 2959 2727 2691 1655 1112 1068 1802 151 11474
NM_004866chr594632 4089 4068 3985 3609 3259 1399 1358 895 11201 1661 --
NM_004904chr765743 5529 1132 528 413 389 35704 5257 4063 14117 15262
NM_005188chr11108187 7573 7377 6328 5825 5116 2507 1118 860 413 25885 900 18054 16064
NM_005235chr2137000 6962 6854 6454 5588 4913 2861 1833 1653 1361 1345 565 278 37455 2775 1205 36598 5230 2438 26617 2155
NM_005497chr17105735 5698 5652 5394 5316 4406 2049 617 600 534 35948 4184 2197 1705 --
NM_005901chr18128199 7799 7755 6750 6504 5789 2994 2912 2424 1934 1411 846 27826 7185 28236 1198 --
NM_005909chr5103484 3019 2661 1484 1385 1027 997 486 355 345 23648 1378 --1450
NM_006060chr7123896 3848 3424 3395 3146 1537 1421 1297 767 616 582 268 ----21760 1321
NM_006203chr595283 5167 4797 4462 4089 2207 1645 1257 456 55595 5585 4668 3990 2029 --15337
NM_006252chr156740 1741 1264 658 325 27137 1732 26765 2580 1473
NM_006306chrX175728 5501 5467 5449 5351 4732 4677 4619 4546 4240 4219 4140 3636 1685 951 649 448 24256 1921 24260 779 14654
NM_006750chr16107500 5966 5804 5532 2471 2385 2367 1933 1272 793 11950 1380 16524
NM_007249chr13129169 7784 7238 6580 6131 6113 3342 2628 2570 1876 920 30 18422 11672 28235 7854
NM_014048chr16134766 4748 4708 4553 4532 4357 4060 3614 1202 1021 831 435 334 23535 3326 ----
NM_014155chr1197533 5765 5275 5151 4903 2630 2177 1380 857 --25949 1691 --
NM_014423chr5115592 5336 4147 4086 3477 2062 1922 1314 478 259 235 24414 1366 ----
NM_014864chr1104166 3409 3349 3001 2874 1537 1073 717 709 77 1541 --14329
NM_014953chr1364265 4142 1351 1247 1041 354 11705 13559 24297 590
NM_014982chr1435175 4914 591 34602 4062 4044 --24466 3412
NM_015247chr1684250 4097 4025 3949 3496 3407 3322 2089 1628 11493 11393
NM_015365chrX54069 3989 1305 190 151 --13289 34251 1716 473
NM_015569chr1114321 4253 4235 3602 3571 1913 1683 1303 1206 957 417 1364 11884 --
NM_016206chr397137 7001 6318 5662 3605 3431 1449 1293 550 36208 5780 1908 38091 8004 5955 --
NM_017637chr9108435 8394 8099 7849 7755 7186 3342 2997 1632 483 59292 9018 7740 5817 167 26556 2126 17168
NM_017644chr385014 4548 3605 3550 3185 644 435 263 41985 1264 1175 1161 12061 13998
NM_017658chr1493899 3658 3516 3054 2898 1284 890 384 274 23384 988 1939 --
NM_017813chr884647 4548 4514 3789 1108 873 812 54 35224 4578 2291 1800 --
NM_018085chr1187601 7366 6605 5891 5874 5853 5788 5429 5408 5029 2886 2577 2004 1346 1235 1217 929 75 ------
NM_018440chr8117362 6660 6371 5846 5379 3015 1603 1477 1076 1034 530 26688 1025 13046 --
NM_020455chr662797 2510 1921 1895 1886 48 22128 1750 --11908
NM_020673chr2057759 6096 6017 4812 1807 37305 7097 575 47613 4806 2976 281 25013 452
NM_020739chr1583582 3312 2959 2727 2691 1655 1112 1068 1802 151 11474
NM_021163chr753717 2471 1524 606 105 13512 --2781 646
NM_021647chr473636 3590 3377 1558 1543 812 116 ----23513 321
NM_021911chr5104016 1996 1226 867 727 477 396 379 188 68 25499 4697 ----
NM_021912chr1594042 2968 2935 2741 2644 1467 1253 1136 946 34019 3112 932 ----
NM_024345chr975520 5110 2295 2005 1407 644 409 35079 3836 581 --15262
NM_024947chr3129252 9088 7900 7755 7320 6369 3004 2749 2130 1609 1510 571 46540 3045 2295 1558 11891 25996 61
NM_030647chr7135261 4619 4438 4099 4021 3956 2089 1160 791 747 587 437 108 31361 1262 1124 ----
NM_031427chr1453994 1589 1190 1047 931 35147 4053 113 --12265
NM_032012chr9115076 4691 4230 4146 3302 1899 1697 1689 1500 1115 243 14516 11157 --
NM_032373chr1074505 3611 2011 1245 1185 955 27 34489 1555 217 25598 768 --
NM_032859chr1353318 2732 1280 1170 638 13240 11258 23184 2662
NM_033224chr7147998 7603 7540 7058 6492 6375 6184 6097 5730 5074 3232 2897 600 159 16524 25384 2844 --
NM_033505chr274830 2588 1981 1860 1808 772 744 --15712 1842
NM_033656chr21125296 5242 4743 4490 4438 4110 3988 3909 2356 1441 1332 814 46009 5165 4404 1699 ----
NM_133334chr456347 6044 5934 1761 782 14834 26215 955 2460 172
NM_133646chr2115451 4926 4753 4054 4017 3468 2144 2016 731 497 86 24622 4411 ----
NM_138444chr13114755 4721 4697 4285 1842 1369 1026 984 965 874 135 --34624 3730 3463 --
NM_144571chr4136728 6482 5792 5341 4764 2798 2276 1966 1033 806 557 135 72 35863 4280 1715 ----
NM_145756chr1821327 1065 --41399 1057 457 210 11185
NM_152263chr1126032 5389 4549 4323 4239 3771 2268 1893 1834 1828 639 119 35378 1886 789 15066 --
NM_152756chr5104226 4191 4004 3608 3540 3245 1476 1350 1305 702 13030 23314 3270 --
NM_152999chr794543 3816 3193 1410 895 524 483 399 121 --14416 1994
NM_153207chr1294117 3528 3382 3350 3318 2867 2628 883 422 23968 140 --12879
NM_172071chr1137154 7038 6977 6634 6324 5673 5306 5217 5202 1576 1107 927 62 16278 11189 --
NM_173468chr495519 5180 4714 2290 2195 2095 1197 786 454 14176 12363 14127
NM_173642chr1179207 8991 8857 8536 7989 7950 7933 7669 6491 6162 5691 3673 3565 2615 1934 1183 1038 12014 21644 588 --
NM_175861chr12104997 4817 4784 4596 3685 2395 2109 909 755 100 35517 4772 30 ----
NM_182515chr1966487 6285 2242 1732 1024 493 24538 659 12084 1561
NM_182898chr765743 5529 1132 528 413 389 35704 5257 4063 14117 15262
NM_182899chr765743 5529 1132 528 413 389 35704 5257 4063 14117 15262
NM_194314chr1115603 4815 4809 4575 4459 4354 3455 3412 2201 636 451 34796 4732 1294 1618 --
NM_198465chrX62650 2318 2066 1953 497 379 22669 812 --12626
NM_198569chr662664 2377 1788 1762 1753 1019 11995 --11775
NM_203282chr19150 11689 --21466 208
NM_203463chr284973 4866 4590 4364 3816 1871 1392 115 11936 --13221
NM_207406chr475886 5863 5710 5502 5036 4582 1861 1487 15568 12524