TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-20a-3p
miRNA Sequence: ACUGCAUUAUGAGCACUUAAAG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000091chr252849 2733 2553 1842 1144 12033 ----
NM_000097chr351176 1059 1029 445 22 ------
NM_000110chr121171 414 --1479 --
NM_000125chr674145 3531 3063 2736 1036 949 507 --23142 3111 --
NM_000134chr451740 1680 1577 1085 273 11386 21473 367 --
NM_000163chr54673 385 316 211 ------
NM_000165chr631404 1156 68 ----11660
NM_000170chr91146 ------
NM_000190chr111232 ------
NM_000212chr1722437 1975 ------
NM_000216chrX11263 23852 1610 1132 1808
NM_000217chr12105105 4998 4514 1300 1155 1050 996 860 463 143 ------
NM_000222chr412144 --11964 --
NM_000232chr432877 2843 454 1443 22332 2028 --
NM_000245chr742252 1884 1650 1443 --1568 11812
NM_000248chr383028 2973 2846 2174 469 391 370 230 12596 1581 --
NM_000252chrX41533 1342 1111 437 1103 ----
NM_000259chr15134831 4592 4448 4196 3954 2514 2376 2283 2086 2046 984 797 661 --12272 13975
NM_000264chr932904 1315 1044 --12374 --
NM_000267chr1763503 2706 2452 2408 2283 1167 --13036 11309
NM_000280chr111673 ----1305
NM_000318chr852250 2185 1013 195 35 --32734 1837 491 --
NM_000328chrX144 ------
NM_000332chr6106838 6442 6041 5723 5064 2005 927 871 720 373 11431 21631 749 --
NM_000337chr565504 5355 4410 4178 2638 1420 11957 16367 --
NM_000348chr241554 1429 627 602 11539 1345 --
NM_000351chrX114227 3638 2771 1476 1289 1282 1181 1127 429 348 298 1321 --12967
NM_000368chr943858 3459 100 63 ----1154
NM_000376chr1272960 2897 2845 1222 1134 736 354 ----13116
NM_000406chr4102475 2454 2319 2117 1955 1046 929 783 299 265 ------
NM_000408chr252854 2737 2681 2429 242 --11261 12174
NM_000439chr522512 911 ------
NM_000441chr752319 1955 523 464 58 1651 21630 770 --
NM_000448chr1163155 2855 2482 2396 2186 577 12294 ----
NM_000461chr3104177 4048 3982 3866 3242 3060 1417 1399 650 545 34589 4145 3784 53514 3247 1047 1020 166 --
NM_000480chr1141228 1209 1056 574 --11487 --
NM_000489chrX32704 1246 1010 ------
NM_000523chr221112 815 ----1765
NM_000531chrX1301 ------
NM_000538chr1331142 537 126 11402 ----
NM_000555chrX77467 6902 6643 6579 6451 2816 254 24847 1549 24958 1087 --
NM_000574chr13900 853 90 ------
NM_000586chr4181 1242 ----
NM_000594chr62614 507 --1548 --
NM_000598chr711460 21100 374 ----
NM_000599chr274401 3854 2845 1531 664 456 196 ----14462
NM_000618chr12126561 6505 5914 5607 5033 4554 1746 1418 1100 682 622 312 --15344 --
NM_000618chr12126561 6505 5914 5607 5033 4554 1746 1418 1100 682 622 312 --15344 --
NM_000621chr131890 ------
NM_000627chr2164 --1913 --
NM_000633chr1894536 4306 4249 4045 3750 3543 3471 1758 603 --14232 --
NM_000639chr11591 1802 --1654
NM_000663chr1663057 2903 2214 626 511 105 ------
NM_000686chrX21526 130 ------
NM_000719chr1276051 4812 2545 2062 1409 1062 867 15874 --15483
NM_000783chr10194 ------
NM_000788chr431463 1304 953 ----1244
NM_000793chr1465001 4959 4905 3177 547 312 24838 4380 --23770 3150
NM_000806chr551436 1406 648 589 184 21608 1203 ----
NM_000809chr4129279 8640 8066 7699 7608 7291 6349 5988 2937 1482 815 422 --28864 8171 144
NM_000813chr585419 5393 4758 4366 3910 1830 277 66 --15338 --
NM_000817chr21766 ------
NM_000824chr42752 364 --1837 --
NM_000826chr492187 2147 2094 2076 1853 1735 991 774 107 ------
NM_000831chr186262 5714 5681 4532 2436 2349 827 654 26108 5131 ----
NM_000844chr331098 755 742 ------
NM_000857chr41439 ------
NM_000859chr531343 353 85 2460 176 ----
NM_000868chrX42309 1821 90 46 --11986 --
NM_000872chr1051253 1173 371 347 303 --158 --
NM_000891chr1763244 2871 2802 2510 1373 729 --12564 23086 2892
NM_000899chr12134217 4211 3537 3481 3286 3009 2948 1615 1408 1177 1052 925 650 --11504 --
NM_000917chr101865 ------
NM_000919chr51620 ------
NM_000924chr121888 ------
NM_000935chr331179 875 498 ----1397
NM_000945chr231601 364 348 11586 ----
NM_000949chr5----184 --
NM_000950chrX43389 3302 2400 588 --11420 --
NM_000956chr1421045 996 ------
NM_000959chr153618 2908 1294 827 115 12559 1346 --
NM_000990chr11114061 3832 3661 3640 3056 2966 2822 1338 1154 884 294 --1482 --
NM_001001323chr1242713 2698 2506 2482 1803 11159 1422
NM_001001331chr352718 2119 1772 795 333 ------
NM_001001342chr1011103 ------
NM_001001395chr1272670 1055 1006 324 299 215 160 --12081 --
NM_001001396chr144259 3767 3655 727 23726 3090 2235 215 --
NM_001001419chr575152 3337 2071 1269 1121 763 323 1218 ----
NM_001001420chr575152 3337 2071 1269 1121 763 323 1218 ----
NM_001001436chr161694 ------
NM_001001481chr842589 2554 1390 413 --1224 --
NM_001001484chr1032373 1778 805 --11855 --
NM_001001549chr752660 2412 2327 2177 2120 --1766 12716
NM_001001550chr752660 2412 2327 2177 2120 --1766 12716
NM_001001555chr752660 2412 2327 2177 2120 --1766 12716
NM_001001586chr11382 ------
NM_001001664chr252527 1355 1151 802 294 --1318 --
NM_001001668chr1973306 2979 2875 2694 2642 1473 1045 --31344 1326 877 11132
NM_001001669chr592396 2320 2201 2021 1673 1081 966 941 258 11046 ----
NM_001001740chr11212 ------
NM_001001740chr11212 ------
NM_001001890chr214891 823 521 455 13125 11641 --
NM_001001924chr82456 44 12007 11742 1828
NM_001001925chr82456 44 12007 11742 1828
NM_001001928chr2288309 7990 7054 5124 3001 2252 1825 290 28101 7409 36086 3119 916 --
NM_001001931chr82456 44 12007 11742 1828
NM_001002243chr22203 157 1869 ----
NM_001002259chr121236 ------
NM_001002295chr10--1721 ----
NM_001002919chr21510 ------
NM_001003652chr1898270 8116 7393 2053 1965 1154 955 317 38 28286 8158 16951 --
NM_001003674chr18156268 5510 5182 5161 5069 4630 2469 1805 1538 1528 1076 986 960 804 541 24797 2406 24736 1382 --
NM_001003675chr18156268 5510 5182 5161 5069 4630 2469 1805 1538 1528 1076 986 960 804 541 24797 2406 24736 1382 --
NM_001003681chr223431 293 147 ------
NM_001003712chr1263929 3395 3263 3135 2522 662 12983 23962 2555 1130
NM_001003760chr663624 2864 2846 2353 907 311 12422 ----
NM_001003792chr341072 873 501 100 ----1895
NM_001003793chr341072 873 501 100 ----1895
NM_001003800chr942416 1056 526 103 11255 --2809 564
NM_001004065chr963963 2997 2666 1462 400 99 1125 23462 1212 --
NM_001004106chr51267 ------
NM_001004317chr694395 4379 4040 3445 3275 3257 2985 1814 1552 --23780 1166 1291
NM_001004342chr185659 5651 5405 5249 5141 1665 1179 1016 --34671 2404 559 --
NM_001004419chr1263831 3140 2828 1300 1157 910 23672 952 --11519
NM_001005386chr232102 1819 1616 ----11980
NM_001005408chr172154 136 ------
NM_001005473chr576607 6052 5357 4157 4025 2399 2360 --11744 26270 6183
NM_001005474chr331364 588 97 ------
NM_001005743chr1421294 338 ------
NM_001005744chr1421294 338 ------
NM_001005745chr1421294 338 ------
NM_001005753chr272309 2178 2101 1761 1617 385 188 ------
NM_001005849chr171496 ------
NM_001006610chr161164 ------
NM_001006624chr11476 --12006 1379
NM_001006634chr162660 630 ----1620
NM_001006681chrX141 ------
NM_001006682chrX141 ------
NM_001006683chrX141 ------
NM_001006684chrX1571 ------
NM_001007023chr1465001 4959 4905 3177 547 312 24838 4380 --23770 3150
NM_001007024chr1744287 3997 3201 119 13561 24087 682 --
NM_001007025chr1744287 3997 3201 119 13561 24087 682 --
NM_001007097chr945074 3366 1849 439 ----25059 207
NM_001007245chr72140 57 --1450 --
NM_001007246chr2161805 1305 442 308 86 58 ------
NM_001007277chr1111004 ------
NM_001007466chr6165059 4997 4824 4817 4724 4011 3554 3326 2018 1646 1241 1085 703 545 461 49 1126 ----
NM_001007527chr53536 451 289 ------
NM_001007565chr31397 --128 --
NM_001008225chr73684 662 93 ------
NM_001008239chr1863612 3559 2950 1069 1050 946 23263 2466 13061 --
NM_001008388chr41203 1947 ----
NM_001008393chr462810 2441 2426 957 768 604 --11865 --
NM_001008408chr776338 5001 4943 4288 2308 1003 283 1289 34918 841 423 1500
NM_001008495chr831593 552 389 ----1187
NM_001008660chr1131568 1393 1314 --11351 --
NM_001008661chr11363 ------
NM_001008662chr11363 ------
NM_001008726chr1431249 470 447 --1248 --
NM_001008756chr352572 2373 1658 866 855 --12019 --
NM_001008801chr1952036 780 696 612 291 --11512 --
NM_001008895chr1331236 360 42 ----11426
NM_001009183chr14136 ------
NM_001009554chr484480 4401 3720 2922 1798 1148 404 65 2817 210 ----
NM_001009554chr484480 4401 3720 2922 1798 1148 404 65 2817 210 ----
NM_001009571chr7----1385 21268 145
NM_001009899chr376471 6401 1809 825 597 365 47 1160 21380 139 --
NM_001009955chr11236 ------
NM_001009955chr11236 ------
NM_001009960chr752685 2666 1075 420 249 --22031 746 --
NM_001009993chr271510 641 424 411 348 292 34 14147 11612 11179
NM_001010844chr61237 ------
NM_001010852chr6----1115 --
NM_001010861chr132437 964 678 --22188 755 --
NM_001010888chrX94518 4434 4142 1746 1555 1540 1514 861 304 --1464 --
NM_001010891chr5106653 6483 6212 6118 2352 1276 978 968 949 795 12140 25133 2550 11209
NM_001010986chrX62334 2276 2082 2062 924 479 12350 11768 --
NM_001011513chr443985 3963 3728 3090 ------
NM_001011515chr421000 196 ------
NM_001011516chr421000 196 ------
NM_001011537chr372203 1972 832 661 483 439 272 ------
NM_001011663chr1031099 175 81 ------
NM_001011666chr776610 4559 4527 2496 2228 2106 1316 --11382 11938
NM_001011713chr1441273 622 106 59 --1521 --
NM_001011724chr131296 ----1257
NM_001011725chr131296 ----1257
NM_001012393chr1185183 4499 4072 1712 1442 928 473 414 34454 3437 3400 34793 3192 1926 --
NM_001012420chr15102935 2864 2685 2607 2303 2010 1909 1901 1850 991 --11965 --
NM_001012423chr15112935 2864 2685 2607 2497 2303 2010 1909 1901 1850 991 --11965 --
NM_001012506chr31139 ------
NM_001012751chr1021451 1234 --1338 11723
NM_001012761chr552682 902 439 347 185 11746 --11040
NM_001012968chrX42047 1032 749 270 2475 411 ----
NM_001012989chrX1143 ------
NM_001013031chr1033481 3257 3248 ----13016
NM_001013398chr711460 21100 374 ----
NM_001013620chr12137469 7135 6068 5881 2875 2683 2409 1436 1414 670 552 376 102 --38311 2446 1064 11867
NM_001013746chr762357 2170 2163 1662 645 145 ------
NM_001014380chr1355610 5063 4434 3722 1773 15214 32298 813 154 --
NM_001014449chr161160 ------
NM_001014451chr161160 ------
NM_001014797chr10137558 6487 5576 5499 2414 2382 1932 1702 1588 1406 1299 920 454 17986 17753 15112
NM_001014812chr152442 298 ------
NM_001015877chrX62976 2201 2098 1947 1938 394 ------
NM_001017395chr372914 2534 1035 787 247 226 43 ----12524
NM_001017405chr42935 702 ------
NM_001017424chr141893 1751 1478 446 1728 21193 333 21561 1300
NM_001017425chr141893 1751 1478 446 1728 21193 333 21561 1300
NM_001017440chr7148073 6776 6282 6158 5728 2965 2570 2420 2195 1560 1113 567 238 152 26094 113 --12035
NM_001017535chr1272960 2897 2845 1222 1134 736 354 ----13116
NM_001017923chr1431566 490 461 ----11545
NM_001017926chr871494 1480 1218 1144 569 238 200 --11398 --
NM_001017962chr101865 ------
NM_001017969chr92573 149 --1469 1630
NM_001018003chr81745 ------
NM_001018037chr941220 1178 1149 578 ------
NM_001018053chr161895 1663 1322 708 366 360 ------
NM_001018065chr986029 5016 4959 4433 2241 1842 1551 1296 --13672 --
NM_001018066chr986029 5016 4959 4433 2241 1842 1551 1296 --13672 --
NM_001020658chr121467 275 ------
NM_001020658chr121467 275 ------
NM_001023567chr1562233 1930 1579 999 674 474 ------
NM_001024382chr111232 ------
NM_001024647chr1265896 2509 2418 1866 335 225 22424 1889 14726 15543
NM_001024649chr542502 2451 344 245 --32765 941 492 --
NM_001024688chr852242 1735 447 275 140 1590 ----
NM_001024916chr9----1144 --
NM_001024937chr17----1725 --
NM_001024947chr521086 915 1102 --1800
NM_001024956chr1165363 4570 1409 853 714 422 ------
NM_001025076chr1075776 3905 3888 3768 2333 750 714 ------
NM_001025077chr10117134 5263 5246 5126 5068 4719 4668 2108 2072 1267 684 ------
NM_001025079chr344097 4063 1417 767 ------
NM_001025105chr5----11544 --
NM_001025108chr274084 3891 3703 3578 3519 2987 673 23421 1094 33852 3825 2770 44002 3106 3098 1176
NM_001025233chr1242308 531 475 159 ------
NM_001025356chr1272848 2784 2314 2262 1845 964 175 1161 ----
NM_001025389chr1141228 1209 1056 574 --11487 --
NM_001025390chr1141228 1209 1056 574 --11487 --
NM_001025580chrX83372 3244 3061 3010 2773 2605 1396 424 1274 ----
NM_001025595chr431519 1314 184 ------
NM_001025780chr941501 1434 195 117 ------
NM_001029863chr672847 2203 2032 1280 1229 1214 940 --12923 22427 669
NM_001029875chr552566 789 677 323 281 1975 ----
NM_001029882chr11250 ------
NM_001029882chr11250 ------
NM_001029884chr662680 2245 2150 1881 323 167 1575 1606 1759
NM_001030055chr1444202 3419 3086 765 --11707 --
NM_001031623chr61105 ------
NM_001031679chr1293331 3314 3140 3071 2888 1161 1010 681 39 13194 1390 --
NM_001031732chr453700 2860 2488 389 156 13572 13436 1257
NM_001031804chr1673929 3785 3241 1599 1518 1211 1129 ------
NM_001031812chr541601 783 757 739 --12212 --
NM_001032280chr621628 1326 ------
NM_001032282chr81527 ------
NM_001032283chr121297 --1121 --
NM_001032284chr121297 --1121 --
NM_001032394chr652778 2335 1009 555 251 --2608 419 --
NM_001032395chr652645 2202 876 422 118 --2475 286 --
NM_001032999chr2075305 5220 5145 4787 3604 1018 86 1732 21622 1414 1862
NM_001033045chr243020 1364 835 748 24105 3609 34349 3153 1765 13918
NM_001033047chr421807 986 1610 ----
NM_001033057chr361693 1376 478 428 420 218 ------
NM_001033059chr632039 1532 251 2257 44 11939 --
NM_001033088chr15158 --1418 --
NM_001033112chr5130 ------
NM_001033117chr374545 4096 3992 3607 3066 1812 1179 24251 137 13109 --
NM_001033557chr211399 ----11067
NM_001033561chr173858 64 56 ------
NM_001033578chr852337 1608 1588 516 138 --11846 --
NM_001033925chr1061778 1575 1558 1510 851 504 21431 1400 ----
NM_001034954chr1072574 2219 2139 956 614 597 402 13163 1820 --
NM_001034955chr1072574 2219 2139 956 614 597 402 13163 1820 --
NM_001034956chr1072574 2219 2139 956 614 597 402 13163 1820 --
NM_001034957chr1072574 2219 2139 956 614 597 402 13163 1820 --
NM_001035511chr11610 ------
NM_001035512chr11717 ------
NM_001035513chr11717 ------
NM_001037132chr772094 1829 737 307 252 193 186 11524 11644 11561
NM_001037133chr772094 1829 737 307 252 193 186 11524 11644 11561
NM_001037164chr741656 1399 643 443 --1176 --
NM_001037174chr231872 1692 421 ------
NM_001037317chr132437 964 678 --22188 755 --
NM_001037332chr532497 2374 643 ------
NM_001037333chr532497 2374 643 ------
NM_001037339chr151850 1812 1747 1596 1342 ------
NM_001037340chr151850 1812 1747 1596 1342 ------
NM_001037341chr151850 1812 1747 1596 1342 ------
NM_001037341chr151850 1812 1747 1596 1342 ------
NM_001037535chrX41400 1383 1356 1348 ------
NM_001037536chrX41400 1383 1356 1348 ------
NM_001037540chrX41400 1383 1356 1348 ------
NM_001037553chr2174495 4429 4152 4101 3737 3418 2039 13697 175 1727
NM_001037582chr451632 1519 1472 1428 1311 --2560 255 --
NM_001038628chr351731 1346 1240 679 424 --1367 1344
NM_001039547chr356366 5265 2064 1953 1367 45193 1625 1185 52 26100 2665 16939
NM_001039577chr183331 3280 1113 1066 857 604 270 39 --33696 1031 71 --
NM_001039580chr474912 4341 1799 1648 1129 1031 151 ------
NM_001039585chr163875 3165 1551 1084 372 154 12816 1603 --
NM_001039590chrX53085 2770 2748 2493 517 ------
NM_001039591chrX53085 2770 2748 2493 517 ------
NM_001039618chr1164203 3783 3742 2007 1662 465 --21922 1788 15304
NM_001039693chr2114135 3888 3771 3596 3009 2705 954 887 795 464 22 13109 13517 --
NM_001039709chr2075305 5220 5145 4787 3604 1018 86 1732 21622 1414 1862
NM_001039802chr111341 1982 1962 11227
NM_001039840chrX86067 4349 4180 3793 1817 1379 612 581 --14287 1693
NM_001039937chr1353355 2960 1609 1562 466 14085 12663 --
NM_001040020chr751399 1378 1254 599 96 ----1630
NM_001040135chr71670 ------
NM_001040142chr252314 2139 1710 774 120 ----12093
NM_001040143chr252314 2139 1710 774 120 ----12093
NM_001040152chr744500 4305 1680 719 ----13734
NM_001040214chr662340 1874 1851 463 234 129 --11494 1600
NM_001040284chr1674483 3768 2184 1483 1407 809 287 1320 11564 --
NM_001040402chr432944 406 328 ------
NM_001040429chr1373566 2986 1258 1046 984 677 333 ------
NM_001040450chr1552448 2420 2150 937 570 1849 ----
NM_001040453chr1552448 2420 2150 937 570 1849 ----
NM_001040665chr743639 1374 1254 431 --11983 --
NM_001040712chr973403 3160 2600 1294 1240 1095 576 12475 ----
NM_001042355chr1695384 4696 4685 4442 3955 1897 1593 351 273 11216 ----
NM_001042412chr1695384 4696 4685 4442 3955 1897 1593 351 273 11216 ----
NM_001042414chr132270 99 1105 ----
NM_001042425chr621628 1326 ------
NM_001042473chr1051931 760 696 496 425 ------
NM_001042481chr1461899 1644 740 610 254 205 11056 12055 --
NM_001042492chr1763503 2706 2452 2408 2283 1167 --13036 11309
NM_001042510chr851336 770 728 412 182 ------
NM_001042511chr851336 770 728 412 182 ------
NM_001042517chr134918 669 647 636 ------
NM_001042550chr941433 1288 247 44 --1338 --
NM_001042555chr1263690 3428 3071 1923 367 57 ----1160
NM_001042599chr297759 6632 6315 5435 2854 2786 1354 275 134 --25227 1078 26588 4860
NM_001042603chr1274002 3586 3473 3415 3357 1845 874 24874 194 ----
NM_001042604chr3104743 4065 4046 3112 1907 1823 906 306 201 88 13430 ----
NM_001042646chr371971 1767 1288 782 696 500 84 ------
NM_001044722chr541601 783 757 739 --12212 --
NM_001044723chr541601 783 757 739 --12212 --
NM_001071775chr1341860 1843 97 76 ----11259
NM_001083620chr492185 2145 2092 2074 1851 1734 990 773 107 ------
NM_001092chr1772535 2266 2211 2095 1874 981 144 12482 ----
NM_001096chr172738 113 ----1693
NM_001100108chr196764 5735 3098 2939 2355 1773 1316 452 27 27993 5970 43020 1815 625 289 --
NM_001106chr3107755 7431 7324 7193 6565 3330 2984 1758 1537 819 1274 79699 9209 8228 2582 2533 2069 109 28466 7706
NM_001109977chr42200 71 ----1647
NM_001113490chrX43690 3562 451 142 32566 833 545 13157 --
NM_001116chr1663081 2710 2363 1904 1077 695 12245 --32722 2377 2307
NM_001121chr1061871 1750 1679 1396 1325 108 11685 --11531
NM_001122631chr114275 186 157 86 ------
NM_001143chrY1122 ------
NM_001148chr462250 1742 1430 552 519 219 ----12001
NM_001160chr1262606 2283 372 288 231 107 --4923 625 159 21 --
NM_001167chrX116517 6428 5559 5441 5168 4962 2561 1285 1029 657 126 --11904 --
NM_001173chr1444202 3419 3086 765 --11707 --
NM_001177chr1242393 2373 1918 207 ----11803
NM_001186chr2143239 3128 2837 1040 12534 32108 967 226 12319
NM_001195chr20129 ------
NM_001200chr201240 ------
NM_001201chr473910 3828 2755 2509 1407 196 99 --33836 3564 2857 --
NM_001204chr297017 6298 5742 5068 4783 2882 2729 915 323 32656 156 55 ----
NM_001206chr932424 2335 500 11237 22630 2313 1812
NM_001222chr104781 774 159 144 11889 ----
NM_001231chr11462 ------
NM_001256chr1762875 2830 586 560 520 173 ------
NM_001257chr16----11322 11523
NM_001259chr775667 4658 4531 4439 3908 1750 182 --22379 1305 --
NM_001270chr551122 1065 947 768 139 ------
NM_001278chr101226 --21029 384 --
NM_001289chrX41183 1120 1090 288 --21487 594 --
NM_001304chr1772994 2634 2578 2332 1488 1216 217 ------
NM_001326chr111440 1400 ----
NM_001331chr1122642 892 --12574 --
NM_001344chr141234 ------
NM_001351chr3----11400 11382
NM_001358chr4--1392 ----
NM_001364chr11124418 4221 3555 1903 1736 1721 1293 1018 961 805 730 133 11352 ----
NM_001379chr191273 ------
NM_001391chr1831169 896 57 --1119 --
NM_001401chr951604 1587 1158 569 560 --11432 --
NM_001412chrX83447 3409 3308 3031 2563 1303 214 101 23263 786 ----
NM_001430chr221999 1469 ------
NM_001432chr4153920 3619 3609 3316 3150 2984 2976 2949 2723 2411 1064 486 449 176 122 1187 13364 11177
NM_001438chr163581 3549 2691 1320 1149 696 12331 1721 --
NM_001443chr2144 ------
NM_001446chr61274 ------
NM_001448chrX21484 107 ------
NM_001452chr61731 ------
NM_001453chr641547 1243 1150 492 ------
NM_001495chr811099 ------
NM_001498chr63310 214 24 11162 ----
NM_001527chr644869 3785 1538 624 --24105 1157 14693
NM_001530chr142785 265 1995 ----
NM_001541chr111123 ------
NM_001543chr514837 ------
NM_001550chr72140 57 --1450 --
NM_001554chr11569 --2544 194 --
NM_001604chr111673 ----1305
NM_001608chr24936 770 227 68 ------
NM_001609chr1074370 4071 3605 3077 2931 1350 891 --1318 --
NM_001616chr223502 3289 --33013 781 262 12418
NM_001620chr111794 ------
NM_001634chr632039 1532 251 2257 44 11939 --
NM_001650chr1893833 3533 2843 2577 1422 1145 842 828 102 --13025 --
NM_001663chr1472790 2491 2059 1898 1879 984 690 32767 1915 455 12214 --
NM_001677chr141061 956 914 157 --11023 --
NM_001681chr123638 576 30 1549 1510 --
NM_001682chr1242427 2412 2220 2196 1517 1873 1136
NM_001683chr352718 2119 1772 795 333 ------
NM_001693chr811075 ----11239
NM_001698chr93429 40 31 ------
NM_001742chr771585 1537 727 611 497 262 245 ------
NM_001746chr542502 2451 344 245 --32765 941 492 --
NM_001748chr12948 213 --2433 334 --
NM_001753chr711651 1641 ----
NM_001754chr214891 823 521 455 13125 11641 --
NM_001755chr1652150 2021 1706 1451 252 ------
NM_001759chr1245301 4954 4452 3652 --34403 766 721 --
NM_001777chr344097 4063 1417 767 ------
NM_001786chr101152 ------
NM_001791chr111341 1982 1962 11227
NM_001797chr162649 504 ------
NM_001799chr52247 200 ----1235
NM_001806chr1942168 1949 1931 1036 --12620 12571
NM_001827chr9286 42 ------
NM_001839chr12677 650 ----1687
NM_001873chr45716 615 509 277 82 --144 --
NM_001892chr5----11544 --
NM_001918chr1118905 8859 8492 8263 7708 6215 3569 3040 1300 1165 756 26366 3607 78316 7924 7880 6949 6195 5907 1033 --
NM_001932chr171639 1884 ----
NM_001942chr1821514 742 ----11931
NM_001946chr1251153 1070 975 795 262 ------
NM_001949chr693129 2671 2576 2470 2245 2040 483 438 71 ------
NM_001951chr82584 90 ------
NM_001964chr541160 1075 993 930 ------
NM_001968chr41778 ------
NM_001969chr14113778 3531 3397 2885 2461 1414 1272 631 545 203 69 --23916 1243 --
NM_001977chr431285 1195 1107 ----11467
NM_001980chr1262130 1515 1468 1409 848 128 --1413 11565
NM_001981chr142429 1891 1882 490 ------
NM_001987chr1234234 3220 2616 11731 ----
NM_001999chr521317 294 --21036 407 --
NM_002006chr485782 4316 4273 3997 1924 1775 1343 189 15343 ----
NM_002015chr1343268 3012 2572 209 13318 --13168
NM_002024chrX71884 1808 1742 1661 1556 675 636 1592 ----
NM_002025chrX129306 9286 8562 6478 2628 2460 1665 1633 1554 1446 819 360 18893 17789 --
NM_002039chr43743 589 322 ------
NM_002051chr10--1721 ----
NM_002053chr141045 727 405 199 1957 ----
NM_002054chr22448 317 ------
NM_002069chr751624 277 110 94 25 ------
NM_002082chr51230 ------
NM_002092chr474898 3085 1930 1739 1536 1195 964 --14576 --
NM_002101chr21520 ------
NM_002126chr1773538 3437 2745 2656 1486 1305 839 ------
NM_002130chr531501 1270 224 11490 ----
NM_002135chr121553 ------
NM_002136chr12------1257
NM_002137chr732146 737 134 2668 167 ----
NM_002158chr273804 3628 3516 3320 3057 1061 329 ------
NM_002166chr2--1740 ----
NM_002199chr41977 ------
NM_002203chr543975 3815 3460 1245 11478 ----
NM_002210chr293193 3180 3077 2925 2869 2817 2323 336 259 ------
NM_002211chr104866 119 105 35 1413 ----
NM_002214chr765748 5686 5302 4787 4115 1213 13838 --23925 278
NM_002223chr1252625 2553 1023 235 199 33386 1555 1506 23624 1097 --
NM_002228chr121272 904 ------
NM_002253chr441393 1329 550 384 11319 1929 --
NM_002264chr364851 4224 3385 1684 1083 909 --11128 --
NM_002265chr17------1885
NM_002268chr331413 681 243 --31888 365 31 --
NM_002270chr564797 4782 4509 4178 2086 1743 25606 2100 31465 858 787 --
NM_002285chr274084 3891 3703 3578 3519 2987 673 23421 1094 33852 3825 2770 44002 3106 3098 1176
NM_002296chr141396 1330 607 293 --31787 1450 1321 --
NM_002310chr556507 1952 1701 1506 1215 11239 36074 547 165 12239
NM_002336chr1264031 3527 1721 509 440 43 ------
NM_002356chr662542 2417 2077 2045 1130 1048 ------
NM_002358chr4124 ------
NM_002382chr141209 ------
NM_002389chr141926 1713 527 206 --1246 --
NM_002408chr141597 ----1643
NM_002451chr973496 2643 1410 1153 512 428 96 ------
NM_002469chr121387 ------
NM_002482chr1150 ------
NM_002485chr852242 1735 447 275 140 1590 ----
NM_002493chr91344 ------
NM_002494chr4----121 --
NM_002500chr241274 991 507 104 --11177 --
NM_002515chr1432071 1389 123 ----1308
NM_002522chr1743876 3720 3588 3558 ----1997
NM_002527chr12157 ------
NM_002545chr1185183 4499 4072 1712 1442 928 473 414 34454 3437 3400 34793 3192 1926 --
NM_002547chrX64036 3841 3043 3021 1678 671 23520 1571 13301 --
NM_002581chr9125416 5039 4996 4786 4428 4168 3584 2044 1810 560 541 247 ------
NM_002590chr132200 179 --1171 --
NM_002594chr2021903 1824 21850 536 ----
NM_002595chr1251907 477 400 295 276 1621 ----
NM_002600chr151850 1812 1747 1596 1342 ------
NM_002613chr1665042 4171 4159 3914 1994 1344 15416 --11058
NM_002618chr2178 ------
NM_002645chr1132990 2017 2011 1239 1432 22709 1936
NM_002655chr8115039 4612 4450 4343 4153 3732 1877 1862 1271 398 33 --1870 11801
NM_002670chr31394 --171 11084
NM_002706chr22682 62 ------
NM_002718chr332337 551 267 ------
NM_002719chr1442287 1628 1499 937 --11616 12409
NM_002729chr101729 ------
NM_002731chr123041 3004 ------
NM_002734chr1731829 344 247 --21450 1408 --
NM_002736chr741988 1530 702 549 ------
NM_002737chr1745071 2411 1365 1232 ----26526 1478
NM_002740chr392841 2784 2681 2482 2117 1065 598 428 47 12759 ----
NM_002742chr145632 581 521 503 264 ------
NM_002745chr2293282 3008 2912 1646 1621 782 364 309 255 23388 1402 1670 --
NM_002753chr43841 660 332 1569 --1223
NM_002763chr1127 ------
NM_002806chr14175 ------
NM_002814chrX3722 625 66 ------
NM_002825chr71167 --1489 --
NM_002834chr1233914 1302 1060 13967 13288 1250
NM_002837chr12104547 4434 4376 4330 4103 1517 872 691 670 329 --34418 3098 1775 --
NM_002839chr973403 3160 2600 1294 1240 1095 576 12475 ----
NM_002843chr1133477 3347 3085 ----11356
NM_002849chr122307 184 --11059 --
NM_002857chr111680 ------
NM_002869chr111301 ------
NM_002886chr364860 3984 3693 3531 1222 261 13962 ----
NM_002893chrX294 34 ------
NM_002894chr181217 ------
NM_002902chr152597 191 ----1132
NM_002906chr1132281 589 83 1544 ----
NM_002912chr63901 192 155 --1238 --
NM_002924chr11570 1643 --128
NM_002930chr18163 ------
NM_002941chr341527 1376 460 96 ----1551
NM_002942chr351409 1229 1118 123 80 ------
NM_002956chr1231346 1206 1053 179 ----
NM_002959chr133385 2735 1750 --43945 1408 1291 161 --
NM_002968chr165894 401 385 219 46 ----1849
NM_002970chrX1295 ------
NM_002977chr283103 2664 1244 997 938 620 517 486 22458 286 22130 121 --
NM_003001chr11717 ------
NM_003010chr1772277 2249 2141 1635 512 396 336 ------
NM_003017chr621437 1335 ----11345
NM_003020chr152479 375 1137 ----
NM_003027chr151139 ------
NM_003034chr12178135 7999 7529 7152 6890 6407 5636 5190 2721 2465 2229 2028 1873 1334 1103 802 286 11133 37125 5883 880 11934
NM_003068chr87879 821 808 788 758 328 34 ------
NM_003076chr121286 ------
NM_003079chr1711053 ------
NM_003101chr131233 1106 441 ----1480
NM_003107chr6------11669
NM_003108chr287225 7009 6282 6210 6004 5781 5153 1499 27050 40 14715 25891 723
NM_003112chr773197 3138 2803 2721 2439 2150 577 2944 622 ----
NM_003115chr11458 ------
NM_003133chr16948 713 415 374 222 167 ------
NM_003142chr21259 ------
NM_003144chr652114 1751 1630 569 162 ----21911 76
NM_003161chr1773620 3603 3042 2977 2823 657 588 ------
NM_003182chr71386 ------
NM_003182chr71386 ------
NM_003184chr8144 ------
NM_003185chr201368 ------
NM_003199chr18125356 5347 5337 5225 4800 3839 3742 2092 1420 1195 324 210 11960 31653 1485 863 11364
NM_003206chr61308 ----1338
NM_003211chr12----2678 46 1126
NM_003220chr621628 1326 ------
NM_003247chr661833 1758 1594 678 668 328 --11738 --
NM_003262chr354739 4113 1498 399 119 14012 34459 591 552 14727
NM_003270chrX31182 459 412 1157 ----
NM_003272chr11673 --1711 1158
NM_003298chr386153 5830 5319 4180 4050 1739 940 653 15211 11353 --
NM_003299chr121189 ------
NM_003314chr51171 ------
NM_003317chr14--1805 ----
NM_003336chrX21126 199 ------
NM_003341chr31253 --1237 --
NM_003348chr1231716 1057 143 --11472 --
NM_003360chr41188 1211 ----
NM_003385chr21393 ------
NM_003392chr384286 4185 3836 3204 3096 3062 2894 1681 14150 ----
NM_003403chr142795 643 ------
NM_003406chr831880 706 692 --11271 --
NM_003410chrX53094 2472 2444 998 849 ------
NM_003411chrY1576 ------
NM_003412chr342867 2105 854 664 22044 1259 1700 --
NM_003413chrX21876 478 ------
NM_003418chr33837 710 331 ------
NM_003423chr1972568 1620 712 628 500 280 30 --12027 --
NM_003453chr131179 1554 ----
NM_003463chr642771 2724 2616 271 1823 22533 2406 --
NM_003468chr254357 3846 3710 1331 1006 --13295 14341
NM_003478chr1183369 3282 2146 2028 518 495 434 362 ------
NM_003483chr1241917 1892 916 268 22824 2048 ----
NM_003489chr2173476 2986 2935 2817 2506 329 302 12494 --1988
NM_003564chr1--154 ----
NM_003566chr12113381 3294 2869 1307 591 384 374 337 296 266 57 --23157 2585 --
NM_003569chr62449 47 ------
NM_003574chr1875683 4429 4089 2272 2244 1413 683 15710 --11758
NM_003589chr1331236 360 42 ----11426
NM_003590chr252620 1632 1407 1029 1016 ----1439
NM_003591chr101325 ------
NM_003603chr471876 1730 1500 863 807 690 109 ------
NM_003607chr193969 2988 2713 1241 666 610 566 509 314 32719 1457 1055 --2979 553
NM_003615chr363524 3322 2929 2644 1243 1121 13298 ----
NM_003617chr164655 4608 4016 3966 3221 758 --13845 23168 1182
NM_003618chr231175 360 298 1291 ----
NM_003624chr1911440 ------
NM_003629chr143510 2210 1368 718 --33344 982 385 --
NM_003658chr111329 ----1826
NM_003659chr221125 1112 ----1843
NM_003672chr141295 752 279 193 ------
NM_003675chr101512 ------
NM_003677chr1242079 2052 2024 1823 --31962 1913 485 --
NM_003688chrX2245 233 ------
NM_003692chr93929 909 259 1957 ----
NM_003713chr131425 1319 1279 11298 190 --
NM_003722chr352055 1690 631 399 344 --12391 --
NM_003744chr1421294 338 ------
NM_003749chr1392385 2126 2093 1714 1651 1584 1511 854 389 1843 1600 --
NM_003750chr101784 ------
NM_003759chr474084 3545 3417 1643 1579 1249 311 ------
NM_003764chr61787 ------
NM_003772chr1131249 1157 122 ------
NM_003773chr3163 ------
NM_003781chr351731 1346 1240 679 424 --1367 1344
NM_003783chr181206 1197 980 964 937 485 400 300 --1931 --
NM_003794chr31801 --2354 155 --
NM_003797chr11162 --1133 --
NM_003799chr1873992 3394 3316 3277 1426 464 113 21037 784 --1139
NM_003816chr82557 266 --2392 187 --
NM_003825chr1511295 ------
NM_003858chr144658 599 583 104 ------
NM_003861chr1411961 ----12207
NM_003864chr4--164 ----
NM_003877chr121999 --2765 50 --
NM_003885chr1762698 2492 2351 1859 1642 38 --2800 795 --
NM_003895chr2151932 1816 875 631 102 11463 ----
NM_003902chr15855 305 292 253 149 173 ----
NM_003913chr684315 4104 3708 2860 514 412 248 73 11234 ----
NM_003930chr751698 405 202 191 138 --11844 --
NM_003934chr921137 220 --1861 --
NM_003939chr1083948 3624 3411 3137 2573 767 598 451 11021 23777 3391 --
NM_003941chr752505 1589 970 528 313 21763 428 ----
NM_003951chrX2302 72 ------
NM_003955chr17----11248 --
NM_003958chr653766 2754 2565 958 466 --12854 --
NM_003966chr5147679 7356 7022 6796 6758 5533 5347 4995 4797 3088 3005 635 420 113 16247 ----
NM_003968chr31242 ------
NM_003972chr103992 861 21 11061 --1554
NM_003985chr171681 ------
NM_003994chr12134217 4211 3537 3481 3286 3009 2948 1615 1408 1177 1052 925 650 --11504 --
NM_004028chr1893833 3533 2843 2577 1422 1145 842 828 102 --13025 --
NM_004035chr1765027 3870 3559 1176 237 184 11512 34357 4183 3249 1753
NM_004050chr1422419 233 ------
NM_004067chr71424 11378 2554 479 1296
NM_004075chr121222 ------
NM_004100chr672475 2433 2365 978 689 547 440 22308 984 ----
NM_004114chrX1348 ------
NM_004116chr22464 353 ------
NM_004117chr642204 1434 1354 89 --1486 --
NM_004132chr1021047 995 ----2954 327
NM_004161chr221210 89 ------
NM_004162chr341067 973 832 489 ----11277
NM_004170chr931660 608 451 ------
NM_004171chr11189412 9273 8941 8824 8713 8436 8137 7227 6937 5871 5857 3000 2739 2627 1928 1416 1380 97 47115 2745 1556 310 28169 8081 --
NM_004187chrX21443 1177 ------
NM_004211chr11--1143 ----
NM_004225chr811310 ------
NM_004229chrX41932 1885 1771 838 11744 --11362
NM_004232chr1853331 3170 1414 1072 728 1246 --11378
NM_004253chr91338 ------
NM_004272chr531837 1445 286 ------
NM_004274chr1452770 2641 2434 1081 610 13155 ----
NM_004275chr611435 ------
NM_004280chr6278 55 ------
NM_004285chr166429 5568 4557 4088 3908 655 44758 1085 458 201 16129 14646
NM_004293chr923571 2969 1867 --13385
NM_004296chr1483959 3556 3515 3449 3338 1515 1234 1152 --23753 3084 --
NM_004297chr9--1123 ----
NM_004304chr2----1326 --
NM_004326chr11155 ------
NM_004338chr18156268 5510 5182 5161 5069 4630 2469 1805 1538 1528 1076 986 960 804 541 24797 2406 24736 1382 --
NM_004342chr742265 2011 534 350 ----11781
NM_004343chr191533 ------
NM_004370chr621920 219 11907 --1237
NM_004376chr1021067 108 21534 531 ----
NM_004380chr1632329 454 441 1627 --12062
NM_004384chr541601 783 757 739 --12212 --
NM_004392chr1382558 2438 2010 1904 945 850 502 223 1757 ----
NM_004429chrX21416 442 ------
NM_004438chr253294 3060 2705 2101 1082 ------
NM_004440chr641651 1358 668 308 ------
NM_004449chr213922 351 314 1262 --11332
NM_004451chr111701 ------
NM_004458chrX62583 2554 1851 964 92 30 --32537 340 195 --
NM_004464chr443916 3317 2997 2755 1387 ----
NM_004474chr111057 ------
NM_004480chr141228 ------
NM_004482chr24231 146 120 104 ----1829
NM_004499chr51450 ------
NM_004500chr1482074 1510 797 760 525 492 484 320 ------
NM_004504chr223039 1004 21972 754 1821 1549
NM_004505chr1781875 1850 1588 1568 1410 1276 781 308 --199 --
NM_004519chr8------136
NM_004521chr101131 ------
NM_004523chr101508 ------
NM_004557chr61133 ------
NM_004580chr152673 388 1316 1350 --
NM_004586chrX103787 3515 3341 2036 1788 1417 1062 659 643 507 ----14576
NM_004592chr121210 ------
NM_004595chrX1159 ------
NM_004598chr543212 3137 2848 2138 --1321 --
NM_004602chr2031312 1065 944 ------
NM_004612chr9124475 4404 4323 4255 4066 3643 3300 3195 1411 1402 1247 462 ------
NM_004630chr1111088 ------
NM_004660chrY22237 687 --21941 1610 --
NM_004663chr1531131 537 288 --1421 --
NM_004705chr11--167 ----
NM_004709chrX31214 719 681 --1687 --
NM_004712chr171491 ------
NM_004713chr141798 ------
NM_004719chr12112879 2774 2413 2401 448 395 371 342 319 290 47 ------
NM_004725chr1041196 1047 945 182 21521 595 ----
NM_004726chrX95781 5448 4609 3720 3695 3566 1163 1020 850 ------
NM_004738chr2072637 726 706 671 204 177 95 11928 ----
NM_004745chr8126541 5616 2621 2600 2354 2171 2052 1894 1877 1124 901 56 --34742 4551 1083 15149
NM_004768chr151104 958 903 392 384 ------
NM_004779chr51330 ------
NM_004781chr11119 ------
NM_004781chr11119 ------
NM_004788chr1132591 992 932 ----143
NM_004798chr2043631 2891 1459 224 22681 1034 11059 13146
NM_004815chr1124930 3751 3615 3405 3188 3129 1835 850 659 481 422 307 --13115 --
NM_004820chr8187 ------
NM_004834chr283160 2786 2586 2480 1361 1142 982 540 31254 731 120 23084 227 --
NM_004836chr2--138 --1347
NM_004842chr631368 562 501 ------
NM_004857chr1464035 3676 3466 1297 980 434 23073 566 21531 183 --
NM_004862chr161642 11453 11026 --
NM_004866chr574740 4083 1851 1227 1084 758 524 23893 1981 24461 791 --
NM_004871chr1744287 3997 3201 119 13561 24087 682 --
NM_004874chr81205 ------
NM_004879chr111882 ------
NM_004902chr201547 1241 1160 1689
NM_004904chr776610 4559 4527 2496 2228 2106 1316 --11382 11938
NM_004926chr1441734 1699 1527 1424 ------
NM_004936chr962000 1988 1209 1200 1066 308 21154 888 11039 --
NM_004949chr1862006 1318 871 516 506 350 ----21979 1489
NM_004952chr11647 ------
NM_004956chr724123 3902 --11175 12844
NM_004966chr101688 ------
NM_004969chr10236 26 2186 141 ----
NM_004985chr1264529 4340 4262 4242 519 279 23239 117 1845 --
NM_004990chr12158 ------
NM_004992chrX78472 8028 7651 6751 5812 2777 806 38150 7556 1863 11724 11750
NM_004992chrX78472 8028 7651 6751 5812 2777 806 38150 7556 1863 11724 11750
NM_004999chr633772 1477 600 12864 14142 --
NM_005010chr772094 1829 737 307 252 193 186 11524 11644 11561
NM_005016chr121276 ------
NM_005032chrX3994 983 701 --11082 --
NM_005034chr82253 218 --1637 --
NM_005036chr2288309 7990 7054 5124 3001 2252 1825 290 28101 7409 36086 3119 916 --
NM_005045chr71618 ------
NM_005056chr1294246 3830 3717 3659 3601 3426 3417 2089 1118 25118 438 ----
NM_005063chr1043171 2765 2391 571 ------
NM_005065chr1464963 4622 4502 4309 3901 3697 23830 1803 33923 2108 1816 --
NM_005086chr12--1718 ----
NM_005093chr2075305 5220 5145 4787 3604 1018 86 1732 21622 1414 1862
NM_005103chr111272 ------
NM_005116chr2023990 171 ----23100 2962
NM_005121chr1752627 2504 2478 1208 465 ------
NM_005156chr9105258 5251 5210 4483 4277 3636 1582 1542 1358 1289 11244 1669 14763
NM_005171chr1221188 923 --1993 --
NM_005180chr1031066 474 464 ------
NM_005197chr1445678 2135 1350 1251 --14627 --
NM_005207chr2282786 2381 1480 1457 1244 1051 924 151 --32708 1075 625 --
NM_005219chr551737 1688 1594 1195 1187 11213 1202 --
NM_005230chr121404 ------
NM_005233chr322562 1610 ----12544
NM_005235chr297759 6632 6315 5435 2854 2786 1354 275 134 --25227 1078 26588 4860
NM_005238chr1163445 3408 1387 1131 945 476 ------
NM_005252chr141208 ------
NM_005254chr1551150 1070 1052 942 187 11023 ----
NM_005277chr461932 1654 1341 716 292 35 1698 --11911
NM_005311chr752660 2412 2327 2177 2120 --1766 12716
NM_005316chr1131026 804 798 ----1753
NM_005329chr166653 490 205 154 138 31 11603 12002 11945
NM_005339chr4104338 3925 3165 3131 1362 1294 1260 1084 943 785 13266 13030 --
NM_005349chr41224 ----1168
NM_005358chr1351893 1222 729 545 431 21874 63 2537 219 1448
NM_005359chr1836221 4538 532 1987 36379 5014 2131 --
NM_005378chr23835 805 768 ------
NM_005385chr342587 1792 1761 63 ------
NM_005388chr961552 1499 1387 1363 1210 394 ------
NM_005399chr133874 1683 1193 --24178 3517 1797
NM_005400chr253042 2911 2824 2708 541 148 --1221
NM_005406chr182992 223 172 --11147
NM_005433chr1852675 1750 1004 961 180 --1629 --
NM_005436chr1044154 3789 1525 1318 --31086 856 162 --
NM_005440chr1733247 2980 2974 --13317 12906
NM_005443chr41198 ------
NM_005455chr171820 1704 1550 1248 693 146 109 11475 ----
NM_005475chr1263280 3263 2355 636 224 71 ------
NM_005487chr223431 293 147 ------
NM_005497chr1776003 5959 4746 4688 4533 1558 1001 --35432 1663 1193 --
NM_005502chr963247 2921 2505 409 156 141 ------
NM_005504chr1295952 5859 5143 4298 1750 1515 597 362 243 --25408 112 15909
NM_005509chr541676 1544 1157 143 21902 1563 ----
NM_005517chr121060 980 11351 --21121 86
NM_005520chr51118 ------
NM_005542chr721838 1765 --11752 --
NM_005563chr11331 --2224 113 --
NM_005575chr51191 ------
NM_005578chr364886 1847 1593 1066 525 195 11265 ----
NM_005593chr123534 521 490 ------
NM_005596chr995609 5274 4838 2116 1933 1869 1299 880 797 15506 ----
NM_005603chr1851998 1946 1896 1725 26 ------
NM_005604chr622580 2356 --1404 12261
NM_005618chr61565 ------
NM_005627chr62904 886 ------
NM_005639chr1221391 1203 ----1163
NM_005647chrX73261 3113 3099 2648 2347 720 705 ----13213
NM_005655chr81527 ------
NM_005665chr174561 4479 4354 3676 3628 1733 291 --13096 --
NM_005668chr584422 4308 4009 3716 1658 588 276 243 ----11453
NM_005685chr7149 ------
NM_005711chr5--1715 ----
NM_005722chr232102 1819 1616 ----11980
NM_005724chr153719 628 266 2749 729 ----
NM_005732chr551466 1381 1017 301 295 --134 --
NM_005738chr741656 1399 643 443 --1176 --
NM_005739chr1582400 2369 2352 2337 591 215 162 65 ------
NM_005746chr741911 1828 855 175 ------
NM_005749chr174615 562 534 34 ------
NM_005759chr254575 4184 4102 1759 575 11644 --12905
NM_005772chr92764 757 ------
NM_005775chr81745 ------
NM_005786chr1851292 1185 1127 1041 807 ------
NM_005801chr173781 670 106 ------
NM_005811chr12--1268 ----
NM_005819chr163409 2951 2598 2287 824 407 --22903 552 --
NM_005828chr1744269 3823 3392 3386 24642 3723 ----
NM_005832chr331327 138 90 1127 21303 314 --
NM_005840chrX97006 6992 6972 2933 2507 1443 348 333 162 --15586 26731 1699
NM_005841chr411099 ----11184
NM_005857chr111511 ----11067
NM_005870chr1331134 410 117 11455 ----
NM_005882chr42935 702 ------
NM_005885chr531202 285 111 ------
NM_005898chr1152773 2451 2284 663 513 ----22949 2158
NM_005901chr1898270 8116 7393 2053 1965 1154 955 317 38 28286 8158 16951 --
NM_005902chr1593987 3730 3550 3483 944 921 762 751 51 1437 12826 13978
NM_005903chr575152 3337 2071 1269 1121 763 323 1218 ----
NM_005909chr5114221 4024 3450 2998 2614 1140 978 961 865 411 145 --1723 14191
NM_005911chr21523 ------
NM_005933chr1152586 2444 2314 959 31 ----13010
NM_005935chr425253 255 21170 190 21655 1434 --
NM_005941chr873724 3636 3252 1457 1389 619 195 ----23424 2595
NM_005966chr272394 2144 1966 638 484 311 304 1960 ----
NM_005990chr572774 2712 2663 2047 904 685 232 ------
NM_006007chr9104513 4347 4058 3962 2756 2731 937 346 199 75 --1277 --
NM_006011chr1513876 14065 11408 11673
NM_006015chr111332 --11222 --
NM_006033chr1822291 1509 ------
NM_006035chr1411241 ----199
NM_006037chr221220 1161 ----11262
NM_006038chr2031522 828 115 11739 --12144
NM_006040chr1651431 1270 463 333 126 ------
NM_006047chr2043297 2817 2487 53 --22977 1165 --
NM_006060chr743800 3380 3150 1331 13281 13658 --
NM_006064chrX2263 68 ------
NM_006070chr31397 --128 --
NM_006079chr61236 ------
NM_006080chr7122958 2615 2605 2599 2592 2552 2211 1034 735 674 657 69 ----1226
NM_006089chrX61746 1729 1702 1386 1308 707 --1321 --
NM_006095chr4104432 4386 3743 3608 3443 3293 1273 996 642 584 --24122 875 11195
NM_006106chr1153312 2694 2171 977 177 12226 12932 --
NM_006133chr1112384 12508 ----
NM_006134chr2111443 ------
NM_006141chr16102742 2735 2460 1932 1714 1065 987 950 616 167 ------
NM_006154chr1592719 2586 2261 1790 1069 941 933 666 427 12287 ----
NM_006186chr231005 384 334 ------
NM_006194chr1431258 1203 849 ------
NM_006195chr961416 1338 1202 1003 373 45 ------
NM_006196chr21271 ------
NM_006197chr832167 94 47 --1280 --
NM_006206chr442886 2071 701 495 12025 --21008 80
NM_006238chr612005 ------
NM_006246chr1441156 1024 408 52 ------
NM_006251chr572779 2656 2508 1118 544 207 121 1172 12252 --
NM_006252chr1157080 6972 6904 6694 6357 5904 5459 5370 3026 2542 2303 1496 1250 941 322 15243 ----
NM_006258chr10----1331 --
NM_006267chr231573 1406 118 ------
NM_006281chr81802 ------
NM_006281chr81802 ------
NM_006283chr864171 4142 1250 1196 1087 161 ----13133
NM_006290chr621948 1573 ----1591
NM_006298chr693186 3005 2860 2359 2304 2236 956 486 234 ------
NM_006300chr1972380 2103 1958 1866 1698 1636 210 ------
NM_006313chr1261626 1496 1442 1246 150 121 ------
NM_006323chr46671 583 575 545 300 109 1737 ----
NM_006330chr851401 1330 1320 438 263 11181 ----
NM_006343chr21362 ------
NM_006364chr141923 ------
NM_006379chr752120 2085 2050 1808 441 --12283 12018
NM_006380chr1763820 1318 844 674 617 466 1450 1999 23160 738
NM_006393chr1031064 286 37 34413 3190 780 2402 331 --
NM_006401chr91172 ------
NM_006416chr6------1190
NM_006421chr831269 1141 1041 21115 953 ----
NM_006434chr1072574 2219 2139 956 614 597 402 13163 1820 --
NM_006449chr252081 1899 1664 1556 1445 ------
NM_006451chr51124 --1374 --
NM_006457chr443985 3963 3728 3090 ------
NM_006460chr1771778 1645 1113 380 274 157 56 ------
NM_006474chr11476 --12006 1379
NM_006489chr1432071 1389 123 ----1308
NM_006496chr151847 1528 1469 758 313 2735 119 ----
NM_006504chr1082923 2786 2773 2604 2487 473 398 188 ------
NM_006519chr6------1120
NM_006530chr12----1467 --
NM_006534chr2063026 2524 1257 744 716 707 ------
NM_006538chr2104057 3719 2631 1341 1032 771 748 300 215 96 133 11382 --
NM_006539chr161506 ------
NM_006540chr861496 991 423 330 320 253 ------
NM_006544chr1485698 4671 4315 4154 3818 1856 1219 897 1636 --24965 246
NM_006546chr1756356 1460 1442 527 517 36112 4586 354 ----
NM_006547chr72192 169 --12099 --
NM_006548chr321141 359 --139 --
NM_006561chr1075776 3905 3888 3768 2333 750 714 ------
NM_006572chr1753214 2672 1382 772 763 --1208 --
NM_006575chr1441206 1008 560 505 --1901 --
NM_006577chr2--1965 ----
NM_006599chr1697313 7254 7041 6341 6245 6162 5988 3260 2666 1566 11463 --
NM_006614chr363155 2590 1416 1190 458 229 13520 --13177
NM_006618chr121585 34 ------
NM_006620chr674770 4737 4170 3971 3545 2945 342 --23954 66 14304
NM_006624chr1062153 2077 1578 1564 1423 373 ------
NM_006628chr1544512 3177 1363 183 11015 23486 1356 11081
NM_006629chr1852815 2645 1104 863 792 ----1729
NM_006648chr91145 ------
NM_006654chr1263690 3428 3071 1923 367 57 ----1160
NM_006670chr62624 178 146 ----
NM_006682chr761974 1898 1845 1817 935 165 ------
NM_006699chr121799 770 22664 2042 --22105 2055
NM_006706chr51609 ------
NM_006717chr982950 2852 2793 2672 2183 1106 342 44 --33168 2811 880 --
NM_006722chr383028 2973 2846 2174 469 391 370 230 12596 1581 --
NM_006726chr42500 83 ------
NM_006727chr51423 ------
NM_006729chrX95153 5101 4256 3955 1726 1600 1351 102 51 21428 1374 15389 --
NM_006746chrX41400 1383 1356 1348 ------
NM_006750chr1687984 6625 6470 6179 5529 5381 2362 1126 11777 27570 2012 17647
NM_006754chr741259 965 453 183 --1796 --
NM_006763chr122125 2106 --12155 --
NM_006766chr842234 1887 1715 362 11880 ----
NM_006775chr6102863 2781 2750 2570 2395 1231 901 656 456 441 1957 2986 107 --
NM_006777chrX21869 890 1568 ----
NM_006805chr521430 1299 --11249 --
NM_006806chr211411 ------
NM_006807chr1711324 ------
NM_006811chr204758 400 316 125 1166 ----
NM_006826chr23464 280 196 2848 266 21121 355 --
NM_006827chr1463254 3131 2535 2431 1358 883 ------
NM_006832chr1451070 845 725 386 372 --1796 --
NM_006838chr121167 --1502 2534 513
NM_006851chr1262875 2463 2169 2028 879 620 --11983 12159
NM_006852chr1762084 1833 926 682 583 346 12666 1950 --
NM_006873chr223201 3120 12844 --22374 508
NM_006885chr1653957 3721 2802 2720 486 11581 14043 --
NM_006888chr1463046 2957 2912 2779 1087 322 1492 12247 --
NM_006908chr741473 1029 443 203 1424 ----
NM_006910chr16164 ------
NM_006912chr152531 1734 1668 450 268 ------
NM_006914chr951298 1176 427 157 37 --11241 --
NM_006918chr1165363 4570 1409 853 714 422 ------
NM_006922chr262551 2408 2151 1934 712 381 11730 ----
NM_006924chr1763427 3204 3178 2727 1653 942 ----13141
NM_006930chr531521 1346 213 --1798 --
NM_006931chr1292178 1990 1820 1714 1693 1473 1444 549 347 ------
NM_006937chr171496 ------
NM_006940chr1231743 1503 510 11692 ----
NM_006965chr182842 130 184 ----
NM_007007chr1294279 4265 3809 3625 3272 3005 1837 1330 406 --21729 852 --
NM_007011chr1566730 5944 5746 5505 5116 4790 11128 ----
NM_007029chr8188 ------
NM_007034chr1--174 ----
NM_007036chr55811 631 269 217 124 1223 ----
NM_007038chr21135778 4394 4368 4350 4159 2372 1460 1033 942 761 575 261 54 1777 35826 4520 2165 --
NM_007039chr1451905 1835 747 713 350 ------
NM_007050chr2087506 6263 5795 5040 3189 2291 1956 347 27277 4922 16474 --
NM_007084chr1321346 124 ------
NM_007106chr1332488 1848 1788 1809 1248 --
NM_007114chr373308 2878 2026 1136 472 151 35 ------
NM_007124chr631939 1273 297 ----11356
NM_007137chrX64848 3364 2047 735 331 180 --1409 1480
NM_007146chr1731908 1815 502 32094 1971 1073 --11895
NM_007159chr31158 ------
NM_007166chr1131568 1393 1314 --11351 --
NM_007174chr1221999 714 ------
NM_007175chr823166 2859 --1374 1328
NM_007187chr133687 347 119 ------
NM_007191chr121603 ------
NM_007195chr182962 191 ----12859
NM_007197chr121176 ------
NM_007198chr811518 ------
NM_007203chr963963 2997 2666 1462 400 99 1125 23462 1212 --
NM_007217chr31351 ------
NM_007222chr871494 1480 1218 1144 569 238 200 --11398 --
NM_007242chr161160 ------
NM_007246chr41883 ------
NM_007249chr13109146 8373 8299 7015 6250 5908 3741 2933 2248 987 26558 1486 ----
NM_007257chr832830 2502 68 22073 570 32227 1981 261 12233
NM_007269chr12413 90 ------
NM_007282chr31946 1929 ----
NM_007292chr1765027 3870 3559 1176 237 184 11512 34357 4183 3249 1753
NM_007347chr1523212 3070 --23035 439 --
NM_007350chr12104635 3759 3050 2989 2877 1661 1569 862 300 191 ----23447 366
NM_007372chr172563 321 ------
NM_012072chr20164533 4413 4346 3234 3089 3020 2915 1683 1633 1549 1094 1031 805 710 591 159 --11343 13057
NM_012083chr1041268 994 500 203 ------
NM_012096chr383743 3566 3524 2492 1066 960 611 201 --12969 --
NM_012097chr231872 1692 421 ------
NM_012115chr62599 440 ------
NM_012120chr662663 2623 2571 2297 1982 436 --12767 --
NM_012141chr1353355 2960 1609 1562 466 14085 12663 --
NM_012154chr82848 696 1550 ----
NM_012158chr1331808 370 41 ------
NM_012164chr987229 6403 4684 2802 2257 1281 265 122 --15431 11019
NM_012175chr113762 687 66 --1701 --
NM_012207chr102975 877 ------
NM_012214chr2136196 5952 5351 4550 4456 4165 4006 2307 1801 816 602 569 487 ------
NM_012215chr101775 --1299 --
NM_012218chr1932031 576 141 ----21979 513
NM_012238chr103709 565 384 --11524 --
NM_012243chr11845 ----1620
NM_012249chr263560 1423 1073 751 672 524 ------
NM_012252chr775352 5112 4907 4528 3259 1390 513 ----11340
NM_012255chr201426 ------
NM_012262chr164455 4176 3995 3539 1401 557 ------
NM_012281chr762309 2287 1586 948 479 337 --22118 101 --
NM_012286chrX4571 545 205 101 ------
NM_012287chr384498 4378 3124 2855 882 680 619 48 14415 34442 1286 571 --
NM_012297chr461781 1009 880 704 474 384 ------
NM_012300chr562494 2246 1013 781 280 133 22111 772 ----
NM_012302chr111148 ------
NM_012309chr1184885 4820 1878 1457 1026 532 363 282 14437 24829 1973 13517
NM_012325chr2061503 1442 1135 445 338 137 1267 ----
NM_012334chr534572 824 416 ----23026 707
NM_012340chr201221 ------
NM_012347chr652297 835 812 682 394 ------
NM_012382chr554136 4095 1400 542 300 13575 --13797
NM_012399chr2241938 617 428 340 1233 ----
NM_012406chr1251283 1266 958 281 36 1437 ----
NM_012421chr11132 ------
NM_012434chr6135 ------
NM_012479chr762742 2610 2447 2165 2062 1067 11023 ----
NM_012482chr13632 120 38 ------
NM_013229chr1262606 2283 372 288 231 107 --4923 625 159 21 --
NM_013231chr1474138 3254 3192 3144 2774 508 109 --1652 --
NM_013233chr221388 1285 ------
NM_013243chr1541295 1247 1181 1010 ------
NM_013255chr798863 8844 7708 7139 5985 3466 2791 2727 1227 13116 12320 --
NM_013257chr852337 1608 1588 516 138 --11846 --
NM_013261chr493750 3248 3227 3001 1329 1218 1071 957 401 --32557 2332 1167 1654
NM_013262chr61363 --11283 --
NM_013269chr1263758 3067 2755 1227 1084 837 23599 879 --11446
NM_013281chr2061286 1178 958 431 199 117 ------
NM_013296chr13431 418 385 ------
NM_013300chr121154 ------
NM_013316chr751031 956 776 381 148 --130 --
NM_013320chr121140 ------
NM_013372chr1553031 2750 2170 2085 572 --139 12253
NM_013374chr353149 896 817 591 94 --32108 2015 119 --
NM_013377chr122633 616 ------
NM_013380chr192284 79 ------
NM_013411chr111085 22783 1761 12698 12014
NM_013437chr841258 905 438 203 --1105 --
NM_013444chrX51159 1046 933 139 30 ----1475
NM_013448chr14----1159 --
NM_013943chr173245 2960 2435 1054 947 414 109 42884 2650 2644 671 --22945 1038
NM_013989chr1465001 4959 4905 3177 547 312 24838 4380 --23770 3150
NM_013995chrX42216 1680 969 846 --12150 1864
NM_013996chr71386 ------
NM_013996chr71386 ------
NM_013997chr71386 ------
NM_013997chr71386 ------
NM_013998chr71386 ------
NM_013998chr71386 ------
NM_014011chr252612 2140 770 546 497 --31008 735 525 11928
NM_014021chr152546 2247 625 385 238 23409 770 11191 --
NM_014023chr1062699 1803 723 255 159 57 ------
NM_014043chr331561 182 42 ----164
NM_014044chr21180 ------
NM_014048chr16115193 4904 4624 4064 3976 3741 3345 1344 768 651 317 24868 4771 ----
NM_014109chr841211 1109 499 78 --1998 --
NM_014112chr8125409 5226 5066 4574 4195 3944 3773 3746 1505 1421 1116 566 11397 34877 1636 595 --
NM_014117chr1642381 2206 778 754 1788 1944 --
NM_014141chr7114689 4589 4522 3869 3342 1951 1374 959 751 634 402 24563 4496 ----
NM_014155chr1187058 6817 6685 6081 5667 2860 2052 1037 --16615 --
NM_014181chr242373 605 549 360 --21007 428 12814
NM_014191chr121260 ----186
NM_014217chr141893 1751 1478 446 1728 21193 333 21561 1300
NM_014232chr1711682 ------
NM_014232chr1711682 ------
NM_014250chr223431 293 147 ------
NM_014260chr6177 ------
NM_014263chr1021191 375 ----1429
NM_014288chr12229 197 ------
NM_014290chr9----158 --
NM_014305chr132654 90 ----2665 144
NM_014315chr141175 ------
NM_014319chr1241838 1718 1458 1430 11760 ----
NM_014331chr4127661 7095 6909 6676 6023 5913 5778 5738 5539 5444 207 186 17424 ----
NM_014363chr1341297 1078 910 843 ------
NM_014372chr121309 685 --11561 1644
NM_014376chr532497 2374 643 ------
NM_014382chr341688 1550 712 501 ------
NM_014393chr8--22091 1702 ----
NM_014421chr442108 798 234 54 189 2193 188 --
NM_014423chr564142 4038 3744 3598 1375 753 11118 11782 1407
NM_014445chr332416 1746 365 12058 11855 --
NM_014447chr431518 1313 184 ------
NM_014456chr1041876 1839 1370 624 --11337 --
NM_014458chr141063 988 451 162 1186 ----
NM_014494chr1652208 1583 1529 817 168 ------
NM_014504chr742102 1824 1409 83 --1728 --
NM_014548chr1521055 540 1238 31148 1132 648 --
NM_014554chr1221807 140 --12158 1864
NM_014570chr221175 ------
NM_014572chr1321522 434 ------
NM_014574chr1441572 1499 1488 1325 ------
NM_014575chr31224 ------
NM_014633chr112595 541 1525 ----
NM_014647chr1652068 1973 1603 868 387 ------
NM_014655chr132339 1977 762 --1768 --
NM_014662chr221450 ------
NM_014667chr341879 1825 815 281 --21984 237 1633
NM_014670chr241563 1242 1027 282 --11262 --
NM_014671chr711320 ------
NM_014674chr333965 3910 3067 11266 33379 3136 1376 --
NM_014676chr121467 275 ------
NM_014683chr1772094 1731 1572 1379 1332 408 274 1856 ----
NM_014707chr751917 738 713 596 429 ----21524 102
NM_014711chr1662054 1824 1445 773 730 503 --1716 --
NM_014717chr192824 104 ------
NM_014720chr1031550 1463 1426 ------
NM_014721chr6107086 5622 4746 2196 2099 1245 673 463 226 202 22875 2597 35777 5368 340 11608
NM_014727chr19--1215 ----
NM_014729chr832286 2185 392 1821 --11922
NM_014733chr551978 1488 887 785 761 12022 --12146
NM_014735chrX22005 1522 ------
NM_014738chr171251 ----1719
NM_014739chr654211 3678 1354 877 83 ----13954
NM_014741chr1112149 ------
NM_014742chr201107 ------
NM_014743chr472909 2892 2563 2031 965 896 776 13043 ----
NM_014750chr142211 84 ------
NM_014751chr872099 1753 697 460 445 415 312 ----11946
NM_014752chr1121615 329 --11962 --
NM_014755chr294244 4204 3700 3666 3167 3149 1633 1377 772 13131 24015 1717 --
NM_014764chr123961 867 63 ----11279
NM_014765chr172293 2285 2086 832 744 634 375 12629 22666 1878 --
NM_014779chr33973 469 175 ------
NM_014781chr81442 11054 --1254
NM_014782chrX1137 ------
NM_014787chr122380 2231 22079 453 12825 --
NM_014791chr91280 ------
NM_014795chr221321 453 1156 11426 --
NM_014803chr1032794 1882 1124 ----22919 77
NM_014804chr1731268 204 197 11076 ----
NM_014810chr173562 3333 3284 3235 1460 387 366 13478 1720 --
NM_014820chr321712 374 21266 669 1829 --
NM_014826chr193969 2988 2713 1241 666 610 566 509 314 32719 1457 1055 --2979 553
NM_014827chr111718 ------
NM_014829chr542355 1493 230 75 ------
NM_014832chr1362079 1827 1669 1485 1363 438 1193 ----
NM_014839chr152491 1958 403 300 192 ------
NM_014848chr15102489 2445 2359 1138 930 898 831 321 280 56 ------
NM_014850chr374545 4096 3992 3607 3066 1812 1179 24251 137 13109 --
NM_014872chr991920 1807 1575 405 398 305 200 180 147 12287 1241 --
NM_014873chr184777 4709 4460 3630 1934 1913 948 726 33488 1089 743 11253 --
NM_014877chr17107782 7758 7152 6844 5795 1091 838 442 339 87 25016 222 26978 5824 --
NM_014881chr10145 ------
NM_014888chr751399 1378 1254 599 96 ----1630
NM_014893chrY52132 902 615 126 51 2908 535 --1499
NM_014903chr1252050 1901 1692 1576 1512 ----1346
NM_014904chr10104017 3845 3730 3572 3434 2717 2634 2582 2527 622 23552 3505 12981 --
NM_014906chr1743318 3289 1159 130 --1374 11095
NM_014909chr1453550 2759 1260 1222 1209 11154 23536 1227 --
NM_014912chr1043534 3447 938 473 1299 13133 1194
NM_014918chr1531050 235 205 --1631 --
NM_014920chr693448 3182 3067 3031 2721 2468 1311 871 378 2456 88 31466 393 189 --
NM_014923chr1332146 1991 180 ----11969
NM_014934chr1323758 1414 11350 12786 13981
NM_014946chr273118 1152 900 782 298 185 179 1741 ----
NM_014947chr172926 2768 2762 2692 484 224 48 22943 2587 32329 1050 964 12631
NM_014950chr1431661 1627 458 11194 ----
NM_014962chr2082910 2859 2245 2127 1023 850 602 38 --1172 12869
NM_014969chr161125 781 394 316 222 26 --11081 1961
NM_014974chr1031768 1269 395 273 41 --11715
NM_014978chr1071849 1730 1509 677 548 453 227 ------
NM_014982chr1495079 3988 3456 1951 1265 1090 1037 577 480 11675 ----
NM_014988chr4112832 2811 2607 2594 2421 1960 1851 527 467 411 337 --12335 --
NM_014989chr621698 1493 11767 ----
NM_014990chr1411279 --11196 --
NM_014991chr453259 3218 3175 2983 2693 --1902 12443
NM_014992chr144760 233 170 146 1631 ----
NM_014999chr121284 1603 --11511
NM_015000chr1242767 2698 2349 1089 ----12601
NM_015008chr372914 2534 1035 787 247 226 43 ----12524
NM_015018chr6139 ------
NM_015020chr1673419 3062 2758 2449 868 157 38 13306 --1834
NM_015026chr1244343 700 674 536 13710 21597 1172 --
NM_015032chr1362663 2410 1023 922 775 95 1235 ----
NM_015040chr253307 3194 3120 3079 3059 ------
NM_015045chr1041982 1686 349 247 11929 11412 11452
NM_015046chr972581 2006 1886 1708 659 307 129 12608 12191 --
NM_015049chr233107 1129 908 13113 13147 13303
NM_015054chr122443 337 ------
NM_015055chr1152868 2789 2462 1839 1148 2627 34 ----
NM_015057chr136675 626 573 504 133 60 ------
NM_015068chr733352 3157 532 ----12586
NM_015076chr6104214 4066 3741 3442 1435 1408 776 450 149 84 --24418 2788 --
NM_015087chr131107 --12697 --
NM_015092chr1694602 4487 4250 4181 3438 936 831 457 102 ------
NM_015100chr131408 690 497 ------
NM_015115chr432944 406 328 ------
NM_015130chr441025 996 432 140 --1185 1987
NM_015137chr842628 2605 1959 307 1394 --1828
NM_015144chr1674006 3417 2935 2451 569 511 156 ----22714 270
NM_015149chr132002 1842 1826 11977 --21508 241
NM_015153chr61693 ------
NM_015155chr1082806 2077 1198 1080 644 406 326 237 --13352 1571
NM_015156chr1443283 2666 1191 563 12758 --21495 994
NM_015184chr32477 154 ------
NM_015186chr92388 177 ------
NM_015192chr2072934 2895 2459 1038 564 394 219 ------
NM_015200chr472457 2175 1966 889 744 327 189 --22617 2063 12342
NM_015205chr13114956 4931 4667 4588 4334 3842 3627 3516 2058 2000 670 23266 409 ----
NM_015208chr1873928 2900 1628 1595 1268 712 133 1539 --13243
NM_015215chr142688 861 685 609 ------
NM_015216chr551502 1466 1424 1101 606 --11494 --
NM_015226chr1643211 3156 1213 206 --23239 846 1241
NM_015231chr112762 747 ------
NM_015236chr441085 1004 930 583 --11381 --
NM_015247chr1695384 4696 4685 4442 3955 1897 1593 351 273 11216 ----
NM_015265chr242405 947 881 806 ----1925
NM_015267chr1231574 1531 772 ------
NM_015268chr31678 ------
NM_015271chr4103823 3762 3151 1481 1149 914 807 601 273 140 --167 --
NM_015272chr1662089 1821 1419 1411 577 322 ------
NM_015282chr282990 2654 2646 2531 757 637 300 176 --12020 --
NM_015285chr1841911 1777 1688 761 12375 ----
NM_015288chr563711 3632 3087 2984 2894 293 1551 1759 --
NM_015294chr173751 324 221 --1238 --
NM_015308chr112716 164 ------
NM_015310chr8128401 7604 6864 6488 6375 5832 5071 3269 3078 2527 549 217 35941 3244 3036 25624 3201 --
NM_015313chr1124675 275 2493 88 ----
NM_015315chr543482 3333 419 143 ------
NM_015335chr1222395 2212 --11900 1572
NM_015336chr1282273 2120 1857 1661 877 761 479 398 ------
NM_015347chr1272603 2233 2162 1899 1150 1024 617 ------
NM_015355chr1761668 1354 1284 725 565 173 ------
NM_015358chr211241 --1461 --
NM_015360chr51195 ------
NM_015365chrX83372 3244 3061 3010 2773 2605 1396 424 1274 ----
NM_015379chr7151 ------
NM_015384chr5256 42 ------
NM_015385chr1072574 2219 2139 956 614 597 402 13163 1820 --
NM_015387chr252112 1439 1374 544 22 ------
NM_015423chr1141489 1257 495 276 ------
NM_015429chr331149 910 837 1795 ----
NM_015435chr841489 1477 331 203 11053 1536 1121
NM_015436chr473358 2373 1182 1062 906 605 336 ----12311
NM_015446chr161652 1485 1160 470 255 23 ----11593
NM_015455chr563951 3485 3085 2921 2599 815 1983 13908 11552
NM_015458chr864965 4906 4736 4698 877 130 ------
NM_015461chr18190 1588 ----
NM_015464chr731058 215 198 ------
NM_015472chr32548 26 ------
NM_015472chr32548 26 ------
NM_015481chr12----11044 --
NM_015511chr2011163 ------
NM_015534chr11687 ------
NM_015542chr10--11159 ----
NM_015550chr7103609 3398 3198 3074 2721 2513 2284 2190 1398 581 --23428 2708 21073 205
NM_015554chr1542916 2586 2210 643 --1191 22642 2135
NM_015555chr61105 ------
NM_015564chr553344 1289 825 619 257 ------
NM_015565chr2122063 143 12206 ----
NM_015569chr134006 1301 132 ------
NM_015570chr751841 1658 471 147 134 ------
NM_015571chr652588 2078 1876 683 566 --32541 2470 732 --
NM_015576chr382903 936 774 563 494 310 98 72 ----1267
NM_015590chr1------2574 528
NM_015602chr171565 1450 1305 1208 615 401 242 ----1232
NM_015633chr125803 436 335 144 115 ------
NM_015691chrX52297 1155 481 435 261 12465 32401 2058 1900 --
NM_015713chr863622 3597 3239 2276 650 400 --12820 --
NM_015716chr17----1725 --
NM_015725chr192491 468 ------
NM_015852chr773648 3547 3310 3002 2659 2233 982 --22840 2653 --
NM_015874chr41224 ----1168
NM_015878chr872069 1482 877 782 525 492 201 ------
NM_015879chr18148616 8555 8525 8216 8106 7651 7139 2142 1574 1282 831 773 700 183 47533 3016 3010 1313 12676 --
NM_015885chr112636 258 ----1754
NM_015886chr895489 4885 4848 4013 3641 1666 1503 1491 257 21903 417 15724 2823 761
NM_015888chr153224 3214 2426 227 110 --12515 --
NM_015891chr651401 713 421 362 72 ------
NM_015902chr82659 300 ----1134
NM_015906chr154311 4002 3798 1693 330 14433 14339 1509
NM_015907chr41368 ----1120
NM_015912chr871981 1864 1717 900 839 437 400 1736 ----
NM_015938chr3----1209 --
NM_015975chrX21534 24 --1109 1615
NM_015980chr51310 ------
NM_015986chr172426 334 ----11456
NM_016018chr832725 623 261 ------
NM_016023chr82741 376 --2505 426 --
NM_016073chr1521174 1060 ----1796
NM_016075chr1372858 2579 2286 2197 2092 611 117 2992 49 --22054 235
NM_016076chr133112 2100 1142 1517 ----
NM_016079chr272309 2178 2101 1761 1617 385 188 ------
NM_016083chr683888 3857 3412 2427 931 912 430 363 --13799 --
NM_016096chr851336 770 728 412 182 ------
NM_016100chr201404 ------
NM_016106chr14149 ------
NM_016107chr531332 308 149 --1342 --
NM_016120chrX3746 96 27 ----21060 933
NM_016121chr121054 926 ------
NM_016125chr171202 --1123 --
NM_016131chr241962 570 236 199 ----1665
NM_016132chr1512418 --32985 795 624 --
NM_016141chr33687 201 44 ----1672
NM_016144chr51513 ------
NM_016166chr151153 ------
NM_016173chr364166 4133 3704 3284 2882 396 1839 24240 1821 14203
NM_016192chr21210 ------
NM_016206chr337954 5624 939 --47438 7135 6288 648 18044
NM_016217chr663665 1072 694 456 428 259 ----11325
NM_016220chr762357 2170 2163 1662 645 145 ------
NM_016231chr17----2248 37 11701
NM_016248chr1383886 3697 3437 3318 3141 3076 972 843 ----13152
NM_016260chr297518 7347 6751 6246 6040 5984 2523 2044 780 11528 27603 7168 --
NM_016269chr42802 269 ------
NM_016271chr1842134 938 325 235 --21536 490 --
NM_016272chr2252279 2010 779 276 87 --12536 --
NM_016277chr651075 593 577 395 43 1542 --2522 162
NM_016279chr51489 ------
NM_016287chr122074 249 --1767 11533
NM_016319chr12----1175 --
NM_016328chr7149 ------
NM_016338chr53993 155 142 --1870 --
NM_016376chr1733806 1313 778 --1670 13923
NM_016377chr631368 562 501 ------
NM_016395chr152334 77 ------
NM_016396chr1562852 2191 2152 1991 1925 229 --42666 1203 1132 42 --
NM_016410chr91613 ------
NM_016422chr1132739 2683 2078 --2952 66 1432
NM_016448chr13195 188 160 --2617 581 --
NM_016454chr151360 ----1222
NM_016472chr1441485 994 983 88 ------
NM_016480chr5130 ------
NM_016485chr631959 1420 399 ------
NM_016488chr1231979 89 65 ----11947
NM_016507chr1711228 ------
NM_016513chr693448 3182 3067 3031 2721 2468 1311 871 378 2456 88 31466 393 189 --
NM_016531chr473840 3807 3621 1325 805 361 278 13484 1508 --
NM_016548chr93647 105 91 ------
NM_016603chr551751 1686 855 463 329 ------
NM_016604chr511146 ----11240
NM_016612chr81671 1467 1264 --
NM_016613chr432357 853 788 ------
NM_016628chr10------1194
NM_016645chr15158 --1418 --
NM_016654chr1551150 1070 1052 942 187 11023 ----
NM_016656chrX2263 68 ------
NM_016824chr1061871 1750 1679 1396 1325 108 11685 --11531
NM_016937chrX2866 328 --1667 1135
NM_016953chr295701 5329 5317 4299 3976 3891 2069 1599 115 --13918 --
NM_017420chr1493638 2666 2602 1495 1480 695 636 336 253 ------
NM_017452chr2031312 1065 944 ------
NM_017453chr2031312 1065 944 ------
NM_017454chr2031312 1065 944 ------
NM_017510chr5----1657 --
NM_017519chr631352 1008 262 --11234 --
NM_017569chr13----1323 --
NM_017582chr131815 1803 420 ----21756 685
NM_017590chr2231854 984 866 --21966 479 12624
NM_017610chr1552053 1396 1311 586 437 11738 12103 1660
NM_017615chr10----1113 --
NM_017626chr102458 305 ----1183
NM_017628chr463842 3681 1402 303 183 110 24768 4563 --14590
NM_017629chr161453 1441 1276 708 225 43 --11430 11941
NM_017632chr41332 ------
NM_017633chr683411 3365 3239 2833 1553 686 678 597 --13226 --
NM_017635chr1121022 1003 ------
NM_017637chr9159374 7807 7745 7266 7195 7047 6702 6619 3256 3228 2912 2730 1924 679 628 13518 18536 --
NM_017643chr1732440 771 371 ----12366
NM_017644chr341585 1411 542 438 1381 23717 1879 --
NM_017650chr786080 5138 4994 4241 3806 1186 1044 168 --31274 773 110 --
NM_017657chr22203 157 1869 ----
NM_017658chr1454675 3645 3203 3106 846 1308 23220 1824 --
NM_017666chrX32097 2044 827 ------
NM_017692chr92803 110 ----2311 154
NM_017700chr42540 244 169 ----
NM_017704chr112309 162 ------
NM_017709chr174261 4066 3134 1658 711 315 81 14241 ----
NM_017712chr1955323 4016 3864 1648 428 11464 1640 --
NM_017737chr142018 544 119 49 1125 --1296
NM_017741chr452759 2570 2549 1862 320 --11011 --
NM_017742chr1871555 1425 1252 630 493 168 117 ------
NM_017747chr5----1378 --
NM_017753chr91157 ------
NM_017754chr665065 4954 4707 4006 3365 1502 ------
NM_017761chr151517 1506 430 158 101 --21074 560 --
NM_017769chr1463057 3015 2986 2476 2316 1083 --1706 --
NM_017776chrX71319 1193 1089 631 561 497 164 --2416 333 --
NM_017779chr142547 2382 1889 1685 1748 168 --
NM_017780chr84909 839 673 186 1966 ----
NM_017786chr81605 --1533 --
NM_017798chr201256 ------
NM_017824chr1072226 692 508 472 323 290 76 22419 941 ----
NM_017830chr41192 1961 ----
NM_017831chr1873688 3366 3152 1359 1312 145 103 13988 34439 4108 1546 1410
NM_017847chr122268 1985 ------
NM_017850chr151448 1325 1261 983 574 ----1992
NM_017864chr81186 ------
NM_017869chr161645 ------
NM_017893chr1011345 ------
NM_017919chr934459 566 219 ----14057
NM_017933chr221607 159 11515 ----
NM_017944chr1182947 2710 1907 1138 1060 866 431 207 1709 13070 --
NM_017954chr7----1385 21268 145
NM_017964chr21164 ------
NM_017987chr1031994 360 189 ------
NM_017994chr752629 1944 1102 853 195 1399 11888 1906
NM_018000chr251856 1450 436 178 138 21435 78 11532 --
NM_018010chr321468 172 11507 --11429
NM_018015chrX31180 1079 834 ------
NM_018017chr1062184 2161 2100 1941 1004 159 ------
NM_018027chr1052904 2695 2632 1018 665 12085 ----
NM_018030chr183317 212 192 ------
NM_018036chr1464419 3482 1378 1066 769 738 --21331 833 13106
NM_018051chr71336 ------
NM_018054chr162660 630 ----1620
NM_018061chr161652 1308 481 251 210 80 1618 ----
NM_018070chr11236 ------
NM_018084chr292974 2777 2605 2073 1196 1178 912 595 485 ------
NM_018085chr167713 5668 4972 2631 2607 78 17557 15734 --
NM_018086chr271925 1840 1794 1352 732 169 26 --11476 11215
NM_018098chr361033 933 884 490 397 33 1412 ----
NM_018121chr1062722 2578 2569 1064 742 107 ----1229
NM_018126chr431275 534 125 ------
NM_018131chr103794 733 317 ------
NM_018133chr352033 758 537 340 242 ------
NM_018137chr121315 261 ------
NM_018144chr10----1362 --
NM_018151chr22688 631 ----1586
NM_018155chr353133 2616 2190 1187 759 ------
NM_018157chr1222047 689 12161 --13091
NM_018159chrX21542 1401 ----11057
NM_018179chr121219 ------
NM_018184chr331974 541 530 22081 1403 ----
NM_018222chr1121892 1254 ------
NM_018225chr975389 5110 3467 3448 900 760 217 11992 31765 1487 438 --
NM_018227chr473074 2988 2551 2189 532 354 52 ----1874
NM_018243chr453689 3339 1296 437 209 11407 --13877
NM_018246chr842840 1929 822 795 --1566 144
NM_018287chr1041293 486 351 70 ----11215
NM_018296chr161106 ------
NM_018299chr842589 2554 1390 413 --1224 --
NM_018300chr194567 481 246 163 --2638 89 --
NM_018312chr111615 ------
NM_018318chr124927 844 814 388 1107 ----
NM_018330chr1051360 1274 1264 1208 1179 ------
NM_018335chr141124 ------
NM_018340chr1654503 4110 966 958 872 35050 878 520 33810 3493 597 13717
NM_018351chr1274638 4287 3127 2883 781 467 66 --13222 --
NM_018362chr1173741 3215 849 785 583 313 173 ----1257
NM_018364chr164089 3890 3696 3555 1514 1288 ------
NM_018368chr61263 ------
NM_018374chr725057 721 24806 4642 24413 1354 --
NM_018383chr231609 688 477 --21288 615 --
NM_018394chr34500 395 155 34 11166 ----
NM_018403chr373754 3703 3309 3217 2789 1276 1033 21623 947 33248 2573 646 23787 1171
NM_018425chr1042287 2267 1716 67 ----12251
NM_018444chr822339 623 --11987 --
NM_018482chr84975 609 547 404 --1376 --
NM_018490chr1131604 215 199 ------
NM_018557chr241572 1390 669 33 ------
NM_018566chr155083 4258 1262 829 762 --44815 4353 3768 3161 24944 3795
NM_018584chr121231 918 ------
NM_018638chr12135642 5296 5283 5260 5227 4673 2280 2170 2128 1947 1504 660 453 33746 920 508 ----
NM_018640chr1272670 1055 1006 324 299 215 160 --12081 --
NM_018650chr161683 1553 439 324 125 64 1109 ----
NM_018682chr72500 490 ------
NM_018691chr531199 981 801 ------
NM_018700chr511518 11627 11541 --
NM_018703chr16164 ------
NM_018710chr811340 --21180 25 --
NM_018717chr442836 2483 1041 501 1221 11013 12502
NM_018834chr53856 660 644 ----1295
NM_018844chr731502 452 88 ------
NM_018847chr951975 1817 764 175 162 ------
NM_018890chr741473 1029 443 203 1424 ----
NM_018898chr552250 1930 1530 1488 65 ------
NM_018899chr552250 1930 1530 1488 65 ------
NM_018900chr552250 1930 1530 1488 65 ------
NM_018901chr552250 1930 1530 1488 65 ------
NM_018902chr552250 1930 1530 1488 65 ------
NM_018903chr552250 1930 1530 1488 65 ------
NM_018904chr552250 1930 1530 1488 65 ------
NM_018905chr552250 1930 1530 1488 65 ------
NM_018906chr552250 1930 1530 1488 65 ------
NM_018907chr552250 1930 1530 1488 65 ------
NM_018908chr552250 1930 1530 1488 65 ------
NM_018909chr552250 1930 1530 1488 65 ------
NM_018910chr552250 1930 1530 1488 65 ------
NM_018911chr552250 1930 1530 1488 65 ------
NM_018945chr672623 2573 2314 908 585 445 171 ------
NM_018947chr754533 4137 1502 1290 909 --54846 1813 977 956 935 14977
NM_018970chr752950 2671 2057 978 920 ----1803
NM_018976chr1232879 1108 900 --12695 41892 851 138 111
NM_018979chr1242478 2225 839 326 ------
NM_018993chr2051339 1189 1128 967 362 2918 307 ----
NM_018999chr1054781 3716 3521 791 226 23771 644 ----
NM_019001chr3104743 4065 4046 3112 1907 1823 906 306 201 88 13430 ----
NM_019002chr2193 ------
NM_019003chrX141 ------
NM_019004chr752263 2099 932 897 653 --2777 298 --
NM_019006chr15--1273 --2249 87
NM_019027chr452600 2473 2014 1039 523 ------
NM_019035chr462091 1938 1665 1557 1391 165 ------
NM_019044chr2104700 4487 4256 4250 4207 4155 3540 1576 542 102 1780 --43375 3276 1206 1049
NM_019045chrX2860 752 ------
NM_019050chr421870 1719 --11419 --
NM_019058chr101552 ------
NM_019084chr1062517 1996 915 895 756 155 ------
NM_019095chr202196 69 1184 ----
NM_019098chr861846 1324 1250 459 252 166 11446 ----
NM_019114chr972376 1959 1843 1748 827 321 212 ------
NM_019555chr361371 707 627 619 608 577 --11188 11201
NM_019556chrX61457 1368 1208 1110 1044 128 ------
NM_019590chr1031215 1084 84 --1235 --
NM_019593chr2062858 2475 1085 753 677 434 22915 996 11070 12540
NM_019859chr1051284 1204 402 378 334 --189 --
NM_019860chr1051332 1252 450 426 382 --1137 --
NM_019903chr1061871 1750 1679 1396 1325 108 11685 --11531
NM_020119chr763872 2897 2763 2625 2575 1388 12864 2999 304 --
NM_020122chr2105575 5125 4649 4312 2235 2034 1961 1540 1297 1153 12160 34051 212 200 --
NM_020132chr2174495 4429 4152 4101 3737 3418 2039 13697 175 1727
NM_020135chr62380 346 ------
NM_020144chr742138 718 544 431 11382 ----
NM_020150chr1052182 2042 1696 362 213 ----11665
NM_020159chr431717 1615 212 --21696 466 --
NM_020177chr543084 851 579 220 ------
NM_020192chr71163 ------
NM_020193chr1141177 1008 979 190 ------
NM_020194chr21119 --1688 --
NM_020199chr51418 11169 ----
NM_020232chr181175 ------
NM_020245chr6164965 4903 4730 4723 4630 3917 3460 3232 1994 1924 1552 1147 991 609 451 367 132 ----
NM_020307chr31296 ------
NM_020337chr453008 2927 1223 873 179 1863 12862 1257
NM_020341chr204495 426 325 313 11819 ----
NM_020342chr242411 2161 926 45 1327 ----
NM_020354chr102934 921 ------
NM_020390chr364539 4196 4181 3270 3068 1257 13600 2970 350 --
NM_020432chr762192 1660 1636 1433 743 24 ------
NM_020443chr176603 6448 5786 4997 4634 2065 794 12325 11721 16765
NM_020445chr71670 ------
NM_020452chr11414 ------
NM_020455chr652778 2335 1009 555 251 --2608 419 --
NM_020463chr231208 986 977 --1328 --
NM_020466chr684102 3686 3425 3324 3105 1448 1104 708 21908 1692 ----
NM_020529chr141441 ------
NM_020640chr362168 2061 1522 1413 643 25 --11676 --
NM_020647chr852299 2292 2192 1962 367 --1477 --
NM_020686chr1663057 2903 2214 626 511 105 ------
NM_020699chr141932 1588 577 81 ----11395
NM_020718chr16126601 6435 6063 6010 5822 5012 4766 4395 4172 4031 2079 1253 ------
NM_020732chr631352 1008 262 --11234 --
NM_020734chr1243382 2701 2330 2188 --23281 2373 1700
NM_020747chr53906 656 334 ------
NM_020749chr82456 44 12007 11742 1828
NM_020766chrX64601 4311 1694 781 696 125 ------
NM_020772chr17127117 6539 6488 5718 5314 2683 2624 2566 2088 1923 863 305 28282 1345 18162 --
NM_020774chr1845467 4821 140 34 25901 1937 15283 --
NM_020778chr1564720 3396 1268 1060 612 401 ----14978
NM_020782chr1223352 891 11462 13458 23325 284
NM_020792chr372382 2227 1866 1804 1029 447 191 ------
NM_020794chr12233 119 ----11233
NM_020800chr341511 1188 447 349 1148 ----
NM_020808chr12237 213 ------
NM_020810chr1432216 1300 42 ----12945
NM_020813chr1982634 2410 2269 1839 1807 310 256 91 ----2897 102
NM_020819chr651179 1095 985 918 60 ----177
NM_020828chr1951253 561 434 287 113 ------
NM_020830chr243297 2700 2435 139 ------
NM_020841chr1263929 3395 3263 3135 2522 662 12983 23962 2555 1130
NM_020844chr8117349 7261 7240 7121 6816 5669 5318 2898 2055 1897 998 --26596 638 15451
NM_020854chr1821279 370 ----1444
NM_020856chr192520 451 --1213 --
NM_020858chr152810 164 ----1346
NM_020860chr431140 1129 100 ------
NM_020861chr63965 513 186 ------
NM_020870chr442093 1749 783 465 ------
NM_020871chrX62573 2560 2531 2406 862 641 11755 1298 --
NM_020873chr32844 677 ------
NM_020895chr191281 ------
NM_020918chr1042829 2676 2534 2391 --33654 3127 349 13272
NM_020920chr142300 146 ------
NM_020921chr1472976 2873 2445 2336 1363 964 840 ------
NM_020935chr263740 3155 3126 1707 686 102 --11779 --
NM_020940chr1042824 2495 2253 1098 ------
NM_020948chr143697 3690 2845 2620 --22334 1428 --
NM_020960chr984452 4330 3755 3561 1788 761 544 330 24885 1897 ----
NM_020975chr1011253 ----21917 1683
NM_020977chr462250 1742 1430 552 519 219 ----12001
NM_020988chr16----11020 --
NM_021007chr252314 2139 1710 774 120 ----12093
NM_021033chr1343491 2244 472 90 12201 ----
NM_021038chr353116 1174 929 538 305 ------
NM_021069chr471876 1730 1500 863 807 690 109 ------
NM_021072chr582507 2367 2256 2241 1934 864 550 144 ------
NM_021079chr1773319 2290 1301 880 378 261 242 ------
NM_021102chr191407 ------
NM_021111chr931360 1313 1087 ----1995
NM_021116chr779027 7975 7279 6149 5511 3540 337 26010 2592 37161 1735 1061 --
NM_021136chr143740 578 257 ----1764
NM_021148chr742441 1850 884 768 12300 2521 265 --
NM_021151chr74298 254 222 211 ----2375 138
NM_021167chr732758 2260 1936 ----12779
NM_021183chrX52416 2392 2310 1574 157 --1606 --
NM_021201chr1132020 1999 1887 ------
NM_021202chr2032911 1006 520 31059 720 643 12671 12834
NM_021204chr41876 1221 ----
NM_021229chr1231040 893 126 ----1834
NM_021239chr1451304 1182 540 482 356 ------
NM_021240chr93643 609 489 --1686 --
NM_021252chr1041783 1381 691 212 11585 1525 --
NM_021619chr911136 ------
NM_021637chrX3521 320 114 ------
NM_021644chr102975 877 ------
NM_021647chr484480 4401 3720 2922 1798 1148 404 65 2817 210 ----
NM_021648chr672638 2463 2431 2228 1812 233 78 ------
NM_021813chr6135572 5557 5321 5315 5103 4713 4702 4359 3712 2147 2031 1343 1000 ------
NM_021814chr651566 1382 1132 375 122 ------
NM_021911chr585419 5393 4758 4366 3910 1830 277 66 --15338 --
NM_021914chr1422041 285 ------
NM_021954chr1383427 1270 1040 1003 914 796 537 67 ------
NM_021956chr651528 1501 1160 545 513 --1287 --
NM_021960chr172631 2312 2238 2092 923 681 66 1888 12760 --
NM_021961chr11147336 7278 6002 4871 4537 4528 1903 1226 1017 898 544 470 396 264 17237 12262 15493
NM_021962chr1772535 2266 2211 2095 1874 981 144 12482 ----
NM_021964chr3116544 6382 6169 4601 4476 2160 1551 859 781 219 104 --16415 --
NM_021977chr6113875 3731 3698 3630 3610 2828 2488 1525 1145 217 77 ------
NM_021979chr143443 437 429 ------
NM_021994chr751070 874 767 459 174 ------
NM_021998chrX31262 1188 1007 ------
NM_022037chr23341 113 95 1964 1262 --
NM_022045chr81185 ------
NM_022048chr15105765 5124 4155 3994 3926 2410 1939 1474 796 545 ------
NM_022058chr242004 1403 295 221 --11943 1703
NM_022060chr141934 ------
NM_022080chr2052671 2330 1894 934 26 ------
NM_022091chr631998 414 209 12292 --12247
NM_022114chr174743 4655 4463 4277 3413 2956 244 2945 745 ----
NM_022118chr13166 ------
NM_022129chr1051178 1134 988 533 65 ------
NM_022130chr511269 ------
NM_022138chr641040 262 207 115 --1570 --
NM_022154chr431266 914 469 1311 --21278 457
NM_022166chr1644906 4702 3940 780 46337 5986 4371 1890 ----
NM_022173chr23341 113 95 1964 1262 --
NM_022351chr883818 3630 3298 2714 2633 1123 128 36 ------
NM_022374chr2153 ------
NM_022456chr1265896 2509 2418 1866 335 225 22424 1889 14726 15543
NM_022457chr11212 ------
NM_022458chr773010 2960 2401 1233 881 464 451 174 12157 2398 221
NM_022459chr1385333 4910 4494 1860 1807 1023 307 45 --11652 --
NM_022469chr163314 3217 2416 2235 2063 314 ----11080
NM_022474chr1422679 811 ------
NM_022484chr741387 996 221 195 ----1372
NM_022648chr284630 4575 4380 4325 3570 1660 1433 128 --1725 --
NM_022652chr1251153 1070 975 795 262 ------
NM_022658chr1221180 522 --11049 21300 415
NM_022716chr163118 2274 2055 936 641 274 ------
NM_022763chr363125 2226 1046 1031 664 166 ------
NM_022810chrX2302 72 ------
NM_022828chr531745 617 57 ----1337
NM_022841chr1562650 2554 2127 2034 750 21 --11011 --
NM_022845chr1652104 1975 1660 1405 206 ------
NM_022893chr282693 2632 2598 2420 2344 2183 633 262 ----12869
NM_022894chr251661 1380 1164 1132 54 ------
NM_022898chr14103847 3758 3705 3477 3233 1644 1175 690 563 264 13137 --13828
NM_022913chr5193 ------
NM_022918chr1151978 1935 1415 747 570 ------
NM_022977chrX62583 2554 1851 964 92 30 --32537 340 195 --
NM_023011chr131839 ------
NM_023016chr262499 2308 530 414 264 24 --22766 357 12178
NM_023033chr12----1511 --
NM_023925chr121236 ------
NM_023929chr822104 1827 12303 ----
NM_024007chr582986 2696 2491 2265 2110 1265 616 575 --2671 192 1985
NM_024016chr171720 ------
NM_024122chrX2218 109 ------
NM_024311chr171284 ------
NM_024336chr161305 ------
NM_024345chr974872 4822 4670 4419 4100 1760 199 --24054 4033 11383
NM_024422chr1851798 663 308 298 142 ----21771 1281
NM_024501chr21650 ------
NM_024511chr453218 3022 2912 260 156 12918 32353 2143 367 12964
NM_024524chr322972 2774 21150 816 ----
NM_024539chrX51260 1072 969 457 445 ------
NM_024563chr521695 644 1205 1719 --
NM_024583chr22852 358 ------
NM_024594chr571871 1644 1537 1233 635 273 218 --11851 --
NM_024607chr854518 4444 3440 2946 64 --34299 4005 528 14339
NM_024613chr8164 ------
NM_024665chr353466 1105 818 585 504 24532 3443 23598 1759 13963
NM_024670chr103569 329 143 --21359 1254 --
NM_024674chr162951 2890 2860 2800 892 203 12821 12141 --
NM_024680chr112551 57 ------
NM_024704chr2051089 997 788 122 62 --1904 --
NM_024721chr872543 2411 1727 1679 1672 894 203 1191 1964 --
NM_024744chr272691 2607 2590 1818 736 581 379 1788 ----
NM_024811chr111398 ----11733
NM_024885chrX--1167 1189 --
NM_024913chr741599 1537 1422 1252 ------
NM_024920chr4----11436 --
NM_024941chr561446 1332 1298 1290 1270 1179 ------
NM_024944chr212360 226 ----1268
NM_024947chr3169216 8630 8125 7352 6832 6486 3856 3214 3017 2566 1888 1823 1397 1282 1186 813 18657 18102 17811
NM_024949chr444860 3722 1308 924 13196 21275 491 11821
NM_024953chr1252692 2548 978 839 116 22501 2131 12068 1737
NM_024989chr2137938 7818 7256 7106 6543 6243 5881 2727 2126 739 614 332 205 17007 22541 2229 27844 7362
NM_024991chr1072574 2219 2139 956 614 597 402 13163 1820 --
NM_025054chr8124056 3609 3488 3113 3092 3085 2906 1339 986 570 502 135 23161 1311 --14012
NM_025073chr174631 4400 4363 3104 2943 1895 708 24311 3764 13913 14538
NM_025129chr191219 ------
NM_025138chr1341415 1360 1117 904 ----1598
NM_025141chr152503 100 ------
NM_025146chr322698 1992 --11867 11697
NM_025147chr221178 1152 ------
NM_025181chr21191 ------
NM_025191chr153484 3428 3032 514 436 --1235 --
NM_025208chr1172458 2422 2222 2125 1707 791 111 --12004 --
NM_025235chr1031860 1614 172 ------
NM_025246chr3------1132
NM_030579chr1643690 3046 1013 28 13215 13629 --
NM_030613chr53360 187 86 ----171
NM_030621chr1474074 3993 3951 2885 2651 867 428 1401 ----
NM_030627chr5123555 3238 3122 3043 2803 2572 1362 904 793 759 590 43 --13087 12652
NM_030647chr796312 5516 5208 4522 3961 2518 1711 566 53 ------
NM_030648chr4115601 5504 5053 4436 3497 2111 2056 1384 974 938 387 --1461 14208
NM_030664chr1032373 1778 805 --11855 --
NM_030674chr1265711 5136 4924 1348 879 109 14824 --24214 3756
NM_030751chr1051924 1594 1501 273 239 --1538 --
NM_030751chr1051924 1594 1501 273 239 --1538 --
NM_030756chr101300 ------
NM_030791chr1461858 1709 1657 1458 519 145 ------
NM_030799chr522189 2104 22145 102 --1800
NM_030802chr17--1739 ----
NM_030806chr1109061 8921 8696 7807 7345 5897 3374 2607 1795 275 2826 688 27119 1841 --
NM_030816chr1103607 2884 1328 1303 1240 938 682 558 488 225 --12255 --
NM_030920chr131602 1595 684 1192 ----
NM_030949chr621467 205 ------
NM_031157chr12------1257
NM_031243chr732146 737 134 2668 167 ----
NM_031244chr611091 ----137
NM_031266chr51450 ------
NM_031268chr1665042 4171 4159 3914 1994 1344 15416 --11058
NM_031314chr1482074 1510 797 760 525 492 484 320 ------
NM_031362chr252775 2659 2479 1768 1070 11959 ----
NM_031365chr242911 2795 2615 1904 12095 ----
NM_031366chr242911 2795 2615 1904 12095 ----
NM_031411chr552250 1930 1530 1488 65 ------
NM_031418chr1182585 2330 1094 971 728 590 387 131 ------
NM_031419chr331364 588 97 ------
NM_031422chr182606 375 --1106 1126
NM_031427chr1432260 1187 1001 24011 1142 12398 15614
NM_031461chr882133 1502 825 681 635 378 127 44 --1690 --
NM_031468chr7148073 6776 6282 6158 5728 2965 2570 2420 2195 1560 1113 567 238 152 26094 113 --12035
NM_031492chr111371 ------
NM_031849chr552250 1930 1530 1488 65 ------
NM_031857chr552250 1930 1530 1488 65 ------
NM_031860chr552250 1930 1530 1488 65 ------
NM_031989chr121276 ------
NM_032012chr975120 4452 1230 891 827 518 408 11191 ----
NM_032021chr1111188 ------
NM_032042chr552407 2266 596 583 169 --12364 --
NM_032047chr32865 580 1523 ----
NM_032102chr1132957 790 364 --11192 22580 642
NM_032116chr1355610 5063 4434 3722 1773 15214 32298 813 154 --
NM_032124chr1821066 402 --135 1790
NM_032128chr42962 737 --2865 742 --
NM_032131chr61222 ------
NM_032143chr21323 ------
NM_032144chr22570 151 ------
NM_032145chr641626 636 500 77 --1556 --
NM_032146chr31472 ------
NM_032153chr332699 2442 2128 --11904 11736
NM_032154chr1031099 175 81 ------
NM_032156chr121236 ------
NM_032160chr1834291 3326 1223 --43662 3559 1577 1135 --
NM_032189chr13114758 4733 4469 4390 4136 3644 3429 3318 1860 1802 472 23068 211 ----
NM_032208chr273375 3356 2924 2441 2353 2347 590 1550 12386 1340
NM_032217chr451444 1412 1350 991 386 1464 ----
NM_032221chr2011957 ------
NM_032228chr11113425 3306 2633 1207 978 960 589 383 67 60 51 ----12463
NM_032229chr131401 --11044 --
NM_032231chr151318 ------
NM_032236chr11784 ------
NM_032246chr1551151 1126 1042 981 264 ------
NM_032271chr16--1322 ----
NM_032288chr372203 1972 832 661 483 439 272 ------
NM_032291chr141818 1231 677 224 ------
NM_032352chr1431366 75 50 11261 ----
NM_032373chr10135796 5279 5171 4796 4786 4573 4420 2219 2197 1990 1505 876 674 1927 11076 --
NM_032383chr31234 --21212 820 --
NM_032433chr1961392 1339 1012 273 233 84 ------
NM_032434chr2--11077 ----
NM_032439chr1021404 1176 ------
NM_032442chr172154 136 ------
NM_032446chr543884 3238 1247 908 1449 1529 --
NM_032457chr493824 2651 1509 1474 1305 1294 1282 1165 458 11533 --1188
NM_032458chrX73306 2531 2428 2277 2268 724 80 ------
NM_032466chr831715 1688 350 --11311 --
NM_032468chr831715 1688 350 --11311 --
NM_032471chr631091 371 258 ----1836
NM_032501chr2031106 505 466 ------
NM_032505chr352699 2457 1984 203 22 --12403 --
NM_032521chr2042903 2541 2312 1985 22507 345 31287 924 538 --
NM_032547chr42368 202 1129 11251 --
NM_032557chr43339 170 22 ------
NM_032558chr921482 1319 11251 ----
NM_032582chr1761887 1862 1611 1591 1433 320 --199 --
NM_032626chr16172 ------
NM_032689chr193224 174 160 ------
NM_032787chr31103 ----1291
NM_032804chr1042588 2053 923 790 32399 1578 605 ----
NM_032810chr1021091 403 ------
NM_032813chr1351038 876 850 225 176 ------
NM_032815chr1632492 2056 796 --1928 12222
NM_032833chr162616 2491 1058 670 541 112 --22434 1646 --
NM_032838chr192813 790 --1328 196
NM_032842chr731341 1155 158 11401 2432 143 --
NM_032859chr1393813 3449 2767 1376 1168 688 602 481 447 32712 729 44 23622 3543 --
NM_032869chr811700 ------
NM_032873chr1174522 4059 3686 3305 2929 1479 1049 ----14008
NM_032875chr171634 ------
NM_032949chr132200 179 --1171 --
NM_032968chrX103932 3375 3153 2807 1600 1434 1166 906 721 357 13799 --11209
NM_032969chrX103932 3375 3153 2807 1600 1434 1166 906 721 357 13799 --11209
NM_032973chrY103924 3370 3148 2802 1599 1434 1166 906 721 357 13791 --11209
NM_032978chr1831169 896 57 --1119 --
NM_032979chr1831169 896 57 --1119 --
NM_032981chr1831169 896 57 --1119 --
NM_033020chr154311 4002 3798 1693 330 14433 14339 1509
NM_033030chr221468 1414 ------
NM_033055chr121118 117 1822 ----
NM_033056chr102569 503 --1119 --
NM_033081chr2031348 1199 499 ------
NM_033119chr16--1151 ----
NM_033121chr1231841 1604 107 2145 137 ----
NM_033135chr1172458 2422 2222 2125 1707 791 111 --12004 --
NM_033138chr742265 2011 534 350 ----11781
NM_033139chr742265 2011 534 350 ----11781
NM_033140chr742265 2011 534 350 ----11781
NM_033143chr454247 3648 3328 3086 132 1718 ----
NM_033157chr742265 2011 534 350 ----11781
NM_033158chr3163 ------
NM_033167chr351731 1346 1240 679 424 --1367 1344
NM_033168chr351731 1346 1240 679 424 --1367 1344
NM_033169chr351731 1346 1240 679 424 --1367 1344
NM_033181chr683888 3857 3412 2427 931 912 430 363 --13799 --
NM_033211chr51419 ------
NM_033224chr787995 7703 5744 5380 2786 2457 1313 565 28103 1915 27756 5085 --
NM_033225chr853045 3038 2518 643 345 --32978 1104 141 --
NM_033254chr31139 ------
NM_033276chr122363 87 ------
NM_033305chr941220 1178 1149 578 ------
NM_033360chr1264650 4461 4383 4363 640 400 23360 238 1966 --
NM_033375chr1711314 --1406 --
NM_033379chr101152 ------
NM_033389chr1773700 3459 3132 1860 1089 917 131 44854 4407 3747 1932 ----
NM_033393chr462923 2883 2841 2341 399 214 ------
NM_033394chr2----1996 --
NM_033430chr453789 1350 1178 705 292 --21622 650 --
NM_033437chr453789 1350 1178 705 292 --21622 650 --
NM_033480chr652297 835 812 682 394 ------
NM_033481chr652297 835 812 682 394 ------
NM_033495chrX3822 366 208 1832 ----
NM_033505chr2106541 6104 5995 5976 4331 4205 2269 777 294 227 11641 16695 34196 1651 822
NM_033551chr543482 3333 419 143 ------
NM_033631chr163743 3558 3240 2523 1032 222 2654 642 11150 --
NM_033637chr1083948 3624 3411 3137 2573 767 598 451 11021 23777 3391 --
NM_033642chrX1348 ------
NM_033644chr562494 2246 1013 781 280 133 22111 772 ----
NM_033645chr562494 2246 1013 781 280 133 22111 772 ----
NM_033656chr2195943 4957 3728 1662 1109 943 699 544 341 15993 ----
NM_052832chr862962 2922 2786 2236 2079 1994 --11866 --
NM_052834chr1841911 1777 1688 761 12375 ----
NM_052879chr1241643 1339 780 598 13079 --11147
NM_052885chr1284689 4609 4384 3920 3818 3783 1559 832 --11358 --
NM_052905chr281430 1352 1324 700 522 511 365 278 ------
NM_052907chr1284107 4033 3883 3490 914 637 271 265 23461 1052 1439 11489
NM_052910chr1341890 792 730 470 --11463 --
NM_052911chr182299 263 --1157 11004
NM_052917chr242403 2319 1301 351 ------
NM_052918chr1033680 3456 3447 ----13215
NM_052932chr1122278 126 --22152 1866 --
NM_052937chr862115 2094 1969 948 516 249 11066 155 12208
NM_052940chr11178 ------
NM_053016chr987717 7566 6391 5427 5398 1375 1018 845 12107 47735 2992 2869 651 22301 619
NM_053023chr1143154 3094 3071 2338 12055 ----
NM_053043chr776338 5001 4943 4288 2308 1003 283 1289 34918 841 423 1500
NM_053053chr13936 746 647 ------
NM_053064chr1453077 2700 2589 430 169 152 ----
NM_053274chr1----1115 --
NM_054026chr82872 249 --1172 --
NM_057157chr10194 ------
NM_057159chr951604 1587 1158 569 560 --11432 --
NM_057175chr441652 790 777 732 32125 2076 961 ----
NM_078474chr152503 100 ------
NM_078483chr583806 3342 2918 2631 2519 1040 972 888 --12935 --
NM_079837chr161645 ------
NM_080422chr18------1240
NM_080423chr18------1240
NM_080552chr201658 ------
NM_080597chr183317 212 192 ------
NM_080599chr10--11159 ----
NM_080645chr621920 219 11907 --1237
NM_080666chr1431249 470 447 --1248 --
NM_080670chr5----1664 --
NM_080723chr611339 ------
NM_080759chr1382558 2438 2010 1904 945 850 502 223 1757 ----
NM_080760chr1382558 2438 2010 1904 945 850 502 223 1757 ----
NM_080794chr21133 ------
NM_080872chr844059 3178 2607 341 --13198 13498
NM_080927chr373331 3224 3079 2506 2127 274 86 --12782 --
NM_100264chr10------1194
NM_100486chr10------1194
NM_130391chr973403 3160 2600 1294 1240 1095 576 12475 ----
NM_130392chr973403 3160 2600 1294 1240 1095 576 12475 ----
NM_130393chr973403 3160 2600 1294 1240 1095 576 12475 ----
NM_130395chr62380 346 ------
NM_130435chr1082923 2786 2773 2604 2487 473 398 188 ------
NM_130438chr2173269 3187 2334 2247 650 76 59 --11097 --
NM_130798chr1511295 ------
NM_130809chr511201 1300 12577 12846
NM_130846chr122307 184 --11059 --
NM_130847chr1195386 5163 5105 4600 4470 3871 3658 292 192 23816 1940 1452 --
NM_133170chr2087506 6263 5795 5040 3189 2291 1956 347 27277 4922 16474 --
NM_133265chrX33562 451 142 32566 833 545 13157 --
NM_133334chr485890 5678 5005 4980 4729 2270 1522 942 14274 26345 3919 1247
NM_133370chr453700 2860 2488 389 156 13572 13436 1257
NM_133445chr973584 2559 2504 2379 2359 793 716 --1155 11282
NM_133468chr731770 567 489 1303 ----
NM_133474chr451625 1471 1076 467 292 --11636 --
NM_133478chr242523 2106 1555 361 --21658 427 --
NM_133482chr551466 1381 1017 301 295 --134 --
NM_133486chrX1147 ------
NM_133496chr153950 3464 1055 640 620 11546 1727 11803
NM_133507chr121881 ------
NM_133631chr341527 1376 460 96 ----1551
NM_133638chr531337 513 360 ------
NM_133646chr274587 4338 4205 3474 3440 2071 846 15193 ----
NM_138270chrX32704 1246 1010 ------
NM_138348chr5156608 6487 6393 6124 5384 5352 5030 2244 1738 1576 1524 1144 816 201 43 --24186 2408 --
NM_138391chr13989 200 103 ----1761
NM_138423chr1562261 1760 1437 460 264 150 ------
NM_138426chr752336 2113 675 547 443 ------
NM_138444chr13124786 4752 4694 4620 4401 3623 1691 1625 1458 1134 915 844 ----13833
NM_138459chr673572 3509 3433 3411 2874 2862 2589 ----1776
NM_138468chr2116237 5817 4945 4818 4366 4077 2550 2054 829 756 608 --11793 --
NM_138473chr1263185 1585 1562 454 111 56 --15159 --
NM_138494chr752685 2666 1075 420 249 --22031 746 --
NM_138576chr14103847 3758 3705 3477 3233 1644 1175 690 563 264 13137 --13828
NM_138612chr16160 ------
NM_138621chr2104057 3719 2631 1341 1032 771 748 300 215 96 133 11382 --
NM_138633chr631368 562 501 ------
NM_138638chr1422041 285 ------
NM_138643chr18161 ------
NM_138644chr18161 ------
NM_138713chr1697313 7254 7041 6341 6245 6162 5988 3260 2666 1566 11463 --
NM_138714chr1697313 7254 7041 6341 6245 6162 5988 3260 2666 1566 11463 --
NM_138731chr1494222 4077 3647 3118 1672 1352 646 568 509 --14017 1919
NM_138766chr51620 ------
NM_138782chr552383 2331 2189 2014 620 ------
NM_138821chr51620 ------
NM_138822chr51620 ------
NM_138927chr211203 ------
NM_138959chr1105609 5391 5224 5081 4810 4275 2509 2430 2370 560 --46137 4122 2300 1967 --
NM_138980chr43710 529 201 ----192
NM_138981chr43841 660 332 1569 --1223
NM_138982chr43710 529 201 ----192
NM_139048chr31119 ------
NM_139071chr121286 ------
NM_139135chr111332 --11222 --
NM_139136chr1221084 821 ------
NM_139169chr1021952 1462 261 55 11836 --
NM_139207chr1231446 266 200 --21963 434 --
NM_139239chr19192 ------
NM_139312chr1021191 375 ----1429
NM_144563chr22580 88 ------
NM_144563chr22580 88 ------
NM_144571chr485831 5581 5569 2491 1989 1654 1042 70 ----12375
NM_144578chr1454904 4644 1481 1459 64 11058 15456 --
NM_144590chr1042349 2306 2300 1890 --12332 11834
NM_144599chr15125441 4361 3959 3568 3478 1690 1586 1471 879 840 775 730 --32192 2150 1510 --
NM_144600chr1631693 597 83 11356 1271 11274
NM_144632chr232079 751 278 ------
NM_144636chr31542 ------
NM_144642chr341172 1040 530 110 1911 --196
NM_144643chr41462 ------
NM_144645chr41231 ------
NM_144664chr114861 778 270 36 ------
NM_144684chr1973009 2726 2474 2335 1876 98 23 2872 568 12805 --
NM_144721chr432704 447 414 1166 ----
NM_144726chr531070 214 198 11214 ----
NM_144770chr213798 191 115 ----1423
NM_144778chr1352751 2330 2276 1758 125 1347 11891 --
NM_144949chr252612 2140 770 546 497 --31008 735 525 11928
NM_144963chr842406 2287 2017 101 ----12168
NM_144973chr12135200 5123 4979 4943 4760 4222 1144 1056 887 488 445 434 381 --23262 1292 --
NM_144977chr11670 ------
NM_145037chr32484 405 --1162 11525
NM_145049chr51330 ------
NM_145055chr1863612 3559 2950 1069 1050 946 23263 2466 13061 --
NM_145112chr141209 ------
NM_145175chr211236 ------
NM_145176chr672902 2627 2485 887 710 609 67 1379 12579 --
NM_145203chr131742 ------
NM_145251chr143360 302 72 11000 1519 --
NM_145259chr287051 6628 6111 4902 4691 4468 1492 434 16706 ----
NM_145263chr421687 794 11763 --1706
NM_145268chr72384 354 ------
NM_145290chr41251 ------
NM_145305chrX51297 1153 401 266 23 --160 --
NM_145307chr1074618 4245 3510 3281 3083 2896 192 11596 ----
NM_145313chr10----11650 1283
NM_145320chr7103609 3398 3198 3074 2721 2513 2284 2190 1398 581 --23428 2708 21073 205
NM_145321chr7103609 3398 3198 3074 2721 2513 2284 2190 1398 581 --23428 2708 21073 205
NM_145322chr7103609 3398 3198 3074 2721 2513 2284 2190 1398 581 --23428 2708 21073 205
NM_145341chr1041876 1839 1370 624 --11337 --
NM_145686chr283160 2786 2586 2480 1361 1142 982 540 31254 731 120 23084 227 --
NM_145687chr283160 2786 2586 2480 1361 1142 982 540 31254 731 120 23084 227 --
NM_145690chr831880 706 692 --11271 --
NM_145693chr272567 2522 2016 1955 747 318 77 11611 --134
NM_145698chr1051931 760 696 496 425 ------
NM_145716chr11236 ------
NM_145753chr331627 1554 1070 11254 ----
NM_145756chr1841527 1080 1053 98 --11181 --
NM_145800chrX1330 ------
NM_145802chrX1279 ------
NM_145808chr762692 2294 2038 1906 1189 474 --12137 --
NM_145859chr31351 ------
NM_145860chr31351 ------
NM_147150chr963963 2997 2666 1462 400 99 1125 23462 1212 --
NM_147156chr1051511 1324 582 301 287 11184 ----
NM_147166chr72549 85 1685 ----
NM_148174chr872069 1482 877 782 525 492 201 ------
NM_152263chr145393 4755 3794 1491 ------
NM_152280chr162684 2556 2536 2486 601 276 --12937 12352
NM_152291chr44894 846 735 203 ----157
NM_152298chr1150 ------
NM_152330chr1461899 1644 740 610 254 205 11056 12055 --
NM_152332chr1472782 2050 1987 1868 1835 164 135 ------
NM_152365chr11395 ------
NM_152400chr431685 1654 650 11355 --12101
NM_152409chr553338 2348 833 773 170 --11370 --
NM_152424chrX44685 4455 1443 196 23604 1154 --14561
NM_152429chr1031135 528 383 21537 313 1416 --
NM_152437chr1241630 946 767 418 ------
NM_152519chr241553 547 522 480 --21626 34 --
NM_152520chr231239 1011 1003 --1116 --
NM_152523chr23758 214 184 ------
NM_152529chr243020 1364 835 748 24105 3609 34349 3153 1765 13918
NM_152551chr673022 2782 2293 2226 974 672 500 12637 12218 --
NM_152556chr742524 1633 812 449 2370 196 --1115
NM_152562chr8--1148 ----
NM_152581chrX41133 561 379 124 ------
NM_152589chr123230 198 112 ------
NM_152594chr1572211 1649 1553 523 447 378 183 ------
NM_152608chr142222 1974 1721 1591 --1531 12415
NM_152622chr543103 439 235 32 12924 21033 489 --
NM_152624chr5117441 6032 4541 2582 2098 1901 1653 1107 1013 684 302 12240 41790 719 178 103 15033
NM_152636chr1163106 3004 2777 2135 1907 1103 --1953 --
NM_152682chr431616 1177 405 ----11368
NM_152688chr62949 867 ------
NM_152695chrX32062 1950 1768 ----11930
NM_152699chr361335 1099 919 387 319 278 --43008 2734 840 542 --
NM_152727chr161254 ------
NM_152733chr656408 6278 4367 697 653 24728 859 26497 4244 --
NM_152737chr651865 1748 1553 1352 1337 ------
NM_152745chr721159 1058 --11024 --
NM_152753chr61817 ------
NM_152754chr763860 3832 3588 934 802 381 22886 824 13795 --
NM_152758chr872775 2141 2062 777 664 638 302 145 ----
NM_152774chr752035 1898 785 364 284 1671 ----
NM_152785chr352572 2373 1658 866 855 --12019 --
NM_152787chrX63242 2976 891 880 754 262 12510 12990 --
NM_152793chr773537 3377 1973 737 614 508 343 11282 33976 1826 411 1329
NM_152838chr2043297 2817 2487 53 --22977 1165 --
NM_152857chr61156 1287 ----
NM_152858chr61156 1287 ----
NM_152860chr121988 ------
NM_152910chr132599 587 ----1512
NM_152924chr1566730 5944 5746 5505 5116 4790 11128 ----
NM_152989chr1231743 1503 510 11692 ----
NM_152991chr112592 214 --1663 162
NM_152995chr4275 24 ------
NM_152999chr743639 1374 1254 431 --11983 --
NM_153020chr631437 1219 408 ----11651
NM_153038chr22711 703 ------
NM_153042chr641540 1310 263 140 --1703 --
NM_153184chr331756 432 327 1333 1197 --
NM_153188chr564797 4782 4509 4178 2086 1743 25606 2100 31465 858 787 --
NM_153207chr1241460 1170 1133 880 12939 ----
NM_153208chr163963 292 167 ------
NM_153211chr181172 ------
NM_153226chr1031173 1109 322 ------
NM_153235chr62593 558 1815 --1609
NM_153261chr161318 ------
NM_153262chr143055 2743 1272 598 11997 1800 --
NM_153333chrX1571 ------
NM_153354chr51917 --1169 --
NM_153358chr191100 ------
NM_153456chr1366081 5583 4352 4306 1976 229 26142 5639 ----
NM_153605chr311206 ------
NM_153607chr582981 2833 2208 2145 2113 991 925 743 ----22769 767
NM_153610chr51504 ----1549
NM_153616chr152810 164 ----1346
NM_153617chr152810 164 ----1346
NM_153618chr152810 164 ----1346
NM_153689chr222357 932 ------
NM_153712chr253467 3325 3079 2679 195 12376 1803 --
NM_153748chr1221084 821 ------
NM_153757chr431173 1136 905 1830 1836 1441
NM_153769chr18161 ------
NM_153825chr421742 634 ----1328
NM_153827chr17----1725 --
NM_170606chr741601 1252 532 412 ------
NM_170663chr17----1725 --
NM_170665chr1274473 4411 4213 4193 3865 1016 755 44384 3365 1639 674 14345 13026
NM_170709chr852337 1608 1588 516 138 --11846 --
NM_170719chr1341415 1360 1117 904 ----1598
NM_170750chrX3868 771 212 ------
NM_172070chr272123 1811 1462 475 408 306 244 ------
NM_172103chr672475 2433 2365 978 689 547 440 22308 984 ----
NM_172105chr672475 2433 2365 978 689 547 440 22308 984 ----
NM_172109chr20153 ------
NM_172127chr451494 407 183 172 142 11892 ----
NM_172128chr451450 363 139 128 98 11848 ----
NM_172164chr1150 ------
NM_172169chr104781 774 159 144 11889 ----
NM_172170chr104781 774 159 144 11889 ----
NM_172171chr104781 774 159 144 11889 ----
NM_172173chr104781 774 159 144 11889 ----
NM_172240chr12154 ------
NM_172354chr141926 1713 527 206 --1246 --
NM_172373chr1321180 421 2514 61 ----
NM_173054chr71618 ------
NM_173082chr621316 423 ------
NM_173083chr131289 1142 208 1344 --21248 924
NM_173091chr201121 ------
NM_173157chr121553 ------
NM_173171chr231005 384 334 ------
NM_173172chr231313 1077 642 ------
NM_173173chr231005 384 334 ------
NM_173214chr1697313 7254 7041 6341 6245 6162 5988 3260 2666 1566 11463 --
NM_173468chr475992 5756 5378 5357 4918 895 718 22118 582 ----
NM_173491chr531269 557 40 1120 --11145
NM_173510chr2222002 1861 --12205 --
NM_173514chr52610 588 ------
NM_173515chr62975 97 ------
NM_173517chr7--1464 ----
NM_173519chr851921 445 402 386 232 186 21624 748 --
NM_173531chr1983636 3191 2717 2698 2486 1030 694 489 --33362 2923 1352 13812
NM_173533chr1----1253 --
NM_173545chr272128 2071 2029 1960 1883 1353 609 --1454 --
NM_173552chr321794 892 ----11576
NM_173582chr1196112 5729 5075 4892 3929 2471 1793 1548 604 25878 3823 1895 22256 2131
NM_173631chr1931197 397 118 --1437 11245
NM_173642chr157984 5697 3676 1748 749 21718 381 23040 1921 37871 6406 1134
NM_173647chr22960 104 1819 ----
NM_173694chrX62400 2342 2148 2128 990 545 12416 11834 --
NM_173802chr12195 ------
NM_173808chr163064 1304 1241 1181 575 437 ------
NM_173809chr1011103 ------
NM_173812chr1241257 1059 411 272 ------
NM_173827chr442880 2821 2118 54 12861 31032 727 496 --
NM_173829chr534639 2302 540 --22133 1856 25259 644
NM_175061chr762182 2028 1845 1393 862 116 ------
NM_175069chr92989 296 ----1340
NM_175071chr92803 110 ----2311 154
NM_175607chr33684 547 211 ----1328
NM_175612chr33684 547 211 ----1328
NM_175623chr1265896 2509 2418 1866 335 225 22424 1889 14726 15543
NM_175624chr1275991 2604 2513 1961 430 320 41 22519 1984 14821 15638
NM_175625chr1275991 2604 2513 1961 430 320 41 22519 1984 14821 15638
NM_175736chr1297858 7714 7162 6923 6916 6869 6732 2312 879 16172 15057 12625
NM_175861chr1295859 4847 4041 3722 2407 1860 1799 1321 767 ------
NM_175863chr631352 1008 262 --11234 --
NM_175884chr731013 995 121 ------
NM_175920chr51191 ------
NM_176824chr431288 374 318 1350 ----
NM_177414chr131425 1319 1279 11298 190 --
NM_177438chr1474074 3993 3951 2885 2651 867 428 1401 ----
NM_177452chr1451592 1571 1557 593 234 12253 ----
NM_177531chr831143 866 130 ------
NM_177937chr93647 105 91 ------
NM_177949chrX1137 ------
NM_177968chr232255 1579 781 --11670 --
NM_177969chr22682 62 ------
NM_177974chr1562261 1760 1437 460 264 150 ------
NM_177976chr31472 ------
NM_177985chr231872 1692 421 ------
NM_177990chr204495 426 325 313 11819 ----
NM_178009chr132562 550 ----1475
NM_178010chr1231743 1503 510 11692 ----
NM_178011chr10103053 2922 2152 2049 1061 985 917 753 307 206 ------
NM_178012chr61306 ------
NM_178140chr572676 1887 1110 1021 648 641 501 ------
NM_178151chrX77467 6902 6643 6579 6451 2816 254 24847 1549 24958 1087 --
NM_178152chrX77467 6902 6643 6579 6451 2816 254 24847 1549 24958 1087 --
NM_178153chrX77467 6902 6643 6579 6451 2816 254 24847 1549 24958 1087 --
NM_178154chr141228 ------
NM_178155chr141228 ------
NM_178156chr141228 ------
NM_178157chr141228 ------
NM_178161chr10277 71 ------
NM_178234chr81260 ------
NM_178496chr341486 604 548 151 ------
NM_178509chr1764136 4095 3973 3580 782 312 11136 ----
NM_178585chr453259 3218 3175 2983 2693 --1902 12443
NM_178586chr1442287 1628 1499 937 --11616 12409
NM_178815chr1032477 784 211 --1138 --
NM_178868chr32218 73 ------
NM_180991chr562745 2715 1142 1119 152 135 ------
NM_181054chr142931 411 11141 ----
NM_181077chr1582320 2226 2070 1928 1707 1577 674 474 --11980 --
NM_181291chr142656 271 ------
NM_181310chr651847 1709 1442 410 353 ------
NM_181358chr174263 3927 3838 3755 2937 1455 1161 --11645 24249 4063
NM_181361chr331327 138 90 1127 21303 314 --
NM_181443chr2082910 2859 2245 2127 1023 850 602 38 --1172 12869
NM_181481chr18156268 5510 5182 5161 5069 4630 2469 1805 1538 1528 1076 986 960 804 541 24797 2406 24736 1382 --
NM_181482chr18156268 5510 5182 5161 5069 4630 2469 1805 1538 1528 1076 986 960 804 541 24797 2406 24736 1382 --
NM_181483chr18156268 5510 5182 5161 5069 4630 2469 1805 1538 1528 1076 986 960 804 541 24797 2406 24736 1382 --
NM_181504chr594175 3025 2591 958 852 527 309 292 171 --11281 --
NM_181523chr594175 3025 2591 958 852 527 309 292 171 --11281 --
NM_181524chr594175 3025 2591 958 852 527 309 292 171 --11281 --
NM_181527chr201404 ------
NM_181528chr201459 ------
NM_181552chr71915 ------
NM_181659chr2063026 2524 1257 744 716 707 ------
NM_181659chr2063026 2524 1257 744 716 707 ------
NM_181670chr1241465 1277 1208 500 11220 ----
NM_181672chrX11502 ------
NM_181673chrX11502 ------
NM_181705chr575682 5060 4353 3822 1036 747 370 --12290 178
NM_181714chr641901 1809 1379 795 --21627 135 --
NM_181723chr842090 898 306 180 --11700 --
NM_181762chrX21126 199 ------
NM_181777chrX21126 199 ------
NM_181782chr651761 578 443 388 296 1176 12296 --
NM_181783chr1241989 618 580 282 ------
NM_181794chr631091 371 258 ----1836
NM_181795chr631091 371 258 ----1836
NM_181861chr1262606 2283 372 288 231 107 --4923 625 159 21 --
NM_181868chr1262606 2283 372 288 231 107 --4923 625 159 21 --
NM_181869chr1262691 2368 457 373 316 192 --41008 710 244 106 --
NM_181872chr91107 ------
NM_181897chr332337 551 267 ------
NM_182485chr482994 2445 2402 1261 1210 1065 737 93 21003 80 2959 685 --
NM_182503chr685584 5486 3605 1243 1161 947 567 273 ------
NM_182515chr1974728 4471 2245 2100 2087 2080 1349 15376 11271 --
NM_182569chr17------1147
NM_182646chr482994 2445 2402 1261 1210 1065 737 93 21003 80 2959 685 --
NM_182648chr14----1159 --
NM_182659chrY1121 ------
NM_182666chr31253 --1237 --
NM_182679chr1------2574 528
NM_182691chr741229 581 484 427 --1994 --
NM_182692chr741229 581 484 427 --1994 --
NM_182715chr741259 965 453 183 --1796 --
NM_182757chr643494 3436 3418 723 1641 12630 --
NM_182762chr755863 4887 4416 928 711 25406 1685 ----
NM_182763chr172620 2301 2227 2081 912 670 55 1877 12749 --
NM_182765chr1062345 2129 1987 1792 429 35 --21724 477 --
NM_182789chr51124 --1374 --
NM_182830chr1421992 1489 12018 21717 507 --
NM_182835chr14149 ------
NM_182898chr776610 4559 4527 2496 2228 2106 1316 --11382 11938
NM_182899chr776610 4559 4527 2496 2228 2106 1316 --11382 11938
NM_182918chr213922 351 314 1262 --11332
NM_182920chr33946 307 53 2203 195 ----
NM_182931chr72500 490 ------
NM_182943chr331179 875 498 ----1397
NM_182948chr123041 3004 ------
NM_182972chr121865 272 11875 --42371 1883 1842 104
NM_182975chr121111 1060 --1976 --
NM_182978chr181734 ------
NM_183004chr14113778 3531 3397 2885 2461 1414 1272 631 545 203 69 --23916 1243 --
NM_183078chr653672 2660 2471 864 372 --12760 --
NM_183227chr651075 593 577 395 43 1542 --2522 162
NM_183234chr152673 388 1316 1350 --
NM_183235chr152673 388 1316 1350 --
NM_183236chr152673 388 1316 1350 --
NM_183238chr1253458 2852 1006 438 71 --22921 1109 125
NM_183323chr51124 --1374 --
NM_183353chrX3746 96 27 ----21060 933
NM_183376chr1542560 1764 1665 250 12405 12315 --
NM_183381chr31946 1929 ----
NM_183383chr31946 1929 ----
NM_183384chr31946 1929 ----
NM_183416chr152075 1713 1677 754 661 1377 ----
NM_183419chr841489 1477 331 203 11053 1536 1121
NM_184234chr201547 1241 1160 1689
NM_194071chr744402 3635 1911 597 1200 14774 11398
NM_194247chr274297 3710 1749 1675 773 235 95 --41248 442 241 220 --
NM_194285chr1143182 3026 2316 123 --22602 2398 2509 198
NM_194291chr852479 2405 1917 476 39 ------
NM_194301chr1421107 405 --11024 --
NM_194314chr165202 4954 4491 614 394 203 --11967 11994
NM_194356chr1252253 1638 1591 1532 251 --1536 11688
NM_194434chr1875683 4429 4089 2272 2244 1413 683 15710 --11758
NM_194442chr141396 1330 607 293 --31787 1450 1321 --
NM_194463chrX51260 1072 969 457 445 ------
NM_197941chr552722 2421 693 101 49 1820 22364 394 --
NM_197968chr131179 1554 ----
NM_197970chr221468 1414 ------
NM_198066chr1452947 2810 2014 1238 871 1645 ----
NM_198128chr1842134 938 325 235 --21536 490 --
NM_198148chr101972 1941 ----
NM_198158chr383028 2973 2846 2174 469 391 370 230 12596 1581 --
NM_198159chr383028 2973 2846 2174 469 391 370 230 12596 1581 --
NM_198177chr383028 2973 2846 2174 469 391 370 230 12596 1581 --
NM_198178chr383028 2973 2846 2174 469 391 370 230 12596 1581 --
NM_198181chr1582700 2633 2449 2375 2064 1936 1008 684 ------
NM_198195chr31242 ------
NM_198240chr1231346 1206 1053 179 ----
NM_198268chr174263 3927 3838 3755 2937 1455 1161 --11645 24249 4063
NM_198269chr174263 3927 3838 3755 2937 1455 1161 --11645 24249 4063
NM_198273chr573072 3057 2435 2289 2267 605 284 1349 ----
NM_198336chr721750 1677 --11664 --
NM_198391chr2061286 1178 958 431 199 117 ------
NM_198400chr1592719 2586 2261 1790 1069 941 933 666 427 12287 ----
NM_198465chrX22771 2732 --2162 134 --
NM_198503chr141995 1558 1520 161 ------
NM_198504chr31855 ------
NM_198569chr652645 2202 876 422 118 --2475 286 --
NM_198581chr284564 2206 2048 1873 1666 1449 810 466 --15190 --
NM_198793chr344093 4059 1413 763 ------
NM_198794chr1441206 1008 560 505 --1901 --
NM_198829chr741473 1029 443 203 1424 ----
NM_198830chr172738 113 ----1693
NM_198859chr394955 3571 3538 3492 1902 1639 786 419 46 ------
NM_198889chr451444 1412 1350 991 386 1464 ----
NM_198896chr111301 ------
NM_198900chr1297858 7714 7162 6923 6916 6869 6732 2312 879 16172 15057 12625
NM_198902chr153719 628 266 2749 729 ----
NM_198904chr541855 672 579 342 --11417 --
NM_198968chr1323758 1414 11350 12786 13981
NM_198995chr181452 ------
NM_199000chr712273 11449 ----
NM_199003chr841314 585 526 73 1155 ----
NM_199044chr15779 558 384 89 52 22163 1174 33047 2277 2021 --
NM_199132chr1952036 780 696 612 291 --11512 --
NM_199136chr7160 ------
NM_199141chr191625 ------
NM_199188chr1241643 1339 780 598 13079 --11147
NM_199189chr53856 660 644 ----1295
NM_199190chr1241643 1339 780 598 13079 --11147
NM_199320chr432536 2319 943 12796 12552 --
NM_199320chr432536 2319 943 12796 12552 --
NM_199324chr463698 3128 2365 1438 874 456 ----22862 798
NM_199327chr411099 ----11184
NM_199436chr273118 1152 900 782 298 185 179 1741 ----
NM_199454chr174743 4655 4463 4277 3413 2956 244 2945 745 ----
NM_199482chr252112 1439 1374 544 22 ------
NM_201280chr631597 1429 1087 --1607 1465
NM_201453chr9----1144 --
NM_201548chr22938 27 ------
NM_201591chr461932 1654 1341 716 292 35 1698 --11911
NM_201592chr461932 1654 1341 716 292 35 1698 --11911
NM_201995chr111659 ------
NM_201998chr111724 ------
NM_203282chr1961648 1471 1430 1294 1169 310 ------
NM_203283chr41224 ----1168
NM_203284chr41224 ----1168
NM_203291chr181217 ------
NM_203292chr181210 ------
NM_203301chr1451725 1094 612 410 195 11550 ----
NM_203304chr191681 ------
NM_203327chr2023990 171 ----23100 2962
NM_203350chr161715 1599 1445 1143 588 41 11370 ----
NM_203364chr1131165 1141 1049 ------
NM_203394chr1252566 1826 634 509 69 --22338 2165 --
NM_203399chr11331 --2224 113 --
NM_203401chr11331 --2224 113 --
NM_203406chr552850 2703 2211 1982 711 1361 --1453
NM_203437chr22203 157 1869 ----
NM_203454chr131210 998 113 1278 1987 --
NM_203458chr153699 2533 1148 840 139 --12440 --
NM_203459chr152493 2164 1950 381 146 --12340 22112 170
NM_203463chr284446 3917 1919 1781 1016 997 434 139 11528 2916 73 23099 1003
NM_203499chr172563 321 ------
NM_203504chr461781 1009 880 704 474 384 ------
NM_203505chr461781 1009 880 704 474 384 ------
NM_206594chr163581 3549 2691 1320 1149 696 12331 1721 --
NM_206595chr163581 3549 2691 1320 1149 696 12331 1721 --
NM_206852chr143740 578 257 ----1764
NM_206853chr6104024 3963 3775 2951 2718 1391 910 863 578 563 --12507 --
NM_206854chr695285 5224 5036 4212 3979 3306 2124 1839 1824 21147 899 13768 --
NM_206855chr676250 6189 6001 5177 4944 4271 678 22112 1864 14733 --
NM_206857chr143740 578 257 ----1764
NM_206866chr2143239 3128 2837 1040 12534 32108 967 226 12319
NM_206886chr1170 ------
NM_206907chr572779 2656 2508 1118 544 207 121 1172 12252 --
NM_206909chr8128401 7604 6864 6488 6375 5832 5071 3269 3078 2527 549 217 35941 3244 3036 25624 3201 --
NM_206933chr132829 934 36 22292 970 ----
NM_206938chr1132020 1999 1887 ------
NM_206939chr1132020 1999 1887 ------
NM_206940chr1132020 1999 1887 ------
NM_206943chr2164 --1913 --
NM_207015chr352369 1745 659 552 148 ------
NM_207043chr122314 818 --1147 --
NM_207044chr122314 818 --1147 --
NM_207047chr122314 818 --1147 --
NM_207123chr43743 589 322 ------
NM_207171chr131408 690 497 ------
NM_207292chr353116 1174 929 538 305 ------
NM_207293chr353116 1174 929 538 305 ------
NM_207294chr353116 1174 929 538 305 ------
NM_207295chr353116 1174 929 538 305 ------
NM_207296chr353116 1174 929 538 305 ------
NM_207297chr353141 1199 954 563 330 126 ----
NM_207299chr91157 ------
NM_207303chr1073174 1636 1490 967 513 505 495 ----1592
NM_207304chr1342638 2217 2163 1645 1234 11778 --
NM_207406chr4126305 6111 5663 5224 4763 4756 4719 4464 4342 4253 1606 1077 --25672 4580 --
NM_207413chr8273 30 ------
NM_207647chr962097 2021 989 922 176 56 ------
NM_212460chr741656 1399 643 443 --1176 --
NM_212471chr1731829 344 247 --21450 1408 --
NM_212472chr1731829 344 247 --21450 1408 --
NM_213589chr295314 5207 4016 3974 3948 2203 1611 1363 1078 1452 1634 15157