TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-202-3p
miRNA Sequence: AGAGGUAUAGGGCAUGGGAA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000016chr11147 1587 ----
NM_000037chr842411 2356 808 237 --1566 --
NM_000038chr542071 1956 1637 160 ------
NM_000052chrX103200 3078 2941 2876 2346 2145 2120 749 156 66 11117 12279 --
NM_000053chr1341597 1548 205 38 22037 465 ----
NM_000059chr135880 801 272 204 185 2782 132 ----
NM_000061chrX130 ------
NM_000081chr151869 1854 1440 557 531 ----11799
NM_000084chrX136350 6162 6078 5588 5376 5361 5219 4812 2803 2442 2197 1686 1091 76769 6719 5791 4586 4217 2396 1841 11666 12501
NM_000089chr73761 507 334 ------
NM_000091chr242872 2229 2094 1039 ----1906
NM_000109chrX42631 1806 800 680 22669 1941 ----
NM_000110chr121043 448 ------
NM_000111chr71286 ------
NM_000112chr585475 5177 4903 4266 3468 1404 682 598 25015 4836 23957 1516 --
NM_000115chr1342469 2060 943 724 12567 11986 --
NM_000125chr683747 3373 3359 3204 2702 1595 688 373 --1726 --
NM_000134chr431754 1495 697 2577 428 --11785
NM_000138chr1562441 2357 1956 1889 412 223 1551 --1510
NM_000142chr451382 1283 568 547 196 ------
NM_000161chr1451849 1535 1477 750 614 21839 333 ----
NM_000163chr51132 11618 31883 1833 719 12252
NM_000167chrX91508 1461 1415 1270 1170 734 673 395 248 11284 11321 --
NM_000168chr753297 2607 1224 779 764 ----11101
NM_000202chrX62964 2690 1212 722 463 360 11323 1304 --
NM_000214chr2021413 1252 ------
NM_000217chr1265369 4583 3345 1693 1139 102 --15039 --
NM_000222chr431739 1460 1365 11823 ----
NM_000232chr472921 2415 2373 2170 2070 1135 34 22400 1147 ----
NM_000245chr732201 2178 2162 ------
NM_000255chr62348 95 ----1136
NM_000259chr15125457 5436 5199 5031 4957 4939 4028 3985 1512 753 153 111 ----16179
NM_000264chr963373 3353 3022 2987 990 742 ------
NM_000267chr1753473 2475 2351 1330 689 --12293 --
NM_000276chrX31851 1810 180 --11708 --
NM_000282chr132212 192 ------
NM_000284chrX61942 1842 1449 1348 275 226 --127 --
NM_000288chr61307 ------
NM_000297chr422058 1834 1650 ----
NM_000314chr1063254 2913 2904 2711 1016 965 --1224 13203
NM_000321chr131108 ----1692
NM_000328chrX3445 321 49 ------
NM_000332chr696458 5468 5365 5224 4839 2785 2599 2098 439 35005 1186 450 26708 5041 15732
NM_000337chr5126553 5811 5762 5273 4961 4838 2492 1408 1298 1249 603 406 14798 14917 25606 1951
NM_000346chr1731961 1359 1291 --11826 --
NM_000353chr1621114 246 2835 452 --1468
NM_000368chr943788 726 589 229 11057 1185 --
NM_000390chrX63404 3049 2982 2903 2163 853 12601 ----
NM_000393chr291988 1965 1762 1640 1517 1406 1357 735 668 --11677 --
NM_000408chr253356 2137 1330 577 543 12599 ----
NM_000441chr721653 493 11570 21985 297 --
NM_000448chr1173234 2384 2135 1291 1235 532 479 12696 --13011
NM_000449chr161505 1468 1453 992 166 154 ------
NM_000452chr1332071 1756 553 31605 1401 701 ----
NM_000461chr331467 1310 1189 31422 1123 770 13418 13190
NM_000488chr1173 ------
NM_000492chr7197 41012 534 229 104 1402 --
NM_000495chrX2801 758 1171 --11086
NM_000531chrX--1275 ----
NM_000533chrX51784 1674 346 240 188 ------
NM_000555chrX167494 7034 6823 5920 5688 5510 5499 5300 5292 2762 2088 2049 858 841 775 64 15026 12697 --
NM_000560chr12661 244 1726 ----
NM_000572chr12136 112 ----1146
NM_000575chr21863 ------
NM_000601chr7----1409 --
NM_000602chr721502 1481 11311 ----
NM_000610chr1142172 1919 683 676 --12216 --
NM_000615chr1143018 2888 472 419 --12246 --
NM_000618chr1296593 5810 4977 2032 1880 1759 1062 294 281 56280 5405 5204 1318 1271 ----
NM_000618chr1296593 5810 4977 2032 1880 1759 1062 294 281 56280 5405 5204 1318 1271 ----
NM_000627chr22777 72 ------
NM_000633chr1885126 5067 5040 5033 3395 2070 1914 608 1782 34908 4140 558 --
NM_000676chr173409 354 112 ------
NM_000684chr1021245 1056 --11104 --
NM_000685chr33811 761 709 --1818 --
NM_000685chr33811 761 709 --1818 --
NM_000686chrX11127 --11201 1249
NM_000693chr1521247 187 21519 725 ----
NM_000701chr11294 176 ----
NM_000719chr1266413 6377 2031 1888 1747 1577 25940 73 12504 --
NM_000724chr1071878 1799 1768 1634 1432 456 175 ----11643
NM_000756chr81477 ------
NM_000788chr43552 448 361 1560 --144
NM_000800chr541621 1273 1231 264 ----11313
NM_000806chr5190 1708 11544 --
NM_000809chr4239319 9205 8791 8370 8120 7887 7076 6609 6288 6151 5960 5760 5606 3557 3462 3383 2736 2303 1769 1727 1517 575 535 11706 37529 3190 3170 17315
NM_000810chr15----137 --
NM_000813chr545364 3624 3415 909 ----21307 116
NM_000814chr1553839 1641 1193 360 77 23994 515 13936 11667
NM_000817chr23319 117 36 --1236 --
NM_000824chr41178 ----1693
NM_000826chr432012 1022 1014 12437 ----
NM_000827chr542458 2418 1696 435 --12164 --
NM_000838chr652562 1977 1965 1038 1013 ------
NM_000844chr331112 424 351 ------
NM_000859chr541717 1659 1530 677 ----1514
NM_000865chr62196 90 ------
NM_000875chr1566667 4828 1454 947 856 502 22626 105 46465 6261 4357 1420 --
NM_000880chr83854 830 812 --1301 --
NM_000891chr1773264 3150 3018 2981 2917 2828 2586 23291 685 ----
NM_000901chr472509 2365 1953 977 638 537 269 ------
NM_000902chr363259 2666 2068 974 696 630 --22511 2384 --
NM_000926chr11259255 9166 9014 8900 8793 8754 8595 8516 7834 7133 6416 5961 5851 3766 3742 2937 2676 2516 2477 2394 2070 1702 1520 1396 861 17683 49041 8357 2765 966 --
NM_000933chr2031736 326 111 1498 11686 --
NM_000944chr462077 1691 754 720 230 100 1644 ----
NM_000945chr251877 1604 656 632 390 1588 ----
NM_000950chrX53342 3292 3201 2519 1164 42878 2380 1011 516 23374 735 --
NM_000959chr1103386 3215 3179 2927 2792 2534 2501 890 309 79 ------
NM_000963chr161876 1860 1663 903 310 146 22445 1570 11703 --
NM_000983chr121166 79 ------
NM_001001132chr2121191 576 2180 170 ----
NM_001001323chr123902 755 240 1598 ----
NM_001001389chr1142172 1919 683 676 --12216 --
NM_001001390chr1142172 1919 683 676 --12216 --
NM_001001391chr1142172 1919 683 676 --12216 --
NM_001001392chr1142218 1965 729 722 --12262 --
NM_001001394chr22580 479 --1679 --
NM_001001396chr173796 3748 3314 2738 2709 1792 1069 13596 13198 --
NM_001001419chr595141 4136 3660 3610 3592 3480 3413 941 652 23740 1573 13351 --
NM_001001420chr595141 4136 3660 3610 3592 3480 3413 941 652 23740 1573 13351 --
NM_001001481chr863146 2677 2612 1024 616 122 --12228 --
NM_001001484chr105948 860 615 240 174 ------
NM_001001549chr732588 2374 612 22548 917 ----
NM_001001550chr732588 2374 612 22548 917 ----
NM_001001555chr732588 2374 612 22548 917 ----
NM_001001664chr293467 3446 3436 2970 2853 1552 1135 508 248 1415 1468 --
NM_001001668chr1963905 3410 3151 2804 976 580 13174 11190 --
NM_001001701chr431492 1483 756 ----1777
NM_001001890chr2173683 3559 3361 3216 1722 1378 1101 11389 12810 --
NM_001001924chr841480 1427 499 187 --11769 11695
NM_001001925chr841480 1427 499 187 --11769 11695
NM_001001928chr2297481 7144 6500 5653 3289 743 610 177 158 37033 6905 1410 38047 7756 1727 --
NM_001001931chr841480 1427 499 187 --11769 11695
NM_001001933chr11433 ------
NM_001001971chr1031317 879 508 --1967 --
NM_001001974chr1042325 458 115 29 12152 --22257 221
NM_001001994chrX1450 ------
NM_001001995chrX51857 1470 1460 253 146 --11389 --
NM_001001996chrX1450 ------
NM_001002033chr17--1808 ----
NM_001002814chr883941 3762 3742 3668 3438 1030 601 458 23178 1553 1669 13297
NM_001002838chrX51895 1673 742 521 248 1699 ----
NM_001002860chr1464547 4196 3974 3657 398 382 14317 ----
NM_001002906chrY1456 ------
NM_001003407chr1024028 1663 1260 ----
NM_001003408chr1024028 1663 1260 ----
NM_001003652chr18148636 7704 7641 7515 7301 6817 3345 3215 2708 2691 1639 1174 1000 433 --12220 13308
NM_001003674chr1896978 6923 6681 5466 5319 5117 2512 1958 1135 34930 4855 2525 12634 25696 1048
NM_001003675chr1896978 6923 6681 5466 5319 5117 2512 1958 1135 34930 4855 2525 12634 25696 1048
NM_001003712chr1223110 679 1974 ----
NM_001003792chr31348 ----1144
NM_001003793chr31348 ----1144
NM_001003810chr4----1582 --
NM_001003895chrY168 ------
NM_001004196chr32495 201 1349 ----
NM_001004317chr694465 4098 3513 3347 3226 1636 782 587 489 34283 647 51 1661 21715 513
NM_001004342chr1136051 5072 4617 4502 4427 4191 3890 1990 1868 1232 806 605 453 24575 1706 ----
NM_001004419chr1273696 3413 3043 1594 1496 998 463 ------
NM_001005266chr15------1105
NM_001005267chr15------1105
NM_001005268chr15------1105
NM_001005269chr15------1105
NM_001005366chr121900 ------
NM_001005375chrY21667 489 1552 11305 --
NM_001005377chr191287 ------
NM_001005386chr232418 1830 348 21656 504 12284 22479 1697
NM_001005404chr1743957 3593 3139 755 24070 3999 13358 32782 723 527
NM_001005463chr1072355 2028 1693 1647 444 420 190 --22186 395 11769
NM_001005473chr5146643 6522 6302 5605 5498 5460 5321 4514 4265 2596 1941 1472 1278 220 11558 ----
NM_001005474chr361576 1354 1233 1196 558 175 ------
NM_001005609chrX32444 1046 851 23541 1461 --12460
NM_001005739chr26771 733 691 655 333 71 ------
NM_001005753chr221628 218 ------
NM_001005781chr2----1520 --
NM_001005782chr21817 1362 1969 --
NM_001005845chr831678 1439 437 31794 762 111 ----
NM_001005849chr17----1406 --
NM_001006118chrY2238 201 1244 ----
NM_001006120chrY2238 201 1244 ----
NM_001006600chr532152 376 53 ------
NM_001006623chr241032 723 576 242 ------
NM_001006636chr22895 803 ------
NM_001006945chr1----3470 216 201 151
NM_001007094chr10104411 4123 3951 3099 2870 1615 1333 784 718 359 14273 --14427
NM_001007097chr964365 4356 3292 3169 1773 320 21762 944 ----
NM_001007098chr12342 241 187 171 1881
NM_001007102chr641656 1198 1192 387 ------
NM_001007156chr1551668 1492 1443 670 658 11828 11553 --
NM_001007226chr1751347 1215 1108 974 299 11310 ----
NM_001007227chr1751347 1215 1108 974 299 11310 ----
NM_001007228chr1751347 1215 1108 974 299 11310 ----
NM_001007229chr1751347 1215 1108 974 299 11310 ----
NM_001007230chr1751347 1215 1108 974 299 11310 ----
NM_001007246chr2141765 1438 1270 1190 21771 1742 ----
NM_001007277chr1121075 58 ------
NM_001007526chrY2238 201 1244 ----
NM_001007527chr51143 ----1609
NM_001007553chr13392 379 107 --175 --
NM_001008239chr1853385 1242 1190 1015 387 12394 ----
NM_001008391chr112639 151 1275 ----
NM_001008392chr393326 3222 2817 2445 2439 2433 2427 2421 136 --12637 --
NM_001008393chr452868 2759 2743 1889 211 1738 2219 47 --
NM_001008401chr1911502 --1538 --
NM_001008408chr766225 4554 4371 1730 1279 1271 24679 1722 14640 --
NM_001008491chr261948 1860 638 630 303 129 11847 ----
NM_001008492chr261948 1860 638 630 303 129 11847 ----
NM_001008495chr851909 1600 1579 617 219 ------
NM_001008539chr864620 3488 1267 821 453 131 13817 ----
NM_001008541chr1071863 1781 1763 1477 819 169 129 ------
NM_001008541chr1071863 1781 1763 1477 819 169 129 ------
NM_001008660chr1121545 64 --11080 --
NM_001008711chr831091 517 31 ------
NM_001008723chr10------1540
NM_001008925chr442891 1386 1325 1227 23556 1269 22763 1261 --
NM_001009554chr464069 3969 3208 3185 590 291 23928 550 33801 3146 2971 24487 278
NM_001009554chr464069 3969 3208 3185 590 291 23928 550 33801 3146 2971 24487 278
NM_001009555chr441647 1435 688 106 ------
NM_001009881chr12623 564 181 ----
NM_001009882chr12623 564 181 ----
NM_001009894chr1241546 1389 587 146 ----169
NM_001009899chr3106112 5248 4991 4947 4837 4783 4607 2377 2060 1574 11441 12342 --
NM_001009955chr11156 ------
NM_001009955chr11156 ------
NM_001009958chr73554 408 79 ------
NM_001009960chr752835 2581 2331 491 377 ----1294
NM_001009993chr263746 3340 3211 1795 485 281 ------
NM_001010000chr1852488 2404 1413 669 398 12806 ----
NM_001010844chr63251 178 52 ------
NM_001010853chr652981 2839 1034 755 594 2621 158 --13128
NM_001010861chr122465 409 1803 --12715
NM_001010862chrX63331 3047 2872 2022 600 256 --11098 --
NM_001010867chr195871 5655 5054 4878 4289 2601 2067 1933 1694 25251 2094 ----
NM_001010877chr63166 130 40 ------
NM_001010888chrX94262 4234 3677 3318 1251 1013 882 866 476 14573 23795 1863 --
NM_001010891chr5106502 6421 4558 2747 2584 1529 1189 464 444 410 25194 1511 ----
NM_001010895chr951813 1546 1474 164 120 1729 ----
NM_001010927chr6------1450
NM_001010932chr7----1409 --
NM_001010934chr71922 ----1293
NM_001010986chrX42243 446 210 51 --1560 --
NM_001011515chr42385 122 --2712 39 --
NM_001011516chr42385 122 --2712 39 --
NM_001011537chr331743 1595 198 190 ----
NM_001011551chrX1432 --1377 --
NM_001011666chr7126401 5653 5031 4816 4566 4443 1716 1570 1485 374 201 162 36030 1625 1325 35586 2406 498 --
NM_001011708chr242803 2790 2008 2002 ----1281
NM_001011713chr1431620 1501 1434 1495 ----
NM_001011885chr1511238 --11649 11720
NM_001012337chr3--151 ----
NM_001012393chr1164460 4160 1011 847 563 266 21953 858 13546 --
NM_001012398chr161187 ------
NM_001012420chr152502 210 189 --12325
NM_001012423chr153502 210 88 ----12325
NM_001012751chr1031575 627 487 --11866 --
NM_001012754chr1322027 1354 12044 41890 1797 1583 622 --
NM_001012755chrX63960 3954 3402 1339 481 70 23156 1296 21579 804 --
NM_001012756chr1952206 858 801 647 218 22449 2423 1575 1992
NM_001012761chr552695 1765 873 472 397 --22732 2128 --
NM_001013031chr1083199 2978 2580 2513 2401 2333 802 681 13328 ----
NM_001013406chr721656 1207 ------
NM_001013438chr33747 727 326 ----1106
NM_001013439chr33593 573 172 ------
NM_001013620chr12208256 7972 7871 7537 7413 7222 5431 3329 3072 2814 2578 1945 1599 1297 1254 1186 1039 999 954 907 46417 5981 5753 2937 47926 5690 2708 1958 48039 7628 7574 244
NM_001013690chr1232458 1804 566 42498 2423 2246 1970 ----
NM_001013699chr12148 ------
NM_001013717chr521179 462 11349 ----
NM_001013843chr152894 360 ------
NM_001014283chr1321858 550 21435 682 ----
NM_001014380chr13185821 5082 4891 4641 4619 4493 3840 3694 3683 2358 2332 2174 1538 1034 916 846 587 544 25150 579 ----
NM_001014434chr13763 710 292 ------
NM_001014449chr161240 ------
NM_001014451chr161240 ------
NM_001014797chr1077505 1687 1650 1630 657 444 433 ------
NM_001015508chr82301 188 1555 ----
NM_001015877chrX22612 2011 ----12855
NM_001017368chr1742200 2050 175 155 22737 1917 ----
NM_001017369chr41143 ------
NM_001017371chr231258 145 80 11346 ----
NM_001017395chr362950 2634 2452 1087 777 684 --12853 13059
NM_001017396chr221467 465 21632 816 ----
NM_001017405chr41686 ------
NM_001017423chr103777 686 123 162 ----
NM_001017424chr131516 1224 245 --1597 --
NM_001017425chr131516 1224 245 --1597 --
NM_001017923chr1481696 1663 1107 620 419 322 247 78 31615 444 282 --11317
NM_001017963chr141312 --1938 1171
NM_001017992chr541556 1421 1067 457 ------
NM_001017995chr5114796 4592 4464 3790 3209 3045 1728 1426 876 645 135 13176 --13914
NM_001018008chr154461 428 225 76 ------
NM_001018056chr91523 1196 1122 --
NM_001018065chr9135478 4933 4810 4793 4725 4602 4472 3816 3711 2000 1475 699 65 --23838 861 --
NM_001018066chr9135478 4933 4810 4793 4725 4602 4472 3816 3711 2000 1475 699 65 --23838 861 --
NM_001018067chr1105261 4930 4691 4321 3497 2061 1981 1243 438 273 14076 11538 --
NM_001018068chr1105261 4930 4691 4321 3497 2061 1981 1243 438 273 14076 11538 --
NM_001018069chr1105261 4930 4691 4321 3497 2061 1981 1243 438 273 14076 11538 --
NM_001018089chr152664 561 23594 895 2658 507 12484
NM_001018108chr1552180 2147 1927 1838 1505 12186 1580 --
NM_001024455chrX31749 704 74 ----1422
NM_001024596chr19103605 3054 2984 2877 2731 2534 2445 1193 694 567 33145 3011 542 --1931
NM_001024647chr12157496 7452 7416 5288 5154 4907 3060 2978 2879 2377 2107 1649 1489 1224 22 --22749 504 13004
NM_001024649chr562675 2667 2476 1880 1098 176 12433 11043 11915
NM_001024688chr842068 1951 1588 893 2801 54 ----
NM_001024847chr352519 816 331 284 189 --2788 368 --
NM_001024916chr91106 ------
NM_001024934chr61524 ------
NM_001024935chr61524 ------
NM_001024936chr61524 ------
NM_001024947chr51145 2897 847 ----
NM_001024948chr162973 2637 2588 753 727 222 1342 ----
NM_001024956chr11105263 5228 5153 4765 4755 4352 3676 2333 989 921 --24647 1824 --
NM_001025068chr361651 1461 1416 471 264 162 ------
NM_001025069chr361651 1461 1416 471 264 162 ------
NM_001025076chr10106002 4914 4841 4088 3950 2152 2092 1965 1105 460 --11841 --
NM_001025077chr10117360 6272 6199 5446 5308 5005 2463 1818 934 752 278 1886 ----
NM_001025079chr383970 3891 3674 1593 1332 1122 398 301 ------
NM_001025105chr521254 1130 1958 ----
NM_001025266chr3114767 4018 3799 3665 3191 1666 1484 1339 546 536 51 23826 1693 13870 --
NM_001025356chr1252560 2268 2050 2020 232 12117 1532 --
NM_001025366chr611876 --1399 --
NM_001025366chr611876 --1399 --
NM_001025367chr611876 --1399 --
NM_001025367chr611876 --1399 --
NM_001025368chr611876 --1399 --
NM_001025368chr611876 --1399 --
NM_001025369chr611892 --1415 --
NM_001025369chr611892 --1415 --
NM_001025370chr611876 --1399 --
NM_001025370chr611876 --1399 --
NM_001025580chrX84300 3666 2926 1272 799 490 389 82 1739 ----
NM_001025595chr451648 1540 1495 1467 150 --1558 --
NM_001025603chr161505 1468 1453 992 166 154 ------
NM_001025616chr471742 1670 1440 1242 717 504 151 ------
NM_001025777chr211248 2387 205 ----
NM_001029858chr663378 2364 2129 996 440 207 11305 22149 617 --
NM_001029863chr652578 785 602 457 102 22317 150 --12457
NM_001029875chr562815 2218 2143 2025 363 135 --1665 12044
NM_001029955chr492886 2620 1328 1224 1099 854 664 245 224 ----13459
NM_001030006chr1732332 2291 415 ----1765
NM_001030007chr1632860 2521 1004 12705 ----
NM_001030055chr1483782 3335 3207 1739 1508 1056 577 564 --22918 872 183
NM_001031623chr621738 444 --1471 --
NM_001031695chr2265019 3941 3931 1830 1732 149 25416 1059 --1161
NM_001031710chr731033 723 210 ------
NM_001031711chr541367 526 165 52 ------
NM_001031716chr211141 ------
NM_001031723chr4----123 --
NM_001031732chr443200 2838 946 503 11117 ----
NM_001031804chr1653164 3061 2935 2914 1081 23802 1097 ----
NM_001031812chr551941 1452 809 358 127 11532 --1137
NM_001032280chr621317 487 ----1466
NM_001032282chr841320 1179 917 338 ------
NM_001032283chr121371 ------
NM_001032284chr121371 ------
NM_001032394chr652857 2744 2716 2415 508 ------
NM_001032395chr652724 2611 2583 2282 375 ------
NM_001032730chr11703 ------
NM_001033045chr2124205 4149 3865 3691 3659 3401 3077 2950 1624 1369 737 728 1627 --14377
NM_001033047chr411680 12020 11931 11648
NM_001033059chr631418 456 187 1509 ----
NM_001033087chr2073170 3136 2230 1320 1246 1216 874 ------
NM_001033117chr343079 1476 1424 487 24810 520 --14105
NM_001033506chr111329 ------
NM_001033521chr203646 637 158 ------
NM_001033522chr203646 637 158 ------
NM_001033566chr17139 ------
NM_001033568chr17139 ------
NM_001033576chr1742538 2483 2231 787 22032 648 22693 2289 --
NM_001033578chr852191 1928 1766 1661 749 1101 1382 --
NM_001033756chr611810 --1333 --
NM_001033756chr611810 --1333 --
NM_001034025chr124859 307 164 59 --1961 --
NM_001034841chr1695030 4646 4129 3632 3600 1606 1565 1114 839 ------
NM_001034954chr1042756 2593 2528 807 12246 22375 333 12396
NM_001034955chr1042756 2593 2528 807 12246 22375 333 12396
NM_001034956chr1042756 2593 2528 807 12246 22375 333 12396
NM_001034957chr1042756 2593 2528 807 12246 22375 333 12396
NM_001035521chr24819 808 523 129 --1693 --
NM_001037132chr771878 1678 1405 1388 553 370 198 ------
NM_001037133chr771878 1678 1405 1388 553 370 198 ------
NM_001037164chr731318 606 21 ------
NM_001037165chr788762 8137 7382 5437 2768 1917 1127 452 27093 5786 18147 --
NM_001037174chr252046 1615 1500 1436 598 ----1479
NM_001037317chr122465 409 1803 --12715
NM_001037332chr522535 2136 1474 --1461
NM_001037333chr522535 2136 1474 --1461
NM_001037339chr151223 690 626 449 438 ------
NM_001037340chr151223 690 626 449 438 ------
NM_001037341chr151223 690 626 449 438 ------
NM_001037341chr151223 690 626 449 438 ------
NM_001037535chrX51359 1012 166 112 53 --1439 --
NM_001037536chrX51359 1012 166 112 53 --1439 --
NM_001037540chrX51359 1012 166 112 53 --1439 --
NM_001037872chr21527 ------
NM_001037954chr1173157 3032 2680 2183 846 645 173 ------
NM_001038628chr32392 39 31694 548 503 ----
NM_001038707chr142239 2188 709 438 1139 1569 12077
NM_001038707chr142239 2188 709 438 1139 1569 12077
NM_001039199chr2094783 4126 4082 3956 3198 3105 1958 1278 265 24941 1535 14737 --
NM_001039348chr2185 157 ----
NM_001039349chr2185 157 ----
NM_001039395chr922012 1704 12354 11854 11790
NM_001039465chr143370 146 70 ------
NM_001039538chr252556 1442 1401 826 297 23470 1153 2840 815 12842
NM_001039547chr3126811 6582 6572 6471 6461 2981 2902 2356 2076 2050 1975 222 12726 26777 5810 26958 209
NM_001039570chr2284128 4111 4071 3948 3377 1372 779 112 ----1665
NM_001039571chr2284128 4111 4071 3948 3377 1372 779 112 ----1665
NM_001039585chr1103643 3472 3436 3184 3049 2791 2758 1147 566 336 ------
NM_001039590chrX43405 1581 1086 755 1378 ----
NM_001039591chrX43405 1581 1086 755 1378 ----
NM_001039618chr11145446 5309 5027 4876 4814 4500 3798 2307 2239 1966 1758 792 773 531 55262 5006 4245 4184 70 1478 --
NM_001039693chr284106 3738 3703 2695 1213 1050 804 746 24121 3651 34037 3847 2731 --
NM_001039711chr1--1244 1359 --
NM_001039712chr1--1244 1359 --
NM_001039762chr1032362 724 63 11980 ----
NM_001039840chrX165993 5768 5622 5564 5144 4878 3823 3783 3684 3670 2159 1741 1691 1569 1384 568 46060 4641 4597 806 --11958
NM_001039937chr1373860 3074 2906 1597 1584 943 793 1847 ----
NM_001039938chr1331403 1356 1179 --11527 --
NM_001040001chr641769 1645 1508 793 --1813 --
NM_001040020chr741430 1094 499 381 11172 11497 --
NM_001040033chr12661 244 1726 ----
NM_001040057chr73511 460 283 11285 ----
NM_001040101chr43429 391 88 ------
NM_001040135chr71629 --1781 --
NM_001040142chr242064 1816 619 125 ------
NM_001040143chr242064 1816 619 125 ------
NM_001040152chr774336 3927 1154 1028 923 632 215 23409 916 --156
NM_001040153chr134806 766 273 265 ------
NM_001040179chr63938 883 877 ------
NM_001040202chr421893 149 11596 ----
NM_001040214chr642409 2182 805 556 ------
NM_001040284chr1695200 5078 5058 4788 4688 4283 2090 1170 560 --11287 --
NM_001040402chr432552 546 387 12683 12898 --
NM_001040429chr1363056 2724 2201 1432 763 306 11234 ----
NM_001040432chr3--1136 ----
NM_001040441chr1114473 3801 3505 1785 1461 1413 1181 813 798 345 59 --1291 --
NM_001040446chr5102738 2717 2676 2567 2109 2042 1096 960 342 265 12725 12585 11058
NM_001040450chr1582665 2425 2238 891 875 677 556 332 --12186 --
NM_001040453chr1582665 2425 2238 891 875 677 556 332 --12186 --
NM_001040458chr551909 1753 1613 103 32 1264 1631 --
NM_001040709chr152485 2235 1593 895 879 22264 2223 ----
NM_001040712chr943526 3464 2460 678 12274 13015 1260
NM_001040875chr872624 2328 2256 1871 1012 453 293 ----11056
NM_001040876chr461861 1775 1519 1294 259 125 11829 ----
NM_001042355chr1653722 3467 1550 581 253 13974 1137 --
NM_001042399chr123486 133 86 1120 ----
NM_001042403chr124791 235 124 45 1220 ----
NM_001042404chr121249 665 ------
NM_001042406chr62807 337 --1435 --
NM_001042412chr1653722 3467 1550 581 253 13974 1137 --
NM_001042413chr962978 2531 1026 928 283 275 1414 ----
NM_001042424chr432912 1223 744 12846 12233 --
NM_001042425chr621317 487 ----1466
NM_001042453chrX41394 1158 1125 632 --2472 297 --
NM_001042459chr31310 ------
NM_001042473chr1051461 1371 797 469 204 ------
NM_001042481chr1472543 2501 2462 1866 1030 623 91 22187 1912 ----
NM_001042492chr1753473 2475 2351 1330 689 --12293 --
NM_001042493chr661910 1897 1503 1368 1275 229 21522 181 12041 --
NM_001042494chr1573445 3257 2592 2403 1512 580 152 33457 2619 1188 --1644
NM_001042495chr1573445 3257 2592 2403 1512 580 152 33457 2619 1188 --1644
NM_001042496chr1573445 3257 2592 2403 1512 580 152 33457 2619 1188 --1644
NM_001042497chr1573445 3257 2592 2403 1512 580 152 33457 2619 1188 --1644
NM_001042510chr821541 68 ----21874 1818
NM_001042511chr821541 68 ----21874 1818
NM_001042533chr332371 1322 23 --41259 1084 495 424 --
NM_001042537chrX42485 1971 1829 1712 --11873 --
NM_001042555chr1274624 3550 3372 3188 3030 2922 688 23155 3076 1310 --
NM_001042599chr2137736 7569 6709 6252 5639 5412 5116 4786 2845 1857 1645 1568 990 27774 5257 67103 6368 4992 2655 2159 1339 --
NM_001042601chr32893 137 22677 2447 --12066
NM_001042603chr1255022 3967 3937 1085 187 14822 ----
NM_001042604chr3114685 4553 4031 3172 3148 1927 1288 1239 541 64 47 21783 1629 --1226
NM_001042635chr14----147 --
NM_001042646chr351907 1752 1614 1236 627 1579 ----
NM_001042669chr471742 1670 1440 1242 717 504 151 ------
NM_001042681chr132528 2152 101 ------
NM_001042682chr132528 2152 101 ------
NM_001042682chr132528 2152 101 ------
NM_001042683chr641619 1517 441 261 1701 ----
NM_001042724chr192841 134 1212 2314 297 --
NM_001042749chrX51968 1737 1435 1408 632 ------
NM_001042750chrX51968 1737 1435 1408 632 ------
NM_001042751chrX51968 1737 1435 1408 632 ------
NM_001044305chr621245 618 --1347 21499 1338
NM_001044385chr243766 2787 2512 640 33009 940 295 13580 --
NM_001044722chr551941 1452 809 358 127 11532 --1137
NM_001044723chr551941 1452 809 358 127 11532 --1137
NM_001046chr542948 2406 2292 1889 140 2750 664 1199
NM_001048183chr153430 3021 940 544 488 23706 2704 13715 --
NM_001071775chr1321865 1532 --11706 --
NM_001076chr41123 ------
NM_001076chr41123 ------
NM_001079874chr132065 1986 314 11555 ----
NM_001083620chr432010 1021 1013 12435 ----
NM_001099678chr3166306 6230 5570 5535 5190 4889 4274 2473 2061 1856 1710 1484 1152 1000 286 29 15013 15552 --
NM_001100108chr1117613 7255 6834 6814 6772 6203 5354 2944 2932 1092 102 22993 127 56438 6349 6045 1560 590 --
NM_001106chr3158876 8855 7989 7291 7084 6059 3003 2897 2501 2141 1105 1004 727 505 124 28486 7362 1458 11462
NM_001109977chr43751 543 117 ------
NM_001113490chrX53211 3006 1284 1171 199 13239 11206 --
NM_001116chr1632980 1235 215 --22518 1886 22549 2370
NM_001117chr1852464 2319 1977 828 196 ------
NM_001121chr1031739 359 307 1288 11809 --
NM_001128chr1632860 2521 1004 12705 ----
NM_001144chr1641348 557 177 27 1331 ----
NM_001148chr432155 540 395 ------
NM_001151chr41236 ------
NM_001152chrX2253 58 ------
NM_001153chr22837 125 187 ----
NM_001160chr1232567 2305 659 41120 984 686 383 2255 183 1941
NM_001167chrX76381 6165 5851 5594 4985 4849 4172 11965 11484 --
NM_001172chr141261 1746 ----
NM_001173chr1483782 3335 3207 1739 1508 1056 577 564 --22918 872 183
NM_001177chr1252365 2348 1853 1761 368 174 ----
NM_001186chr2163242 3101 2519 2407 735 193 32668 2288 841 ----
NM_001196chr222193 179 ----1902
NM_001198chr662254 2142 1660 509 236 215 ------
NM_001200chr202951 175 1958 1908 --
NM_001201chr483787 3649 3067 2961 1374 952 945 859 33238 2918 364 --23899 1386
NM_001204chr2117115 6884 5821 5203 3119 2128 1949 1890 1730 1270 614 25950 5924 26264 1416 --
NM_001206chr932346 1975 492 --12779 --
NM_001217chr19----198 --
NM_001233chr752105 903 426 413 199 11949 144 --
NM_001237chr431193 464 166 ------
NM_001237chr431193 464 166 ------
NM_001241chr252369 1962 1712 497 280 ----1403
NM_001241chr252369 1962 1712 497 280 ----1403
NM_001256chr1742116 1017 741 545 22677 530 ----
NM_001259chr786245 5780 5746 5088 4840 4298 4236 1125 25343 860 14224 14567
NM_001260chr131240 ------
NM_001270chr51126 ------
NM_001282chr1732332 2291 415 ----1765
NM_001304chr1763508 1008 949 847 817 640 --21386 21 11016
NM_001310chr1272680 2252 1959 744 648 617 78 --11139 --
NM_001315chr63894 853 87 --1460 --
NM_001324chr203646 637 158 ------
NM_001331chr1172760 2209 1763 1129 1066 973 116 --12061 --
NM_001332chr511233 ------
NM_001343chr551679 1593 1391 284 146 ------
NM_001351chr331660 1640 390 --11279 --
NM_001356chrX41770 1570 887 525 --175 --
NM_001364chr11114797 4731 4298 4064 4003 3589 3433 3136 3008 1212 930 ------
NM_001385chr8----1434 --
NM_001387chr532708 2590 809 12762 --11941
NM_001389chr21162 ------
NM_001392chr18146 ------
NM_001399chrX32444 1046 851 23541 1461 --12460
NM_001412chrX43253 2842 2692 939 --13614 --
NM_001415chrX31709 1331 703 2401 117 11235 --
NM_001417chr1251866 1787 397 338 124 ------
NM_001418chr113760 732 485 ------
NM_001418chr113760 732 485 ------
NM_001419chr1964327 3965 3005 1626 1236 1022 23627 1321 ----
NM_001430chr22776 734 ------
NM_001431chr62978 955 ------
NM_001448chrX11395 1659 ----
NM_001451chr161425 ------
NM_001452chr62680 218 ------
NM_001482chr152799 309 1688 ----
NM_001494chr101722 1660 ----
NM_001518chr731150 354 84 11109 2347 102 --
NM_001521chr24819 808 523 129 --1693 --
NM_001527chr634475 3673 3201 34283 3942 3011 24587 1762 13263
NM_001554chr11213 ------
NM_001560chrX52492 2356 1705 322 23 --12166 --
NM_001584chr1121204 1018 ------
NM_001587chrX31851 1810 180 --11708 --
NM_001616chr273317 3147 3126 2801 2627 2359 881 13257 11163 1595
NM_001621chr752857 2750 934 627 370 2551 467 22333 946 --
NM_001621chr752857 2750 934 627 370 2551 467 22333 946 --
NM_001634chr631418 456 187 1509 ----
NM_001642chr1111348 ------
NM_001647chr32141 41 ------
NM_001650chr1853450 551 508 261 243 ------
NM_001655chr1151918 853 762 703 306 1466 1297 --
NM_001659chr1282203 2074 2025 1813 782 152 143 47 12216 ----
NM_001660chr33753 252 234 ------
NM_001661chr172607 268 --1198 --
NM_001663chr1442169 996 989 595 ------
NM_001682chr122616 469 1312 ----
NM_001684chr153513 3465 3031 1509 786 13313 12915 --
NM_001690chr332566 2541 1820 1733 --11787
NM_001695chr853455 3303 1559 1374 1078 33520 1413 151 ----
NM_001701chr921195 554 11288 ----
NM_001718chr611141 1116 ----
NM_001722chr81547 ----1522
NM_001742chr711213 --21203 345 --
NM_001746chr562675 2667 2476 1880 1098 176 12433 11043 11915
NM_001753chr751641 1506 582 233 28 ------
NM_001754chr2173683 3559 3361 3216 1722 1378 1101 11389 12810 --
NM_001755chr1652132 1895 451 294 226 ------
NM_001759chr12104506 4299 3870 3814 3502 3491 3475 3433 1741 318 34919 3786 1989 11259 12056
NM_001777chr383970 3891 3674 1593 1332 1122 398 301 ------
NM_001789chr33558 142 130 11476 ----
NM_001795chr1621586 1375 ------
NM_001797chr16----1183 --
NM_001806chr1972864 2794 2757 1806 864 263 186 --1723 --
NM_001827chr92106 76 ------
NM_001845chr132515 41 194 --11400
NM_001851chr63315 122 97 ------
NM_001855chr92830 701 ----1150
NM_001858chr684445 4294 4175 4104 1916 1795 1656 1238 25161 5019 13387 --
NM_001859chr9103885 3717 3392 2938 2562 2520 2428 1446 1167 529 --11092 --
NM_001860chr91913 --168 11139
NM_001873chr4191 ------
NM_001884chr5----1499 --
NM_001892chr521254 1130 1958 ----
NM_001895chr2061196 1098 994 768 414 25 ------
NM_001903chr51201 1797 ----
NM_001904chr32144 50 1392 ----
NM_001924chr11531 --156 --
NM_001935chr22150 130 2197 61 ----
NM_001938chr131763 1745 538 11601 11546 --
NM_001939chrX83511 3241 2509 1397 1384 704 604 260 22503 541 32915 1541 1450 --
NM_001946chr124981 938 814 808 ------
NM_001949chr652745 2125 779 647 90 12109 ----
NM_001951chr83610 137 33 1148 ----
NM_001966chr311098 1479 1183 21301 24
NM_001968chr42357 167 ------
NM_001969chr1453578 3504 2617 989 513 11193 22414 1143 --
NM_001977chr411248 1229 21179 280 --
NM_001981chr131853 1575 452 --1704 --
NM_001987chr1264268 3132 2666 680 480 411 ------
NM_002006chr4105235 4266 4238 3861 3577 3549 2079 1936 1573 720 ------
NM_002009chr151619 1736 12169 --
NM_002010chr13--1407 1435 --
NM_002013chr141198 1250 ----
NM_002015chr1323362 2320 22293 35 23132 2348 --
NM_002023chr131641 474 348 --3641 520 459 --
NM_002024chrX31584 1378 560 ----1199
NM_002025chrX159090 7046 6803 6575 6255 3486 3415 3400 3215 2737 2517 2330 913 824 45 27400 2285 25820 3534 --
NM_002031chr61270 1652 ----
NM_002035chr1833756 3057 1353 --23999 1603 13812
NM_002039chr4--1327 ----
NM_002040chr2152595 1042 955 347 67 22500 2301 --22972 808
NM_002061chr141720 249 164 154 11529 ----
NM_002062chr61186 ----21671 1095
NM_002069chr721590 518 --1384 --
NM_002071chr182654 144 ------
NM_002092chr464397 4048 3365 1793 1245 1001 24637 1416 --14263
NM_002094chr16--161 ----
NM_002106chr4184 127 ----
NM_002112chr15------138
NM_002126chr1773191 2796 2695 1119 1006 720 340 23573 1325 --11212
NM_002130chr541546 419 324 81 11134 1263 --
NM_002137chr752240 2223 1882 1590 244 2212 115 1686 --
NM_002138chr4----1582 --
NM_002140chr911031 ------
NM_002156chr2123 ------
NM_002158chr263739 3368 3227 3014 2393 179 23303 697 21082 431 13118
NM_002193chr231408 330 217 ------
NM_002203chr573946 3779 2855 2629 1598 440 219 --32986 679 546 --
NM_002205chr122138 83 ------
NM_002210chr263453 2861 1436 1170 1136 307 ------
NM_002211chr1041170 1161 1042 759 ------
NM_002214chr7105530 4832 4354 4315 2024 1790 1612 1248 1138 315 65263 4963 4904 1923 1275 953 ----
NM_002222chr331121 232 31 1998 ----
NM_002234chr122789 66 --1740 --
NM_002241chr162805 2546 925 716 400 346 22305 1935 22028 224 --
NM_002242chr251876 526 432 132 126 172 ----
NM_002245chr12276 251 ------
NM_002247chr1022237 1993 21621 948 ----
NM_002264chr3114794 4194 3988 3916 3736 3646 3332 1328 1047 833 25 24881 4753 --21712 462
NM_002267chr1322093 704 2644 609 1107 --
NM_002268chr321700 1371 ----11521
NM_002270chr575410 4683 1202 1184 1109 697 369 13783 24549 4540 24268 814
NM_002290chr661359 1313 1168 1032 967 412 ------
NM_002293chr1--1235 --12486
NM_002312chr131111 1939 11056 --
NM_002313chr1024028 1663 1260 ----
NM_002336chr12124629 4622 4242 3520 1893 1334 743 735 682 353 284 28 --45010 3402 1305 697 --
NM_002351chrX1269 ------
NM_002354chr21371 ------
NM_002356chr631975 1942 316 21757 683 12823 11910
NM_002371chr21515 ------
NM_002374chr252556 1442 1401 826 297 23470 1153 2840 815 12842
NM_002381chr22992 204 1807 ----
NM_002384chr181956 ------
NM_002397chr51580 1157 --161
NM_002398chr211344 ------
NM_002399chr1521388 1357 11237 ----
NM_002401chr1722458 642 11992 --11539
NM_002427chr1131102 1044 947 --2262 55 --
NM_002439chr51947 ------
NM_002444chrX41414 573 461 267 ------
NM_002445chr821149 139 21605 1556 21545 207 1474
NM_002449chr531254 1069 1030 --11198 1370
NM_002478chr112519 451 ------
NM_002480chr1221110 368 ----1329
NM_002481chr1107957 7206 6442 6393 3148 3003 2067 1939 1805 639 1975 37628 7375 2635 --
NM_002485chr842068 1951 1588 893 2801 54 ----
NM_002486chr9140 --22490 181 --
NM_002499chr1542090 2007 1804 408 12076 ----
NM_002500chr221091 420 ------
NM_002515chr1471994 1846 1474 1429 1269 438 217 ------
NM_002519chr1161184 1008 1002 515 431 132 ------
NM_002522chr1743639 3565 3058 526 23757 378 23044 2756 --
NM_002524chr13777 192 130 ------
NM_002526chr641481 1311 1176 569 --1577 --
NM_002536chrX2270 227 ----1336
NM_002545chr1164460 4160 1011 847 563 266 21953 858 13546 --
NM_002546chr8194 1751 ----
NM_002547chrX73679 3331 1576 1448 945 457 418 --53918 3773 3236 2646 191 --
NM_002577chr373962 3190 2463 890 631 472 355 12872 --12599
NM_002581chr995661 4989 4898 4324 4272 1654 1452 603 313 45327 4330 3499 2192 15087 12169
NM_002583chr124598 510 241 213 1197 1154 --
NM_002591chr203615 582 23 --2476 221 --
NM_002599chr1121121 138 ------
NM_002600chr151223 690 626 449 438 ------
NM_002607chr731267 845 325 ------
NM_002613chr1675342 4660 3715 3365 3322 3271 1495 ------
NM_002628chr3----1219 --
NM_002641chrX21362 122 1659 --11839
NM_002645chr1183039 2831 2248 2000 814 772 146 117 --13091 --
NM_002646chr192172 2146 1477 1358 701 678 426 349 264 11504 ----
NM_002648chr641305 493 482 169 ------
NM_002649chr741414 1386 1202 1091 --11236 --
NM_002655chr864817 3680 3206 2037 1580 358 --11668 --
NM_002670chr321046 635 11305 --2240 46
NM_002687chr14168 ------
NM_002709chr2103588 3532 3390 3340 3266 2729 2482 1256 826 529 --1430 22945 50
NM_002711chr73842 581 201 --1611 --
NM_002714chr6--1899 --1760
NM_002716chr1133568 3538 755 12258 2719 395 --
NM_002718chr372565 1944 1856 1848 1720 724 329 2947 193 ----
NM_002719chr1451754 1703 1510 748 629 --21680 69 --
NM_002721chr93470 114 80 ----1456
NM_002726chr63439 353 328 ------
NM_002731chr163177 3078 2736 985 979 235 12175 --11173
NM_002734chr1762252 1745 759 693 671 635 ------
NM_002740chr352800 2320 746 611 122 12005 12178 --
NM_002745chr2263218 1825 1459 1428 1309 982 34558 948 250 1532 --
NM_002786chr11179 ------
NM_002822chr1221805 1748 --1268 --
NM_002828chr181763 11001 ----
NM_002835chr7--1119 1270 --
NM_002836chr202488 91 ------
NM_002839chr943526 3464 2460 678 12274 13015 1260
NM_002840chr111539 ------
NM_002843chr1173370 2907 2686 2355 2132 446 97 23196 2167 ----
NM_002847chr741562 1502 1463 257 ------
NM_002850chr1921004 224 --146 --
NM_002851chr7----1715 --
NM_002858chr141351 1014 52 22 ------
NM_002860chr103777 686 123 162 ----
NM_002863chr141110 ------
NM_002868chr1232242 247 127 11623 ----
NM_002869chr1131884 1694 378 1306 11703 --
NM_002873chr52459 450 265 31 ----
NM_002874chr942176 1588 560 97 1760 ----
NM_002890chr521029 967 --1301 --
NM_002892chr1421175 120 11685 11222 --
NM_002901chr111736 ----1118
NM_002906chr1142424 1559 708 235 1637 11732 --
NM_002912chr64776 708 388 303 ------
NM_002923chr11647 ------
NM_002940chr461861 1775 1519 1294 259 125 11829 ----
NM_002941chr311136 --155 1244
NM_002942chr321087 1010 ------
NM_002945chr173720 574 565 ------
NM_002956chr1231256 555 498 1540 --1318
NM_002957chr933531 3410 3385 ----13311
NM_002968chr1621059 150 ----1393
NM_002971chr3----1346 --
NM_002973chr121171 ------
NM_002977chr273435 3249 3047 2767 2119 1024 688 22724 1306 --11239
NM_002999chr203526 129 113 --1706 1319
NM_003010chr1731784 956 180 11802 ----
NM_003011chr911164 --21049 176 --
NM_003013chr41766 --2589 539 --
NM_003016chr1751884 1755 1712 1470 779 ------
NM_003017chr62881 567 142 ----
NM_003022chrX51255 1200 946 940 429 21150 400 11015 --
NM_003030chr321743 642 21897 1550 11666 --
NM_003034chr12118107 7955 7029 6208 5927 5584 5362 2958 2448 1628 203 26844 6469 17054 --
NM_003042chr332053 391 99 11897 182 --
NM_003043chr343996 1695 1079 360 --21563 509 1605
NM_003046chr864620 3488 1267 821 453 131 13817 ----
NM_003051chr151958 1944 1817 659 49 ------
NM_003060chr521081 468 ----11245
NM_003069chrX1502 ------
NM_003071chr342102 343 268 39 ----11640
NM_003074chr352057 1869 1674 1528 135 --11909 --
NM_003079chr1741021 416 320 32 ------
NM_003081chr201160 ------
NM_003099chr15126520 5989 5931 5577 4599 4462 2614 2496 2144 1826 1628 949 36041 4922 565 ----
NM_003107chr6----12605 11830
NM_003108chr245422 2588 1870 309 24854 1316 36499 5701 862 --
NM_003111chr231258 145 80 11346 ----
NM_003118chr532042 642 362 ------
NM_003128chr271908 1841 1737 1048 413 181 36 --12871 --
NM_003131chr632203 1504 177 ------
NM_003133chr1147 --1815 --
NM_003144chr641900 1782 1689 1525 ------
NM_003150chr1751921 1722 1570 369 136 22306 1771 ----
NM_003155chr842645 2367 2340 222 1880 ----
NM_003161chr1773249 1390 1206 1140 1114 745 396 13387 ----
NM_003182chr72548 420 ------
NM_003182chr72548 420 ------
NM_003184chr841107 1082 1031 423 --1859 --
NM_003198chr11253 ------
NM_003199chr1875633 5131 5093 4397 1520 1379 437 ------
NM_003201chr1041012 260 160 64 ------
NM_003203chr272329 2008 1918 385 363 159 77 ----12341
NM_003220chr621317 487 ----1466
NM_003222chr202458 195 1117 1404 --
NM_003234chr352344 1779 1674 271 236 1181 ----
NM_003236chr233462 3451 86 13538 --22218 877
NM_003242chr352519 816 331 284 189 --2788 368 --
NM_003243chr121192 444 --11307 --
NM_003246chr1511608 21524 159 11970 11784
NM_003247chr6------11728
NM_003250chr17--1354 146 --
NM_003253chr2131608 1499 1360 --140 --
NM_003255chr17----12272 --
NM_003257chr1531069 1050 1010 --183 --
NM_003262chr3115275 4923 4892 4700 4656 4157 3812 3795 3789 2024 1670 24521 1607 35182 3532 3452 --
NM_003264chr42509 253 ------
NM_003281chr185319 4644 4488 3338 2018 1670 1059 841 24732 1824 ----
NM_003292chr132289 1980 1601 ------
NM_003298chr396086 4791 3958 3781 2163 1628 1043 972 204 ------
NM_003304chr311012 --1417 --
NM_003305chr43298 109 71 ------
NM_003320chr11114339 4306 4099 4078 3358 3267 2990 1734 1285 922 166 ------
NM_003334chrX1159 ------
NM_003338chr1031887 659 245 --11337 --
NM_003339chr551490 1038 206 189 160 ------
NM_003341chr3------1585
NM_003342chr1763105 2148 1237 990 623 573 22671 2105 12603 --
NM_003347chr2232104 1966 415 1249 ----
NM_003352chr21817 1362 1969 --
NM_003359chr431228 476 64 149 ----
NM_003372chrX1921 ------
NM_003373chr1041946 1661 1255 449 2753 655 1493 --
NM_003374chr5153 ------
NM_003376chr611876 --1399 --
NM_003376chr611876 --1399 --
NM_003379chr63754 378 282 ------
NM_003380chr102225 62 ------
NM_003383chr91523 1196 1122 --
NM_003385chr22654 347 11039 ----
NM_003392chr344342 3891 1700 877 21718 1334 11622 21474 1408
NM_003400chr21308 1250 ----
NM_003404chr2031839 1788 1630 ------
NM_003406chr841676 1480 489 117 2739 27 ----
NM_003407chr19--1657 ----
NM_003409chr18--1444 ----
NM_003410chrX92693 2282 2066 1113 887 315 306 274 130 --1618 --
NM_003412chr343050 2915 2513 1060 33025 2876 991 1418 --
NM_003421chr10104411 4123 3951 3099 2870 1615 1333 784 718 359 14273 --14427
NM_003423chr1962514 2375 927 783 760 233 42243 2088 1937 153 ----
NM_003439chr71593 --1300 --
NM_003453chr131195 ------
NM_003458chr363478 3364 3237 2662 972 367 33991 3702 2668 13777 1908
NM_003463chr6102994 2846 2699 2364 2337 1088 1056 925 371 195 23167 613 ----
NM_003468chr284191 4006 3159 1381 969 563 301 89 24211 1637 11028 12830
NM_003471chr341661 910 654 302 11591 --1489
NM_003472chr631333 1102 340 ------
NM_003474chr1022416 2164 --11458 --
NM_003478chr112903 882 1131 ----
NM_003483chr1252527 2373 2060 1817 793 31136 1113 28 12233 12547
NM_003489chr2153442 2541 2362 1300 903 --11163 --
NM_003506chr841272 1091 946 193 ------
NM_003559chr1741024 886 857 290 --23221 311 --
NM_003563chr1751347 1215 1108 974 299 11310 ----
NM_003565chr1231418 1297 1157 ------
NM_003566chr1243222 2615 2486 354 ------
NM_003569chr63568 269 118 ------
NM_003574chr18115143 5050 4851 4709 4509 2022 1614 1210 483 453 373 24284 1831 12209 --
NM_003583chr1233890 2933 203 43951 3144 533 296 ----
NM_003590chr253623 2806 2625 1606 927 23654 3408 ----
NM_003603chr462013 1936 1803 1737 223 93 11634 --12109
NM_003613chr152472 132 1270 ----
NM_003615chr382831 2597 2497 1338 969 753 628 341 --13788 --
NM_003617chr165032 4941 3928 236 170 80 --1668 --
NM_003621chr11--1491 ----
NM_003629chr123444 3291 11175 23468 724 --
NM_003630chr63480 100 72 --1515 --
NM_003645chr151261 ------
NM_003663chr353248 1303 993 487 233 --1579 --
NM_003664chr53539 438 178 ------
NM_003670chr331457 1140 46 ------
NM_003672chr131315 631 225 1117 1102 --
NM_003692chr9--1286 ----
NM_003702chr82843 188 ------
NM_003705chr23843 595 144 ------
NM_003713chr111747 ------
NM_003714chr553033 2357 753 745 256 11021 ----
NM_003718chr71451 ------
NM_003722chr352476 2269 1772 1733 145 ----1887
NM_003743chr252211 1758 1526 1520 560 --1614 189
NM_003749chr1371764 1492 931 812 606 398 183 32162 862 460 1802 --
NM_003750chr105988 747 355 333 68 ------
NM_003754chr111138 ------
NM_003758chr1521398 1187 2510 385 1371 --
NM_003758chr1521398 1187 2510 385 1371 --
NM_003759chr464310 3958 3140 3093 952 433 169 13007 --
NM_003762chr141335 939 925 268 ------
NM_003766chr171168 ------
NM_003774chr1243204 2183 1301 203 12569 1832 1708
NM_003779chr1--122 ----
NM_003781chr32392 39 31694 548 503 ----
NM_003783chr12855 839 ------
NM_003787chr1831137 595 389 --2117 81 --
NM_003796chr192458 180 ------
NM_003799chr1874361 3900 3117 1141 881 717 257 23025 3000 23800 3562 --
NM_003800chr651801 1775 814 243 165 2826 733 ----
NM_003816chr851292 1053 458 424 51 21408 376 ----
NM_003821chr8----151 --
NM_003822chr152588 2067 1944 473 167 12545 ----
NM_003825chr15165 21211 416 11359 1276
NM_003829chr931159 449 266 ----1432
NM_003831chr184623 617 380 196 --11415 --
NM_003842chr842488 1807 701 43 12079 ----
NM_003845chr12------177
NM_003877chr125947 912 297 186 41 ------
NM_003887chr272342 1989 1823 1542 1511 623 286 ------
NM_003888chr1521672 274 ------
NM_003895chr2182224 1912 570 534 500 364 261 111 ------
NM_003899chr1352435 2012 561 477 369 1254 ----
NM_003901chr1032646 1699 922 2597 388 ----
NM_003902chr15745 578 327 310 159 --1643 --
NM_003909chr862961 2911 2748 964 422 132 ----11136
NM_003913chr653271 3051 2830 2671 1103 13546 24358 2664 --
NM_003916chrX31277 1113 138 11437 3595 535 226 --
NM_003921chr12673 128 11470 2295 165 --
NM_003922chr15171 ------
NM_003927chr185991 970 416 173 144 ------
NM_003930chr742000 1708 345 220 ------
NM_003931chr61524 ------
NM_003939chr1053804 3664 2820 1664 25 11094 13300 --
NM_003941chr752376 2282 1599 679 371 ----1155
NM_003947chr32402 302 11149 ----
NM_003948chr442359 1823 1733 229 ------
NM_003958chr6123877 3812 3276 2936 2901 2651 2526 715 508 423 386 236 2446 251 1328 13914
NM_003968chr33541 216 44 ------
NM_003971chr171246 ------
NM_003980chr64412 397 386 223 ------
NM_003998chr42629 531 ------
NM_004006chrX42631 1806 800 680 22669 1941 ----
NM_004007chrX42631 1806 800 680 22669 1941 ----
NM_004009chrX42631 1806 800 680 22669 1941 ----
NM_004010chrX42631 1806 800 680 22669 1941 ----
NM_004011chrX42631 1806 800 680 22669 1941 ----
NM_004012chrX42631 1806 800 680 22669 1941 ----
NM_004013chrX42631 1806 800 680 22669 1941 ----
NM_004014chrX42631 1806 800 680 22669 1941 ----
NM_004015chrX42631 1806 800 680 22669 1941 ----
NM_004016chrX42545 1720 714 594 22583 1855 ----
NM_004017chrX42631 1806 800 680 22669 1941 ----
NM_004018chrX42545 1720 714 594 22583 1855 ----
NM_004019chrX1385 2435 369 ----
NM_004020chrX42631 1806 800 680 22669 1941 ----
NM_004021chrX42545 1720 714 594 22583 1855 ----
NM_004022chrX42545 1720 714 594 22583 1855 ----
NM_004023chrX42545 1720 714 594 22583 1855 ----
NM_004028chr1853450 551 508 261 243 ------
NM_004035chr1794975 4909 4642 4459 4391 4038 1560 1308 1131 24417 1677 11542 11220
NM_004040chr221239 956 ------
NM_004052chr102275 42 ------
NM_004067chr741529 1471 505 230 --1573 --
NM_004075chr12155 ------
NM_004077chr1261180 1075 841 291 105 62 11063 ----
NM_004081chrY21667 489 1552 11305 --
NM_004093chr1373114 2687 2297 2275 2141 1137 774 --157 --
NM_004096chr1041330 1305 557 43 1833 ----
NM_004100chr6----32066 2028 73 --
NM_004105chr2185 157 ----
NM_004112chr1751654 1189 458 451 282 21429 1199 ----
NM_004114chrX41062 1007 275 43 ------
NM_004124chr14112738 2624 1323 1216 1139 1013 913 870 350 79 69 ------
NM_004130chr3156 1482 ----
NM_004134chr52609 596 ------
NM_004136chr1552672 2628 2514 2301 1297 1113 22377 23 23095 2289
NM_004157chr31259 --1890 --
NM_004170chr91506 11397 ----
NM_004171chr11119474 8957 7829 6511 3585 3438 3296 2649 2097 1037 526 13303 49662 9247 2882 1724 --
NM_004180chr2168 ------
NM_004200chr111760 12624 --12615
NM_004202chrY3617 62 23 --1564 --
NM_004225chr821381 1286 1947 ----
NM_004227chr793071 2869 2841 2578 2367 1919 865 578 545 ------
NM_004229chrX42120 1463 1452 903 11444 --12056
NM_004232chr1873690 3483 3204 2891 1315 579 451 11482 ----
NM_004235chr94713 626 616 552 ------
NM_004237chr5--2898 833 ----
NM_004253chr91949 1282 ----
NM_004261chr13659 162 124 138 1985 1360
NM_004272chr541730 1375 403 231 ------
NM_004273chr1054188 4134 3919 3619 922 24402 1038 ----
NM_004274chr1452780 2722 1297 326 285 --12885 --
NM_004293chr943085 2394 1545 94 22816 1449 1219 --
NM_004301chr3125 1355 ----
NM_004302chr1272860 2798 2170 1922 720 200 83 ------
NM_004304chr2----1284 --
NM_004329chr1031044 438 239 11094 ----
NM_004338chr1896978 6923 6681 5466 5319 5117 2512 1958 1135 34930 4855 2525 12634 25696 1048
NM_004342chr732218 886 576 ----11546
NM_004349chr821243 224 1130 ----
NM_004356chr111169 ------
NM_004370chr631838 1734 1584 ------
NM_004374chr81135 ------
NM_004380chr1662565 1964 1698 1673 316 187 ------
NM_004384chr551941 1452 809 358 127 11532 --1137
NM_004388chr12422 89 ------
NM_004391chr391983 1767 1612 1415 802 723 582 291 128 1609 11566 --
NM_004392chr132640 580 --11632 --
NM_004397chr1153704 3035 1417 1264 982 14318 43609 3112 884 185 --
NM_004404chr261948 1860 638 630 303 129 11847 ----
NM_004407chr431007 859 657 1994 ----
NM_004419chr103322 239 78 --1760 --
NM_004423chr372744 2532 2197 2138 687 199 93 32750 2467 538 22006 1693 --
NM_004430chr832096 1753 42 12535 1733 --
NM_004431chr1140 ------
NM_004432chr972140 1766 1598 830 729 610 189 ------
NM_004437chr153406 3175 2342 963 699 21413 760 ----
NM_004438chr293259 2494 981 541 436 292 271 132 85 145 ----
NM_004441chr3--21283 1217 ----
NM_004456chr71254 ------
NM_004457chr251297 593 556 116 58 ------
NM_004458chrX42279 2144 650 278 11868 1370 1533
NM_004464chr443753 901 440 105 --23996 993 23889 614
NM_004481chr122658 1952 12373 --1108
NM_004498chr15193 ------
NM_004500chr1412063 1718 1249 21416 1378
NM_004501chr153508 3226 973 936 320 ------
NM_004504chr273049 1199 1162 660 558 529 406 11146 11919 --
NM_004505chr1772011 1962 1458 1435 1293 418 64 1763 ----
NM_004520chr51554 ------
NM_004521chr101143 1328 ----
NM_004532chr3--2362 28 --1161
NM_004537chr1231403 224 46 1534 ----
NM_004540chr211701 ----1913
NM_004566chr1052578 2532 2313 1914 645 ------
NM_004575chr4167 11385 --11249
NM_004580chr1531419 576 42 ------
NM_004586chrX105300 5212 4438 4431 3944 3660 899 821 666 516 11458 1650 --
NM_004598chr553032 2497 2441 2117 547 12532 31096 705 631 22888 2452
NM_004607chr51194 ------
NM_004612chr983868 3238 1792 1564 954 823 618 242 34771 3895 82 ----
NM_004637chr311094 --1162 --
NM_004643chr141658 ------
NM_004654chrY21327 557 ------
NM_004660chrY32015 1702 860 ------
NM_004661chr561213 1135 1088 212 150 55 ------
NM_004677chrY1456 ------
NM_004680chrY168 ------
NM_004681chrY2551 198 1180 ----
NM_004685chr1322803 2117 22921 1924 1628 --
NM_004703chr1752256 2179 944 732 133 12198 ----
NM_004713chr142769 146 ------
NM_004717chr771565 1500 1266 983 428 207 101 ------
NM_004719chr1272721 2622 2261 2123 1756 529 37 ------
NM_004726chrX65676 5513 4370 841 591 251 22214 1942 --1188
NM_004729chrX31608 597 67 ----11558
NM_004730chr52694 354 21806 33 ----
NM_004736chr142116 519 307 79 1228 3862 746 366 --
NM_004737chr221120 1951 ----
NM_004738chr2032312 978 336 ------
NM_004745chr8106597 6548 5885 5724 5457 2705 2549 1983 1881 1471 25976 1673 36750 6308 311 11057
NM_004748chr1583262 2982 1485 1450 1302 623 613 449 1528 ----
NM_004755chr1441064 480 114 56 --1357 --
NM_004756chr1921387 1335 ------
NM_004760chr742075 1792 850 386 --12428 --
NM_004766chr3------1254
NM_004772chr511089 --1446 --
NM_004774chr1743075 1033 861 248 ------
NM_004775chr1841638 1599 1514 825 41999 1755 1714 852 1418 --
NM_004776chr202639 523 --22709 2280 --
NM_004787chr4----144 --
NM_004788chr1172705 2373 2213 1977 1841 1042 217 --1534 1826
NM_004789chr92337 330 ------
NM_004792chr2122 ------
NM_004796chr1411935 --12140 --
NM_004798chr2073685 3573 3545 3019 2733 2477 2395 13208 ----
NM_004801chr211051 1161 11592 --
NM_004805chr231221 360 239 3997 562 288 ----
NM_004808chr1063338 3182 3017 2841 2069 1132 13242 ----
NM_004815chr1114275 4268 3935 3640 3422 3316 3222 1809 1531 1232 823 23358 198 14850 14048
NM_004817chr92749 649 ------
NM_004824chr641379 1274 1181 230 11039 1557 1507
NM_004835chr33811 761 709 --1818 --
NM_004835chr33811 761 709 --1818 --
NM_004836chr25793 616 196 65 52 ------
NM_004841chr141147 1123 288 53 1100 ----
NM_004845chrX73993 3375 1657 1315 806 411 381 23076 737 ----
NM_004857chr1454348 3753 2929 1803 1197 33915 1592 1033 ----
NM_004865chr6--1289 ----
NM_004866chr5114516 3842 3742 3104 3049 1948 1635 1121 1069 40 28 13770 23966 3528 13489
NM_004872chr1--1332 ----
NM_004874chr83397 134 85 ----1441
NM_004884chr1531335 248 129 3692 541 459 ----
NM_004898chr482724 2354 2321 2214 1987 758 623 363 12334 ----
NM_004902chr201130 1769 ----
NM_004904chr7126401 5653 5031 4816 4566 4443 1716 1570 1485 374 201 162 36030 1625 1325 35586 2406 498 --
NM_004906chr62659 75 --1192 --
NM_004912chr721656 1207 ------
NM_004915chr211607 --1564 --
NM_004922chr10185 ----1740
NM_004930chr12706 692 ------
NM_004932chr521629 1541 ------
NM_004947chr392561 2241 1997 1678 994 955 843 786 533 ------
NM_004956chr754544 4348 4282 3153 869 ------
NM_004972chr92788 136 --1399 --
NM_004976chr1135013 3306 1100 24096 1020 ----
NM_004985chr1274190 3273 3150 2987 290 245 223 23836 135 --13185
NM_004992chrX108475 6225 5564 5489 5196 2766 2078 2026 1781 1115 12105 ----
NM_004992chrX108475 6225 5564 5489 5196 2766 2078 2026 1781 1115 12105 ----
NM_004993chr142451 33 ------
NM_004999chr694459 4315 4196 3268 3131 2979 742 349 102 21315 292 ----
NM_005006chr23875 747 138 ------
NM_005009chr162106 50 ------
NM_005010chr771878 1678 1405 1388 553 370 198 ------
NM_005014chr9148 2705 641 ----
NM_005028chr1032164 1550 823 11695 ----
NM_005032chrX1853 1706 ----
NM_005036chr2297481 7144 6500 5653 3289 743 610 177 158 37033 6905 1410 38047 7756 1727 --
NM_005045chr72705 94 --1884 --
NM_005054chr221676 446 --21432 56 11424
NM_005056chr1265266 4211 4181 1329 431 104 15066 ----
NM_005057chr141449 368 307 109 11573 1494 --
NM_005058chrY2238 201 1244 ----
NM_005065chr14105139 4783 4282 3521 2020 1407 892 706 687 157 --11598 --
NM_005069chr2121717 674 ----11546
NM_005080chr222766 664 1191 --1845
NM_005087chr33593 573 172 ------
NM_005095chr1--11465 11709 --
NM_005105chr141893 1375 717 673 1376 1239 --
NM_005109chr342109 1693 489 51 21819 230 1416 --
NM_005112chr421029 855 ------
NM_005114chr42513 121 ------
NM_005116chr2074305 3474 1147 663 468 186 92 --14351 --
NM_005121chr1743795 3014 2561 427 1124 12733 --
NM_005126chr331682 601 129 11839 ----
NM_005135chr1573445 3257 2592 2403 1512 580 152 33457 2619 1188 --1644
NM_005140chrX41011 766 381 21 ------
NM_005154chr151425 ------
NM_005155chr62676 558 1216 ----
NM_005156chr985380 4413 3338 1748 1103 1012 633 91 --25340 3438 --
NM_005171chr1251005 504 379 144 130 ------
NM_005180chr1041541 1214 602 54 --1541 --
NM_005187chr1651492 1314 770 758 91 21665 213 ----
NM_005188chr11107459 7268 7121 6799 6634 5920 5205 2272 2229 1304 --36965 5151 2978 --
NM_005189chr1732166 798 230 32342 1784 262 --12372
NM_005191chr321446 1355 11240 ----
NM_005197chr14116079 5383 5211 4918 4654 3818 2450 2159 2058 1636 1411 ------
NM_005201chr331151 1027 170 --1296 --
NM_005207chr2263365 2494 2483 1171 1036 166 43406 2721 2531 686 1942 --
NM_005222chr74942 267 227 182 ------
NM_005224chr192674 666 ------
NM_005229chrX21228 166 1249 ----
NM_005231chr111162 ------
NM_005233chr341904 882 679 139 1493 1967 1466
NM_005235chr2137736 7569 6709 6252 5639 5412 5116 4786 2845 1857 1645 1568 990 27774 5257 67103 6368 4992 2655 2159 1339 --
NM_005238chr1153230 2816 2534 1053 119 13200 --12327
NM_005249chr142732 288 ------
NM_005252chr142703 194 ------
NM_005254chr1511365 11214 ----
NM_005256chr114900 811 735 601 ------
NM_005259chr231430 1293 467 11367 ----
NM_005261chr83641 310 83 ------
NM_005264chr101377 ----1713
NM_005277chr441541 1206 758 388 ------
NM_005278chrX1450 ------
NM_005311chr732588 2374 612 22548 917 ----
NM_005328chr83806 710 629 ----1290
NM_005333chrX21233 177 --1470 --
NM_005339chr473976 3633 3106 1162 833 211 36 1403 13254 21078 1008
NM_005348chr141312 --1938 1171
NM_005349chr4----1431 --
NM_005359chr18116479 5324 5074 4347 2553 2461 2235 2165 1391 1146 740 25253 2192 12525 1453
NM_005373chr151562 1503 625 493 482 1313 ----
NM_005378chr23737 632 596 ----1876
NM_005385chr362753 2660 989 657 40 25 2742 606 12165 1555
NM_005387chr111605 --1440 --
NM_005398chr1041407 1206 1102 247 ------
NM_005399chr183997 3959 2976 1574 1322 1008 606 397 1453 13208 --
NM_005400chr232866 1100 93 --12490 --
NM_005406chr1831445 603 301 --11308 21570 420
NM_005413chr21339 ------
NM_005417chr2012002 ------
NM_005436chr1093948 3939 3931 3660 3580 2777 2743 652 358 1876 ----
NM_005445chr101294 ------
NM_005455chr141610 1467 506 220 11589 ----
NM_005465chr1--2215 23 ----
NM_005479chr1041552 1504 1434 414 ------
NM_005483chr192277 57 ------
NM_005493chr61858 ------
NM_005497chr17135487 4625 4377 4042 2288 1697 1494 1145 1124 871 501 415 377 35875 4189 2085 ----
NM_005499chr191636 ------
NM_005502chr963126 2508 2395 2241 785 254 ------
NM_005504chr12126248 6014 5714 5588 4563 4366 2173 1899 1065 775 538 285 76431 5884 5872 4248 848 298 218 ----
NM_005509chr561593 1465 1251 1213 293 152 ------
NM_005517chr121175 31 ------
NM_005520chr51651 ------
NM_005522chr71522 --11369 --
NM_005539chr101873 ----1181
NM_005542chr731736 1262 777 ------
NM_005544chr22720 115 ------
NM_005569chr2261232 1104 1001 226 183 142 ------
NM_005570chr18--2918 23 31138 1027 367 --
NM_005576chr151240 ----1189
NM_005578chr354165 1618 1539 1471 1340 44386 4097 3933 796 ----
NM_005584chr133738 673 249 --1525 --
NM_005585chr151171 ------
NM_005587chr153999 774 58 ------
NM_005593chr122190 135 ------
NM_005595chr12826 156 ------
NM_005596chr955253 3964 1405 898 428 32580 1683 509 35496 1676 790 --
NM_005602chr32923 376 1502 ----
NM_005604chr652475 2244 2116 734 337 12351 ----
NM_005607chr8--1367 ----
NM_005613chr142145 1470 324 254 ----1845
NM_005614chr72970 385 ------
NM_005639chr122573 351 ----167
NM_005644chr12139 47 ------
NM_005650chr2221204 426 ------
NM_005655chr841320 1179 917 338 ------
NM_005665chr1113858 3644 3280 1565 1527 1400 1240 797 623 476 300 1608 ----
NM_005668chr563980 3828 3181 1263 639 161 1770 13023 --
NM_005669chr54602 387 238 38 ------
NM_005715chr672076 1750 799 742 695 426 31 42527 2467 1976 356 12573 --
NM_005721chr251090 934 807 397 388 ------
NM_005722chr232418 1830 348 21656 504 12284 22479 1697
NM_005725chr162250 2233 2185 1824 1598 181 11735 --1978
NM_005737chr242688 2467 2387 1034 ------
NM_005738chr731318 606 21 ------
NM_005746chr752434 2143 863 691 471 ------
NM_005748chr1221280 172 32643 2443 2417 ----
NM_005749chr173655 639 543 ------
NM_005756chrX4440 388 304 60 11316 ----
NM_005759chr274413 4289 3624 3471 3293 3286 1836 126 ----
NM_005762chr191134 ------
NM_005765chrX294 63 ------
NM_005766chr13------11413
NM_005776chr142613 243 ------
NM_005780chr13176 ------
NM_005785chr1251730 1385 1225 749 107 --11464 --
NM_005789chr1732145 287 171 12051 1730 1568
NM_005802chr92735 537 ------
NM_005808chr393326 3222 2817 2445 2439 2433 2427 2421 136 --12637 --
NM_005813chr262472 2212 2149 1024 583 554 --11894 --
NM_005828chr1795072 4432 4016 3109 1851 1003 863 664 50 14935 ----
NM_005834chrX257 30 ------
NM_005840chrX87258 6864 5778 5069 4797 2292 1414 169 1639 1340 --
NM_005843chr21319 21349 395 11796 11743
NM_005857chr131212 953 296 --11143 --
NM_005862chr311016 ------
NM_005871chr10148 ------
NM_005877chr2262450 1861 825 551 374 40 1770 ----
NM_005880chr1621587 1511 ------
NM_005882chr41686 ------
NM_005895chr1273231 3203 1558 1420 1205 996 457 33245 2972 661 12670 --
NM_005898chr1182696 2620 2534 2289 2125 1228 998 282 12331 23162 764 --
NM_005899chr1741017 557 362 142 ------
NM_005901chr18148636 7704 7641 7515 7301 6817 3345 3215 2708 2691 1639 1174 1000 433 --12220 13308
NM_005902chr1564522 4434 1711 1616 1124 475 13920 --11691
NM_005903chr595141 4136 3660 3610 3592 3480 3413 941 652 23740 1573 13351 --
NM_005907chr61248 --21364 1308 2550 50
NM_005909chr564183 3590 2825 1289 1038 972 --21704 1588 --
NM_005911chr221506 1078 ------
NM_005920chr163504 3377 3290 1498 1230 575 12846 13384 --
NM_005924chr721059 884 ------
NM_005926chr153463 366 123 1373 ----
NM_005927chr53333 185 25 11128 ----
NM_005933chr1142951 2076 1975 672 31930 1871 660 ----
NM_005935chr484736 3917 3411 1855 1721 1219 915 26 15056 14348 --
NM_005941chr854179 4115 3574 2984 673 12685 ----
NM_005944chr32495 201 1349 ----
NM_005955chr1105479 5353 4010 3722 3652 2133 1683 1473 1335 63 21956 1236 --14414
NM_005962chr1071863 1781 1763 1477 819 169 129 ------
NM_005962chr1071863 1781 1763 1477 819 169 129 ------
NM_005966chr22706 658 32431 2279 93 --11849
NM_006011chr1584153 3771 3348 2970 2911 339 154 148 11061 ----
NM_006016chr621640 614 32207 1751 1713 --12197
NM_006022chr134926 263 141 78 ------
NM_006036chr241810 787 337 57 --12584 --
NM_006037chr294627 4303 4103 3756 3400 3041 1681 1490 738 ------
NM_006047chr203988 872 517 --12510 --
NM_006048chr121188 1097 ------
NM_006060chr774164 4004 3678 3528 2967 794 236 11662 1832 --
NM_006067chr165930 880 809 331 82 ------
NM_006079chr62824 247 187 ----
NM_006080chr732904 2127 1203 ------
NM_006086chr161265 ------
NM_006089chrX4542 363 314 219 11369 ----
NM_006094chr841840 1703 580 344 11743 --21717 314
NM_006095chr4113922 3563 3072 2839 1773 1767 1399 1037 627 600 34 --11692 --
NM_006106chr1183351 3018 2566 2290 1332 489 475 131 --13438 12541
NM_006113chr132065 1986 314 11555 ----
NM_006133chr1172455 1626 763 751 699 687 345 1162 ----
NM_006135chr131470 1261 211 1412 ----
NM_006136chr731156 917 460 ------
NM_006154chr1562191 1105 864 629 467 332 ----11866
NM_006155chr261948 1860 638 630 303 129 11847 ----
NM_006158chr81559 21117 698 --1472
NM_006164chr2186 ------
NM_006166chr1232053 893 822 --21865 468 --
NM_006178chr1771636 1491 1373 1347 1170 229 113 11237 ----
NM_006190chr22313 235 ------
NM_006203chr5115508 4889 4845 3653 3410 1967 1702 1683 1121 978 22 13717 14540 --
NM_006206chr442811 1121 446 197 ----1210
NM_006237chr1342157 2141 1616 77 11557 ----
NM_006241chr372277 959 859 796 776 320 171 ------
NM_006246chr141141 ----11083
NM_006251chr542910 1290 1237 1132 ------
NM_006252chr1137394 6940 6425 6266 5702 4880 1466 808 788 507 383 230 161 47246 6624 2096 1946 27192 1886 --
NM_006254chr31156 ------
NM_006256chr152413 1899 1710 819 271 1190 1162 --
NM_006258chr1061387 1359 980 591 348 113 ------
NM_006259chr42836 97 ----1718
NM_006264chr42500 380 1567 ----
NM_006267chr251536 1383 593 575 363 21210 707 ----
NM_006275chr20102531 2119 1753 1591 1556 810 747 542 398 74 ------
NM_006282chr2074268 4081 1897 1648 1532 740 453 33147 211 67 --14738
NM_006283chr8104160 3897 3868 3299 3275 1494 899 705 457 129 --11126 --
NM_006290chr641851 1789 1295 745 --11280 --
NM_006306chrX75802 2331 2050 1850 1557 1038 90 44587 2278 945 901 11949 --
NM_006313chr1211545 --1606 --
NM_006317chr55334 253 112 87 75 --1263 --
NM_006320chr41283 ------
NM_006330chr811539 --1150 --
NM_006333chr23563 464 146 ------
NM_006334chr91119 ------
NM_006346chr131180 1399 ----
NM_006348chr72161 145 ------
NM_006357chr22441 434 ------
NM_006359chrX42485 1971 1829 1712 --11873 --
NM_006364chr1431311 1029 285 ------
NM_006369chr1----1407 --
NM_006371chr385207 5142 4802 4466 3813 1699 1063 339 25067 4441 14113 21104 89
NM_006375chrX41835 1722 1706 1345 21471 196 --11413
NM_006379chr722146 247 ------
NM_006380chr1784222 4085 3876 3659 2851 794 529 28 33553 3400 1356 ----
NM_006393chr1083966 3743 3622 3311 1610 900 852 74 ----13819
NM_006408chr71947 ------
NM_006420chr2073255 3243 3114 2749 2686 2305 678 ------
NM_006434chr1042756 2593 2528 807 12246 22375 333 12396
NM_006449chr23809 778 556 22086 1561 12123 --
NM_006451chr51847 1683 ----
NM_006464chr234533 3900 1519 11053 ----
NM_006465chr1522348 469 174 --32258 1660 939
NM_006469chr13498 441 156 ------
NM_006482chr1233890 2933 203 43951 3144 533 296 ----
NM_006489chr1471994 1846 1474 1429 1269 438 217 ------
NM_006496chr111367 --21886 543 --
NM_006504chr1082729 2039 867 810 329 245 124 90 ------
NM_006517chrX32154 1478 276 ------
NM_006526chr2032113 418 323 21951 73 ----
NM_006534chr2073067 2931 2706 2602 2150 401 184 --21199 1016 1604
NM_006537chr152461 66 ------
NM_006538chr252718 834 674 547 163 ------
NM_006540chr851403 1356 1050 595 184 11338 ----
NM_006544chr14175674 5665 5569 5279 4249 4028 3941 3891 3829 3781 2160 1971 1868 1670 536 507 153 24556 753 1661 34601 98 60
NM_006546chr1765682 5672 5574 4333 2223 1101 44930 4276 1657 1639 1451 --
NM_006547chr741919 716 628 174 21583 567 12119 --
NM_006557chr93495 375 257 ------
NM_006559chr13754 285 61 ------
NM_006561chr10106002 4914 4841 4088 3950 2152 2092 1965 1105 460 --11841 --
NM_006572chr1773491 3246 3189 2613 403 359 29 1896 12777 --
NM_006575chr1431347 1192 181 11309 ----
NM_006577chr221224 340 ------
NM_006578chr1551466 629 408 70 31 --1213 --
NM_006595chr1131466 566 101 --1187 --
NM_006599chr16157841 7159 6146 5710 5636 5556 5490 5011 3001 2977 2571 2448 1932 1385 857 ------
NM_006602chr201557 1648 ----
NM_006603chrX51968 1737 1435 1408 632 ------
NM_006609chr252362 2028 519 318 25 ------
NM_006614chr353541 2846 2252 843 815 33693 3477 2782 ----
NM_006620chr664639 4483 1722 860 634 324 23791 892 ----
NM_006622chr52462 228 ------
NM_006626chr972652 767 753 631 614 600 511 ----1212
NM_006628chr15124661 4556 4228 4010 3520 3235 3114 1094 1000 776 495 399 43803 3547 3045 325 23095 650 14282
NM_006646chr1373029 2115 777 672 603 592 175 ------
NM_006654chr1274624 3550 3372 3188 3030 2922 688 23155 3076 1310 --
NM_006667chrX2448 22 11155 ----
NM_006675chr1222179 549 22282 143 11111 1495
NM_006690chr2011752 ------
NM_006699chr192640 2616 2343 2305 2169 1863 550 270 184 12089 ----
NM_006704chr132120 93 --1112 --
NM_006706chr51740 ------
NM_006713chr52609 135 2598 527 ----
NM_006717chr932898 782 407 ------
NM_006720chr1024028 1663 1260 ----
NM_006727chr51125 ------
NM_006729chrX215602 5404 5370 5333 5269 5076 5012 4924 4918 4493 4101 3732 1960 1816 1593 1286 1180 1131 1035 776 759 21190 569 24311 1623 --
NM_006731chr9104757 4723 4664 4604 4480 2237 2140 1432 1021 235 54831 4589 3610 2338 1147 35779 4942 4189 12261
NM_006745chr41143 ------
NM_006746chrX51359 1012 166 112 53 --1439 --
NM_006749chr82275 128 11271 ----
NM_006750chr16167705 7206 7103 7053 5753 5545 3119 2925 2734 2638 2399 1795 1375 678 179 165 1587 18088 --
NM_006754chr731264 485 408 ------
NM_006756chr851197 479 206 156 24 ----1300
NM_006766chr852584 2575 2307 2201 1044 1474 22644 2446 --
NM_006769chr12678 525 ------
NM_006775chr672516 2343 2053 998 931 698 54 ------
NM_006777chrX32613 2412 1931 --22314 676 --
NM_006800chrX1595 ------
NM_006815chr122535 220 --11227 --
NM_006826chr231268 1177 1132 --11102 --
NM_006827chr1433106 2640 511 42732 2597 2549 36 1530 --
NM_006838chr1281834 1508 1375 1312 1240 301 290 114 11869 ----
NM_006846chr5161 ------
NM_006851chr12132946 2747 2576 2036 1951 1935 1887 1008 866 773 403 372 84 12595 --1782
NM_006856chr121392 21090 725 ----
NM_006884chr321743 642 21897 1550 11666 --
NM_006888chr1482582 2321 1415 1361 556 234 143 64 2478 245 ----
NM_006889chr33491 441 422 --1290 --
NM_006914chr93616 597 552 --11534 --
NM_006915chrX52057 643 547 402 367 11823 ----
NM_006918chr11105263 5228 5153 4765 4755 4352 3676 2333 989 921 --24647 1824 --
NM_006922chr242358 805 573 350 11667 ----
NM_006924chr1742883 1376 972 372 ------
NM_006925chr143370 146 70 ------
NM_006930chr551719 1529 639 267 78 ------
NM_006937chr17----1406 --
NM_006939chr1441054 990 447 357 ------
NM_006940chr121550 11860 ----
NM_006947chr461715 1111 596 449 373 343 1191 --1307
NM_006948chr2141600 1542 433 67 11819 ----
NM_006951chr103806 705 571 1641 --168
NM_006965chr183265 228 184 ------
NM_006999chr521484 1294 ------
NM_007005chr951537 1300 1062 277 241 ------
NM_007006chr1673047 2518 1255 1089 453 223 103 23053 2733 ----
NM_007007chr1233844 3055 501 11349 --1574
NM_007008chr22586 238 ------
NM_007010chr1751738 1532 1520 1343 76 --1396 1764
NM_007011chr1596760 6063 5784 4839 4555 4362 2158 2059 1540 26042 1809 ----
NM_007013chr841000 853 364 266 ------
NM_007017chr51667 2620 139 ----
NM_007034chr11715 --1333 --
NM_007042chr352106 1760 1666 903 284 1396 ----
NM_007043chr1251810 1686 1386 560 32 ------
NM_007054chr573514 2955 2726 2640 942 931 49 12753 ----
NM_007055chr1061216 1207 1072 847 467 25 ------
NM_007078chr1042877 2864 1887 542 1246 --12172
NM_007099chr22666 367 2622 136 --1599
NM_007106chr1342321 2236 2030 429 ------
NM_007111chr131813 ------
NM_007114chr3102890 2568 2545 2081 1217 1066 678 668 449 49 --12485 --
NM_007124chr631250 677 600 21607 442 ----
NM_007125chrY21461 156 1194 ----
NM_007137chrX33674 3507 1938 1133 ----
NM_007144chr1741323 1295 507 176 ------
NM_007146chr1722138 527 ------
NM_007150chrX42155 2115 690 482 ------
NM_007158chr13392 379 107 --175 --
NM_007166chr1121545 64 --11080 --
NM_007172chr2243253 1042 1033 697 12831 ----
NM_007173chr1132345 2253 231 --12308 1617
NM_007175chr8103352 3177 3136 3093 986 834 397 338 88 31 --13048 --
NM_007202chr171668 ------
NM_007212chr11229 12056 --1553
NM_007217chr3128 ------
NM_007218chr82972 179 --1167 --
NM_007220chrX134876 4019 3840 3734 3612 3588 3128 1862 845 555 389 217 198 23324 1341 22989 1883 11732
NM_007235chr121511 127 ----
NM_007236chr15102483 1721 1630 1560 938 822 795 626 594 434 --1655 --
NM_007242chr161240 ------
NM_007249chr1366921 6599 6377 3775 2693 1072 12204 26976 3374 1334
NM_007282chr3----1764 1179
NM_007287chr363259 2666 2068 974 696 630 --22511 2384 --
NM_007288chr363259 2666 2068 974 696 630 --22511 2384 --
NM_007289chr363259 2666 2068 974 696 630 --22511 2384 --
NM_007292chr1794975 4909 4642 4459 4391 4038 1560 1308 1131 24417 1677 11542 11220
NM_007294chr1721091 398 ------
NM_007295chr1721091 398 ------
NM_007296chr1721091 398 ------
NM_007297chr1721091 398 ------
NM_007298chr1721091 398 ------
NM_007299chr1721091 398 ------
NM_007300chr1721091 398 ------
NM_007302chr1721091 398 ------
NM_007303chr1721091 398 ------
NM_007304chr1721091 398 ------
NM_007305chr1721091 398 ------
NM_007345chr1842349 2132 1570 850 12336 1563 --
NM_007358chr161882 1748 1635 1625 466 153 --1432 --
NM_007361chr142575 499 ----1171
NM_007373chr1041353 706 321 66 ------
NM_009585chr33811 761 709 --1818 --
NM_009585chr33811 761 709 --1818 --
NM_012072chr2074423 3924 2952 1503 784 629 335 ------
NM_012081chr563382 3273 3196 3048 2996 2971 ------
NM_012082chr82924 722 ------
NM_012090chr121301 194 31231 1098 391 ----
NM_012092chr251819 1599 1448 721 425 --1631 --
NM_012096chr393408 3279 2821 2737 2573 2483 2396 1370 1166 23449 3030 ----
NM_012097chr252046 1615 1500 1436 598 ----1479
NM_012102chr132528 2152 101 ------
NM_012110chr41214 ------
NM_012129chr742512 1637 752 240 1557 22302 383 --
NM_012137chr1102857 2312 2202 2026 2019 1812 593 552 453 188 ------
NM_012141chr1373860 3074 2906 1597 1584 943 793 1847 ----
NM_012153chr1151876 1781 716 185 133 ------
NM_012158chr1331785 475 113 --1212 --
NM_012161chr43920 790 190 129 ----
NM_012164chr9147496 7451 6500 6432 5262 4969 4820 4576 2036 1892 1266 1154 1125 606 47349 2572 2319 2073 ----
NM_012175chr112348 294 --1272 --
NM_012193chr1184685 4091 4012 2024 1690 1639 1562 143 15035 14627 --
NM_012199chr1124559 3762 3679 3580 1363 1312 1091 821 703 667 401 121 --33951 1457 1066 --
NM_012207chr102235 188 ------
NM_012214chr295973 5892 5422 4583 4511 1713 952 508 95 --15004 15180
NM_012219chr373235 3177 3096 2915 2697 1003 532 ------
NM_012224chr421175 234 ------
NM_012238chr1041702 1277 695 635 ------
NM_012243chr12901 267 ------
NM_012247chr102702 279 ------
NM_012249chr262901 2874 2681 2326 510 217 23173 2751 1382 --
NM_012250chr113865 554 83 --1945 --
NM_012257chr721095 770 ------
NM_012262chr1104742 3322 1749 1582 1321 1312 869 673 663 384 44695 4103 1327 1278 14672 1693
NM_012281chr752445 2406 2381 2148 1853 11948 ----
NM_012287chr344525 3957 2959 838 33548 1347 416 1584 --
NM_012288chr685588 4870 4788 4595 1008 941 354 78 14170 --14407
NM_012290chr261414 1325 674 608 335 27 --11720 --
NM_012296chr1163558 3233 2843 1364 416 267 --22959 241 --
NM_012297chr431973 745 243 ------
NM_012300chr53891 742 70 12529 1587 --
NM_012301chr742083 614 501 455 ------
NM_012309chr1154812 4144 3548 3103 913 24277 3525 21429 376 --
NM_012316chr1104945 4632 4460 4419 3867 2252 1761 1661 1564 1132 --11707 --
NM_012325chr2051125 1057 399 192 123 ----11244
NM_012328chr711455 --11494 --
NM_012330chr1041460 1431 403 212 11635 21531 64 --
NM_012343chr531045 849 387 --1310 --
NM_012382chr5123625 3588 3547 3232 3027 2960 1771 1240 990 879 829 45 23204 1785 11406 --
NM_012383chr91405 1334 ----
NM_012417chr172458 422 --1601 --
NM_012420chr1052312 506 352 292 148 11544 ----
NM_012433chr2--139 ----
NM_012434chr631447 229 25 --1323 --
NM_012443chr102625 149 --1117 --
NM_012444chr203460 326 198 ------
NM_012454chr6------1450
NM_012463chr1231278 741 328 --1145 --
NM_012464chr4------2294 247
NM_012465chr1023302 2170 --12160 --
NM_012471chrX31809 702 207 11259 11592 --
NM_013229chr1232567 2305 659 41120 984 686 383 2255 183 1941
NM_013230chrY51482 1390 1338 1169 322 ------
NM_013231chr1484388 3077 2791 1703 1593 1367 1115 860 --1472 --
NM_013233chr241130 485 454 427 11290 ----
NM_013237chr51369 ------
NM_013255chr7137683 7179 6087 2831 2589 1624 1010 926 843 557 451 227 162 36707 2688 502 --11732
NM_013257chr852191 1928 1766 1661 749 1101 1382 --
NM_013261chr443529 3383 2809 88 ----144
NM_013263chr16138 ------
NM_013269chr1273623 3340 2970 1521 1423 925 390 ------
NM_013277chr122673 22 --1163 --
NM_013282chr1911184 ----11153
NM_013286chr393680 3219 3091 2912 2665 2552 1473 1034 99 43027 2520 2443 874 23450 2606 --
NM_013300chr122213 206 ------
NM_013302chr1664598 4246 4083 3742 1070 580 33943 537 402 ----
NM_013309chr1572606 2103 1679 958 713 585 349 22354 1943 12656 2282 255
NM_013316chr751034 750 288 245 115 ------
NM_013341chr242803 2790 2008 2002 ----1281
NM_013354chr851188 1141 227 95 63 1163 ----
NM_013357chr82712 349 --1118 1135
NM_013372chr15113266 3148 2534 2432 2355 1313 1283 1142 1128 244 119 12762 11034 --
NM_013381chr1272234 1797 1718 1705 879 768 345 1818 12400 12224
NM_013386chr121362 227 ----1476
NM_013390chr941671 1421 1272 387 11477 ----
NM_013433chr1931359 1282 137 --11623 --
NM_013436chr22780 173 179 ----
NM_013437chr8------1363
NM_013438chr931530 705 67 ----11705
NM_013444chrX3842 207 169 ------
NM_013445chr2----1144 --
NM_013996chr72548 420 ------
NM_013996chr72548 420 ------
NM_013997chr72548 420 ------
NM_013997chr72548 420 ------
NM_013998chr72548 420 ------
NM_013998chr72548 420 ------
NM_014000chr1041946 1661 1255 449 2753 655 1493 --
NM_014016chr341309 672 432 104 1603 --11261
NM_014021chr193001 2949 2312 1315 946 898 834 450 88 22647 2382 ----
NM_014034chr611236 1388 11454 --
NM_014039chr112355 123 1250 1440 --
NM_014048chr1685104 4513 3828 2009 985 680 456 284 ----15284
NM_014055chr121555 1448 1394 --
NM_014057chr931566 1352 1285 1106 --11517
NM_014071chr20126 ------
NM_014106chr15102993 2786 2626 2541 2308 2228 2210 1073 996 253 1682 ----
NM_014112chr843964 3792 1791 1184 14807 --198
NM_014117chr1662408 2133 1952 1818 1771 746 --1172 --
NM_014141chr765288 4707 2105 1924 1463 1230 24292 3935 24338 3570 11322
NM_014154chr331507 1434 1057 11032 2560 308 --
NM_014155chr11167567 7361 6606 6208 6141 6111 5912 5338 5123 4985 2865 1848 1043 874 682 95 22233 1360 1781 26009 2383
NM_014176chr1165 ------
NM_014188chr12278 50 ------
NM_014208chr41214 ----1298
NM_014217chr131516 1224 245 --1597 --
NM_014240chr363665 3552 1595 737 429 177 12605 11239 11176
NM_014243chr421698 771 --22051 1827 --
NM_014246chr2232008 1504 470 ------
NM_014253chrX32356 1772 336 --12080 --
NM_014258chr203651 625 24 ------
NM_014267chr11----1805 --
NM_014268chr1831287 1119 502 ------
NM_014271chrX1619 ------
NM_014278chr41341 ------
NM_014280chr1142 1297 ----
NM_014283chr11133 --11266 --
NM_014286chr993599 3218 2809 2435 950 673 381 288 23 --1922 --
NM_014289chrX31179 1137 1000 --3352 190 148 --
NM_014294chr841360 1083 996 56 ------
NM_014296chr361532 1038 642 615 307 33 21014 595 --21210 1137
NM_014309chr2265009 3931 3921 1820 1722 139 25406 1049 --1151
NM_014331chr4137754 7478 6757 5880 5743 5580 5549 5482 2946 1198 956 944 247 165 26584 1075 --
NM_014332chrX2325 109 --1150 --
NM_014333chr1142812 1019 647 260 ------
NM_014342chr1111473 ----1518
NM_014344chr111836 ------
NM_014345chr64943 690 229 159 187 ----
NM_014363chr1321279 1138 166 ----
NM_014368chr91397 --12104 --
NM_014376chr522535 2136 1474 --1461
NM_014392chr43429 391 88 ------
NM_014393chr841681 842 417 298 2629 504 --1166
NM_014394chr1041120 1000 468 40 ----1152
NM_014399chr72722 673 1115 ----
NM_014411chr712000 1634 --11596
NM_014415chr321381 1053 --1274 --
NM_014423chr5125177 3982 3431 1978 1970 1434 1387 1333 1239 1110 450 23 11890 34131 2212 427 --
NM_014431chr1041623 1409 1258 279 21637 1589 ----
NM_014447chr451647 1539 1494 1466 150 --1558 --
NM_014456chr1031451 253 45 21276 1248 ----
NM_014458chr131101 1039 947 2149 115 ----
NM_014469chr111112 ------
NM_014494chr163865 502 157 1519 12005 --
NM_014498chr31323 ------
NM_014517chr371830 1693 1578 1356 1200 637 372 11477 11243 --
NM_014554chr1232013 1691 802 1175 ----
NM_014572chr1361786 1722 1543 692 582 34 1123 ----
NM_014574chr1451578 1525 1127 1030 257 ------
NM_014584chr1441655 1101 542 209 --11610 11488
NM_014612chr931107 627 56 --21333 1252 --
NM_014615chr1643494 2529 1133 60 22655 2641 12787 1399
NM_014616chr343368 2857 2524 2514 12619 ----
NM_014630chr1563552 3146 2831 2799 2682 1609 --11017 --
NM_014636chr984345 3455 3435 3036 2911 2796 1724 697 24275 444 ----
NM_014637chr821171 549 --194 --
NM_014660chr71752 1722 ----
NM_014663chr1----11054 --
NM_014666chr521255 354 ------
NM_014667chr34940 884 455 249 1257 ----
NM_014670chr231652 257 90 --11160 --
NM_014671chr741494 1446 1260 1182 1624 ----
NM_014674chr383978 3637 3501 3120 1291 914 523 510 43414 2602 707 467 --1313
NM_014675chr1----1461 --
NM_014677chr831028 903 889 --11147 --
NM_014679chr1131392 463 70 144 ----
NM_014683chr1771789 1760 1654 1480 872 782 49 31862 1391 279 12125 --
NM_014691chr15------1301
NM_014701chr1572677 2213 1229 1202 972 56 26 1735 ----
NM_014702chr653354 2885 2147 963 402 --33202 1097 468 --
NM_014705chr751562 509 374 367 265 --1565 --
NM_014707chr751831 278 225 195 117 11985 ----
NM_014709chr21524 --1193 --
NM_014711chr1632076 2012 424 ------
NM_014721chr697023 6875 6776 6325 5858 5472 5453 2304 2188 17117 --25873 921
NM_014730chr1294847 3435 3384 3319 2105 1226 920 302 255 11238 11901 --
NM_014730chr1294847 3435 3384 3319 2105 1226 920 302 255 11238 11901 --
NM_014733chr562010 1476 531 381 200 177 --1318 --
NM_014735chrX52137 2038 1816 1535 707 --11733 --
NM_014739chr674006 2879 1653 1587 928 916 152 13279 13771 --
NM_014746chr294258 4048 3198 2864 1738 1302 1074 550 33 33538 3225 1451 ----
NM_014747chr195639 3974 3964 3793 3577 1942 1289 1209 114 15082 --13717
NM_014752chr1161929 1604 1574 1274 479 292 ------
NM_014755chr253826 3694 1562 426 404 11467 13303 --
NM_014766chr753761 3104 980 505 142 21465 1009 ----
NM_014774chr173110 2528 2149 2043 1986 114 40 1966 11276 12465
NM_014776chr1273025 2714 2575 2554 2045 636 483 2624 459 ----
NM_014781chr821242 411 2514 267 1288 1123
NM_014783chr1541108 537 260 182 1346 ----
NM_014795chr21273 ------
NM_014797chr652906 2590 2453 2197 1023 ------
NM_014803chr1052375 492 457 229 102 3820 91 42 ----
NM_014810chr1123672 3640 3302 3066 2743 2683 2663 2559 1467 1267 300 58 13168 ----
NM_014812chr121249 665 ------
NM_014813chr12376 163 162 ----
NM_014819chr522123 793 ------
NM_014827chr121690 629 1674 1128 --
NM_014830chr12103361 3324 3031 2728 2659 1328 919 212 205 57 11362 ----
NM_014839chr132270 2011 314 12236 ----
NM_014841chr64892 865 428 113 1183 ----
NM_014844chr1444144 1343 1297 763 23394 90 12738 21099 676
NM_014850chr343079 1476 1424 487 24810 520 --14105
NM_014859chr1741146 389 253 23 ----11361
NM_014860chr272387 1978 1047 702 487 344 333 1621 ----
NM_014871chr122672 428 --188 --
NM_014872chr972239 2078 2039 2015 1975 626 72 --1363 --
NM_014873chr154537 4407 4031 1287 330 34650 1587 1314 1895 11951
NM_014877chr17147799 7518 7049 6923 6398 5249 5081 5039 2443 2213 1704 1685 1367 692 36016 4947 979 17191 17498
NM_014880chr232085 2041 415 22307 734 1703 --
NM_014887chr133810 715 347 1106 ----
NM_014888chr741430 1094 499 381 11172 11497 --
NM_014890chr31310 ------
NM_014892chr6----128 --
NM_014897chr1763096 2926 2276 1291 862 170 12575 12158 --
NM_014904chr10103332 3267 2867 2721 1583 1483 959 920 568 303 12696 12817 1523
NM_014906chr1743726 2613 2564 1402 --13062 --
NM_014912chr1043294 3097 2381 272 2259 69 --32197 1037 587
NM_014913chr1821371 377 1134 ----
NM_014918chr1541200 1167 399 238 --11150 --
NM_014920chr673071 2763 2751 2689 2341 1500 48 21257 503 12369 12780
NM_014923chr1351936 738 690 471 264 12008 ----
NM_014932chr321460 225 ------
NM_014933chr42379 307 ------
NM_014934chr1373725 3700 3097 2807 2678 2425 71 13259 23934 3252 1930
NM_014935chr143575 3310 1059 443 33650 2864 515 --1188
NM_014936chr682793 2738 2027 1952 1105 737 479 93 1497 1298 --
NM_014939chr1861565 1222 173 123 105 77 11435 1958 --
NM_014943chr841101 1042 482 323 ------
NM_014946chr262774 2634 2183 1184 640 622 ------
NM_014947chr153030 2899 1068 842 39 21160 1025 ----
NM_014949chr11982 1229 ----
NM_014952chr1532059 749 232 1424 ----
NM_014953chr13114137 4007 3989 3769 3163 2849 1655 1011 908 866 710 13786 1181 --
NM_014962chr2042637 2281 2179 1065 12826 21035 708 --
NM_014969chr1------1376
NM_014978chr1061742 1704 1542 1340 140 98 ------
NM_014982chr1494774 4728 4586 3621 3351 1887 1582 413 83 21989 729 14748 14763
NM_014988chr462486 2008 1126 643 584 502 --12767 --
NM_014991chr473307 3187 3124 2511 2434 771 659 22605 2571 1859 --
NM_014992chr142702 328 ----1850
NM_014997chr772587 2571 2514 2228 1072 485 136 1288 1849 --
NM_014999chr1231561 1106 1069 21213 346 ----
NM_015001chr12915 187 ------
NM_015008chr362950 2634 2452 1087 777 684 --12853 13059
NM_015009chr33638 310 63 ------
NM_015020chr1683767 3503 2876 2767 1176 1129 360 74 23643 741 ----
NM_015025chr241722 895 279 166 1468 144 12649
NM_015026chr1294698 4581 4537 4243 4131 4067 3999 1085 495 --1268 33969 1261 845
NM_015032chr1332762 2434 261 --22856 605 --
NM_015039chr161695 1519 1068 973 586 69 13374 ----
NM_015042chr1574293 4258 3632 2802 1077 908 192 1156 ----
NM_015045chr1011622 11856 ----
NM_015049chr253244 2737 2233 508 347 ----12696
NM_015051chr962979 1165 716 566 443 234 1406 ----
NM_015052chr731210 911 348 --2279 269 11323
NM_015064chr1212570 23313 2407 33273 1148 771 --
NM_015068chr753188 2779 1502 1176 1069 1987 ----
NM_015074chr194641 3825 3643 1908 1612 1225 441 117 55 11349 ----
NM_015075chrX62089 1984 1950 1642 334 177 --1492 12277
NM_015076chr664276 4076 3997 3985 3123 907 33603 2849 790 23641 3483 1418
NM_015082chr552540 2300 1821 871 209 11815 11028 22461 2406
NM_015090chr1105131 2394 1590 1419 1335 871 782 741 619 577 --45217 5184 960 594 --
NM_015091chr141545 ------
NM_015092chr1664675 4627 3289 1176 1053 613 --24526 749 14405
NM_015093chr621802 1161 --1315 1166
NM_015094chr2241164 835 549 217 24161 845 24385 1671 --
NM_015097chr32793 743 ------
NM_015115chr432552 546 387 12683 12898 --
NM_015120chr21279 ------
NM_015132chr731624 1311 563 --11882 --
NM_015135chr71182 ------
NM_015137chr872593 2434 2161 1644 624 363 121 --22468 96 --
NM_015141chr332544 2274 635 32470 1733 479 11860 --
NM_015144chr1633949 3282 955 12799 13736 --
NM_015149chr122179 2023 ------
NM_015153chr61643 ------
NM_015155chr1053143 3097 2738 1018 911 22785 2632 1412 11140
NM_015163chr1451728 1428 505 195 39 ------
NM_015170chr852307 1841 1444 895 612 21940 804 11579 --
NM_015172chr151281 1111 1104 1032 203 --11086 --
NM_015192chr2022310 1002 12918 12580 --
NM_015198chr73344 235 226 --11071 --
NM_015199chr332832 1897 754 12119 ----
NM_015200chr442431 1814 1779 152 --11740 --
NM_015206chr15113626 3232 2843 2642 1198 1109 984 870 845 502 233 11412 ----
NM_015208chr18103529 3480 3290 2575 2537 1342 961 809 610 92 ----12815
NM_015215chr142850 2433 2301 2124 ----1992
NM_015225chr973150 3027 1254 765 288 89 59 1212 1324 22971 266
NM_015231chr113977 950 40 ------
NM_015235chr1021813 1458 12111 22005 777 --
NM_015247chr1653722 3467 1550 581 253 13974 1137 --
NM_015250chr942006 1911 1699 1433 11813 ----
NM_015252chr22984 126 ------
NM_015265chr232477 2443 2429 --22020 424 --
NM_015269chr12623 564 181 ----
NM_015271chr464301 3286 892 758 726 697 13343 --1413
NM_015272chr1672158 1432 426 388 259 241 159 ----12096
NM_015275chr1221740 1324 12117 ----
NM_015278chr643455 2580 2465 297 --22226 653 --
NM_015291chr143048 2359 821 812 11283 11309 --
NM_015299chr1464003 1590 1342 612 584 546 14009 11450 --
NM_015310chr8167777 7429 7422 7371 6119 6065 5650 5470 5450 3138 2884 2205 2148 2062 1709 1100 1827 --27577 1246
NM_015313chr11134787 4767 4735 4729 4705 4526 3812 3776 3710 3522 3468 1914 1132 --14400 --
NM_015314chr732485 1625 637 --138 1481
NM_015317chr292892 2607 2550 2525 2406 2037 695 316 255 ------
NM_015328chr792983 2975 2681 2386 2167 1202 924 776 659 42554 2338 1920 832 ----
NM_015335chr1232649 2129 771 1931 22628 721 --
NM_015336chr1232443 2397 2222 --1912 --
NM_015344chr831669 1539 1379 ----1558
NM_015345chr642687 2663 831 190 32719 983 172 ----
NM_015347chr1242780 2271 1854 524 32155 531 71 ----
NM_015349chr642703 713 341 181 --12873 --
NM_015355chr1741789 1596 1568 625 1160 ----
NM_015358chr2141306 1097 415 186 --1861 --
NM_015361chr21716 --3692 636 253 --
NM_015365chrX84300 3666 2926 1272 799 490 389 82 1739 ----
NM_015375chr184999 3849 3763 3178 1436 1147 1123 845 22012 519 21043 327 13525
NM_015381chr2231759 1315 460 --1808 --
NM_015384chr5162 ------
NM_015385chr1042756 2593 2528 807 12246 22375 333 12396
NM_015387chr281498 790 603 565 531 399 237 153 ----1828
NM_015393chr453398 3289 3107 2343 77 33041 1142 887 ----
NM_015396chr321480 993 --11071 1408
NM_015409chr1232693 43 21 --1467 1453
NM_015415chr11244 ------
NM_015423chr1121589 187 --1465 --
NM_015429chr351072 717 461 349 314 ------
NM_015435chr831021 561 282 ------
NM_015446chr151549 1506 1224 304 69 1566 --1262
NM_015449chr11511 ------
NM_015455chr543990 932 393 289 14064 --14071
NM_015472chr31385 ------
NM_015472chr31385 ------
NM_015477chr153900 700 91 1717 --1194
NM_015497chr151456 ------
NM_015503chr161735 ------
NM_015508chr311170 11029 ----
NM_015525chr65999 902 855 746 437 ------
NM_015541chr321283 246 1959 ----
NM_015548chr63911 854 283 ----1351
NM_015550chr783568 3373 3104 1434 1145 1008 460 340 1470 13562 --
NM_015553chr6175115 4843 4717 4271 4265 4120 4032 4016 3440 3230 1860 1655 1373 1283 1112 898 731 24147 3623 --14488
NM_015555chr621738 444 --1471 --
NM_015559chr1851074 1066 939 713 704 ------
NM_015564chr573585 3576 2542 1283 1013 375 71 1243 ----
NM_015569chr164818 4702 3550 3284 3127 258 11733 13790 --
NM_015570chr731392 1317 680 --1504 --
NM_015571chr641742 761 395 264 12367 ----
NM_015575chr263473 3237 3025 2538 1269 1259 33389 2724 822 ----
NM_015576chr332198 2023 1982 1177 1860 --
NM_015578chr1921832 1468 1278 12119 --
NM_015609chr171191 1162 1056 1033 915 724 507 --1731 --
NM_015630chr22842 181 ------
NM_015635chr921465 861 22096 1616 11821 --
NM_015640chr1105261 4930 4691 4321 3497 2061 1981 1243 438 273 14076 11538 --
NM_015678chr1341578 1546 463 427 --169 --
NM_015726chr141318 1134 742 176 --11683 --
NM_015844chr181956 ------
NM_015846chr181956 ------
NM_015847chr181956 ------
NM_015850chr842305 1881 541 457 11939 11715 --
NM_015852chr753590 2764 2621 2450 2304 12515 ----
NM_015874chr4----1431 --
NM_015878chr821899 1775 1889 ----
NM_015879chr18158453 7985 7966 7158 6902 6817 6675 6356 6195 3242 3103 1652 474 466 298 38583 7739 2238 37015 6505 693 1451
NM_015885chr112627 92 ------
NM_015888chr1102981 2272 825 803 664 538 531 499 362 70 ------
NM_015902chr81667 1117 ----
NM_015906chr154440 759 618 356 337 13196 ----
NM_015912chr832456 715 282 ----12312
NM_015955chr2----1500 --
NM_015975chrX41433 1332 702 626 31745 1685 93 ----
NM_015981chr552324 1245 1171 794 136 2718 525 ----
NM_015995chr15104968 4868 4831 4563 3399 1657 1641 859 593 458 23779 675 ----
NM_016023chr831549 1478 406 1105 ----
NM_016025chr1631521 1404 286 ------
NM_016038chr72530 86 ------
NM_016040chr142748 1983 1076 843 11770 1969 --
NM_016048chr55949 734 267 213 84 ------
NM_016072chr1252426 2416 1825 1734 430 11644 1702 --
NM_016075chr1332658 2450 942 21066 791 2832 506 --
NM_016076chr183234 3173 2960 2624 2203 1067 998 928 --22441 382 --
NM_016079chr221628 218 ------
NM_016081chr452026 1864 1809 858 715 --1300 1811
NM_016083chr693836 3762 3738 3363 2940 2541 992 725 328 1674 1621 --
NM_016096chr821541 68 ----21874 1818
NM_016097chr184838 329 235 83 1996 ----
NM_016098chr61196 ------
NM_016106chr141152 ------
NM_016122chr123486 133 86 1120 ----
NM_016127chr82564 189 ------
NM_016131chr222140 1483 --11592 11796
NM_016132chr152967 766 12101 22378 873 12266
NM_016166chr15--185 ----
NM_016169chr1093111 2787 2554 2349 2218 1995 1301 1265 639 ------
NM_016185chr17--1808 ----
NM_016194chr1551466 629 408 70 31 --1213 --
NM_016200chr71280 ------
NM_016205chr421035 79 ------
NM_016206chr3108946 8531 5804 5632 3145 3054 2497 1974 1070 544 47499 6110 2143 590 28761 1912 18845
NM_016211chr42379 307 ------
NM_016217chr662968 2631 2485 2475 1395 58 23197 469 12844 11122
NM_016226chr122386 374 ------
NM_016227chr11133 --11266 --
NM_016230chr62536 399 ------
NM_016231chr1731525 1153 1122 ------
NM_016248chr1394036 3682 3347 3017 2956 2872 1116 200 175 --12815 --
NM_016255chr683367 3097 3057 2849 2642 1318 256 151 --13237 --
NM_016260chr2137474 6777 6586 6567 5884 5666 5590 2702 2543 2100 1635 1318 562 25898 5303 27139 99 17197
NM_016262chr6123 1195 ----
NM_016264chr193534 484 51 ----1587
NM_016271chr1842258 2062 904 31 ------
NM_016275chr362772 785 718 674 465 140 ----12429
NM_016277chr641423 510 429 317 ------
NM_016281chr1231088 976 878 ------
NM_016283chr52273 228 --143 --
NM_016289chr222324 705 ----1913
NM_016299chr10184 ------
NM_016308chr111460 ------
NM_016315chr22274 209 11487 11175 1370
NM_016316chr21527 ------
NM_016322chr973133 2925 2795 2550 2086 444 368 173 11113 --
NM_016340chr531185 953 218 --11032 --
NM_016351chr7--143 ----
NM_016395chr1551786 557 456 199 63 1269 --11345
NM_016396chr1552681 2004 1077 1023 832 22497 174 12335 1872
NM_016422chr1153184 3157 3146 2193 1277 12368 --1440
NM_016424chr1741966 1773 1402 249 ----1630
NM_016436chr2052620 2516 1069 983 607 1877 ----
NM_016441chr211818 ----11622
NM_016448chr151904 1596 1230 454 163 11618 1698 --
NM_016451chr111116 ------
NM_016468chr14----2176 75 --
NM_016505chr1--1693 ----
NM_016507chr1752797 2325 2158 1272 619 2238 227 11086 --
NM_016513chr673071 2763 2751 2689 2341 1500 48 21257 503 12369 12780
NM_016516chr26771 733 691 655 333 71 ------
NM_016530chr1563766 3097 2943 1514 1351 667 33689 2764 607 --12917
NM_016531chr494154 3753 3624 3564 3468 3425 897 413 63 13800 24069 1266 --
NM_016542chrX41394 1158 1125 632 --2472 297 --
NM_016599chr431444 1043 979 ------
NM_016603chr532159 1691 1559 21534 250 ----
NM_016604chr531246 856 425 1157 11152 --
NM_016607chrX2454 219 ------
NM_016617chr1322196 1419 21740 232 ----
NM_016620chr12296 152 1486 11452 11418
NM_016623chr81495 191 ----
NM_016644chr51548 ------
NM_016654chr1511365 11214 ----
NM_016733chr2261232 1104 1001 226 183 142 ------
NM_016818chr211607 --1564 --
NM_016824chr1031739 359 307 1288 11809 --
NM_016830chr122518 489 ------
NM_016929chr694515 4033 3651 3468 2965 1667 1502 542 396 14142 1334 --
NM_016930chr4169 ------
NM_016940chr211444 ------
NM_016946chr172797 2785 2576 2248 841 128 92 43219 2707 2205 1325 --11254
NM_017412chr821390 428 11383 ----
NM_017415chr594462 4261 3795 3512 3121 2916 2845 1665 979 11837 11565 --
NM_017416chrX1133 ------
NM_017420chr1433780 1180 995 12566 --13056
NM_017423chr462193 1397 884 804 632 545 1209 ----
NM_017447chr2194073 4028 3432 2962 2711 1766 1546 985 577 13059 1639 --
NM_017491chr421029 855 ------
NM_017519chr6----1951 --
NM_017526chr1----1113 --
NM_017545chr202577 438 --1505 --
NM_017563chr3105535 5154 4038 2044 1587 1220 387 325 172 43 46377 3904 2125 803 ----
NM_017577chr351391 1318 665 52 32 ----11573
NM_017580chr1022285 952 --1166 1730
NM_017599chr1221460 772 1323 11702 11369
NM_017610chr1521330 825 11304 --11767
NM_017628chr464421 3719 3673 1202 710 229 23894 2022 11382 1550
NM_017629chr141467 511 144 65 2434 246 ----
NM_017634chr851711 1451 1419 1269 513 --1497 --
NM_017637chr999227 8991 8764 8411 6360 5957 5941 3695 3102 39137 3130 2139 29427 7390 1892
NM_017643chr1752903 2060 1902 648 408 ------
NM_017644chr3115108 4860 4819 4802 4733 4701 3414 3346 1896 1164 245 44540 3775 3635 1196 35136 301 83 --
NM_017650chr796006 5895 5047 3903 3672 2259 1469 1197 701 15465 --11143
NM_017658chr1484523 4510 4336 3932 3503 3124 675 561 ------
NM_017664chr131369 ----1115
NM_017666chrX61865 1429 512 266 244 202 11414 12028 --
NM_017693chr1331502 394 330 21614 537 ----
NM_017694chr251935 700 594 442 126 12068 186 --
NM_017704chr114763 248 186 42 1663 1739 --
NM_017719chr372331 1865 1586 1577 968 269 122 ------
NM_017736chr1652658 2508 2488 1262 707 1942 --1649
NM_017737chr111682 ------
NM_017739chr13231 203 110 ------
NM_017741chr432085 577 85 --2678 26 --
NM_017742chr1841891 1862 756 294 ------
NM_017747chr51324 ------
NM_017752chrX52170 1889 1611 590 266 1232 --12109
NM_017753chr92979 380 1762 --156
NM_017754chr685008 4715 4513 4316 1762 1247 1018 655 14217 --13499
NM_017762chr1521931 1539 ------
NM_017769chr1493163 3134 2620 1232 1183 1066 818 591 502 ----22596 238
NM_017770chr672908 2577 2557 2226 2117 2084 995 1988 ----
NM_017779chr1102573 2471 2454 2166 2100 1853 401 217 58 29 ------
NM_017789chr21687 174 ----
NM_017801chr322594 2498 21977 223 21712 1024 --
NM_017811chr9103158 3145 2478 2336 2290 2054 1983 1967 1179 744 ------
NM_017813chr875813 5661 5176 5167 3803 1492 449 24894 2053 15239 24393 417
NM_017819chr32215 193 ------
NM_017822chr122246 102 --1729 --
NM_017824chr1022565 1748 22717 2242 1347 1669
NM_017831chr1883135 3095 1470 1319 1157 1081 1022 903 ------
NM_017845chr42777 649 1254 ----
NM_017848chrX64396 4186 3660 709 490 277 ----14599
NM_017866chr81801 ------
NM_017902chr10135686 5379 4303 4197 3998 1888 1823 1736 1647 1015 524 415 206 25692 434 14399 --
NM_017913chr91417 ------
NM_017919chr9125194 4526 4365 3762 2210 1728 1557 1169 1103 999 622 531 35000 1296 1076 ----
NM_017925chr971916 1879 1806 1622 1490 240 161 ----21470 398
NM_017933chr231443 1133 659 --1277 --
NM_017934chr6--124 ----
NM_017935chr42608 171 ----1579
NM_017938chrX41442 1391 617 541 11947 ----
NM_017944chr1122993 2519 2991 443 ----
NM_017945chr34914 854 519 126 11047 --1232
NM_017969chr2----1198 --
NM_017974chr221313 809 ----1287
NM_017988chr123959 813 93 1675 ----
NM_017990chr1643295 2770 122 108 1561 24186 535 --
NM_017994chr732307 1082 1031 --1516 1549
NM_017998chr92150 93 11465 ----
NM_018010chr331565 1038 360 1457 11643 --
NM_018015chrX1234 2739 244 --1823
NM_018018chr1221491 1278 ------
NM_018048chr1242052 1926 598 367 --11254 --
NM_018061chr131357 687 581 21627 667 11444 --
NM_018062chr2--1366 ----
NM_018063chr10--1353 ----
NM_018070chr11156 ------
NM_018078chr44934 923 358 46 --1378 1674
NM_018084chr253196 2961 1285 1061 564 --22295 258 --
NM_018085chr1118040 7490 7153 6759 6254 6035 5202 5160 2410 2038 1324 56765 6378 5210 2495 2222 1771 --
NM_018086chr211558 41409 743 656 384 ----
NM_018090chr111183 ------
NM_018092chr1631426 609 307 11689 --1501
NM_018098chr331223 972 226 ------
NM_018107chr148820 739 707 382 282 248 34 24 ------
NM_018117chr103508 282 248 ------
NM_018121chr1042613 2209 786 132 ----12024
NM_018126chr441428 602 360 57 ------
NM_018128chr171436 --11042 --
NM_018144chr101261 ------
NM_018150chr12236 87 ------
NM_018151chr2----1785 --
NM_018155chr372951 1361 1230 1220 818 546 222 ------
NM_018169chr122542 490 ------
NM_018184chr33776 283 231 21357 522 ----
NM_018195chr1171933 1688 1580 1486 1456 650 639 ------
NM_018208chr11476 141 ----
NM_018211chr1146 --21567 627 --
NM_018214chr62419 24 ------
NM_018227chr473138 2743 2556 2198 1098 766 557 12343 ----
NM_018243chr4113780 3140 3016 2591 1589 1276 913 906 640 253 59 11229 1959 --
NM_018247chr683164 2883 2604 1103 757 596 461 79 2899 823 ----
NM_018250chr8121 ------
NM_018254chr152302 1807 1797 1758 343 --11860 --
NM_018263chr252371 2245 2050 1883 770 22510 549 ----
NM_018266chr341041 687 310 221 ------
NM_018279chr1251926 1071 914 687 615 11207 ----
NM_018286chr174915 739 355 205 ------
NM_018287chr101390 ------
NM_018290chr431031 940 24 ------
NM_018293chr312607 --22190 883 --
NM_018299chr863146 2677 2612 1024 616 122 --12228 --
NM_018302chr452268 2160 950 412 178 1476 ----
NM_018307chr17139 ------
NM_018313chr352554 870 690 520 493 11709 ----
NM_018321chr5167 ------
NM_018325chr921645 1493 --1424 --
NM_018330chr1011490 --1512 --
NM_018339chr931772 1546 362 ------
NM_018351chr12114700 4653 4355 4278 4208 3749 3390 3083 1637 1153 597 2539 342 --13969
NM_018361chr864002 3787 3478 2554 767 179 14078 13687 --
NM_018362chr111141 24018 3281 1947 --
NM_018364chr183753 3633 3397 2983 1191 994 950 149 --11273 --
NM_018367chr1142502 1806 1693 1012 12171 21824 369 1263
NM_018372chr1----3470 216 201 151
NM_018373chr14106231 6136 5231 4660 2450 1222 1150 743 639 442 15529 22533 319 11042
NM_018374chr734855 623 35 --31765 1147 270 --
NM_018383chr242087 2013 1513 596 21968 1328 ----
NM_018387chr9198 1215 ----
NM_018388chrX--1396 ----
NM_018406chr3--2362 28 --1161
NM_018416chr1231909 596 385 1183 1583 --
NM_018429chr531860 628 126 12556 ----
NM_018440chr898592 8498 7413 6904 6156 2327 2114 1094 828 48264 8213 7739 3032 46854 5717 5436 2514 26737 91
NM_018469chr1731132 413 348 ----11521
NM_018471chr2--1442 ----
NM_018477chr1421076 993 ----1916
NM_018482chr81703 1682 12203 --
NM_018490chr1141528 1475 409 316 ------
NM_018557chr241714 1303 100 78 ------
NM_018566chr1105120 4306 3748 3267 1949 1844 1728 1564 1534 1390 31511 1447 36 1219 --
NM_018569chr441404 1358 1325 995 ------
NM_018571chr23494 94 32 ------
NM_018590chr10383 68 62 ------
NM_018638chr12115324 4384 4138 4115 2251 2198 1960 1688 1548 834 184 32019 2001 1559 35365 5270 130 15314
NM_018650chr152069 801 397 187 76 ------
NM_018683chr2041629 1335 631 259 183 ----
NM_018685chr731174 832 148 ------
NM_018693chr22263 97 ------
NM_018695chr532152 376 53 ------
NM_018715chr13672 230 172 11646 ----
NM_018717chr462759 1982 1093 1033 920 825 ------
NM_018719chr71247 11070 ----
NM_018840chr201480 ------
NM_018841chr1103484 3295 2903 2685 2627 1191 1079 470 295 74 33929 3854 2880 1557 --
NM_018847chr941704 1524 541 394 --149 --
NM_018898chr541456 841 691 673 ------
NM_018899chr541456 841 691 673 ------
NM_018900chr541456 841 691 673 ------
NM_018901chr541456 841 691 673 ------
NM_018902chr541456 841 691 673 ------
NM_018903chr541456 841 691 673 ------
NM_018904chr541456 841 691 673 ------
NM_018905chr541456 841 691 673 ------
NM_018906chr541456 841 691 673 ------
NM_018907chr541456 841 691 673 ------
NM_018908chr541456 841 691 673 ------
NM_018909chr541456 841 691 673 ------
NM_018910chr541456 841 691 673 ------
NM_018911chr541456 841 691 673 ------
NM_018945chr653647 2631 2250 478 151 13541 ----
NM_018951chr711200 ------
NM_018972chr872624 2328 2256 1871 1012 453 293 ----11056
NM_018976chr1242527 2192 619 454 ------
NM_018979chr1232608 2194 1789 --21705 871 --
NM_018992chr1671660 1620 1612 1346 472 231 143 ------
NM_018999chr1054823 4038 3263 1674 1515 1928 ----
NM_019001chr3114685 4553 4031 3172 3148 1927 1288 1239 541 64 47 21783 1629 --1226
NM_019004chr732320 485 329 ------
NM_019005chr72357 335 ----178
NM_019008chr2263515 2841 1506 432 401 327 183 13291 --
NM_019030chr51151 ------
NM_019035chr431831 1635 589 2618 211 ----
NM_019036chr62807 337 --1435 --
NM_019044chr284714 4667 4641 4618 4299 3626 579 302 23167 3008 1742 --
NM_019045chrX185 ------
NM_019050chr482225 1979 1641 852 827 744 270 122 ------
NM_019051chr93415 360 78 ------
NM_019058chr10--1280 ----
NM_019063chr281966 1850 1813 1707 1635 1480 839 264 ------
NM_019067chrX104718 3575 3292 3060 1795 1781 1775 1769 1534 751 24056 3923 --13251
NM_019072chr553573 1578 880 854 107 11605 13310 --
NM_019083chr141453 1293 1162 82 31299 1247 159 ----
NM_019084chr1052116 2070 1917 791 764 31979 1867 382 --1910
NM_019087chr531552 1453 1298 ------
NM_019091chr231015 885 150 ------
NM_019094chr12103842 3402 3168 2615 1479 1391 1384 1080 355 224 42502 1348 1154 662 13029 1823
NM_019114chr942532 2127 966 280 1556 11947 11716
NM_019116chr1673666 3340 3103 2808 1318 1284 757 1619 ----
NM_019556chrX41213 252 246 69 --1435 --
NM_019592chr93136 118 69 1643 ----
NM_019593chr2052567 2247 714 403 87 22796 428 ----
NM_019596chr2162876 2400 2328 578 305 25 1988 22316 814 --
NM_019600chr15--1569 1526 --
NM_019604chr1161141 755 477 452 423 231 2308 243 11105 --
NM_019610chr141550 809 504 112 ------
NM_019842chr61139 ------
NM_019903chr1031739 359 307 1288 11809 --
NM_020120chr211248 2387 205 ----
NM_020122chr2125997 5898 5198 4850 4491 4262 4015 1453 1121 551 236 184 25434 362 11899 12207
NM_020123chr1021320 607 --11115 --
NM_020130chr841407 1250 1124 499 199 ----
NM_020144chr752041 1840 1763 1465 263 2735 28 ----
NM_020148chr1842363 1022 967 278 ----11168
NM_020150chr1031639 795 34 22198 1890 21856 1473 1462
NM_020157chr202821 650 1117 11034 --
NM_020159chr471683 1676 1571 1517 670 597 336 ----11596
NM_020177chr522550 328 12929 11182 --
NM_020182chr2033629 3023 554 12223 ----
NM_020189chr8------1176
NM_020193chr1121159 955 ------
NM_020198chr172982 179 1324 ----
NM_020199chr551287 939 891 865 335 1225 ----
NM_020204chr13763 710 292 ------
NM_020231chr35689 497 262 118 99 --2699 91 --
NM_020239chr142239 2188 709 438 1139 1569 12077
NM_020244chr12293 26 ------
NM_020307chr31372 ------
NM_020336chr2073751 3491 3367 2928 2635 2480 1140 1379 11131 --
NM_020337chr432787 2766 74 1135 --21952 845
NM_020338chr1053516 3376 2902 1248 403 13726 ----
NM_020340chr631763 648 404 11521 ----
NM_020341chr202521 350 --11650 --
NM_020342chr242497 2001 1844 714 ------
NM_020346chr1141359 1125 1117 576 21649 1616 1471 --
NM_020357chr321140 269 --11569 --
NM_020382chr1241553 430 165 141 1111 ----
NM_020390chr364496 4227 2998 1899 1706 1004 43163 1655 1168 1031 --24856 1666
NM_020403chr1351737 1298 643 425 114 ------
NM_020420chrY21667 489 1552 11305 --
NM_020423chr1------164
NM_020425chr661910 1897 1503 1368 1275 229 21522 181 12041 --
NM_020432chr741803 1685 655 260 11906 12036 --
NM_020443chr1137027 6757 6379 6074 6056 5266 4653 4238 2589 1859 1464 1441 166 ------
NM_020445chr71629 --1781 --
NM_020449chrX1257 ------
NM_020452chr142163 2121 1329 389 11611 ----
NM_020455chr652857 2744 2716 2415 508 ------
NM_020456chr1332233 2195 172 31743 634 619 ----
NM_020466chr684997 4927 4892 4680 4539 4266 1877 1800 21407 1123 14304 13555
NM_020473chrX21362 122 1659 --11839
NM_020474chr1832039 1792 328 151 --1606
NM_020475chr842348 2293 745 174 --1503 --
NM_020476chr842348 2293 745 174 --1503 --
NM_020477chr842348 2293 745 174 --1503 --
NM_020478chr842411 2356 808 237 --1566 --
NM_020480chr842348 2293 745 174 --1503 --
NM_020532chr22586 238 ------
NM_020546chr562795 2756 2224 1944 1258 939 ------
NM_020638chr1221434 317 11887 ----
NM_020640chr331849 1841 254 1701 --11421
NM_020647chr841570 1448 865 815 1528 ----
NM_020651chr241832 1406 604 268 11543 11446 1438
NM_020673chr20127676 7629 7555 7276 5821 5754 5283 1985 1694 1345 1000 611 26076 5149 15596 --
NM_020699chr144065 3819 1561 270 --24708 4497 --
NM_020715chr1471873 1863 1780 1678 877 654 40 1430 ----
NM_020717chrX54792 3965 3321 1710 612 ------
NM_020718chr1676159 5990 4600 3993 2544 2065 1353 --11651 --
NM_020724chr41964 21070 568 12216 12547
NM_020727chr2163874 2604 2469 1115 1029 463 23528 2451 ----
NM_020728chr732457 2306 2258 11154 --1120
NM_020732chr6----1951 --
NM_020734chr1283202 2846 2544 2156 2148 880 840 302 12604 12122 --
NM_020739chr1583262 2982 1485 1450 1302 623 613 449 1528 ----
NM_020742chrX32530 2469 1737 12087 ----
NM_020749chr841480 1427 499 187 --11769 11695
NM_020751chr1331271 943 448 ------
NM_020752chr1042307 2080 652 476 ------
NM_020766chrX1519 13160 24180 3008 --
NM_020768chr542793 2598 356 243 ------
NM_020769chrX5930 315 184 144 30 1322 ----
NM_020772chr1798306 8013 7591 6496 5535 5248 1166 637 548 15993 25770 1139 --
NM_020774chr18146112 6077 5728 5640 4318 4123 2317 1293 1187 1117 1065 973 843 243 34008 2399 1479 12195 --
NM_020778chr1594627 4521 4458 4236 3999 3338 3207 1789 1663 ------
NM_020782chr12114792 4702 4635 4190 4184 3381 3160 3082 1686 1552 1227 24015 1361 11607 --
NM_020783chr1862182 2120 1543 788 375 100 --1230 --
NM_020787chr1741271 1075 406 230 ------
NM_020794chr151308 1152 583 526 380 1365 ----
NM_020801chr532194 628 48 --1750 --
NM_020808chr11437 1309 ----
NM_020809chr1172162 1661 1589 775 173 126 89 ------
NM_020810chr1442893 2304 966 225 --13041 --
NM_020819chr631207 859 282 136 1109 --
NM_020825chr1693682 3554 2757 2746 1310 1107 603 518 300 11338 11014 --
NM_020830chr293019 2872 2851 2845 2742 2070 1290 1247 899 1234 ----
NM_020834chr1451929 1836 1604 1251 92 1769 ----
NM_020841chr1223110 679 1974 ----
NM_020843chr151163 ------
NM_020850chr1643211 2248 1134 340 23101 2412 ----
NM_020854chr1821533 327 ------
NM_020858chr1531785 412 326 2274 75 12348 1448
NM_020861chr631148 279 233 1506 ----
NM_020870chr442021 1789 1689 423 ------
NM_020871chrX32322 1891 988 ----11734
NM_020872chr361655 1585 1296 644 604 181 1117 11710 1228
NM_020899chr1772507 1934 1915 827 598 491 294 ------
NM_020909chr284028 3970 3698 2802 1669 1039 349 231 1797 11375 --
NM_020918chr1083595 2932 1435 1342 1169 853 830 384 11470 ----
NM_020919chr2------1919
NM_020922chrX51895 1673 742 521 248 1699 ----
NM_020935chr284002 3039 1859 952 755 451 365 272 24257 3808 ----
NM_020940chr1042933 2194 1876 626 12682 ----
NM_020948chr153528 1176 325 263 248 175 1242 --
NM_020951chr1982436 2224 1874 374 368 335 173 91 21746 329 11519 --
NM_020962chr1572300 1778 924 768 495 425 60 1851 ----
NM_020964chr18104760 4672 4638 3963 3892 3089 2951 1905 872 755 23902 3480 14385 --
NM_020975chr1031720 1623 168 ------
NM_020977chr432155 540 395 ------
NM_020988chr1621316 1295 ------
NM_021007chr242064 1816 619 125 ------
NM_021033chr1352809 2642 2160 1164 945 --1157 --
NM_021069chr462013 1936 1803 1737 223 93 11634 --12109
NM_021072chr562376 1849 1831 1697 179 77 ------
NM_021083chrX31250 843 801 13009 --12975
NM_021088chr221467 465 21632 816 ----
NM_021090chr2284925 4418 3792 3756 3479 2004 1562 193 --13492 --
NM_021097chr272134 1994 1075 758 681 600 571 13064 12427 --
NM_021109chrX162 ------
NM_021109chrX162 ------
NM_021111chr911115 --11161 --
NM_021116chr789072 8923 7043 6601 6257 1943 1743 627 47256 6868 5584 1648 17969 --
NM_021127chr1841074 1066 981 481 11376 ----
NM_021140chrX3936 244 85 1208 ----
NM_021148chr772122 919 592 320 175 165 125 21544 946 ----
NM_021155chr1952394 2049 1072 655 211 1682 1136 12934
NM_021183chrX71863 874 831 513 453 440 385 ------
NM_021190chr121227 1070 1548 ----
NM_021205chr162682 2430 993 477 279 196 1826 --12665
NM_021215chr2042056 781 326 298 12166 ----
NM_021219chr211242 ------
NM_021227chr42544 124 ------
NM_021237chr31227 ------
NM_021238chr1252072 1914 1502 323 42 1190 1818 --
NM_021249chr1421067 336 31666 1631 1385 ----
NM_021252chr1021939 230 21358 622 ----
NM_021255chr1474073 3016 2652 1455 446 236 75 23532 3026 ----
NM_021572chr651301 791 505 438 177 1316 ----
NM_021622chr1042325 458 115 29 12152 --22257 221
NM_021629chr384696 4431 4013 3899 1512 1316 1050 36 24360 83 23498 480 24709 3655
NM_021639chr11897 ----1105
NM_021644chr102235 188 ------
NM_021647chr464069 3969 3208 3185 590 291 23928 550 33801 3146 2971 24487 278
NM_021722chr7--255 43 ----
NM_021723chr7--143 ----
NM_021728chr141747 ------
NM_021813chr695703 5529 5474 5452 5337 4527 4109 2220 187 1346 --1500
NM_021814chr631677 1361 416 11534 11316 --
NM_021818chr1431410 947 335 --11309 --
NM_021911chr545364 3624 3415 909 ----21307 116
NM_021912chr1553839 1641 1193 360 77 23994 515 13936 11667
NM_021914chr1472130 1967 1944 647 617 343 221 1590 22087 261 12453
NM_021940chr621245 618 --1347 21499 1338
NM_021942chr41200 ----2844 155
NM_021947chr1751331 1177 503 270 165 11147 ----
NM_021954chr1393240 3032 2756 2696 2567 1292 804 462 452 ------
NM_021956chr611206 1111 ----
NM_021959chr63836 829 63 ------
NM_021960chr142212 614 558 549 --1515 --
NM_021961chr11117423 7147 6641 6624 6278 5095 4964 2529 2438 1418 28 14554 --24672 1305
NM_021964chr384958 4308 2480 2466 1848 1058 659 418 14785 16621 --
NM_021970chr4184 128 ----
NM_021977chr693653 3316 3200 3187 3170 3089 2856 1183 1134 ------
NM_021979chr141413 ------
NM_021998chrX51399 608 471 295 261 11273 ----
NM_021999chr131611 1161 ----
NM_022037chr231023 814 218 1708 ----
NM_022041chr1682734 2618 2285 2092 1779 1668 755 469 --12653 --
NM_022048chr1586202 6189 4455 2378 2372 1606 988 53 12018 36120 5826 4176 --
NM_022068chr181163 --1633 --
NM_022073chr1421640 114 31191 627 153 2532 345 --
NM_022080chr2032355 2307 78 22845 250 ----
NM_022085chr661601 1321 1254 1180 1006 614 --2571 532 --
NM_022091chr652014 848 731 678 578 2958 398 11733 --
NM_022118chr131151 1194 1254 --
NM_022124chr101200 ------
NM_022130chr551003 519 478 429 294 ------
NM_022132chr5--2424 135 ----
NM_022133chr83748 723 662 --1414 --
NM_022136chr213440 158 24 ------
NM_022154chr441082 1027 241 213 --11045 --
NM_022166chr1675609 5522 4961 4796 2350 489 478 55485 4633 4599 4590 1655 ----
NM_022173chr231023 814 218 1708 ----
NM_022351chr853285 2974 2943 1486 844 1371 11330 --
NM_022373chr72693 177 1900 ----
NM_022456chr12157496 7452 7416 5288 5154 4907 3060 2978 2879 2377 2107 1649 1489 1224 22 --22749 504 13004
NM_022458chr763146 2810 2535 2133 2043 661 1806 12612 --
NM_022459chr13105657 5195 4655 4358 4003 2263 2078 1800 1105 817 15122 ----
NM_022461chr341192 362 299 42 ----11208
NM_022462chr1963497 3323 2637 358 304 275 51131 996 697 285 147 13242 --
NM_022465chr1232104 1212 486 1504 32696 560 524 --
NM_022474chr1442150 1849 503 320 1222 ----
NM_022475chr41568 --1251 --
NM_022476chr161187 ------
NM_022484chr731108 333 108 --21298 100 --
NM_022496chr123456 121 83 ------
NM_022497chr373861 3819 3580 2915 1497 982 628 ------
NM_022552chr2----1408 --
NM_022566chr154594 470 416 51 ------
NM_022650chr521029 967 --1301 --
NM_022652chr124981 938 814 808 ------
NM_022658chr1231250 167 145 ------
NM_022726chr611580 11474 11780 --
NM_022731chr11223 ------
NM_022735chr141737 1409 1393 179 1104 ----
NM_022753chr142761 1131 504 281 1368 32495 877 742 --
NM_022756chr191467 1384 1378 1164 1088 532 516 499 414 ------
NM_022757chr32980 415 ------
NM_022763chr353160 1246 894 813 288 23001 1257 --11021
NM_022781chr943179 2166 979 935 23051 371 ----
NM_022782chr12------1150
NM_022818chr1631498 1290 262 ------
NM_022826chr27960 448 397 299 288 142 89 --11029 --
NM_022828chr541789 1687 1499 37 1717 ----
NM_022836chr161736 1430 727 628 571 217 ----11817
NM_022838chrX188 --1259 --
NM_022845chr1662086 1849 889 405 248 180 ------
NM_022893chr242848 2684 2347 2091 ------
NM_022898chr1474514 4005 3872 1284 962 402 76 11314 13513 --
NM_022901chr921792 1586 --11636 --
NM_022902chr51297 ------
NM_022912chr253063 2283 1923 493 425 137 ----
NM_022918chr1142125 2117 1886 1353 1562 11403 --
NM_022965chr451382 1283 568 547 196 ------
NM_022977chrX42279 2144 650 278 11868 1370 1533
NM_023000chr1421175 120 11685 11222 --
NM_023001chr1421175 120 11685 11222 --
NM_023016chr2102790 2642 2615 2466 2299 1160 807 696 336 208 --1197 --
NM_023039chr5139 187 1454 --
NM_023079chr1761849 1395 1294 392 247 89 ------
NM_023105chr842305 1881 541 457 11939 11715 --
NM_023106chr842305 1881 541 457 11939 11715 --
NM_023110chr842305 1881 541 457 11939 11715 --
NM_023111chr842305 1881 541 457 11939 11715 --
NM_023923chr153430 3021 940 544 488 23706 2704 13715 --
NM_023929chr862406 2184 2023 1797 1099 882 1700 --1910
NM_024007chr593181 2100 2031 1062 995 736 630 587 214 12255 ----
NM_024016chr172791 172 ------
NM_024045chr10----1182 --
NM_024052chr1732728 919 73 2556 253 32462 2247 1990 --
NM_024054chr72349 268 ------
NM_024057chr121110 ------
NM_024061chr73554 408 79 ------
NM_024090chr421321 496 --1685 --
NM_024329chr121556 124 ------
NM_024332chrX1598 11503 ----
NM_024345chr975019 4975 4545 2454 1561 851 506 14940 24744 4676 25701 1947
NM_024408chr143081 3045 1025 740 13309 ----
NM_024416chr931566 1352 1285 1106 --11517
NM_024422chr1831223 653 388 ------
NM_024423chr1844233 4123 2792 1225 ------
NM_024524chr373019 2866 2612 2370 2166 356 216 1955 12041 --
NM_024529chr11137 11069 ----
NM_024539chrX2475 378 ------
NM_024546chr1361158 1036 1000 316 159 66 ------
NM_024548chr331282 1251 49 1348 ----
NM_024551chr1232316 949 668 --1688 1189
NM_024551chr1232316 949 668 --1688 1189
NM_024556chr111394 ------
NM_024558chr142966 691 ------
NM_024561chr1321353 564 --11096 --
NM_024563chr531832 160 56 11838 1675 --
NM_024582chr411047 --1309 --
NM_024586chr12436 25 1122 ----
NM_024607chr864367 3716 2863 1600 969 489 24504 4326 11321 --
NM_024611chr152664 561 23594 895 2658 507 12484
NM_024613chr841735 531 481 463 1136 1621 --
NM_024624chr251577 1328 1176 522 315 ------
NM_024626chr141532 1352 1266 117 11185 11441 --
NM_024635chr91134 ------
NM_024639chr662443 2408 2162 2047 696 376 12828 --12001
NM_024646chr173945 3802 3276 1171 696 429 66 --12709 12602
NM_024652chr15------1864
NM_024659chr22895 803 ------
NM_024665chr333540 3225 3004 11207 23203 1616 --
NM_024666chr151242 11362 2551 55 --
NM_024674chr153159 3032 2584 2173 259 32200 912 113 ----
NM_024675chr162187 85 ------
NM_024689chrX81746 1229 1134 709 535 485 320 198 --1516 --
NM_024692chr2------21628 537
NM_024700chr13965 814 218 1785 1112 --
NM_024704chr202156 98 ----1882
NM_024713chr1551620 1272 1089 590 551 ------
NM_024721chr831060 755 741 --1936 --
NM_024725chr112829 103 ------
NM_024744chr21168 21969 508 ----
NM_024745chr1631142 454 303 ------
NM_024749chr12854 676 21590 453 11884 1320
NM_024755chr152894 360 ------
NM_024761chr974562 4428 4235 4139 3967 1778 1696 11659 11352 --
NM_024770chr276765 6589 4874 4768 4536 540 182 15085 ----
NM_024786chr52966 88 ------
NM_024787chr83727 397 190 143 1825 1857
NM_024811chr1141372 780 583 526 1569 ----
NM_024817chr1555903 5391 5042 4106 136 11156 ----
NM_024818chr321168 128 --11180 --
NM_024834chr1041687 1333 752 683 1179 ----
NM_024847chr1621144 947 --1805 1850
NM_024852chr11504 1170 --1489
NM_024854chr1231345 487 196 --1434 --
NM_024884chr1474407 4123 3256 1078 1008 468 194 21171 1035 11797 --
NM_024899chr182136 28 --1695 1121
NM_024911chr1------2775 102
NM_024913chr761719 1098 702 534 379 238 ----11263
NM_024920chr441531 1358 1253 1030 11618 21368 23 --
NM_024921chrX42012 1647 730 610 --1707 --
NM_024930chr572665 2626 2223 2087 1754 929 751 --1787 --
NM_024944chr2121218 406 ------
NM_024947chr3128508 8206 8017 7091 6631 6543 3658 3428 3393 1294 1173 931 27413 3278 21810 1131 --
NM_024949chr433258 1333 173 11043 13528 --
NM_024953chr1252557 1982 937 854 447 --12146 --
NM_024989chr277551 6454 2990 2428 1896 1833 1501 22290 1958 15540 --
NM_024991chr1042756 2593 2528 807 12246 22375 333 12396
NM_025004chr113632 538 189 ------
NM_025027chr1931142 826 267 ------
NM_025047chr32477 156 ------
NM_025054chr894149 4040 3826 3737 3315 3200 1465 555 121 13000 ----
NM_025057chr1431116 954 72 ----11322
NM_025074chr452727 2698 2510 2455 638 22078 158 --12608
NM_025114chr124122 114 108 61 ------
NM_025134chr163788 636 326 1590 --1922
NM_025146chr382673 2551 2269 1942 951 623 577 159 12031 ----
NM_025152chr141666 12014 ----
NM_025154chr741485 1074 575 190 11110 ----
NM_025160chr153625 3606 3255 2694 1136 13379 ----
NM_025179chr1134892 3259 3211 1891 1637 1454 1376 1364 1357 1184 815 497 295 23632 988 ----
NM_025191chr122803 901 12544 1737 --
NM_025195chr861691 1565 1557 1479 642 241 ----11524
NM_025211chr9----1224 --
NM_025214chr1872773 2747 2685 2589 2233 966 544 32534 2345 636 1833 11978
NM_025234chr152172 66 ------
NM_025235chr1011848 --1698 1519
NM_025238chr1511035 --11446 11517
NM_025244chr2--1248 ----
NM_030579chr1683641 3235 3177 3151 1221 337 323 198 23543 2827 ----
NM_030621chr1484208 3889 3798 3259 3020 1481 1129 773 12924 23524 1469 11363
NM_030623chr241725 1445 1288 469 --11418 1613
NM_030627chr523405 382 --13211 11026
NM_030629chr1621930 1530 --11430 11739
NM_030634chr162358 2332 2184 1562 793 180 1221 ----
NM_030640chr122866 640 2604 585 1194 --
NM_030647chr786231 5127 4394 1987 1373 1096 1081 896 32531 1948 696 11733 21073 420
NM_030648chr4105387 5139 5064 4651 4637 3868 3754 859 829 756 24320 3713 14877 --
NM_030650chr2104161 4119 3793 3085 2793 2713 1316 1255 868 254 22668 417 --11426
NM_030660chr142451 33 ------
NM_030664chr105948 860 615 240 174 ------
NM_030670chr122360 269 11552 1492 11502
NM_030671chr122360 269 11552 1492 11502
NM_030674chr12114096 3876 2080 1920 1238 1077 995 857 706 408 119 11118 24684 3681 24951 4465
NM_030762chr1261868 1701 1541 1340 667 336 11395 ----
NM_030780chr851559 1537 332 204 28 1606 11615 11197
NM_030786chr11490 21788 661 --11768
NM_030791chr1451464 1334 569 344 314 ------
NM_030797chr22195 86 ------
NM_030799chr521887 145 1847 ----
NM_030803chr221313 809 ----1287
NM_030809chr1241786 1736 195 22 11831 --1450
NM_030810chr661601 1321 1254 1180 1006 614 --2571 532 --
NM_030816chr193502 3301 3283 3235 663 362 356 350 344 ------
NM_030885chr342268 2165 903 167 12103 168 --
NM_030918chr134552 1904 1279 14682 21397 689 12178
NM_030920chr132094 1817 466 --11400 --
NM_030923chr21158 1498 ----
NM_030934chr151787 1201 688 599 580 1764 1528 --
NM_030938chr172160 145 ----1928
NM_030939chr621107 363 1168 ----
NM_030949chr61437 2334 60 ----
NM_030964chr573368 2501 2359 645 585 462 341 --33158 2805 494 --
NM_031216chr1811395 --11763 --
NM_031243chr752240 2223 1882 1590 244 2212 115 1686 --
NM_031262chr91974 ------
NM_031263chr911031 ------
NM_031267chr71451 ------
NM_031268chr1675342 4660 3715 3365 3322 3271 1495 ------
NM_031296chr442422 719 409 46 22334 896 ----
NM_031302chr12192 --1149 --
NM_031305chr471742 1670 1440 1242 717 504 151 ------
NM_031314chr1412063 1718 1249 21416 1378
NM_031362chr242798 2155 2020 965 ----1832
NM_031365chr242934 2291 2156 1101 ----1968
NM_031366chr242934 2291 2156 1101 ----1968
NM_031369chr4----1582 --
NM_031370chr4----1582 --
NM_031372chr411418 ------
NM_031411chr541456 841 691 673 ------
NM_031419chr361576 1354 1233 1196 558 175 ------
NM_031422chr18134 ------
NM_031427chr14135671 5652 5373 5131 5063 5056 4287 4151 3801 2268 1542 589 441 23614 563 15860 --
NM_031442chrX52937 2801 2590 1247 968 3996 660 322 12918 12986
NM_031445chr273385 3311 2730 2248 173 143 94 2847 211 172 --
NM_031453chr1041876 1613 513 160 11633 ----
NM_031461chr81902 12040 22067 1820 --
NM_031469chr6114103 4024 3390 2845 2588 1502 1235 1100 1033 729 587 21241 235 23705 2708 --
NM_031476chr1642819 2703 2179 837 12281 11979 --
NM_031483chr2063446 3326 3276 2496 758 149 13542 ----
NM_031844chr153508 3226 973 936 320 ------
NM_031845chr252556 1442 1401 826 297 23470 1153 2840 815 12842
NM_031847chr252556 1442 1401 826 297 23470 1153 2840 815 12842
NM_031849chr541456 841 691 673 ------
NM_031850chr33811 761 709 --1818 --
NM_031850chr33811 761 709 --1818 --
NM_031857chr541456 841 691 673 ------
NM_031858chr1741017 557 362 142 ------
NM_031860chr541456 841 691 673 ------
NM_031862chr1741017 557 362 142 ------
NM_031889chr471610 1476 1363 671 513 330 255 ------
NM_031935chr15984 307 244 184 149 1960 ----
NM_032025chr351752 1668 1484 655 185 1643 ----
NM_032028chr51618 ------
NM_032042chr552794 2761 2594 2191 2183 ------
NM_032047chr352304 1868 1543 677 286 1178 1610 --
NM_032049chr33811 761 709 --1818 --
NM_032049chr33811 761 709 --1818 --
NM_032102chr1182921 2419 2170 1934 1243 736 471 131 ------
NM_032116chr13185821 5082 4891 4641 4619 4493 3840 3694 3683 2358 2332 2174 1538 1034 916 846 587 544 25150 579 ----
NM_032121chrX82192 2042 1839 1099 726 476 411 103 ------
NM_032128chr421039 819 ------
NM_032144chr241740 1125 669 228 1156 11559 --
NM_032145chr661961 1770 1520 1217 605 523 21493 598 ----
NM_032147chr124791 235 124 45 1220 ----
NM_032160chr1873993 3912 3590 3256 1686 1403 38 11644 22806 1525 --
NM_032182chr1051652 1196 384 368 170 --1526 1105
NM_032186chr12296 152 1486 11452 11418
NM_032195chr214498 485 466 205 ------
NM_032199chr1033603 3567 157 11001 ----
NM_032208chr263118 2628 2566 1373 1224 391 --23563 1126 --
NM_032226chr93872 834 308 ------
NM_032228chr1143465 3046 879 345 --12997 --
NM_032229chr132472 391 21027 447 158 --
NM_032246chr153482 218 84 11337 ----
NM_032271chr161334 --11492 --
NM_032283chr111819 ------
NM_032288chr331743 1595 198 190 ----
NM_032291chr141565 1357 191 98 ------
NM_032303chr931783 1278 434 ------
NM_032312chr23852 688 352 --2937 609 --
NM_032316chr321877 111 1170 ----
NM_032321chr2113003 2764 2750 2422 2137 2079 2009 1073 729 492 168 22449 828 ----
NM_032329chr234126 102 87 --11521 --
NM_032345chr121112 ------
NM_032352chr1431239 361 211 21272 32 --1525
NM_032373chr10125861 5007 3910 3624 1727 1521 1035 789 742 436 381 136 24343 1279 ----
NM_032380chr51410 146 ----
NM_032410chr851269 993 792 265 117 11127 2836 48 --
NM_032420chr51348 ------
NM_032424chr1131586 509 149 1222 21541 414 --
NM_032434chr211316 11121 ----
NM_032435chr182053 1928 1872 1692 913 312 275 67 ----11514
NM_032438chr641656 1198 1192 387 ------
NM_032439chr1021288 1275 ------
NM_032440chr1052615 2200 1042 726 689 2801 252 12144 1871
NM_032445chr1552604 2552 1661 783 523 11825 ----
NM_032446chr543459 2839 2601 2439 1421 13802 --
NM_032457chr433857 2678 136 ----11481
NM_032458chrX22942 2341 ----13185
NM_032466chr821617 529 --11269 --
NM_032468chr821617 529 --11269 --
NM_032471chr62944 206 ------
NM_032503chr63938 883 877 ------
NM_032509chr842190 1701 1018 466 ------
NM_032521chr2063107 2583 1212 1028 958 730 22639 985 22176 79 12307
NM_032557chr45729 394 261 193 80 ----1113
NM_032558chr921440 441 --1235 --
NM_032576chrY1351 --1111 --
NM_032582chr1751616 1481 1458 1312 429 11223 ----
NM_032590chr1211072 ------
NM_032622chr431573 1459 1423 --1573 --
NM_032632chr1421619 31 ----1508
NM_032664chr831629 545 264 --21407 1301 --
NM_032682chr322854 699 ----12717
NM_032778chr332371 1322 23 --41259 1084 495 424 --
NM_032784chr64982 816 797 196 144 ----
NM_032801chr1112002 1474 148 --
NM_032804chr1071993 1841 1676 1601 968 402 299 22600 840 1699 12258
NM_032812chr10----168 --
NM_032828chr19134565 4501 3940 3067 1941 1929 1885 1859 1790 1390 1071 878 808 74787 4111 3095 1747 971 835 246 --14486
NM_032833chr12796 38 11707 --1977
NM_032837chr1752129 1893 1630 498 104 ------
NM_032846chr1461456 1355 1295 551 522 411 ------
NM_032859chr1393960 3453 2984 1556 983 973 543 233 88 --13594 --
NM_032860chr62273 186 ------
NM_032861chr641150 505 448 401 11540 ----
NM_032866chr1563163 2894 2435 602 211 27 2763 629 ----
NM_032869chr862002 1958 369 251 107 51 ------
NM_032873chr1154119 3239 3162 1224 432 13459 --13930
NM_032900chr1053355 2817 2524 583 516 --2876 151 --
NM_032932chr1796378 5528 5458 5330 3911 710 671 574 350 21256 1236 ----
NM_032968chrX83987 3145 2711 2686 2634 858 400 381 1594 21565 1487 --
NM_032969chrX83987 3145 2711 2686 2634 858 400 381 1594 21565 1487 --
NM_032973chrY83979 3140 2706 2681 2633 858 400 381 1594 21564 1487 --
NM_032998chr1--1244 1359 --
NM_032999chr731150 354 84 11109 2347 102 --
NM_033000chr731150 354 84 11109 2347 102 --
NM_033001chr731150 354 84 11109 2347 102 --
NM_033014chr931566 1352 1285 1106 --11517
NM_033020chr154440 759 618 356 337 13196 ----
NM_033023chr731243 821 301 ------
NM_033030chr231235 443 434 --1615 1128
NM_033044chr121301 194 31231 1098 391 ----
NM_033084chr33506 148 76 1693 ----
NM_033089chr2031023 488 134 --1338 --
NM_033121chr121498 --21650 1200 --
NM_033132chr1362290 912 755 581 465 455 --1748 --
NM_033133chr1783375 3339 3066 2595 958 947 691 301 --13112 --
NM_033136chr541802 1454 1412 445 ----11494
NM_033137chr541802 1454 1412 445 ----11494
NM_033138chr732218 886 576 ----11546
NM_033139chr732218 886 576 ----11546
NM_033140chr732218 886 576 ----11546
NM_033143chr454084 1232 771 436 44 --34327 1324 159 34220 945 52
NM_033157chr732218 886 576 ----11546
NM_033161chr951964 1844 1476 1417 1332 ------
NM_033167chr32392 39 31694 548 503 ----
NM_033168chr32392 39 31694 548 503 ----
NM_033169chr32392 39 31694 548 503 ----
NM_033181chr693836 3762 3738 3363 2940 2541 992 725 328 1674 1621 --
NM_033211chr541679 1560 389 371 1577 ----
NM_033222chr92478 354 --11164 --
NM_033224chr7127655 7619 7196 6679 6074 6017 5709 5228 2462 2123 1710 1158 56706 6231 5689 5021 1269 ----
NM_033228chr5----187 --
NM_033261chr102598 163 ------
NM_033274chr533573 3191 163 ------
NM_033281chr52216 209 --1930 --
NM_033285chr873952 3747 3185 2810 1423 1193 181 --13045 --
NM_033290chrX43588 3068 2744 634 ----11148
NM_033340chr1021257 372 1108 1972 --
NM_033360chr1274311 3394 3271 3108 411 366 344 23957 256 --13306
NM_033380chrX2801 758 1171 --11086
NM_033381chrX2801 758 1171 --11086
NM_033389chr1734633 4524 3651 34066 3374 1506 ----
NM_033394chr21139 11132 ----
NM_033425chr1173157 3032 2680 2183 846 645 173 ------
NM_033427chr73810 705 318 --176 --
NM_033429chr15--32404 2212 373 ----
NM_033430chr484080 3863 3738 1609 1411 1052 105 58 --13882 --
NM_033437chr484080 3863 3738 1609 1411 1052 105 58 --13882 --
NM_033449chr531675 258 219 11818 ----
NM_033484chr51561 --137 --
NM_033505chr296041 5699 5434 4460 2693 2208 1967 1055 833 24647 2014 11735 14905
NM_033512chr873098 2494 2111 2029 238 156 26 --11110 --
NM_033535chr43920 790 190 129 ----
NM_033540chr341031 977 930 110 1904 --11114
NM_033542chr2081829 1558 1504 1414 429 398 338 292 ------
NM_033631chr143373 1388 1300 560 ------
NM_033637chr1053804 3664 2820 1664 25 11094 13300 --
NM_033642chrX41062 1007 275 43 ------
NM_033644chr53891 742 70 12529 1587 --
NM_033645chr53891 742 70 12529 1587 --
NM_033656chr2195126 4570 4369 4179 4122 2394 1853 1235 499 15557 13776 15689
NM_044472chr11736 ------
NM_052832chr842776 2365 577 344 22341 2104 ----
NM_052840chr1531006 382 311 --11158 --
NM_052849chr15--1661 ----
NM_052851chr1372037 1704 1668 887 558 316 117 12368 2827 366 12351
NM_052860chr53998 978 139 1687 1718 --
NM_052879chr1242908 2560 1217 604 ------
NM_052882chr193669 308 199 ------
NM_052885chr12104614 4283 3640 1621 751 563 536 475 251 136 11986 24772 685 14713
NM_052886chr841985 1679 804 787 ------
NM_052900chr831484 1172 387 11335 1559 --
NM_052907chr1244057 3189 2874 35 --1189 11509
NM_052911chr1831024 917 820 ------
NM_052913chr641048 998 982 861 ------
NM_052917chr293240 3021 2869 2854 2831 2569 2512 478 358 --23062 989 --
NM_052918chr1083398 3177 2779 2712 2600 2532 1001 880 13527 ----
NM_052927chr542122 1474 732 396 ------
NM_052932chr1141986 1879 920 443 11937 ----
NM_052936chrX1632 ------
NM_052937chr851842 1833 696 635 24 1454 ----
NM_052953chr3172 ------
NM_052954chr2151949 1539 1474 281 101 --159 11864
NM_053016chr9147799 7543 7241 6601 6342 6292 5703 5209 3144 2706 2589 2539 445 416 11721 21947 1338 --
NM_053023chr1133245 2958 2684 12575 --12613
NM_053025chr331684 1281 161 11375 ----
NM_053026chr331684 1281 161 11375 ----
NM_053027chr331684 1281 161 11375 ----
NM_053028chr331684 1281 161 11375 ----
NM_053031chr331684 1281 161 11375 ----
NM_053032chr331684 1281 161 11375 ----
NM_053043chr766225 4554 4371 1730 1279 1271 24679 1722 14640 --
NM_053056chr1132544 2128 2020 12879 --12220
NM_053064chr1412711 1902 52868 2394 1890 955 929 --
NM_053275chr12163 ------
NM_054033chr22523 441 ------
NM_054035chr172702 267 ------
NM_054111chr61115 ------
NM_057169chr1273025 2714 2575 2554 2045 636 483 2624 459 ----
NM_057170chr1273025 2714 2575 2554 2045 636 483 2624 459 ----
NM_057175chr441944 1026 173 42 12353 1989 2380 248
NM_057178chr1742200 2050 175 155 22737 1917 ----
NM_057180chr122386 374 ------
NM_057749chr8--1370 ----
NM_058163chrX------1739
NM_058170chr131295 1238 610 ----11626
NM_058172chr411146 11385 --1638
NM_058237chr141695 ------
NM_058241chr252269 1862 1612 397 180 ----1303
NM_058241chr252269 1862 1612 397 180 ----1303
NM_078469chr1051246 557 385 338 283 ----1244
NM_078485chr63315 122 97 ------
NM_078487chr963275 2790 2740 2045 281 220 12879 ----
NM_078629chrX1595 ------
NM_078630chrX1595 ------
NM_080491chr1163558 3233 2843 1364 416 267 --22959 241 --
NM_080546chr951839 1652 1452 371 303 --1182 --
NM_080552chr201679 ------
NM_080617chr2051044 1026 916 788 223 ------
NM_080645chr631838 1734 1584 ------
NM_080654chr1161041 495 460 416 396 204 1950 11197 --
NM_080672chr201480 ------
NM_080676chr2073170 3136 2230 1320 1246 1216 874 ------
NM_080678chr2--1241 ----
NM_080683chr42500 380 1567 ----
NM_080684chr42500 380 1567 ----
NM_080685chr42500 380 1567 ----
NM_080743chr652587 2527 2021 909 814 --1334 --
NM_080759chr132640 580 --11632 --
NM_080760chr132640 580 --11632 --
NM_080764chr2252615 2439 1292 791 677 32797 2021 546 13121 --
NM_080840chr202488 91 ------
NM_080841chr202488 91 ------
NM_080867chr1454556 4440 1818 998 247 23675 1850 11796 --
NM_080872chr853534 3320 1122 1082 216 ------
NM_080874chr451820 1195 1160 717 212 --126 11578
NM_080927chr393237 2812 2635 2414 2196 1307 1258 988 394 --22278 1273 --
NM_130386chr181459 ------
NM_130387chr3----21156 218 --
NM_130391chr943526 3464 2460 678 12274 13015 1260
NM_130392chr943526 3464 2460 678 12274 13015 1260
NM_130393chr943526 3464 2460 678 12274 13015 1260
NM_130435chr1082729 2039 867 810 329 245 124 90 ------
NM_130438chr2133096 2488 2307 --1354 --
NM_130439chr1071863 1781 1763 1477 819 169 129 ------
NM_130439chr1071863 1781 1763 1477 819 169 129 ------
NM_130440chr111539 ------
NM_130469chr141694 ------
NM_130768chr72284 277 ------
NM_130798chr15165 21211 416 11359 1276
NM_130808chr31387 --166 --
NM_130811chr201160 ------
NM_130830chr383207 2716 1408 1244 1007 946 137 69 ------
NM_130847chr11114753 4397 2272 1930 1625 1612 1535 1243 783 388 296 --15063 --
NM_133263chr5------238 30
NM_133265chrX53211 3006 1284 1171 199 13239 11206 --
NM_133266chr1121182 364 ------
NM_133329chr241738 1701 668 486 --1570 --
NM_133330chr432912 1223 744 12846 12233 --
NM_133331chr432912 1223 744 12846 12233 --
NM_133335chr432912 1223 744 12846 12233 --
NM_133338chr52459 450 265 31 ----
NM_133339chr52459 450 265 31 ----
NM_133340chr52459 450 265 31 ----
NM_133341chr52459 450 265 31 ----
NM_133342chr52459 450 265 31 ----
NM_133343chr52459 450 265 31 ----
NM_133344chr52459 450 265 31 ----
NM_133367chr673246 3080 2878 2848 2417 635 285 13126 22925 673 --
NM_133370chr443200 2838 946 503 11117 ----
NM_133433chr52603 249 ------
NM_133445chr942919 2814 1064 786 12422 12619 --
NM_133468chr731960 1872 494 ------
NM_133478chr231728 600 393 12441 12514 --
NM_133486chrX--1425 ----
NM_133496chr1114355 4011 3787 3647 3419 3358 3148 2834 1318 1080 560 1788 1195 11712
NM_133631chr311136 --155 1244
NM_133636chr4172 ------
NM_133638chr52311 277 --11274 --
NM_133642chr221120 1951 ----
NM_133646chr285403 5204 4804 1823 772 564 435 317 25144 65 11023 --
NM_133647chr1573445 3257 2592 2403 1512 580 152 33457 2619 1188 --1644
NM_134424chr1231246 1116 432 1369 1235 21004 849
NM_134447chr192458 180 ------
NM_138286chr1963623 3583 1398 353 234 198 11221 ----
NM_138288chr1441711 1471 1381 816 11733 12203 12254
NM_138297chr3--2362 28 --1161
NM_138316chr1041344 1019 994 405 11099 ----
NM_138335chr43718 649 165 ------
NM_138348chr5125274 4992 4911 4873 4220 2529 2500 2427 1764 579 277 257 34246 2186 1620 14058 --
NM_138357chr1061858 1839 1187 626 547 110 1232 1636 --
NM_138396chr12--2777 292 ----
NM_138426chr72128 107 1514 11939 --
NM_138459chr672568 2508 1366 1124 1076 560 330 ------
NM_138468chr2156318 6093 5869 4790 4272 4097 3873 2339 2003 1074 1013 972 906 767 183 34711 2163 978 25560 5013 --
NM_138473chr12135087 4500 4365 3981 3949 3798 3628 3527 3465 1923 387 357 188 13701 24473 506 --
NM_138494chr752835 2581 2331 491 377 ----1294
NM_138554chr942710 2490 2136 2062 1273 ----
NM_138565chr111162 ------
NM_138576chr1474514 4005 3872 1284 962 402 76 11314 13513 --
NM_138621chr252718 834 674 547 163 ------
NM_138638chr1472130 1967 1944 647 617 343 221 1590 22087 261 12453
NM_138713chr16157841 7159 6146 5710 5636 5556 5490 5011 3001 2977 2571 2448 1932 1385 857 ------
NM_138714chr16157841 7159 6146 5710 5636 5556 5490 5011 3001 2977 2571 2448 1932 1385 857 ------
NM_138717chr62676 558 1216 ----
NM_138731chr1473571 3373 3281 2979 1073 342 276 12829 1793 1270
NM_138735chr211051 1161 11574 --
NM_138771chr731458 1195 95 ------
NM_138799chr221393 666 ----11614
NM_138970chr1411935 --12140 --
NM_139012chr63894 853 87 --1460 --
NM_139035chrX1502 ------
NM_139048chr331265 426 50 ----1803
NM_139057chr1552590 2466 551 520 259 22251 925 ----
NM_139076chr441286 958 943 498 21170 162 ----
NM_139126chr64871 765 331 190 --1743 --
NM_139131chr111605 --1440 --
NM_139155chr1011198 ----1213
NM_139168chr5--21529 509 11450 --
NM_139207chr1242077 1369 898 720 --1315 11619
NM_139244chr61950 1145 --1808
NM_139276chr1751921 1722 1570 369 136 22306 1771 ----
NM_139283chr1242474 2254 1782 192 ------
NM_139319chr1221339 57 ------
NM_139321chr2083679 3334 3147 3106 1702 523 506 218 ------
NM_139323chr2031839 1788 1630 ------
NM_144571chr4116986 6344 6070 4689 4240 2105 1911 1206 594 427 334 --24801 779 22256 2011
NM_144574chr14--1179 ----
NM_144578chr14115397 5071 4881 4837 4476 4384 1648 1621 1103 730 146 23697 3624 15038 1451
NM_144590chr1052988 2937 2086 1060 282 12699 12684 --
NM_144595chr134806 766 273 265 ------
NM_144600chr1661685 1449 1400 1307 578 305 21513 332 ----
NM_144609chr1731338 1281 945 ------
NM_144610chr172514 393 ------
NM_144632chr272381 2230 2183 1694 1649 918 53 ------
NM_144642chr351411 1364 251 231 170 ------
NM_144643chr41408 ------
NM_144667chr1221050 845 ------
NM_144775chr1764041 3881 3509 1796 1156 1018 54503 4142 3805 3480 3341 11844 --
NM_144778chr132561 326 22678 172 ----
NM_144963chr851093 969 387 265 224 11005 ----
NM_144982chr121802 ------
NM_145049chr551095 906 870 118 34 ------
NM_145055chr1853385 1242 1190 1015 387 12394 ----
NM_145056chr19181 1683 ----
NM_145062chr63157 137 43 ----1168
NM_145117chr1142432 2215 877 219 12922 22774 284 --
NM_145165chr1452402 1177 942 930 838 ------
NM_145206chr1042665 847 820 253 ------
NM_145207chr4125038 4694 4532 4337 3976 3916 3384 3247 1669 1284 1210 987 44505 1968 1529 809 24369 181 --
NM_145251chr141314 --2585 131 --
NM_145259chr2136512 6457 6426 5905 5417 4761 4461 2758 1910 1855 898 811 663 22324 97 11718 --
NM_145263chr412024 42256 1453 755 84 1765 12005
NM_145274chr173935 294 251 ------
NM_145284chrX42529 1931 1805 1703 1282 ----
NM_145305chrX21306 1262 ------
NM_145307chr10104434 4385 4248 3675 3377 3051 2857 1875 1579 809 ----23139 1077
NM_145320chr783568 3373 3104 1434 1145 1008 460 340 1470 13562 --
NM_145321chr783568 3373 3104 1434 1145 1008 460 340 1470 13562 --
NM_145322chr783568 3373 3104 1434 1145 1008 460 340 1470 13562 --
NM_145341chr1031451 253 45 21276 1248 ----
NM_145690chr841676 1480 489 117 2739 27 ----
NM_145698chr1051461 1371 797 469 204 ------
NM_145716chr11156 ------
NM_145735chr1352737 1956 1872 942 883 ----11043
NM_145793chr101377 ----1713
NM_145800chrX----11014 --
NM_145802chrX----1963 --
NM_145808chr763048 2968 2737 2436 879 106 --21926 960 --
NM_145859chr3128 ------
NM_145860chr3128 ------
NM_145891chr1611397 11227 --1159
NM_145892chr1611397 11227 --1159
NM_145893chr1611519 11349 --1281
NM_147156chr1061534 1252 1048 455 379 113 --1389 --
NM_147175chrX41489 1388 662 619 1697 21378 28 --
NM_147223chr252394 1941 1709 1703 743 --1797 1272
NM_147233chr252211 1758 1526 1520 560 --1614 189
NM_148174chr821899 1775 1889 ----
NM_148904chr12436 25 1122 ----
NM_148905chr12436 25 1122 ----
NM_148906chr12436 25 1122 ----
NM_148907chr12436 25 1122 ----
NM_148908chr12436 25 1122 ----
NM_148909chr12436 25 1122 ----
NM_148955chr15126520 5989 5931 5577 4599 4462 2614 2496 2144 1826 1628 949 36041 4922 565 ----
NM_148957chr1321697 402 1457 12676 --
NM_148976chr11179 ------
NM_148977chr1041344 1019 994 405 11099 ----
NM_148978chr1041344 1019 994 405 11099 ----
NM_152233chr1421067 336 31666 1631 1385 ----
NM_152253chr2284331 4138 3635 3345 1434 789 742 580 14337 ----
NM_152261chr1241601 599 404 193 ------
NM_152265chr171465 1452 1246 1141 984 604 555 ------
NM_152271chr821193 998 --1161 --
NM_152275chr221703 733 21584 451 1886 --
NM_152277chr551931 1686 1645 1605 853 ------
NM_152280chr153483 3068 2732 845 612 22957 2897 1854 --
NM_152289chr1961564 1472 1427 1411 1133 67 1224 ----
NM_152300chr1751738 1532 1520 1343 76 --1396 1764
NM_152305chr372258 1713 689 497 262 118 99 32063 1833 297 3795 699 91 --
NM_152308chr164951 862 635 341 ----1177
NM_152330chr1472543 2501 2462 1866 1030 623 91 22187 1912 ----
NM_152352chr1843094 2807 1173 533 1936 1141 --
NM_152388chr243766 2787 2512 640 33009 940 295 13580 --
NM_152398chr4----1135 --
NM_152403chr5----1390 --
NM_152407chr532706 1200 486 31102 858 95 ----
NM_152409chr573191 2984 2758 2201 1315 613 341 ------
NM_152424chrX54678 4589 1673 536 161 23658 1169 14712 --
NM_152446chr142628 99 --1989 --
NM_152448chr151135 --122 1583
NM_152450chr1541965 1322 666 153 --162 --
NM_152470chr1833809 1081 719 33952 1459 1395 1366 --
NM_152520chr241242 1195 231 223 1267 ----
NM_152522chr23766 672 211 1253 1418 --
NM_152529chr2124205 4149 3865 3691 3659 3401 3077 2950 1624 1369 737 728 1627 --14377
NM_152556chr752515 1885 1846 261 147 ------
NM_152581chrX2481 296 ------
NM_152594chr1541677 722 597 164 --12157 --
NM_152606chr192506 223 1294 1130 --
NM_152608chr142450 2163 1622 709 1592 12098 --
NM_152609chr12327 258 1435 11104 --
NM_152621chr41389 1322 ----
NM_152622chr573488 2752 2614 2371 2337 1026 139 32845 1170 720 1276 --
NM_152624chr5117213 5731 2678 2440 2333 2287 1906 781 491 205 78 26904 6857 11343 16247
NM_152629chr962978 2531 1026 928 283 275 1414 ----
NM_152630chrX61109 1097 1033 497 333 187 --11085 --
NM_152641chr122501 117 --2796 642 1946
NM_152660chr12849 746 --1677 --
NM_152666chr14643 204 159 145 ------
NM_152667chr2041375 1011 565 198 ------
NM_152678chr352669 2621 2462 2452 190 ----12041
NM_152682chr461650 1502 592 582 523 233 31662 1161 480 ----
NM_152692chrX1432 --1377 --
NM_152699chr363784 3683 3573 3550 2768 886 32937 2795 129 ----
NM_152707chr102830 177 ----1201
NM_152716chr1181669 1557 1545 1517 1507 559 222 26 11069 1204 --
NM_152723chr113903 296 97 --11037 --
NM_152754chr752731 2691 2486 743 436 --23619 2577 --
NM_152756chr573940 3152 2809 1525 896 405 281 1551 13841 --
NM_152758chr842844 1096 996 59 1782 ----
NM_152789chr73511 460 283 11285 ----
NM_152793chr764409 3840 1432 794 485 162 13426 21289 141 --
NM_152826chr15126520 5989 5931 5577 4599 4462 2614 2496 2144 1826 1628 949 36041 4922 565 ----
NM_152835chr152636 2349 2232 1980 936 12031 ----
NM_152836chr83748 723 662 --1414 --
NM_152837chr83748 723 662 --1414 --
NM_152838chr203988 872 517 --12510 --
NM_152890chr141258 915 505 491 --11216 --
NM_152896chr92189 96 1286 --1851
NM_152903chr1342208 2109 398 75 12692 ----
NM_152924chr1596760 6063 5784 4839 4555 4362 2158 2059 1540 26042 1809 ----
NM_152989chr121550 11860 ----
NM_152991chr113537 239 174 ------
NM_152994chr22634 419 ------
NM_152998chr71254 ------
NM_153013chr572263 2099 1958 1901 1811 854 423 21768 51 21647 268 --
NM_153020chr621543 1482 1535 ----
NM_153022chr1241639 514 161 70 11198 ----
NM_153029chr1683800 3676 2648 1640 1127 825 289 67 --23691 1510 11629
NM_153035chr1103012 2455 2410 2299 2104 2040 1191 1107 803 443 --22166 765 --
NM_153042chr631290 1122 619 ----21679 1407
NM_153050chr2284925 4418 3792 3756 3479 2004 1562 193 --13492 --
NM_153051chr2284925 4418 3792 3756 3479 2004 1562 193 --13492 --
NM_153182chr332371 1322 23 --41259 1084 495 424 --
NM_153184chr311673 ------
NM_153188chr575410 4683 1202 1184 1109 697 369 13783 24549 4540 24268 814
NM_153207chr1293914 3756 3513 3468 3206 2848 2593 2485 507 11211 33810 2980 1306 --
NM_153235chr652455 2439 2163 290 35 ------
NM_153240chr341213 860 505 366 21080 35 ----
NM_153251chr131235 ------
NM_153261chr1621614 1151 1229 ----
NM_153262chr142356 2223 671 485 32814 1037 567 ----
NM_153267chr92660 635 --142 --
NM_153280chrX1159 ------
NM_153332chr893042 2594 2510 1139 863 752 535 393 333 12814 ----
NM_153346chrX52075 1988 658 627 292 --11691 --
NM_153365chr42804 370 4835 558 451 343 12566 --
NM_153371chr1362100 1775 1539 1513 1471 446 11521 ----
NM_153374chr151337 ------
NM_153377chr121341 2375 40 ----
NM_153437chr9130 ------
NM_153607chr582736 2642 2620 2525 2436 2148 879 166 ------
NM_153616chr1531785 412 326 2274 75 12348 1448
NM_153617chr1531785 412 326 2274 75 12348 1448
NM_153618chr1531785 412 326 2274 75 12348 1448
NM_153619chr1533023 950 941 11313 13586 --
NM_153620chr72384 144 1367 11760 --
NM_153634chr1241451 1342 411 152 --1499 --
NM_153645chr2243253 1042 1033 697 12831 ----
NM_153689chr2----11739 22221 1464
NM_153690chr33791 636 165 ------
NM_153695chr9148 ------
NM_153702chr4--1199 ----
NM_153705chr1162657 2437 2179 2015 1087 539 22113 989 42682 2485 2104 300 --
NM_153712chr293580 2823 2813 2462 2438 1535 1339 1171 317 23208 2640 11431 --
NM_153713chr12103 87 ------
NM_153715chr711200 ------
NM_153759chr2----1408 --
NM_153810chr1065093 3955 1412 1331 1253 945 ------
NM_153819chr11------153
NM_153828chr22586 238 ------
NM_153831chr8--1367 ----
NM_153834chrX3265 76 43 ------
NM_153836chr251812 1667 1317 348 342 --1713 1213
NM_170587chr82843 188 ------
NM_170606chr71598 ------
NM_170665chr1264218 2947 2876 1301 657 524 23559 497 ----
NM_170674chr1521388 1357 11237 ----
NM_170675chr1521064 1033 2913 314 ----
NM_170676chr1521064 1033 2913 314 ----
NM_170677chr1521388 1357 11237 ----
NM_170692chr141147 1123 288 53 1100 ----
NM_170696chr1521672 274 ------
NM_170697chr1521672 274 ------
NM_170706chr161695 1519 1068 973 586 69 13374 ----
NM_170709chr852191 1928 1766 1661 749 1101 1382 --
NM_170710chr482375 2197 2159 2009 1976 579 414 200 22452 68 12606 --
NM_170724chr631080 1004 295 --1958 --
NM_170751chr641379 1274 1181 230 11039 1557 1507
NM_170752chr641379 1274 1181 230 11039 1557 1507
NM_171825chr552324 1245 1171 794 136 2718 525 ----
NM_172020chr761839 1747 1699 1485 818 774 21855 1808 ----
NM_172037chr831351 934 27 ----1946
NM_172069chr231532 828 780 12154 ----
NM_172070chr242137 1656 328 190 ------
NM_172071chr177318 7015 6788 5988 5002 2073 1796 25438 2307 14994 --
NM_172097chr151302 1243 ----
NM_172103chr6----32066 2028 73 --
NM_172105chr6----32066 2028 73 --
NM_172159chr341661 910 654 302 11591 --1489
NM_172160chr341661 910 654 302 11591 --1489
NM_172231chr19121 ------
NM_172242chr102632 156 --1124 --
NM_172315chr1521388 1357 11237 ----
NM_172316chr1521388 1357 11237 ----
NM_172337chr141747 ------
NM_172344chr241738 1701 668 486 --1570 --
NM_173039chr111191 ------
NM_173054chr72705 94 --1884 --
NM_173082chr631356 1254 178 1438 ----
NM_173156chr111868 1254 ----
NM_173163chr161360 ------
NM_173167chr1742538 2483 2231 787 22032 648 22693 2289 --
NM_173172chr221271 303 11034 ----
NM_173177chr23563 464 146 ------
NM_173199chr93451 125 42 ------
NM_173214chr16157841 7159 6146 5710 5636 5556 5490 5011 3001 2977 2571 2448 1932 1385 857 ------
NM_173353chr122648 126 ------
NM_173354chr2132138 1400 336 ------
NM_173359chr341553 1374 562 389 ------
NM_173463chr474072 4001 3835 3390 3367 3002 1548 33078 2821 337 ----
NM_173468chr455347 4527 1779 686 495 34465 4019 4005 21543 1210 --
NM_173469chr153601 259 191 ------
NM_173470chrX42860 2245 2123 796 --1570 12375
NM_173491chr53943 531 277 31461 1434 257 11103 --
NM_173495chrX51761 1634 884 696 534 ------
NM_173496chr1052881 2165 636 588 264 ------
NM_173502chr16147 ------
NM_173508chr12915 85 ------
NM_173511chr273926 3343 3336 3256 2503 980 250 23946 1514 ----
NM_173531chr1983898 3880 2569 2388 1337 714 507 387 23566 3423 ----
NM_173552chr332516 976 211 1168 1638 11569
NM_173560chr62454 168 ------
NM_173570chr342179 2108 1957 74 ------
NM_173576chr1022258 444 --12100 21802 310
NM_173582chr11105927 5817 5592 5248 5114 4758 4082 4067 3863 340 44632 4145 1728 99 15792 16084
NM_173595chr12115072 4978 4322 3749 3642 3207 1041 637 418 267 40 --11767 21780 1465
NM_173602chr1243816 3422 3322 3099 33164 3107 3011 --11351
NM_173607chr1452115 1871 1534 697 440 --11345 --
NM_173609chr15------1105
NM_173611chr15174 ------
NM_173642chr168723 8653 5951 2593 2438 1376 46233 5872 2023 1690 12580 11994
NM_173667chr552438 2039 775 753 426 1802 1447 --
NM_173670chr521012 952 ------
NM_173683chr821788 337 1372 ----
NM_173694chrX42309 512 276 117 --1626 --
NM_173808chr194306 3566 3224 1708 1402 729 509 191 156 --14189 --
NM_173814chr152428 239 3483 461 419 1505 --
NM_173822chr242189 1682 255 34 1470 ----
NM_173824chr31213 --1178 --
NM_173829chr5125816 5031 4880 4667 4652 4615 4565 4150 1451 1265 657 470 34395 3859 298 2691 612 21363 823
NM_173851chr863685 3493 2721 2455 1588 1445 ------
NM_174890chr101739 1529 ----
NM_174911chr873911 3695 3258 3203 1204 728 661 ------
NM_174916chr1542154 927 736 471 11973 ----
NM_174937chr10--1630 ----
NM_175052chr52704 308 11028 ----
NM_175056chr321754 487 --1582 12143
NM_175061chr762212 1777 816 784 774 461 --1436 1857
NM_175607chr331561 1185 159 ------
NM_175610chr1531069 1050 1010 --183 --
NM_175612chr331561 1185 159 ------
NM_175623chr12157496 7452 7416 5288 5154 4907 3060 2978 2879 2377 2107 1649 1489 1224 22 --22749 504 13004
NM_175624chr12147591 7547 7511 5383 5249 5002 3073 2974 2472 2202 1744 1584 1319 117 --22844 599 13099
NM_175625chr12147591 7547 7511 5383 5249 5002 3073 2974 2472 2202 1744 1584 1319 117 --22844 599 13099
NM_175629chr2----1408 --
NM_175634chr821243 224 1130 ----
NM_175635chr821243 224 1130 ----
NM_175636chr821243 224 1130 ----
NM_175733chr1152181 1409 1389 624 472 ------
NM_175736chr12137793 7434 7152 7117 6743 5367 5354 5019 4860 2971 2951 2301 755 26906 3138 --16785
NM_175748chr1432132 1796 1767 ------
NM_175767chr541856 1721 1633 292 11373 --21680 470
NM_175839chr202277 206 ------
NM_175840chr202277 206 ------
NM_175841chr202277 206 ------
NM_175842chr202277 206 ------
NM_175852chr182289 2110 2101 1902 1228 1113 704 203 ------
NM_175854chr1332641 2587 349 12617 ----
NM_175861chr12125940 5831 5706 4735 4670 4419 3711 2366 2223 2202 642 42 13667 33751 2386 295 --
NM_175862chr33491 441 422 --1290 --
NM_175863chr6----1951 --
NM_175871chr19254 21 160 ----
NM_175876chr152677 2294 1901 922 587 1681 12061 --
NM_175910chr1932326 1967 1555 --12435 2416 164
NM_175921chr594027 3567 3138 2857 1666 1274 812 587 380 34045 838 421 33419 888 877 --
NM_175931chr1651492 1314 770 758 91 21665 213 ----
NM_176814chr731312 1234 388 ------
NM_176823chr173848 3739 3711 3185 877 253 228 --12575 --
NM_176824chr441192 1170 1035 112 1392 ----
NM_176863chr1732145 287 171 12051 1730 1568
NM_176871chr852583 2284 928 844 575 --12140 --
NM_177414chr111747 ------
NM_177422chr11504 1170 --1489
NM_177424chr121331 361 1632 ----
NM_177438chr1484208 3889 3798 3259 3020 1481 1129 773 12924 23524 1469 11363
NM_177452chr1462463 2309 1840 979 934 872 ------
NM_177553chr114900 811 735 601 ------
NM_177559chr2061196 1098 994 768 414 25 ------
NM_177560chr2061196 1098 994 768 414 25 ------
NM_177947chrX2454 219 ------
NM_177948chrX2454 219 ------
NM_177951chr141213 ------
NM_177967chr1311068 1397 ----
NM_177972chr11114339 4306 4099 4078 3358 3267 2990 1734 1285 922 166 ------
NM_177985chr252046 1615 1500 1436 598 ----1479
NM_177989chr3125 1355 ----
NM_177990chr202521 350 --11650 --
NM_177999chr983410 3216 2946 2790 2277 523 498 458 12688 ----
NM_178006chr1372037 1704 1668 887 558 316 117 12368 2827 366 12351
NM_178007chr1372037 1704 1668 887 558 316 117 12368 2827 366 12351
NM_178010chr121550 11860 ----
NM_178014chr63636 171 94 --1283 --
NM_178034chr157745 723 657 407 349 276 269 ------
NM_178037chr1212570 23313 2407 33273 1148 771 --
NM_178038chr1212570 23313 2407 33273 1148 771 --
NM_178042chr3125 1355 ----
NM_178123chr21890 1939 ----
NM_178140chr542654 2150 1840 250 1712 ----
NM_178151chrX167494 7034 6823 5920 5688 5510 5499 5300 5292 2762 2088 2049 858 841 775 64 15026 12697 --
NM_178152chrX167494 7034 6823 5920 5688 5510 5499 5300 5292 2762 2088 2049 858 841 775 64 15026 12697 --
NM_178153chrX167494 7034 6823 5920 5688 5510 5499 5300 5292 2762 2088 2049 858 841 775 64 15026 12697 --
NM_178270chrX1632 ------
NM_178313chr262021 1800 1433 1424 1411 192 1814 1830 --
NM_178450chr5--1187 ----
NM_178498chr1163303 3146 2791 468 365 245 22839 754 22846 69 --
NM_178509chr1724008 270 ------
NM_178539chr1251894 1739 1483 760 753 11682 ----
NM_178554chr353549 3465 570 555 476 22703 128 ----
NM_178565chr861712 1623 1471 619 458 419 ------
NM_178566chr951893 1638 1557 1476 1356 1655 ----
NM_178585chr473307 3187 3124 2511 2434 771 659 22605 2571 1859 --
NM_178586chr1451754 1703 1510 748 629 --21680 69 --
NM_178812chr81469 1314 ----
NM_178815chr1062693 2674 2538 1952 1109 63 ------
NM_180989chr1352410 2299 933 389 196 21770 503 --1315
NM_181054chr1421206 826 ------
NM_181093chr1------164
NM_181265chr482375 2197 2159 2009 1976 579 414 200 22452 68 12606 --
NM_181291chr14--1718 ----
NM_181302chr14--1179 ----
NM_181308chr14--1179 ----
NM_181332chrX32530 2469 1737 12087 ----
NM_181351chr1143018 2888 472 419 --12246 --
NM_181354chr811265 --1418 1510
NM_181356chr631034 873 91 ----1310
NM_181358chr153684 1444 747 597 37 13052 --11093
NM_181359chr141997 1793 1575 203 2839 311 1136 --
NM_181443chr2042637 2281 2179 1065 12826 21035 708 --
NM_181457chr2----1338 --
NM_181458chr2----1471 --
NM_181459chr2----1237 --
NM_181460chr2----1284 --
NM_181481chr1896978 6923 6681 5466 5319 5117 2512 1958 1135 34930 4855 2525 12634 25696 1048
NM_181482chr1896978 6923 6681 5466 5319 5117 2512 1958 1135 34930 4855 2525 12634 25696 1048
NM_181483chr1896978 6923 6681 5466 5319 5117 2512 1958 1135 34930 4855 2525 12634 25696 1048
NM_181492chr2221142 364 ------
NM_181504chr584110 3948 2723 2674 1655 1458 1222 855 11393 ----
NM_181523chr584110 3948 2723 2674 1655 1458 1222 855 11393 ----
NM_181524chr584110 3948 2723 2674 1655 1458 1222 855 11393 ----
NM_181571chr103719 434 257 --1753 1396
NM_181581chr73735 620 32 2832 76 ----
NM_181655chr172532 71 1615 1670 --
NM_181656chr172741 280 1824 1879 --
NM_181659chr2073067 2931 2706 2602 2150 401 184 --21199 1016 1604
NM_181659chr2073067 2931 2706 2602 2150 401 184 --21199 1016 1604
NM_181670chr12----1333 --
NM_181671chr173769 733 88 --1912 1329
NM_181672chrX51765 1632 1495 99 34 --21790 78 --
NM_181673chrX51765 1632 1495 99 34 --21790 78 --
NM_181702chr83641 310 83 ------
NM_181723chr832221 1678 1608 11647 1285 22033 1631
NM_181782chr651784 869 696 688 350 197 11815 12162
NM_181783chr1231717 1312 599 22028 395 --21774 1364
NM_181784chr242516 2175 1871 134 1518 ----
NM_181787chr883892 3612 3481 3039 1501 942 697 199 23163 2455 ----
NM_181794chr62944 206 ------
NM_181795chr62944 206 ------
NM_181836chr552092 1893 1819 1794 266 ------
NM_181838chr551490 1038 206 189 160 ------
NM_181861chr1232567 2305 659 41120 984 686 383 2255 183 1941
NM_181868chr1232567 2305 659 41120 984 686 383 2255 183 1941
NM_181869chr1242652 2390 1783 744 31069 771 468 2340 268 11026
NM_181892chr41180 157 ----
NM_181897chr372565 1944 1856 1848 1720 724 329 2947 193 ----
NM_182314chrX41835 1722 1706 1345 21471 196 --11413
NM_182485chr453233 2756 2526 2461 1345 ----1538
NM_182487chr964437 4411 4350 3643 1751 171 23512 2789 23274 1004 --
NM_182503chr674659 3850 3756 3537 1630 1055 572 14939 14761 --
NM_182511chr181268 ----1939
NM_182606chr42884 237 --1912 --
NM_182609chr19----11546 --
NM_182643chr841840 1703 580 344 11743 --21717 314
NM_182646chr453233 2756 2526 2461 1345 ----1538
NM_182666chr3------1585
NM_182678chr22441 434 ------
NM_182680chrX------134
NM_182691chr731353 1315 306 --11009 --
NM_182692chr731353 1315 306 --11009 --
NM_182700chr731398 1263 679 --11818 --
NM_182701chr62325 299 --1881 --
NM_182715chr731264 485 408 ------
NM_182717chr1021124 1013 --11158 --
NM_182718chr103719 434 257 --1753 1396
NM_182719chr103719 434 257 --1753 1396
NM_182720chr1021124 1013 --11158 --
NM_182721chr1021124 1013 --11158 --
NM_182722chr1021124 1013 --11158 --
NM_182723chr1021124 1013 --11158 --
NM_182724chr103719 434 257 --1753 1396
NM_182725chr103719 434 257 --1753 1396
NM_182757chr693395 3183 2961 2664 1310 838 531 111 82 --12506 --
NM_182762chr755806 3835 1998 1056 411 ------
NM_182763chr142201 603 547 538 --1504 --
NM_182765chr101932 ----12065
NM_182767chr1272133 1963 1810 808 431 286 258 1308 ----
NM_182769chr103719 434 257 --1753 1396
NM_182770chr103719 434 257 --1753 1396
NM_182771chr103719 434 257 --1753 1396
NM_182772chr103719 434 257 --1753 1396
NM_182789chr51847 1683 ----
NM_182797chr2031756 346 131 1518 11706 --
NM_182798chr5----1390 --
NM_182799chr5----1390 --
NM_182801chr5----1390 --
NM_182830chr1442281 2247 1465 520 11554 --11951
NM_182835chr141152 ------
NM_182850chr103719 434 257 --1753 1396
NM_182853chr1021124 1013 --11158 --
NM_182896chr361805 1784 1561 1536 601 377 11237 2593 134 --
NM_182898chr7126401 5653 5031 4816 4566 4443 1716 1570 1485 374 201 162 36030 1625 1325 35586 2406 498 --
NM_182899chr7126401 5653 5031 4816 4566 4443 1716 1570 1485 374 201 162 36030 1625 1325 35586 2406 498 --
NM_182907chr662254 2142 1660 509 236 215 ------
NM_182911chr2--1248 ----
NM_182920chr321196 158 --160 --
NM_182948chr163177 3078 2736 985 979 235 12175 --11173
NM_182964chr1142432 2215 877 219 12922 22774 284 --
NM_182972chr142817 2689 2357 231 --22616 68 --
NM_182975chr1188 11153 ----
NM_182977chr531045 849 387 --1310 --
NM_182978chr182654 144 ------
NM_183004chr1453578 3504 2617 989 513 11193 22414 1143 --
NM_183011chr1021124 1013 --11158 --
NM_183012chr1021124 1013 --11158 --
NM_183013chr1021124 1013 --11158 --
NM_183049chr4162 ------
NM_183060chr103719 434 257 --1753 1396
NM_183075chr4112954 2825 2621 2340 1913 848 785 389 363 253 237 1312 1409 22981 185
NM_183078chr6123783 3718 3182 2842 2807 2557 2432 621 414 329 292 142 2352 157 1234 13820
NM_183079chr2041574 1388 1104 490 --2352 338 --
NM_183227chr641423 510 429 317 ------
NM_183234chr1531419 576 42 ------
NM_183235chr1531419 576 42 ------
NM_183236chr1531419 576 42 ------
NM_183238chr1253130 3079 401 314 50 --13194 --
NM_183244chr201480 ------
NM_183246chr201480 ------
NM_183323chr51847 1683 ----
NM_183376chr1572292 2221 2157 1691 893 846 784 ------
NM_183380chr63911 854 283 ----1351
NM_183381chr3----1764 1179
NM_183383chr3----1764 1179
NM_183384chr3----1764 1179
NM_183416chr171475 1462 563 363 329 274 78 ------
NM_183419chr831021 561 282 ------
NM_183422chr134926 263 141 78 ------
NM_184234chr201130 1769 ----
NM_194247chr262871 1653 1026 1006 847 713 ------
NM_194281chr181270 1229 --1217
NM_194282chr452998 2890 2486 1028 408 11055 1286 --
NM_194283chr533386 3190 1645 13691 11653 1394
NM_194285chr1123387 99 --1922 --
NM_194286chr1245611 5047 5000 1085 --24505 108 35151 861 691
NM_194291chr822371 1063 144 ----
NM_194292chr181780 1632 1578 1521 1330 601 460 129 1512 ----
NM_194298chr1031509 1218 190 21727 604 11572 --
NM_194314chr195535 5515 5449 4482 2118 1886 1802 1747 514 --24736 1240 1678
NM_194328chr943179 2166 979 935 23051 371 ----
NM_194329chr943179 2166 979 935 23051 371 ----
NM_194330chr943179 2166 979 935 23051 371 ----
NM_194332chr943179 2166 979 935 23051 371 ----
NM_194358chr1251730 1385 1225 749 107 --11464 --
NM_194359chr1251730 1385 1225 749 107 --11464 --
NM_194434chr18115143 5050 4851 4709 4509 2022 1614 1210 483 453 373 24284 1831 12209 --
NM_194454chr721656 1207 ------
NM_194455chr721656 1207 ------
NM_194456chr721656 1207 ------
NM_194463chrX2475 378 ------
NM_197941chr532842 886 313 22241 480 ----
NM_197966chr222193 179 ----1902
NM_197967chr222193 179 ----1902
NM_197968chr131195 ------
NM_197970chr231235 443 434 --1615 1128
NM_198081chr662766 2687 2678 2443 2285 409 32936 489 454 22413 2097 12708
NM_198123chr831484 1172 387 11335 1559 --
NM_198124chr831484 1172 387 11335 1559 --
NM_198128chr1842258 2062 904 31 ------
NM_198181chr1521877 908 32114 787 74 ----
NM_198195chr33541 216 44 ------
NM_198240chr1231256 555 498 1540 --1318
NM_198243chr152685 46 ------
NM_198268chr153684 1444 747 597 37 13052 --11093
NM_198269chr153684 1444 747 597 37 13052 --11093
NM_198273chr583005 2780 2655 2298 1247 888 870 742 12551 ----
NM_198279chrX21262 878 ----1939
NM_198291chr2012002 ------
NM_198324chr1261180 1075 841 291 105 62 11063 ----
NM_198329chr321168 128 --11180 --
NM_198336chr731648 1174 689 ------
NM_198390chr1621930 1530 --11430 11739
NM_198399chr361651 1461 1416 471 264 162 ------
NM_198400chr1562191 1105 864 629 467 332 ----11866
NM_198404chr131687 ------
NM_198468chr6164487 3993 3838 3626 3440 3421 3256 3050 2796 1707 1442 430 417 345 228 135 23892 2823 11819 1308
NM_198484chr395256 4389 4200 2539 1933 1670 1585 494 34 12276 14051 --
NM_198503chr172303 1763 899 834 777 759 736 11974 1958 --
NM_198513chr83595 577 309 ------
NM_198569chr652724 2611 2583 2282 375 ------
NM_198581chr2157390 7200 7175 6919 6855 6497 6321 5787 5552 4925 2638 2538 1983 587 76 87269 6521 5696 5578 4952 4725 2097 45 67534 6718 6179 6152 4582 2337 --
NM_198597chr10185 ----1740
NM_198715chr1105402 5181 5102 4862 4007 2434 1645 1164 914 423 15624 22010 1296 --
NM_198793chr383966 3887 3670 1589 1328 1118 394 297 ------
NM_198794chr1431347 1192 181 11309 ----
NM_198859chr374774 4497 3862 3673 1944 1520 1142 24327 1655 --14106
NM_198896chr1131884 1694 378 1306 11703 --
NM_198900chr12137793 7434 7152 7117 6743 5367 5354 5019 4860 2971 2951 2301 755 26906 3138 --16785
NM_198904chr522059 1397 1498 1424 --
NM_198935chr2062649 2369 2306 2259 503 204 ------
NM_198956chr731398 1263 679 --11818 --
NM_198968chr1373725 3700 3097 2807 2678 2425 71 13259 23934 3252 1930
NM_198989chr132424 191 ------
NM_198990chr742929 2545 2036 651 12189 --12557
NM_199000chr762294 2005 1884 1737 1425 915 2565 448 1505 --
NM_199040chr12103842 3402 3168 2615 1479 1391 1384 1080 355 224 42502 1348 1154 662 13029 1823
NM_199053chr41222 ----2866 177
NM_199072chr752846 2642 1225 839 275 ------
NM_199168chr102984 232 21347 374 11335 --
NM_199169chr2033629 3023 554 12223 ----
NM_199170chr2033629 3023 554 12223 ----
NM_199171chr2033629 3023 554 12223 ----
NM_199188chr1242908 2560 1217 604 ------
NM_199190chr1242908 2560 1217 604 ------
NM_199245chr1232562 2533 1695 ------
NM_199320chr442518 2149 922 845 ------
NM_199320chr442518 2149 922 845 ------
NM_199324chr4113691 3562 3497 3046 3032 2918 2849 1420 567 476 126 ------
NM_199328chr2111012 1267 --1360
NM_199346chr21145 ------
NM_199351chr12402 367 --2481 389 --
NM_199355chr1621367 43 --21451 426 --
NM_199414chr1521122 421 ------
NM_199420chr32758 630 186 1656 --
NM_199421chr1454556 4440 1818 998 247 23675 1850 11796 --
NM_199436chr262774 2634 2183 1184 640 622 ------
NM_199440chr2123 ------
NM_199462chr184999 3849 3763 3178 1436 1147 1123 845 22012 519 21043 327 13525
NM_199478chrX51784 1674 346 240 188 ------
NM_199482chr281498 790 603 565 531 399 237 153 ----1828
NM_199483chr201308 ------
NM_201269chr12296 152 1486 11452 11418
NM_201437chr851197 479 206 156 24 ----1300
NM_201438chr121367 ------
NM_201439chr122437 108 ------
NM_201440chr122437 108 ------
NM_201515chr122437 108 ------
NM_201542chr12215 61 1221 ----
NM_201567chr33558 142 130 11476 ----
NM_201568chr111868 1254 ----
NM_201569chr111868 1254 ----
NM_201570chr1071878 1799 1768 1634 1432 456 175 ----11643
NM_201571chr1071878 1799 1768 1634 1432 456 175 ----11643
NM_201572chr1071878 1799 1768 1634 1432 456 175 ----11643
NM_201590chr1071878 1799 1768 1634 1432 456 175 ----11643
NM_201591chr441541 1206 758 388 ------
NM_201592chr441541 1206 758 388 ------
NM_201593chr1071878 1799 1768 1634 1432 456 175 ----11643
NM_201596chr1071878 1799 1768 1634 1432 456 175 ----11643
NM_201597chr1071878 1799 1768 1634 1432 456 175 ----11643
NM_201629chr92749 649 ------
NM_203282chr1951700 1277 501 297 110 ------
NM_203283chr4----1431 --
NM_203284chr4----1431 --
NM_203301chr1441198 660 529 142 ------
NM_203309chr14--122 ----
NM_203327chr2074305 3474 1147 663 468 186 92 --14351 --
NM_203341chr13732 235 197 1111 11058 1433
NM_203342chr153406 3175 2342 963 699 21413 760 ----
NM_203343chr153406 3175 2342 963 699 21413 760 ----
NM_203349chr1512188 ----11825
NM_203350chr141505 1362 401 115 11484 ----
NM_203351chr1722458 642 11992 --11539
NM_203372chr251297 593 556 116 58 ------
NM_203382chr541593 1250 304 119 11444 ----
NM_203390chr841756 1396 1213 371 11348 ----
NM_203391chrX91508 1461 1415 1270 1170 734 673 395 248 11284 11321 --
NM_203403chr91824 --1160 --
NM_203446chr2153034 2722 1174 1071 921 --1220 11950
NM_203453chr971958 1620 1251 781 650 603 587 ----11572
NM_203458chr153820 3333 2864 1495 337 32818 2528 666 11190 --
NM_203459chr142585 1923 1714 822 --2488 442 --
NM_203463chr274282 4187 3665 3336 3140 1680 1371 14607 --192
NM_203467chr142183 30 ------
NM_203487chr1351737 1298 643 425 114 ------
NM_203504chr431973 745 243 ------
NM_203505chr431973 745 243 ------
NM_205842chr22780 173 179 ----
NM_205848chr152500 2398 2243 1834 1009 ------
NM_205860chr152588 2067 1944 473 167 12545 ----
NM_206853chr673859 3440 3145 2795 2562 1156 279 11119 11243 --
NM_206854chr675120 4701 4406 4056 3823 1540 111 1729 ----
NM_206855chr6126085 5666 5371 5021 4788 4200 4143 2505 1076 947 910 237 34088 1694 346 ----
NM_206866chr2163242 3101 2519 2407 735 193 32668 2288 841 ----
NM_206876chr2103588 3532 3390 3340 3266 2729 2482 1256 826 529 --1430 22945 50
NM_206886chr1------181
NM_206907chr542910 1290 1237 1132 ------
NM_206909chr8167777 7429 7422 7371 6119 6065 5650 5470 5450 3138 2884 2205 2148 2062 1709 1100 1827 --27577 1246
NM_206914chr1252006 1880 1701 1497 153 2901 427 ----
NM_206937chr131111 1939 11056 --
NM_206943chr22777 72 ------
NM_207015chr352361 2257 2114 1820 193 21720 716 ----
NM_207123chr4--1327 ----
NM_207174chr211607 --1564 --
NM_207299chr92979 380 1762 --156
NM_207303chr1062907 2742 946 464 359 42 1390 --11214
NM_207304chr132448 213 22565 59 ----
NM_207321chr1041071 245 183 81 1349 --1712
NM_207325chr1941989 1628 1518 298 2604 487 ----
NM_207344chr1241313 435 273 157 2865 81 1361 --
NM_207361chr1396056 5771 2448 1938 1916 1485 1000 988 39 25728 1951 171 25110 772
NM_207371chr1021348 39 3981 322 236 ----
NM_207372chr1022360 951 ----1138
NM_207377chr14--1118 ----
NM_207391chr1931279 1249 1211 1502 ----
NM_207406chr486165 5175 4172 4022 2538 2240 1062 290 26512 1934 26520 1812 --
NM_207429chr1151709 986 842 631 472 ------
NM_207520chr22586 238 ------
NM_207521chr22586 238 ------
NM_207627chr211607 --1564 --
NM_207628chr211607 --1564 --
NM_207629chr211607 --1564 --
NM_207645chr1131053 913 229 11335 ----
NM_212460chr731318 606 21 ------
NM_212471chr1762252 1745 759 693 671 635 ------
NM_212472chr1762252 1745 759 693 671 635 ------
NM_212539chr31156 ------
NM_212554chr1041313 1162 612 592 11644 ----
NM_212558chr964285 3760 2995 2636 808 688 14097 1915 --
NM_213569chr10174 ------
NM_213589chr295166 4408 4038 3806 3716 995 956 912 30 14141 11408 --
NM_213606chr1082106 1698 890 796 620 537 483 421 ------
NM_213651chr121362 227 ----1476
NM_213654chr331507 1434 1057 11032 2560 308 --
NM_213662chr1762015 1816 1664 463 230 84 22400 1865 ----