TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-202-5p
miRNA Sequence: UUCCUAUGCAUAUACUUCUUUG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000337chr555997 5300 4057 1741 243 15580 22085 1810 36139 5900 581
NM_001009899chr395094 4456 4338 2534 1791 1312 820 390 316 24062 1267 --15791
NM_001024948chr1--23337 2700 13281 2807 38
NM_001039840chrX25413 4535 12147 --25157 2053
NM_001106chr3129744 7982 7059 6405 6381 6197 3313 3051 3044 2276 2232 1065 --38039 6338 880 --
NM_002655chr864726 3672 3564 1482 1367 816 1262 --14177
NM_003034chr1267243 7166 2983 1505 445 100 17233 18010 11824
NM_004171chr11108929 7847 7428 6995 3645 2430 2365 2267 1570 1138 19072 13386 --
NM_004293chr923245 1199 --13100 23782 2621
NM_004612chr964742 3799 3550 1460 1249 629 14263 --21911 1872
NM_004985chr1224453 3560 ----23538 835
NM_005596chr996147 6056 5937 5805 2552 1901 1388 1267 29 --34221 2411 1158 --
NM_006544chr1475618 4993 4319 4085 1943 1328 1042 35026 4582 870 ----
NM_007050chr2057362 5431 2586 810 586 36106 5681 3019 23245 1352 27241 6531
NM_007137chrX75004 4606 4423 3884 3442 3366 2019 21464 321 25087 455 11895
NM_007249chr1337794 6131 3406 36581 6515 780 12569 28559 6530
NM_014155chr1164946 2348 2273 1663 1386 1162 35709 5058 2836 --1981
NM_014898chr19--22426 378 --2118 47
NM_016510chr2----8938 295 281 267 253 239 225 211 --
NM_017633chr653814 3182 2921 1340 1004 11125 --21257 353
NM_019008chr2223386 2687 ----33781 1117 654
NM_020921chr1462926 2603 2521 1229 1118 159 1772 --12943
NM_031427chr1421956 95 43995 2115 1887 471 35356 5273 1223 11444
NM_032859chr1393635 3433 2660 2429 1544 1257 1245 1170 665 13173 ----
NM_033224chr777729 7602 6960 6374 6092 2083 1600 47211 6493 5770 3233 --13120
NM_033360chr1224574 3681 ----23659 956
NM_133170chr2057362 5431 2586 810 586 36106 5681 3019 23245 1352 27241 6531
NM_144599chr1594758 4553 4201 4039 4020 1994 1670 1071 900 1822 --11034
NM_152754chr743486 1212 829 237 3814 759 535 --11062
NM_153362chr65947 659 368 166 82 1703 --1779
NM_173468chr486014 5852 5558 5298 5115 4125 1226 784 56020 5520 4291 1932 891 ----
NM_175624chr1287622 7272 7140 7039 4733 3126 2869 1526 12292 --22917 2416
NM_175625chr1287622 7272 7140 7039 4733 3126 2869 1526 12292 --22917 2416
NM_199000chr742117 850 740 188 --1522 1903