TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-20b-3p
miRNA Sequence: ACUGUAGUAUGGGCACUUCCAG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr51899 ----1839
NM_000024chr51529 ------
NM_000038chr551973 1295 606 527 43 ----1319
NM_000051chr1122310 2250 13512 12388 --
NM_000067chr8------1567
NM_000074chrX1900 --1173 1806
NM_000084chrX95653 5202 4750 2593 1690 1540 1024 992 152 --26310 4242 21389 42
NM_000092chr274270 4246 3692 1244 937 321 314 12962 13735 --
NM_000096chr34676 284 191 100 ------
NM_000109chrX62594 2102 898 875 618 305 1742 1709 --
NM_000112chr574935 4658 4524 4291 3803 2056 1231 13908 22041 164 --
NM_000115chr1382503 2276 2044 959 744 611 243 154 ------
NM_000125chr684056 3672 3557 3352 2925 1514 1141 591 ----1662
NM_000129chr631497 551 300 --1960 21127 121
NM_000138chr1562609 2550 2117 573 488 59 ------
NM_000141chr1021392 52 21476 358 ----
NM_000151chr1721924 1449 --21654 1326 --
NM_000163chr552230 2120 1578 585 478 --41777 1643 641 605 --
NM_000165chr631570 1460 560 --11629 --
NM_000166chrX1635 ------
NM_000167chrX31766 1515 1313 1188 ----
NM_000176chr573907 3538 3166 2900 1274 551 141 --12636 --
NM_000208chr1934604 1647 473 1186 ----
NM_000210chr232372 318 300 ------
NM_000212chr1721645 280 174 ----
NM_000217chr1251479 1196 719 551 544 ----1745
NM_000242chr1052619 2478 697 310 40 --11860 --
NM_000245chr792182 2065 2034 1856 1722 1681 1564 591 218 --2772 637 --
NM_000248chr362415 2263 1919 704 534 195 --11122 --
NM_000259chr15136300 5829 5303 4615 4609 2160 2124 1970 1715 1281 883 680 641 21557 758 24728 612 --
NM_000264chr953191 2594 2337 1200 832 --22770 2403 --
NM_000267chr1753093 2736 1334 843 253 1401 1663 --
NM_000276chrX2578 555 ------
NM_000286chr172199 109 1702 ----
NM_000297chr441996 1903 1663 1643 11369 ----
NM_000314chr1052652 1206 1117 601 476 ------
NM_000329chr11715 1142 ----
NM_000332chr6116382 6257 5362 5342 5037 4721 1570 1260 680 365 142 11275 --16135
NM_000337chr564188 2200 1463 1370 1164 727 16486 ----
NM_000351chrX64083 3569 2871 786 422 54 13682 ----
NM_000362chr2273537 2738 2593 2395 1051 607 540 11357 ----
NM_000390chrX53281 3021 2656 1241 859 21086 750 12396 --
NM_000393chr242032 697 552 428 ----12115
NM_000408chr243480 3466 1281 716 13361 1879 --
NM_000411chr2143119 2233 1140 734 12167 12641 --
NM_000428chr1482545 2538 2390 2202 1941 869 850 413 ----1350
NM_000430chr1753705 3396 1410 909 496 ------
NM_000439chr542302 2290 300 287 ------
NM_000441chr742225 1885 1543 559 2793 617 ----
NM_000451chrX3799 382 345 --11403 --
NM_000452chr1361870 1738 1589 1323 625 56 --1417 --
NM_000461chr374420 3733 3500 1025 837 738 32 21273 819 --14402
NM_000462chr1541406 1398 1163 212 --1659 --
NM_000474chr71445 ------
NM_000484chr213843 788 225 ----1901
NM_000489chrX21251 831 13183 ----
NM_000492chr741497 1194 578 506 ------
NM_000522chr7------11165
NM_000533chrX3657 423 263 --11575 --
NM_000536chr111471 1555 ----
NM_000555chrX97301 7227 7022 6801 6286 6166 1706 1260 815 12783 35194 5051 1733 1662
NM_000601chr71448 ------
NM_000609chr1022740 30 12788 22114 2050 --
NM_000618chr1286609 6263 5615 5367 2546 1783 1754 459 36329 2160 248 46072 5564 5430 4538 --
NM_000618chr1286609 6263 5615 5367 2546 1783 1754 459 36329 2160 248 46072 5564 5430 4538 --
NM_000633chr1831609 1475 97 ------
NM_000663chr161346 22784 199 ----
NM_000673chr42820 576 1321 ----
NM_000686chrX41041 1002 627 565 ------
NM_000689chr9153 ----1388
NM_000693chr1531775 1609 191 21803 443 ----
NM_000722chr7----172 --
NM_000724chr1041649 219 195 92 --1687 --
NM_000726chr22902 156 ------
NM_000767chr1931106 295 110 --41294 1168 493 358 --
NM_000780chr8----2342 40 149
NM_000782chr20183 11048 ----
NM_000786chr721342 591 --31419 1095 960 --
NM_000793chr1495018 3872 3641 3580 1496 1291 1130 450 356 --11568 --
NM_000806chr521467 468 --11712 --
NM_000807chr42663 556 --1573 1180
NM_000812chr43394 150 61 ------
NM_000813chr545198 3628 2023 1251 --14166 14533
NM_000814chr1553849 3131 2574 2555 1260 23145 3059 11552 --
NM_000824chr43786 293 251 ----1304
NM_000826chr462425 1986 890 498 441 397 1355 152 --
NM_000831chr1105630 4946 4786 4687 4122 2290 1785 1095 610 397 35589 5033 330 ----
NM_000844chr31763 ------
NM_000855chr111259 ------
NM_000857chr41434 ------
NM_000859chr521387 279 ----1618
NM_000866chr351904 1766 1560 1526 1373 11434 --1535
NM_000868chrX5970 747 609 39 28 --12601 1669
NM_000875chr15107055 6499 6376 6168 5428 4635 1616 1160 470 156 --16196 --
NM_000880chr82884 851 ------
NM_000891chr1743643 3032 1307 398 ------
NM_000899chr1284374 4026 3940 3611 3455 1673 642 322 --32925 826 399 1888
NM_000901chr432559 997 932 ----11619
NM_000902chr332676 769 466 --1412 --
NM_000912chr833470 2419 2358 --42164 665 531 82 12300
NM_000921chr121157 ------
NM_000944chr44419 325 292 187 11541 --12330
NM_000945chr231690 754 594 11893 ----
NM_000949chr5------159
NM_000950chrX53147 2662 613 533 74 23186 1467 ----
NM_000961chr2032859 2465 214 1869 43484 3351 3055 2922 --
NM_000963chr11677 --2998 806 12179
NM_000965chr31818 ------
NM_000983chr13656 482 84 11098 ----
NM_001001132chr211238 11086 --1157
NM_001001323chr1262540 2139 2028 1241 1172 264 ------
NM_001001395chr1252465 2347 1050 149 39 ------
NM_001001419chr575167 1538 1085 1051 978 964 508 --44848 4448 4237 104 14259
NM_001001420chr575167 1538 1085 1051 978 964 508 --44848 4448 4237 104 14259
NM_001001433chr2042314 903 719 311 ----1321
NM_001001481chr863329 1359 1281 825 133 105 32660 2505 1302 --12170
NM_001001483chr112311 160 ------
NM_001001484chr1051823 1798 756 731 164 11909 ----
NM_001001557chr852168 2052 1717 1603 355 2622 76 ----
NM_001001664chr243149 2762 2711 2577 ----11028
NM_001001665chr273260 2805 2500 2398 2376 821 794 22900 1240 ----
NM_001001684chr1731618 235 113 --31953 960 38 12016
NM_001001890chr2164125 2659 1570 1169 853 714 ------
NM_001001933chr11148 --1579 --
NM_001001974chr1042398 1826 1579 375 --21677 1459 --
NM_001001995chrX3623 68 36 --11280 --
NM_001002233chr852131 2100 1414 1370 171 1500 ----
NM_001002814chr862696 1414 1370 1254 1231 171 23100 500 13233 --
NM_001002838chrX101561 1402 1365 1306 1270 1191 549 389 203 126 --1724 --
NM_001002860chr1431808 1687 1417 24087 73 34614 1873 1054 13851
NM_001003652chr18118034 6766 5651 5625 3108 2723 2616 2151 1621 1449 1348 --38451 6740 1819 --
NM_001003674chr1876566 5563 2619 2447 2015 1714 1171 34756 4436 1637 11020 --
NM_001003675chr1876566 5563 2619 2447 2015 1714 1171 34756 4436 1637 11020 --
NM_001003679chr152074 1433 704 401 336 159 --123
NM_001003681chr22----22095 1510 --
NM_001003698chr641612 1533 1510 1320 --1592 1734
NM_001003699chr641612 1533 1510 1320 --1592 1734
NM_001003712chr1263876 3673 2908 2832 2627 330 12826 --23239 452
NM_001003760chr643600 3277 872 104 13375 ----
NM_001003792chr34953 859 825 265 --11203 --
NM_001003793chr34953 859 825 265 --11203 --
NM_001003800chr973406 2657 1229 1214 538 451 26 ----12322
NM_001003805chr14182 ------
NM_001004019chr32414 90 ------
NM_001004065chr962650 1516 1229 802 753 315 --13005 11602
NM_001004106chr5162 1720 11002 --
NM_001004304chr1232296 2019 217 22677 1191 1472 --
NM_001004317chr653629 3327 3315 2772 161 ------
NM_001004346chr441261 461 319 80 11020 ----
NM_001004419chr1273266 3065 2841 1836 754 82 29 13927 13493 --
NM_001004720chr22868 848 ------
NM_001004722chr251037 1017 166 104 56 ------
NM_001005266chr151611 ------
NM_001005267chr151611 ------
NM_001005268chr151611 ------
NM_001005269chr151611 ------
NM_001005375chrY21542 575 ----1163
NM_001005386chr24816 661 490 279 ----1870
NM_001005404chr1783493 3393 1702 1461 1445 1090 885 535 24276 3782 13626 --
NM_001005463chr1042315 1750 527 128 --12141 --
NM_001005473chr5106557 5502 4210 1439 1176 1097 498 446 182 161 25898 4062 --15160
NM_001005474chr311380 --11083 --
NM_001005502chr1295131 4888 4464 4225 4014 3828 1834 737 67 24191 911 15091 11635
NM_001005505chr31527 ----11828
NM_001005609chrX53775 3425 2400 750 582 12390 ----
NM_001005746chr22902 156 ------
NM_001005747chr22902 156 ------
NM_001005751chr103176 89 32 ------
NM_001005861chr31694 ------
NM_001005910chr33667 626 84 ------
NM_001005911chr33667 626 84 ------
NM_001006600chr542248 737 248 57 ------
NM_001006612chrX1307 ------
NM_001006613chrX1307 ------
NM_001006614chrX1307 ------
NM_001006623chr252083 1670 936 678 529 1581 195 --
NM_001006684chrX------1629
NM_001007023chr1495018 3872 3641 3580 1496 1291 1130 450 356 --11568 --
NM_001007067chr85853 832 730 385 308 1209 ----
NM_001007068chr85853 832 730 385 308 1209 ----
NM_001007069chr85853 832 730 385 308 1209 ----
NM_001007070chr85853 832 730 385 308 1209 ----
NM_001007097chr964107 4002 1673 1390 274 159 21536 799 24722 969 1962
NM_001007099chr12222 91 ------
NM_001007100chr12222 91 ------
NM_001007246chr2161976 1840 450 152 111 92 11277 ----
NM_001007248chr192328 23 ------
NM_001007466chr674566 3871 1214 1194 835 756 677 21725 786 ----
NM_001007527chr53646 245 205 ------
NM_001007559chr1831693 465 404 1299 11891 --
NM_001008225chr72553 135 ------
NM_001008392chr363510 2239 1091 628 491 391 13395 22795 1236 --
NM_001008408chr786433 6393 3992 1734 1645 1581 1573 1165 ----12443
NM_001008495chr831621 578 233 --198 --
NM_001008541chr1042221 1858 348 126 ------
NM_001008541chr1042221 1858 348 126 ------
NM_001008564chr1372094 2058 2046 1520 821 749 244 --1429 --
NM_001008726chr1421050 403 ------
NM_001008738chr542290 1938 1878 897 --22075 319 11118
NM_001008801chr1931535 812 510 12145 21732 1598 --
NM_001008925chr483516 2969 2876 2253 2160 545 510 322 ------
NM_001009554chr464376 1819 1044 605 392 153 --14702 --
NM_001009554chr464376 1819 1044 605 392 153 --14702 --
NM_001009569chr102551 481 --1127 --
NM_001009571chr761416 1226 664 561 415 80 ------
NM_001009881chr11528 2475 201 1233 --
NM_001009882chr11528 2475 201 1233 --
NM_001009899chr396351 5985 5644 5063 4178 2128 1403 204 41 --65911 2248 2113 2050 1600 1466 --
NM_001009958chr7------1631
NM_001009960chr752572 2249 1918 935 90 ----12296
NM_001009993chr263907 2873 439 337 133 69 14069 34561 3317 812 13809
NM_001010853chr642356 996 855 583 --41297 781 646 213 --
NM_001010861chr14914 611 550 27 ------
NM_001010862chrX33276 3005 2833 1767 12821 --
NM_001010867chr1135348 4942 2442 2056 1911 1771 1380 1339 1277 1229 1100 1009 423 --45276 5214 2203 2119 15067
NM_001010888chrX114656 4333 3348 2967 1693 1352 1074 940 743 487 296 11303 44169 913 685 550 --
NM_001010891chr5115949 5478 5451 5156 2573 2107 1862 1851 1840 323 184 --55219 2773 2636 2316 1817 --
NM_001010922chr173725 3536 2747 2618 1344 1236 559 21420 184 31483 756 622 11216
NM_001010932chr71448 ------
NM_001010935chr13910 839 327 1820 2679 36 --
NM_001010971chr12931 787 1367 ----
NM_001010986chrX72485 2408 2400 1898 1891 775 27 --11912 12506
NM_001010989chr161404 ------
NM_001010990chr161404 ------
NM_001011537chr332378 900 573 ------
NM_001011546chr203728 314 272 ------
NM_001011553chr71320 ------
NM_001011663chr1041018 865 54 47 1797 ----
NM_001011666chr7106581 6408 4940 4908 2588 1611 1099 1090 1060 514 14822 45895 4159 1972 1406 --
NM_001011708chr232392 1861 377 1360 --1503
NM_001011885chr1531748 1212 24 1647 --11640
NM_001012393chr1194723 4665 3336 3283 1895 1668 1560 554 428 33569 638 568 ----
NM_001012419chr951017 853 356 295 200 --11078 --
NM_001012420chr1532279 2089 945 --12630 2859 390
NM_001012421chr94853 356 295 200 ------
NM_001012423chr1542279 2089 945 784 --12630 1390
NM_001012426chr683172 2832 2616 1147 927 891 879 778 --22817 2679 --
NM_001012427chr683172 2832 2616 1147 927 891 879 778 --22817 2679 --
NM_001012751chr1031918 1754 325 11416 11395 --
NM_001012755chrX94912 4225 4089 3619 1258 1048 697 672 456 34707 3458 2047 21458 1321 --
NM_001012756chr1952411 2383 1137 1083 369 32144 880 289 42735 2608 2474 1033 --
NM_001012989chrX------199
NM_001013399chr621141 397 2855 230 1865 --
NM_001013406chr741757 1425 1360 430 11685 11287 --
NM_001013415chr431244 1220 410 1155 --1355
NM_001013437chr182414 127 ------
NM_001013438chr35903 709 193 178 72 1674 ----
NM_001013439chr35749 555 257 39 24 ------
NM_001013699chr12--2495 156 ----
NM_001014380chr1385694 5056 3907 2321 1330 1250 835 719 14569 1898 --
NM_001014434chr12177 154 --1624 1580
NM_001014797chr10108115 7780 7260 7222 6818 6695 5334 2826 2484 1855 26709 1812 ----
NM_001015045chr472379 2037 1720 1549 799 480 315 42019 705 431 337 1231 --
NM_001015877chrX22260 209 --11911 --
NM_001017368chr1752398 1881 1809 488 32 22813 613 12038 --
NM_001017395chr353190 1327 1268 643 329 13633 1657 --
NM_001017396chr252147 1594 802 532 295 --11657 11792
NM_001017415chr1166 ------
NM_001017416chr1166 ------
NM_001017523chr1231573 736 375 21703 175 ----
NM_001017923chr143542 449 105 --11502 --
NM_001017926chr81443 --31365 722 178 --
NM_001017930chrX11003 ------
NM_001017977chr1--174 ----
NM_001018004chr152687 460 ------
NM_001018006chr152687 460 ------
NM_001018007chr152687 460 ------
NM_001018009chr311177 ------
NM_001018020chr152687 460 ------
NM_001018025chrX3790 547 166 1339 177 1180
NM_001018054chr13346 178 51 21099 354 --11142
NM_001018065chr995662 5338 4556 4487 4426 1831 1706 1649 1215 24938 1286 138 2595 232
NM_001018066chr995662 5338 4556 4487 4426 1831 1706 1649 1215 24938 1286 138 2595 232
NM_001018067chr154133 1144 521 399 172 --24101 4042 11908
NM_001018068chr154133 1144 521 399 172 --24101 4042 11908
NM_001018069chr154133 1144 521 399 172 --24101 4042 11908
NM_001018072chr1231573 736 375 21703 175 ----
NM_001018074chr573907 3538 3166 2900 1274 551 141 --12636 --
NM_001018075chr573907 3538 3166 2900 1274 551 141 --12636 --
NM_001018076chr573907 3538 3166 2900 1274 551 141 --12636 --
NM_001018077chr573907 3538 3166 2900 1274 551 141 --12636 --
NM_001020658chr131514 657 189 ------
NM_001020658chr131514 657 189 ------
NM_001020825chr531382 1013 375 --1111 --
NM_001024075chr21250 ------
NM_001024094chr573907 3538 3166 2900 1274 551 141 --12636 --
NM_001024660chr321604 595 ------
NM_001024847chr342320 2031 1008 345 ------
NM_001024934chr63596 185 25 ------
NM_001024935chr63596 185 25 ------
NM_001024936chr63596 185 25 ------
NM_001024948chr183062 3018 2991 2472 2280 2269 1179 452 --22214 1283 --
NM_001024956chr11105883 5466 5194 4874 3997 3760 2358 858 636 508 12340 ----
NM_001025076chr1056069 4188 4111 2476 2187 --25600 4373 --
NM_001025077chr1087427 5546 5469 4624 1107 719 630 556 --26958 5731 --
NM_001025079chr384019 3817 3024 2717 2680 2603 1336 930 ------
NM_001025201chr2--136 ----
NM_001025252chr832723 499 267 1287 12900 --
NM_001025253chr832723 499 267 1287 12900 --
NM_001025266chr354215 3121 3109 1848 701 34870 3084 1039 23851 3428 --
NM_001025366chr611553 ------
NM_001025366chr611553 ------
NM_001025367chr611553 ------
NM_001025367chr611553 ------
NM_001025368chr611553 ------
NM_001025368chr611553 ------
NM_001025369chr611569 ------
NM_001025369chr611569 ------
NM_001025370chr611553 ------
NM_001025370chr611553 ------
NM_001025580chrX73173 1609 1353 1295 1267 1238 813 21589 39 ----
NM_001025616chr411435 1133 ----
NM_001025780chr93988 566 48 --21545 1181 11052
NM_001029858chr653271 1267 461 328 116 --11330 --
NM_001029863chr643125 2516 1098 777 ----1855
NM_001029875chr572850 2528 2294 2050 1054 807 367 ------
NM_001029883chr242855 1995 865 533 11122 ----
NM_001029997chr192548 303 ----1274
NM_001030055chr14104289 4038 3117 3107 1864 1372 1203 1093 162 117 1326 ----
NM_001030272chr115441 359 158 63 31 ------
NM_001030273chr115441 359 158 63 31 ------
NM_001031623chr621421 99 --11210 --
NM_001031690chr743113 2601 2005 640 12364 12184 --
NM_001031695chr2255040 4242 3869 1554 87 --24110 1346 --
NM_001031700chr432083 501 332 21755 796 ----
NM_001031732chr433049 1461 1196 --11451 --
NM_001031804chr1624112 928 11527 --14228
NM_001031812chr541889 1547 1519 937 --11793 --
NM_001032280chr611456 ------
NM_001032282chr831176 455 78 ------
NM_001032283chr123773 425 358 1385 ----
NM_001032284chr123773 425 358 1385 ----
NM_001032296chr1342544 2143 579 171 22008 669 ----
NM_001032380chr1051327 587 407 218 74 ----11569
NM_001032393chrX----1211 --
NM_001033045chr2124412 3741 3578 3300 3215 1670 1458 984 927 857 592 465 11638 --1831
NM_001033047chr422475 310 1699 1904 --
NM_001033057chr341950 1737 1372 810 --11355 --
NM_001033081chr131472 772 557 ------
NM_001033082chr131472 772 557 ------
NM_001033087chr2063271 2986 2746 2569 825 420 1166 32801 2400 983 --
NM_001033117chr333007 954 162 24833 639 --11040
NM_001033503chr52459 319 ------
NM_001033557chr231385 533 307 ------
NM_001033561chr172701 117 1890 ----
NM_001033602chr1342682 2465 2009 342 ----1279
NM_001033723chr822710 413 --162 12448
NM_001033756chr611487 ------
NM_001033756chr611487 ------
NM_001033925chr1031868 1621 264 --1809 --
NM_001034841chr16105386 5319 4447 4412 4170 3941 1938 1889 1720 337 --34672 4510 2074 --
NM_001034954chr1053239 3139 3060 3024 2959 12869 ----
NM_001034955chr1053239 3139 3060 3024 2959 12869 ----
NM_001034956chr1053239 3139 3060 3024 2959 12869 ----
NM_001034957chr1053239 3139 3060 3024 2959 12869 ----
NM_001035chr131284 812 474 ------
NM_001035003chr441063 949 930 498 11255 11124 --
NM_001035004chr441063 949 930 498 11255 11124 --
NM_001035260chr1031368 598 224 1559 ----
NM_001037132chr732023 286 138 --1661 --
NM_001037133chr732023 286 138 --1661 --
NM_001037172chr311275 11232 ----
NM_001037174chr222053 908 ------
NM_001037317chr14914 611 550 27 ------
NM_001037324chr3--1723 ----
NM_001037334chr1822031 359 ----1170
NM_001037339chr131764 1542 1439 --1575 11718
NM_001037340chr131764 1542 1439 --1575 11718
NM_001037341chr131764 1542 1439 --1575 11718
NM_001037341chr131764 1542 1439 --1575 11718
NM_001037533chr1--2213 104 ----
NM_001037535chrX31548 1254 1134 --1625 --
NM_001037536chrX31548 1254 1134 --1625 --
NM_001037540chrX31548 1254 1134 --1625 --
NM_001037553chr2164680 4116 3477 3413 3389 1271 13344 ----
NM_001037631chr22381 198 ------
NM_001037954chr1173359 3167 2908 668 604 478 373 12927 ----
NM_001038702chr552126 2058 2044 2026 749 ----1940
NM_001039538chr263413 3102 2354 1414 1275 324 11123 13207 --
NM_001039547chr3118043 7722 7618 6531 6204 5722 5083 2766 2688 2295 1901 --12884 25035 3111
NM_001039569chr273307 2792 2116 918 716 519 32 --32636 2441 1113 --
NM_001039590chrX93894 3590 1550 1245 635 352 322 178 51 1147 --13756
NM_001039591chrX93894 3590 1550 1245 635 352 322 178 51 1147 --13756
NM_001039616chr19--157 ----
NM_001039618chr11125611 5275 5217 5178 5097 4391 4082 3842 3757 3626 2200 1697 25458 262 ----
NM_001039693chr243039 2832 752 292 24018 99 ----
NM_001039762chr1041758 736 583 557 --11698 --
NM_001039840chrX55419 3952 2189 1373 1063 24781 4114 ----
NM_001039937chr1363948 3629 3599 702 670 155 1133 ----
NM_001040020chr721535 478 ------
NM_001040057chr72397 72 --1241 --
NM_001040135chr7------1686
NM_001040142chr252337 2184 2054 864 43 ------
NM_001040143chr252337 2184 2054 864 43 ------
NM_001040152chr784477 3772 3558 3492 3467 1138 1021 796 11529 14806 --
NM_001040157chr452755 2594 1130 89 42 21784 254 2269 98 --
NM_001040159chr421280 264 ------
NM_001040181chr31838 --1785 --
NM_001040182chr31838 --1785 --
NM_001040183chr31838 --1785 --
NM_001040199chr31838 --1785 --
NM_001040200chr31838 --1785 --
NM_001040214chr652198 2055 1907 1710 350 ------
NM_001040284chr1664696 4505 912 882 253 170 15301 --15694
NM_001040402chr463101 2189 2173 993 907 670 ----1216
NM_001040429chr1342270 1343 517 87 --22457 1278 --
NM_001040441chr165251 4696 3837 3773 1456 262 13973 23793 1970 --
NM_001040665chr774920 4712 4359 3416 3276 2006 297 1688 ----
NM_001040712chr963153 2493 1379 740 359 130 33495 3305 253 133 --
NM_001042353chr20--143 1510 --
NM_001042355chr1695415 5191 4553 4413 4156 2036 1787 1757 871 25247 2062 11386 --
NM_001042357chr101591 --11084 1295
NM_001042358chr101591 --11084 1295
NM_001042360chr101591 --11084 1295
NM_001042363chr101591 --11084 1295
NM_001042388chr182804 391 2880 635 ----
NM_001042389chr101591 --11084 1295
NM_001042390chr101591 --11084 1295
NM_001042392chr101591 --11084 1295
NM_001042395chr101591 --11084 1295
NM_001042404chr161531 1452 1357 1269 277 103 ------
NM_001042412chr1695415 5191 4553 4413 4156 2036 1787 1757 871 25247 2062 11386 --
NM_001042413chr963556 3006 2961 2899 2542 1510 31222 722 118 1183 22613 1346
NM_001042425chr611456 ------
NM_001042453chrX31362 607 327 --21537 214 --
NM_001042473chr1041964 1502 165 101 --11353 --
NM_001042481chr141177 11035 --1198
NM_001042492chr1753093 2736 1334 843 253 1401 1663 --
NM_001042493chr631927 715 170 11918 ----
NM_001042494chr1573177 2643 2491 2442 1307 570 181 12410 23388 2788 21288 191
NM_001042495chr1573177 2643 2491 2442 1307 570 181 12410 23388 2788 21288 191
NM_001042496chr1573177 2643 2491 2442 1307 570 181 12410 23388 2788 21288 191
NM_001042497chr1573177 2643 2491 2442 1307 570 181 12410 23388 2788 21288 191
NM_001042510chr831813 817 72 1120 --11331
NM_001042511chr831813 817 72 1120 --11331
NM_001042533chr323032 137 21250 544 ----
NM_001042550chr932049 1797 326 11389 --11440
NM_001042555chr1243743 1788 1251 1243 1786 1389 13423
NM_001042599chr2116831 6566 6516 6339 5771 5307 5046 4970 2651 1597 417 12707 ----
NM_001042601chr373236 2774 2129 1025 686 651 265 --12866 12411
NM_001042603chr1275283 4544 4329 3669 1859 715 255 --11022 --
NM_001042604chr394334 4166 3284 3271 962 778 763 671 410 ------
NM_001042669chr411435 1133 ----
NM_001042749chrX51900 1759 1655 1341 210 ------
NM_001042750chrX51900 1759 1655 1341 210 ------
NM_001042751chrX51900 1759 1655 1341 210 ------
NM_001042784chr4--126 ----
NM_001043318chr1483674 2680 1404 1224 1191 1008 363 292 23130 2955 12886 --
NM_001043351chr142186 1928 1842 1470 1729 11532 --
NM_001044722chr541889 1547 1519 937 --11793 --
NM_001044723chr541889 1547 1519 937 --11793 --
NM_001046chr533019 2842 696 --22353 1939 --
NM_001049chr1432104 1968 989 --11504 --
NM_001068chr3------1279
NM_001069chr6----1149 --
NM_001071775chr1321638 92 21809 173 ----
NM_001079874chr111964 22013 851 ----
NM_001083620chr462423 1984 889 497 440 396 1354 152 --
NM_001099678chr376086 4185 3895 1435 1356 442 426 56317 2215 1883 1769 1687 --21668 517
NM_001100108chr1117881 5898 5654 2727 2569 2113 897 552 537 244 152 --1349 --
NM_001106chr369402 8006 2433 2306 2134 677 13913 49514 3549 2848 2596 17411
NM_001117chr1822452 2289 ------
NM_001121chr1051674 1476 612 480 409 11286 11486 --
NM_001122679chr51899 ----1839
NM_001123chr101109 ------
NM_001126chr121053 121 1867 ----
NM_001146chr822064 1552 12009 --1223
NM_001149chr101889 1204 1880 --
NM_001160chr1242697 2146 515 123 --31009 842 711 --
NM_001167chrX106633 6446 6327 5419 4914 4735 2700 1927 1657 257 16386 55877 5742 5614 2127 1990 11709
NM_001173chr14104289 4038 3117 3107 1864 1372 1203 1093 162 117 1326 ----
NM_001174chrX62043 1998 1913 1895 572 39 41506 694 207 83 ----
NM_001177chr12102082 1875 1821 1591 936 800 591 126 97 36 ------
NM_001178chr115441 359 158 63 31 ------
NM_001186chr2182789 2396 2280 1058 1047 824 676 587 2386 356 22700 316 --
NM_001187chr212582 192 --1104 --
NM_001198chr611532 ------
NM_001204chr266548 6201 5849 1887 1125 978 47321 6307 5087 3027 1397 17444
NM_001219chr752168 550 536 94 46 21573 756 ----
NM_001222chr1051674 1667 1540 768 123 31832 1435 696 ----
NM_001238chr19--192 ----
NM_001241chr232084 1968 44 12064 12227 --
NM_001241chr232084 1968 44 12064 12227 --
NM_001256chr1712643 12300 ----
NM_001257chr16190 ------
NM_001259chr784921 2273 2120 1624 1411 1070 841 370 21563 80 ----
NM_001270chr52919 205 --1266 --
NM_001271chr152932 67 42934 2839 2126 1319 12382 --
NM_001290chr4272 51 ----1399
NM_001304chr1743636 3180 616 71 13529 149 --
NM_001310chr1273088 2916 2811 2173 2121 710 455 13062 --12081
NM_001329chr104569 466 421 145 --11292 --
NM_001331chr1152558 2314 1814 1134 128 42728 2688 658 275 ----
NM_001332chr521254 550 ----1518
NM_001338chr212499 178 ------
NM_001343chr521553 532 1501 ----
NM_001346chr342826 1784 388 49 12318 12239 --
NM_001351chr341630 1516 477 412 ------
NM_001356chrX42485 2438 265 71 --1814 --
NM_001357chr11310 ------
NM_001358chr41132 ------
NM_001364chr1134560 1878 749 44551 4040 1226 331 ----
NM_001380chr1011018 ------
NM_001390chr1873415 3024 2910 2755 2246 308 42 --1211 --
NM_001391chr1811174 ------
NM_001394chr81604 ------
NM_001396chr2192470 2456 2432 2205 2103 1088 679 362 117 ------
NM_001399chrX53775 3425 2400 750 582 12390 ----
NM_001400chr111214 ------
NM_001402chr642038 2023 1276 491 --21455 1339 --
NM_001412chrX73751 3174 1429 1039 861 456 253 11072 --23661 1481
NM_001419chr1954824 4782 4082 1367 260 11494 ----
NM_001427chr731985 187 157 ------
NM_001438chr1113451 2949 2888 2718 2447 1284 1251 1244 947 817 115 ------
NM_001448chrX21339 717 11727 1255 1690
NM_001449chrX41045 879 203 142 21308 900 ----
NM_001453chr621486 1285 ----11617
NM_001455chr651933 1016 786 575 116 162 ----
NM_001458chr72116 56 ------
NM_001527chr6144773 4325 4128 3330 3268 2973 1859 1716 1457 779 725 586 545 367 23488 756 44712 3170 3036 448 24640 1113
NM_001539chr9----1115 --
NM_001553chr4153 1192 ----
NM_001560chrX41909 757 638 102 ----1920
NM_001587chrX2578 555 ------
NM_001616chr252997 2408 1159 168 74 ------
NM_001621chr772764 2214 1857 995 786 762 193 --1203 --
NM_001621chr772764 2214 1857 995 786 762 193 --1203 --
NM_001635chr72941 776 2356 102 ----
NM_001655chr1141897 1698 814 428 --31620 625 490 --
NM_001656chr552040 1488 620 568 497 ------
NM_001663chr1452783 2128 1821 840 132 12544 12631 --
NM_001664chr31111 ------
NM_001668chr142015 1866 1707 1603 ------
NM_001681chr12----1488 1205
NM_001682chr1242254 1853 955 886 ------
NM_001690chr362366 1907 1896 924 587 347 12308 3892 758 696 --
NM_001709chr113442 222 111 ------
NM_001713chr521174 144 ------
NM_001718chr641119 1095 841 52 1439 --1253
NM_001730chr1331171 652 585 --11083 --
NM_001730chr1331171 652 585 --11083 --
NM_001743chr21602 ------
NM_001754chr2164125 2659 1570 1169 853 714 ------
NM_001755chr1672191 1848 1740 1428 638 582 544 --2799 155 11875
NM_001759chr1284708 4687 4582 4003 3678 2017 617 282 24393 295 14754 --
NM_001777chr384019 3817 3024 2717 2680 2603 1336 930 ------
NM_001788chr71320 ------
NM_001792chr181216 ------
NM_001797chr16--1124 ----
NM_001822chr2--136 ----
NM_001845chr1311363 ----1499
NM_001851chr62535 110 ----1137
NM_001855chr93308 228 113 --195 --
NM_001858chr663879 3834 3352 1106 721 162 ------
NM_001859chr963032 2651 2628 2566 1517 167 13275 ----
NM_001873chr42489 224 ------
NM_001874chr1295131 4888 4464 4225 4014 3828 1834 737 67 24191 911 15091 11635
NM_001875chr251076 965 779 687 185 ------
NM_001890chr41365 ------
NM_001895chr2041158 1142 436 242 ------
NM_001918chr1168781 8675 8652 8084 7201 6977 6327 5841 3177 2808 2776 2598 1950 1865 1842 1730 39312 8844 6734 27174 7039 --
NM_001924chr11139 ----1104
NM_001931chr112499 174 ------
NM_001938chr111845 1293 2670 659 --
NM_001949chr633183 3011 124 --22438 475 --
NM_001957chr462239 1772 1639 770 654 514 12329 1667 --
NM_001962chr52552 539 ------
NM_001968chr46792 700 687 362 303 96 --1229 --
NM_001969chr1473563 3384 2949 2846 907 743 112 23304 2808 ----
NM_001981chr131923 1523 1506 ----1164
NM_001987chr1274322 4035 2943 1558 1056 663 345 34056 3020 848 ----
NM_001993chr15963 944 448 209 25 ----1974
NM_001998chr32414 90 ------
NM_002006chr454176 3913 1832 1178 869 25639 4026 25288 2157 --
NM_002009chr1552181 2082 903 426 176 ------
NM_002015chr1352207 2175 1161 280 258 13224 23049 2262 --
NM_002024chrX32140 1471 1422 11862 ----
NM_002025chrX259275 9087 8649 8403 8374 8228 7889 7326 7153 7145 6534 6443 6378 6322 6089 3691 3345 2883 2408 2130 1917 1865 1189 843 170 ------
NM_002033chr11134090 3840 3719 3649 3086 3049 2596 1395 1179 1073 1025 1010 488 21050 930 32793 2659 2573 1867
NM_002035chr1853627 3611 3377 2643 847 21219 83 ----
NM_002039chr41706 --1636 --
NM_002048chr921059 287 1483 ----
NM_002054chr21161 ------
NM_002061chr131467 1444 416 ------
NM_002069chr751766 1581 1265 410 199 --1492 --
NM_002074chr131727 1698 1125 ------
NM_002076chr1252674 2355 2313 1285 1058 123 12737 --
NM_002077chr972168 2029 1755 791 771 315 157 --1101 --
NM_002082chr5125 1683 1965 --
NM_002092chr454751 4599 4054 3602 1808 --34662 4423 4226 14289
NM_002095chr8--132 ----
NM_002126chr1733718 2914 2559 12627 --11386
NM_002128chr1312257 11000 1557 --
NM_002130chr51104 ----1411
NM_002137chr742185 2091 1917 1767 --1864 --
NM_002139chrX------1651
NM_002148chr21529 ------
NM_002158chr243232 3152 1382 1158 11071 1384 --
NM_002161chr9144 ------
NM_002182chr332557 2501 1693 1822 ----
NM_002196chr20------1960
NM_002196chr20------1960
NM_002199chr42912 859 1630 ----
NM_002203chr543207 2739 1593 990 23185 1282 1142 23262 411
NM_002210chr291158 1052 930 855 663 627 493 451 24 --1457 --
NM_002211chr1021127 304 ------
NM_002214chr7145008 4726 4517 4147 3988 2236 2205 2092 1794 1237 679 377 309 301 15075 21435 1300 --
NM_002223chr1273949 3570 1414 1204 1058 996 578 13488 1366 --
NM_002233chr111161 ------
NM_002242chr231757 429 190 ------
NM_002247chr1052162 2066 2054 2032 2008 --1281 --
NM_002264chr354257 1997 1919 1418 1318 --23942 3825 --
NM_002267chr1341897 1696 1608 907 --21916 286 --
NM_002270chr5145715 5263 5002 4727 4239 3985 3963 3568 1091 533 398 98 58 21 11550 ----
NM_002293chr162697 2492 2256 1805 871 81 12577 ----
NM_002310chr575043 4459 1999 1737 1134 124 62 14282 --36254 6149 4484
NM_002317chr51259 ------
NM_002332chr121131 ------
NM_002336chr1255037 4405 3644 3541 1589 34395 3836 3128 --14512
NM_002356chr62720 562 --2986 890 --
NM_002374chr263413 3102 2354 1414 1275 324 11123 13207 --
NM_002376chr142464 178 --1388 --
NM_002382chr1421327 1319 ------
NM_002383chr161911 ------
NM_002387chr5115003 4394 3877 3663 3142 1769 1433 1381 1175 889 607 23991 3851 41934 1800 494 46 --
NM_002392chr124438 375 172 39 --1572 --
NM_002395chr621271 569 ----1267
NM_002398chr21507 ------
NM_002401chr1752455 2436 1586 316 180 11966 ----
NM_002440chr11114 ------
NM_002444chrX21529 1391 --11603 --
NM_002480chr1231507 1392 287 ----1555
NM_002481chr187506 6400 5686 5463 2907 2290 1809 531 37458 5233 2717 --12369
NM_002487chr152646 89 ------
NM_002499chr1541708 943 339 237 1884 --1715
NM_002500chr231095 207 50 1951 ----
NM_002505chr641392 1230 366 151 --1109 11371
NM_002508chr141993 1646 527 273 ------
NM_002509chr20--1262 ----
NM_002514chr831059 423 251 128 ----
NM_002515chr1421658 1459 1585 ----
NM_002519chr1141409 1272 999 480 --11517 --
NM_002542chr31220 ------
NM_002545chr1194723 4665 3336 3283 1895 1668 1560 554 428 33569 638 568 ----
NM_002547chrX43716 3336 2627 560 23694 2788 ----
NM_002556chr1132100 2007 598 ------
NM_002570chr1531028 967 511 ------
NM_002581chr9125658 5050 4812 4319 4007 3979 3962 3649 2203 2197 1991 1522 14893 15597 --
NM_002583chr121612 ------
NM_002585chr11365 ------
NM_002588chr531466 703 303 ------
NM_002590chr131519 ------
NM_002591chr201631 ------
NM_002594chr2041855 975 589 159 1690 ----
NM_002595chr1241193 740 540 241 1153 2461 259 --
NM_002600chr131764 1542 1439 --1575 11718
NM_002601chr25513 475 347 341 133 ------
NM_002610chr263088 2428 2155 475 299 74 --22177 1218 --
NM_002613chr1675235 4870 4791 3581 1325 830 583 23485 1039 ----
NM_002628chr3--11235 ----
NM_002636chr61455 ------
NM_002641chrX42014 1925 1273 408 ------
NM_002645chr1153135 2753 2599 1175 247 ------
NM_002646chr121466 549 --21662 1529 --
NM_002655chr8105262 5150 5140 4533 4480 4462 3800 3619 3610 2068 13658 25245 936 21762 27
NM_002657chr2033889 1309 860 33883 1471 416 ----
NM_002667chr671249 1096 1089 872 393 322 28 ------
NM_002670chr331163 626 56 11009 ----
NM_002687chr1431228 1047 466 ------
NM_002709chr241371 665 565 173 1484 12558 --
NM_002710chr121871 ------
NM_002713chr141201 1056 481 359 ------
NM_002715chr53875 805 350 ----1292
NM_002716chr1133597 1326 1001 --33425 2572 926 --
NM_002721chr92342 175 ------
NM_002729chr101845 159 ----
NM_002731chr153163 2432 2082 2005 1117 ------
NM_002737chr17116591 6389 5631 5325 5016 4753 2402 2394 1954 1532 980 --24949 4816 --
NM_002738chr161773 ------
NM_002745chr2273883 3003 1389 1086 1050 701 553 ------
NM_002747chr1811632 11420 --11878
NM_002748chr151299 ------
NM_002755chr15----1274 --
NM_002813chr1221531 322 ------
NM_002822chr1241800 1721 1594 1344 --1627 --
NM_002828chr185703 677 141 75 51 --1176 --
NM_002833chr1521600 69 ------
NM_002835chr73787 177 158 ------
NM_002837chr12104082 4027 3315 3121 1549 1377 1231 1180 1033 805 179 13181 --
NM_002839chr963153 2493 1379 740 359 130 33495 3305 253 133 --
NM_002841chr31229 1509 1705 --
NM_002844chr621200 197 ------
NM_002848chr122917 177 --21152 988 --
NM_002851chr71225 ----1316
NM_002852chr33472 453 423 ------
NM_002858chr121257 888 ----144
NM_002869chr1131616 1497 1365 31850 545 522 171 --
NM_002874chr92399 43 ------
NM_002884chr13910 839 327 1820 2679 36 --
NM_002886chr345002 4288 2073 660 21042 856 34490 4363 3949 --
NM_002892chr1441577 1070 670 67 1323 1590 --
NM_002902chr15----1606 --
NM_002906chr1132367 2076 1644 ------
NM_002912chr6----124 --
NM_002938chr441963 1268 584 553 12009 ----
NM_002942chr33440 366 254 --1900 --
NM_002955chr641612 1533 1510 1320 --1592 1734
NM_002958chr31694 ------
NM_002971chr351205 1125 1048 889 164 ----1483
NM_002977chr262883 2689 2541 2107 784 28 --12749 --
NM_002979chr12222 91 ------
NM_002993chr431027 731 176 --1721 --
NM_002994chr441906 1897 1886 1734 --1289 --
NM_002998chr831570 664 196 31968 1483 781 11555 12045
NM_003010chr1752441 2136 2110 553 547 1879 --11652
NM_003016chr1731765 1369 543 1167 ----
NM_003028chr973910 3312 2574 1180 1052 995 133 ----1719
NM_003029chr161324 1304 1114 1073 968 922 ------
NM_003034chr1297927 7762 7254 2930 2896 2344 1565 1269 968 --36628 6494 589 17362
NM_003043chr352844 2795 1559 1059 701 21410 77 --13830
NM_003060chr541101 987 243 164 2482 215 ----
NM_003068chr82941 228 ------
NM_003071chr351588 1505 663 554 448 ------
NM_003092chr20143 ------
NM_003100chr53295 114 98 --1435 --
NM_003108chr247296 6051 4644 1193 26077 489 35222 1297 703 14586
NM_003112chr7102901 2858 2299 1284 1258 1025 985 601 417 225 ----188
NM_003128chr232332 951 502 1533 12064 --
NM_003137chr6--11463 11888 --
NM_003139chr113843 821 642 1270 1286 1896
NM_003142chr21293 ------
NM_003144chr652162 1823 1611 488 167 11766 --11737
NM_003161chr1752300 1356 1214 1085 114 --23015 2686 12779
NM_003182chr72449 405 ------
NM_003182chr72449 405 ------
NM_003185chr2031013 921 382 1969 ----
NM_003199chr18105105 4927 4903 4288 4055 2057 1724 1077 974 451 --15067 --
NM_003220chr611456 ------
NM_003234chr352326 2082 1640 910 88 ------
NM_003242chr342320 2031 1008 345 ------
NM_003244chr182333 171 ------
NM_003253chr2131662 747 297 ------
NM_003257chr1541351 1097 190 183 --1103 --
NM_003262chr395156 4765 4482 4020 3437 3422 2031 885 228 11869 24682 4546 --
NM_003270chrX2169 124 ------
NM_003272chr11120 ------
NM_003274chr2121926 1140 --22888 2627 --
NM_003275chr941527 1081 414 64 ------
NM_003286chr201378 ------
NM_003292chr142008 1670 1554 746 1738 1634 --
NM_003298chr385993 5956 5836 5704 2149 1798 1435 1096 55721 4903 4777 1755 772 ----
NM_003336chrX181 1453 ----
NM_003337chr551555 1279 1063 681 392 1106 11262 --
NM_003338chr1021801 1218 1786 --11306
NM_003340chr41996 ------
NM_003342chr1732431 937 903 1196 32130 2068 1311 11009
NM_003348chr1221658 326 ----199
NM_003368chr1166 ------
NM_003369chr1142509 2249 992 260 --21959 781 --
NM_003376chr611553 ------
NM_003376chr611553 ------
NM_003379chr62854 775 1761 ----
NM_003387chr232401 222 62 1336 12533 --
NM_003390chr11----1139 1352
NM_003392chr353870 3694 2918 1500 972 13017 21551 1324 --
NM_003403chr14--1770 ----
NM_003407chr191627 ------
NM_003409chr1821223 488 1946 ----
NM_003410chrX42533 782 759 461 ------
NM_003411chrY2480 87 --11573 --
NM_003412chr332250 913 812 --21130 603 --
NM_003413chrX41718 651 466 115 --11517 --
NM_003418chr32748 175 ------
NM_003423chr19102537 2416 2205 2050 1858 1831 1643 913 809 358 --32592 2268 534 --
NM_003430chr1931608 1590 128 --11653 1425
NM_003439chr783036 2871 2665 2485 959 643 628 201 ------
NM_003442chr111605 ------
NM_003453chr13------1269
NM_003463chr652621 2612 2504 583 176 ------
NM_003468chr221386 541 13359 14067 --
NM_003471chr33885 817 494 11530 ----
NM_003474chr1062169 1857 1776 1628 869 119 11911 1222 --
NM_003478chr1173229 3137 3109 2420 2046 145 103 13002 ----
NM_003483chr1252962 2681 975 376 183 1800 22764 66 --
NM_003489chr2133448 2099 660 32645 1016 756 23397 2585 --
NM_003506chr82926 874 ------
NM_003558chr93248 239 109 --1694 --
NM_003559chr1763514 3174 2444 1359 1323 1147 --33848 3316 139 --
NM_003566chr1243338 2483 2185 31 12491 12848 --
NM_003574chr1852232 1299 1198 658 459 15258 55635 5436 4528 4274 722 --
NM_003576chr1342544 2143 579 171 22008 669 ----
NM_003580chr8----1559 --
NM_003581chr22868 848 ------
NM_003583chr1233625 2941 2736 1317 --1726
NM_003590chr263669 3064 2897 1586 317 222 --1109 11315
NM_003603chr441871 1363 755 575 11443 ----
NM_003607chr153421 3165 2668 1649 306 11481 23650 522 --
NM_003615chr353837 3733 1538 1011 68 ------
NM_003618chr251088 835 417 90 53 --1854 --
NM_003622chr1232314 1794 880 12233 22515 2377 --
NM_003629chr152962 1231 1135 62 46 11066 12594 --
NM_003630chr62688 598 --124 --
NM_003633chr552531 2052 2020 1969 710 ------
NM_003646chr111570 ------
NM_003663chr342570 2389 1319 163 ------
NM_003671chr933613 3405 51 21121 1060 13288 --
NM_003672chr141444 562 398 187 --11430 --
NM_003676chr12731 638 ------
NM_003677chr1262294 2271 2209 1660 508 260 --1571 1705
NM_003679chr1103239 2960 2918 2299 2185 1127 727 405 240 211 --23051 1135 --
NM_003692chr9--1372 ----
NM_003705chr21281 ------
NM_003713chr121744 1619 ----11357
NM_003714chr522657 2125 12017 12873 13047
NM_003722chr331912 530 332 1279 1206 1929
NM_003735chr531466 703 303 ------
NM_003736chr531466 703 303 ------
NM_003758chr1541461 1051 619 95 --11476 11573
NM_003758chr1541461 1051 619 95 --11476 11573
NM_003759chr454214 3433 2813 921 136 21600 702 --13473
NM_003763chr2042314 903 719 311 ----1321
NM_003774chr1232639 2499 433 12843 ----
NM_003778chr31101 ------
NM_003783chr151160 1085 801 164 72 ------
NM_003796chr193544 413 67 ------
NM_003819chr11104 ------
NM_003822chr143028 2396 777 415 --12905 12252
NM_003825chr1521382 140 --11063 --
NM_003829chr91301 --11199 --
NM_003831chr1851634 1596 1196 662 238 11697 ----
NM_003870chr1551767 1650 1524 313 291 ------
NM_003872chr232524 2360 62 12294 ----
NM_003873chr1042539 2113 992 83 12379 ----
NM_003884chr311143 ------
NM_003885chr1732461 2255 832 1952 ----
NM_003887chr232030 1579 697 1292 22024 666 --
NM_003895chr2152132 1690 1559 1487 415 ------
NM_003899chr1342581 2567 930 221 31970 1649 566 2899 615 --
NM_003909chr852504 2291 1157 1127 534 12555 ----
NM_003913chr653351 1214 872 481 227 1799 1238 --
NM_003931chr63596 185 25 ------
NM_003934chr921149 126 ------
NM_003941chr772279 872 610 519 470 407 286 ----1572
NM_003958chr683835 3749 3192 2786 1414 974 567 256 22626 635 32728 1170 1037 1695
NM_003966chr575674 3051 3019 3001 2797 714 600 46392 5432 4737 1752 12224 17559
NM_003971chr173616 191 143 ------
NM_003983chr1663491 2928 2840 1258 559 159 2374 278 14132 12961
NM_003994chr1284374 4026 3940 3611 3455 1673 642 322 --32925 826 399 1888
NM_004006chrX62594 2102 898 875 618 305 1742 1709 --
NM_004007chrX62594 2102 898 875 618 305 1742 1709 --
NM_004009chrX62594 2102 898 875 618 305 1742 1709 --
NM_004010chrX62594 2102 898 875 618 305 1742 1709 --
NM_004011chrX62594 2102 898 875 618 305 1742 1709 --
NM_004012chrX62594 2102 898 875 618 305 1742 1709 --
NM_004013chrX62594 2102 898 875 618 305 1742 1709 --
NM_004014chrX62594 2102 898 875 618 305 1742 1709 --
NM_004015chrX62594 2102 898 875 618 305 1742 1709 --
NM_004016chrX62508 2016 812 789 532 219 1656 1623 --
NM_004017chrX62594 2102 898 875 618 305 1742 1709 --
NM_004018chrX62508 2016 812 789 532 219 1656 1623 --
NM_004020chrX62594 2102 898 875 618 305 1742 1709 --
NM_004021chrX62508 2016 812 789 532 219 1656 1623 --
NM_004022chrX62508 2016 812 789 532 219 1656 1623 --
NM_004023chrX62508 2016 812 789 532 219 1656 1623 --
NM_004035chr1785172 4895 4380 3584 3495 1956 1364 1351 21654 92 94577 4442 4079 3835 3766 3647 3480 1962 994 --
NM_004081chrY21542 575 ----1163
NM_004094chr1422431 1021 --1426 --
NM_004096chr10--11960 1117 11381
NM_004098chr1021252 1019 1812 ----
NM_004100chr642239 1843 1664 1007 1181 ----
NM_004109chr1162117 1938 1524 916 895 192 --11587 11723
NM_004112chr1721432 1342 ------
NM_004113chr31489 ------
NM_004124chr1443097 492 115 101 1301 ----
NM_004157chr3----1587 --
NM_004161chr22487 99 1538 ----
NM_004171chr11179383 9069 9012 8950 8720 8707 8497 7762 7183 7088 6717 3847 3054 3028 2364 2254 2011 13104 22212 2079 27799 6650
NM_004172chr521819 432 --173 --
NM_004180chr24625 447 147 61 ------
NM_004202chrY2722 527 1291 ----
NM_004229chrX42230 1784 1655 280 1897 ----
NM_004238chr2134 ------
NM_004241chr101220 ------
NM_004261chr11400 1690 156 --
NM_004272chr53728 565 222 ------
NM_004279chr741540 635 584 254 ------
NM_004290chr5----21229 989 1236
NM_004294chr133718 615 118 --1100 --
NM_004301chr3--1365 ----
NM_004311chr1041203 1060 792 592 22095 914 21933 1143 22114 659
NM_004331chr862448 2251 2007 1981 1948 1929 --11961 --
NM_004338chr1876566 5563 2619 2447 2015 1714 1171 34756 4436 1637 11020 --
NM_004342chr782157 2125 1973 1627 824 584 499 155 ------
NM_004346chr451349 1011 490 281 258 1105 ----
NM_004354chr42854 35 ------
NM_004362chr42525 217 ------
NM_004370chr651752 1514 1417 613 32 12006 --12144
NM_004380chr1621642 497 ------
NM_004384chr541889 1547 1519 937 --11793 --
NM_004392chr1342213 1920 256 244 1413 ----
NM_004395chr51172 ------
NM_004397chr1142903 1734 853 23 11651 1704 --
NM_004399chr121927 ----1718
NM_004407chr43645 145 73 2932 407 ----
NM_004425chr1172 ------
NM_004426chr1271864 1847 1522 722 598 228 171 --11915 --
NM_004430chr822215 1053 11808 ----
NM_004432chr962259 2185 1791 1499 558 40 ------
NM_004438chr292796 2383 2087 1212 938 867 369 136 72 31108 276 179 1402 --
NM_004440chr641711 1656 773 510 21752 144 --133
NM_004458chrX42215 2169 980 451 --1603 --
NM_004459chr1721581 1366 --11605 1680
NM_004463chrX3652 485 198 ------
NM_004464chr473575 3451 3194 2879 580 301 53 22968 322 12612 --
NM_004482chr22325 249 ----1158
NM_004491chr1964293 3755 3287 3046 1610 1585 2566 199 --1752
NM_004496chr1451236 1203 970 439 212 ------
NM_004500chr142733 375 11969 21541 1309 --
NM_004501chr153942 3569 2538 1459 477 11343 ----
NM_004504chr282404 2381 1089 951 784 592 278 49 12689 --12106
NM_004505chr1711809 11688 ----
NM_004520chr53771 530 133 ------
NM_004521chr102270 82 ------
NM_004525chr24495 241 200 125 ------
NM_004529chr91394 ------
NM_004535chr2031277 716 230 ------
NM_004537chr1211053 ------
NM_004575chr421297 1224 1366 ----
NM_004580chr1511517 1581 ----
NM_004588chr1193892 3265 2599 2493 1459 1364 1065 822 580 23923 984 ----
NM_004593chr33833 788 242 ------
NM_004595chrX1477 ------
NM_004598chr543072 1022 850 405 --1385 --
NM_004600chr111179 ------
NM_004602chr2031118 1041 533 11083 11047 --
NM_004612chr9164603 4521 4334 3687 3188 1941 1866 1597 1586 1320 1129 715 639 613 473 359 11478 24302 3511 --
NM_004631chr13346 178 51 21099 354 --11142
NM_004637chr321047 378 --1498 --
NM_004641chr102551 481 --1127 --
NM_004642chr124270 145 102 54 ------
NM_004654chrY21257 351 ------
NM_004655chr1731260 1073 534 ------
NM_004657chr241405 1322 1099 477 ------
NM_004660chrY42309 2142 263 72 --1920 --
NM_004663chr1541461 1366 1273 1173 --21299 182 --
NM_004666chr641329 1185 1086 197 --1283 --
NM_004667chr152657 243 ------
NM_004703chr1741620 1581 217 188 11820 ----
NM_004717chr721494 953 1503 --11129
NM_004726chrX75463 3860 2300 1904 1809 1803 549 24901 1203 45079 4035 2102 1967 --
NM_004730chr522125 2065 22135 1534 ----
NM_004734chr1382664 2330 2322 2262 2207 996 946 407 ----22439 524
NM_004737chr2231052 848 297 ----1151
NM_004741chr1041572 1288 1032 137 11092 ----
NM_004745chr8127059 6913 6297 5159 5043 4629 2452 2349 1597 883 454 396 37000 6315 6228 24886 4357 16265
NM_004747chr1021512 1409 --21035 28 --
NM_004748chr1554251 3847 2908 1594 1581 --11134 11280
NM_004760chr732288 874 343 ------
NM_004761chr6--125 ----
NM_004772chr551344 268 241 142 25 ------
NM_004773chr171389 ------
NM_004774chr1733141 2316 2001 --11012 --
NM_004775chr1842411 2136 2033 149 1138 ----
NM_004776chr2043284 3172 2297 2235 ------
NM_004790chr11150 123 ----
NM_004795chr1351852 1564 1383 1265 242 ------
NM_004796chr1421594 467 ------
NM_004801chr2----2992 326 --
NM_004808chr1083330 3148 3030 2549 2522 2422 955 232 32497 1343 339 23205 2150 --
NM_004824chr621402 195 ------
NM_004827chr451863 1834 1551 1429 1196 ------
NM_004834chr253291 2952 2920 2877 2777 --11219 --
NM_004840chrX82237 2124 2055 2048 1791 1748 1621 1598 ------
NM_004841chr13823 725 349 186 1340 --
NM_004842chr621746 1619 ------
NM_004844chr311177 ------
NM_004849chr631231 1158 533 --1492 --
NM_004850chr291751 1375 1313 1102 567 500 415 286 168 --1401 --
NM_004855chr151169 ------
NM_004859chr1753077 2888 2876 2066 142 22047 552 22615 1131 --
NM_004863chr1495277 4901 4781 4480 4180 2108 1759 1511 1286 14512 11459 --
NM_004866chr564916 4343 3524 1904 1193 216 11497 1336 13788
NM_004867chrX3499 215 157 ------
NM_004869chr181440 11530 11502 --
NM_004887chr51339 1838 ----
NM_004896chr1031283 513 139 1474 ----
NM_004897chr10151 1250 185 --
NM_004898chr452885 2852 2019 633 416 32001 380 170 ----
NM_004904chr7106581 6408 4940 4908 2588 1611 1099 1090 1060 514 14822 45895 4159 1972 1406 --
NM_004912chr741757 1425 1360 430 11685 11287 --
NM_004926chr1451477 1142 731 509 403 1359 ----
NM_004929chr831293 107 62 ----1535
NM_004932chr541572 456 320 123 ------
NM_004948chr1861434 1241 928 339 120 62 ------
NM_004956chr773176 3088 1818 1688 962 464 318 13849 23133 1010 23937 1186
NM_004965chr211696 ----1536
NM_004969chr102482 168 ------
NM_004973chr631740 1636 1248 --1197 11539
NM_004982chr123482 290 113 ------
NM_004985chr1294545 4133 3639 3532 3419 688 632 497 61 14078 23367 3195 13103
NM_004992chrX67416 5578 3240 3174 2970 423 22062 284 ----
NM_004992chrX67416 5578 3240 3174 2970 423 22062 284 ----
NM_004993chr1411022 --159 --
NM_005006chr23736 700 70 ------
NM_005010chr732023 286 138 --1661 --
NM_005028chr103886 580 167 12072 ----
NM_005044chrX84175 3218 3075 2800 1788 1036 815 63 21688 470 --11313
NM_005045chr72254 74 ------
NM_005054chr231707 1115 519 1618 ----
NM_005056chr1295527 4788 4573 3913 2103 959 499 209 131 --11266 --
NM_005063chr1033414 2477 1245 12995 1945 --
NM_005065chr14115000 4942 4863 4519 3820 3644 3396 1379 1287 1016 871 ------
NM_005068chr621474 295 ------
NM_005077chr91100 --1494 --
NM_005079chr832723 499 267 1287 12900 --
NM_005086chr122737 282 ------
NM_005087chr35749 555 257 39 24 ------
NM_005095chr122119 1797 12220 ----
NM_005105chr122187 1572 --2401 339 --
NM_005109chr322555 933 1737 22307 1996 --
NM_005113chr142448 113 ------
NM_005116chr2063971 3730 1822 1380 891 295 --1925 --
NM_005121chr1763566 3048 2602 798 719 59 1824 ----
NM_005124chr6--1151 11004 --
NM_005126chr342323 1402 648 191 ------
NM_005134chr182804 391 2880 635 ----
NM_005135chr1573177 2643 2491 2442 1307 570 181 12410 23388 2788 21288 191
NM_005141chr42363 148 ------
NM_005151chr1822031 359 ----1170
NM_005154chr154659 200 139 86 ------
NM_005156chr984215 4156 2038 1862 1822 1795 999 884 12009 25287 3545 --
NM_005168chr231593 1452 656 11280 ----
NM_005171chr1251273 836 440 350 188 ------
NM_005180chr1061262 1195 1080 357 303 154 --168 --
NM_005188chr1197738 5764 5172 881 839 776 531 262 21 58167 3288 2884 2175 300 27810 5121 --
NM_005190chr621141 397 2855 230 1865 --
NM_005197chr1434676 4600 945 25766 1044 ----
NM_005203chr10--1106 ----
NM_005206chr1731404 1138 934 1213 ----
NM_005207chr2253531 3172 649 372 97 23183 122 32363 846 711 --
NM_005214chr23445 344 161 ------
NM_005233chr342312 706 564 501 22626 66 ----
NM_005235chr2116831 6566 6516 6339 5771 5307 5046 4970 2651 1597 417 12707 ----
NM_005238chr1142993 2509 2500 2164 --12311 --
NM_005241chr31105 ----1440
NM_005252chr14------165
NM_005254chr151228 --11045 1113
NM_005256chr11--1877 ----
NM_005259chr261163 268 247 130 109 92 1369 ----
NM_005277chr441850 1430 1307 474 --1423 11663
NM_005284chr62510 479 ------
NM_005296chrX2946 188 ------
NM_005318chr22--11055 11023 1154
NM_005324chr1741908 1834 641 455 1496 ----
NM_005339chr454240 3869 3820 3311 1651 1986 --13024
NM_005342chrX5846 733 536 400 107 ----1698
NM_005359chr1864865 2154 1807 1579 1131 48 46287 1656 356 329 32217 1531 1005 --
NM_005374chr1751892 1761 1699 1643 1561 1591 1600 --
NM_005385chr342449 650 434 209 ----12488
NM_005389chr6----184 --
NM_005399chr174154 4091 1756 1557 1141 318 307 ------
NM_005406chr1851528 1136 1114 488 191 ------
NM_005415chr21789 --177 --
NM_005433chr18167 1362 ----
NM_005436chr1053677 3369 2626 573 462 3825 559 388 ----
NM_005455chr111499 21736 22 ----
NM_005475chr1273051 2566 915 904 736 705 381 1219 --12711
NM_005476chr961348 1066 1001 990 276 247 --1108 --
NM_005487chr22----22095 1510 --
NM_005493chr64863 808 690 144 ----1637
NM_005497chr1765710 5626 5369 1579 1546 484 25862 5442 44968 4771 1749 1687 --
NM_005499chr192633 583 ------
NM_005502chr953310 2364 2102 935 754 --1179 --
NM_005506chr452709 2053 963 592 535 --32358 2249 2116 --
NM_005509chr51187 --11274 --
NM_005511chr92893 442 --2827 693 --
NM_005522chr741170 450 365 96 ------
NM_005537chr133414 223 55 ------
NM_005539chr1021264 1114 11071 1549 11203
NM_005563chr11813 ------
NM_005570chr182894 467 --1832 11151
NM_005575chr51203 1627 ----
NM_005578chr3104465 3990 3606 3474 3350 1581 1162 626 571 85 --21832 725 --
NM_005596chr9106459 6008 5821 5792 5471 4991 4068 1559 1237 1098 24804 4627 16391 --
NM_005603chr183692 449 426 11819 ----
NM_005607chr83842 756 105 ------
NM_005618chr61545 ------
NM_005625chr85853 832 730 385 308 1209 ----
NM_005637chr1831693 465 404 1299 11891 --
NM_005644chr1--1102 ----
NM_005647chrX53009 2826 1226 957 452 ----11376
NM_005652chr16----2357 223 --
NM_005655chr841176 808 455 78 ------
NM_005664chr152886 436 ------
NM_005665chr184111 4011 2979 784 632 570 297 152 33054 1452 444 1769 11025
NM_005667chr2142 ------
NM_005668chr554241 3659 1303 1137 732 34451 3973 3313 34320 929 795 --
NM_005669chr572220 1932 1906 1823 897 473 272 12175 ----
NM_005715chr672406 2306 1894 1738 1138 1065 584 ------
NM_005722chr24816 661 490 279 ----1870
NM_005739chr1552060 1936 1611 788 671 --1542 12008
NM_005746chr74928 899 743 485 1584 189 1838
NM_005749chr171227 ------
NM_005756chrX41237 1091 175 154 ------
NM_005759chr254149 3960 1904 726 118 1366 --11714
NM_005776chr14------1801
NM_005779chr553515 2994 471 352 186 --11117 --
NM_005807chr12581 141 2701 188 ----
NM_005808chr363510 2239 1091 628 491 391 13395 22795 1236 --
NM_005813chr24958 493 395 89 11934 ----
NM_005822chr62786 417 --11816 11742
NM_005826chr11234 ------
NM_005840chrX106851 6289 5747 5736 5354 2982 2816 1770 1105 128 25106 1202 --12058
NM_005841chr411177 --1336 --
NM_005842chr131564 2733 504 124 --
NM_005845chr131358 ----1280
NM_005853chr16----1504 1456
NM_005875chr3185 ----1146
NM_005885chr511426 11123 ----
NM_005896chr22147 52 --1525 --
NM_005898chr1173220 3193 2748 2241 466 287 148 12427 ----
NM_005899chr1731396 1351 148 11149 ----
NM_005901chr18118034 6766 5651 5625 3108 2723 2616 2151 1621 1449 1348 --38451 6740 1819 --
NM_005903chr575167 1538 1085 1051 978 964 508 --44848 4448 4237 104 14259
NM_005908chr41557 ------
NM_005909chr554124 4019 2649 1428 1195 13196 12896 --
NM_005924chr7----1411 --
NM_005930chr14181 --1767 --
NM_005935chr495070 4600 4381 4082 3730 3540 1495 1089 991 ------
NM_005941chr853223 2844 2754 2574 1181 11619 1960 --
NM_005955chr165341 4315 4137 3999 1800 603 24388 672 22115 1981 --
NM_005962chr1042221 1858 348 126 ------
NM_005962chr1042221 1858 348 126 ------
NM_005964chr1731069 475 90 167 11143 11250
NM_005966chr231923 1606 456 --12288 --
NM_006007chr974487 3702 1094 981 740 166 116 11392 23918 3765 --
NM_006015chr131306 835 315 ------
NM_006016chr632276 931 552 12211 ----
NM_006030chr31527 ----11828
NM_006036chr252561 1843 1779 663 399 1605 ----
NM_006038chr2021470 34 --22063 1914 --
NM_006047chr2033412 3136 195 1156 ----
NM_006063chr22456 345 ------
NM_006079chr61136 ------
NM_006080chr772522 2290 1073 1044 646 392 347 --12365 --
NM_006089chrX41894 1332 1208 724 --21504 1379 --
NM_006094chr852391 2043 2020 1981 109 --1135 --
NM_006113chr111964 22013 851 ----
NM_006114chr19--1475 ----
NM_006136chr731064 989 971 ------
NM_006143chr12152 ------
NM_006145chr193377 193 146 --1888 --
NM_006153chr3----1263 --
NM_006154chr1562713 2655 1177 1147 950 486 22485 969 ----
NM_006166chr1232355 2275 1921 1849 1835 --
NM_006167chr832078 719 648 ------
NM_006190chr241127 1110 1045 767 ------
NM_006197chr831938 1461 513 12118 ----
NM_006203chr5144987 4925 4759 4508 4468 4388 4382 3674 3444 3402 2088 1569 1242 715 11453 11859 --
NM_006210chr192827 421 1434 --1290
NM_006223chrX157 ------
NM_006224chr1742454 2390 739 259 11607 ----
NM_006241chr332442 243 22 12308 155 --
NM_006243chr12923 70 --1885 --
NM_006246chr1421052 95 --1124 --
NM_006258chr1021468 1284 --2464 141 --
NM_006264chr43542 470 178 ------
NM_006267chr221434 64 11600 1717 --
NM_006275chr2022074 965 --21981 1948 --
NM_006283chr854231 4219 3719 1467 502 21560 587 ----
NM_006298chr673324 2102 1311 1271 981 321 121 22680 508 ----
NM_006306chrX95806 5656 5599 5530 5137 4924 3975 1831 1821 25307 3615 1678 --
NM_006315chr474397 4154 4042 3617 3544 1333 1068 21122 181 13151 --
NM_006321chr361937 1771 476 302 74 66 --1362 --
NM_006323chr4----1590 1524
NM_006324chr16177 ------
NM_006328chr111643 162 ----
NM_006330chr841454 512 307 221 ------
NM_006335chr13935 911 72 ------
NM_006345chr441165 1071 874 203 ------
NM_006352chr142085 1432 714 311 1798 ----
NM_006366chr621151 319 1132 ----
NM_006375chrX11752 21668 679 1174 --
NM_006377chr921263 1204 1996 ----
NM_006379chr721944 1628 ------
NM_006380chr1763787 3515 3347 1392 957 564 14215 23578 3173 --
NM_006386chr222905 40 11700 ----
NM_006390chr1241845 1701 1156 514 11437 11181 --
NM_006393chr1074255 3782 3545 3530 1789 1574 1435 13399 14328 --
NM_006434chr1053239 3139 3060 3024 2959 12869 ----
NM_006439chr41434 ------
NM_006460chr1751553 704 561 445 44 ----11104
NM_006471chr18184 ------
NM_006482chr1233625 2941 2736 1317 --1726
NM_006489chr1421658 1459 1585 ----
NM_006496chr13657 211 81 21741 1452 131 --
NM_006504chr1022830 597 --32801 2258 2131 --
NM_006517chrX2888 340 ------
NM_006526chr2011937 31732 807 637 1164 --
NM_006534chr2032870 922 51 11049 --12975
NM_006538chr253576 3131 1090 435 403 13805 11074 34161 3916 493
NM_006544chr14115789 5385 4676 3993 3756 2167 2018 1041 543 420 270 25511 42 ----
NM_006546chr1735174 4940 542 --14634 14132
NM_006557chr931534 676 654 11685 ----
NM_006558chr81422 ------
NM_006561chr1056069 4188 4111 2476 2187 --25600 4373 --
NM_006571chr8--1226 ----
NM_006572chr1762414 2238 1389 1248 816 328 ------
NM_006587chr461614 1603 501 316 130 34 178 1272 --
NM_006595chr1131509 793 601 --11763 11477
NM_006599chr16158276 8257 6138 5964 5773 3293 2854 2795 2386 1251 1201 1164 974 778 141 27782 6506 --15223
NM_006603chrX51900 1759 1655 1341 210 ------
NM_006609chr23836 648 67 22667 2530 ----
NM_006620chr684632 4315 4129 4076 3470 3456 1788 377 24524 1679 44269 3808 3784 1812 13061
NM_006622chr5155 --1511 --
NM_006624chr1011954 1285 11870 1384
NM_006628chr1554492 3509 3091 2824 1379 24611 4380 13572 13819
NM_006646chr1373070 2715 2378 2122 1918 1201 847 1327 --13038
NM_006654chr1243743 1788 1251 1243 1786 1389 13423
NM_006667chrX61042 972 963 464 426 85 --1211 --
NM_006670chr62648 549 1460 --197
NM_006696chr5--197 ----
NM_006699chr182517 2390 2131 1770 1740 983 864 404 ----157
NM_006706chr52844 764 ------
NM_006716chr721376 247 2152 107 --1182
NM_006721chr101109 ------
NM_006722chr362415 2263 1919 704 534 195 --11122 --
NM_006727chr52381 146 ------
NM_006729chrX105110 4864 4421 4282 4083 3992 1648 1139 993 209 24624 3789 14219 --
NM_006734chr651633 1590 1152 1124 107 ------
NM_006735chr71315 ------
NM_006746chrX31548 1254 1134 --1625 --
NM_006750chr1658037 7529 2899 2035 1223 12406 11757 13029
NM_006754chr71442 1851 ----
NM_006756chr831079 1064 408 ------
NM_006761chr172328 252 ------
NM_006766chr81224 ------
NM_006775chr642757 939 671 234 --1543 --
NM_006790chr5258 34 --1286 --
NM_006805chr53426 234 33 ------
NM_006807chr1731338 388 139 ----11369
NM_006811chr201411 --2709 253 --
NM_006815chr1231198 1159 375 ------
NM_006826chr231201 364 83 --1140 11225
NM_006846chr51245 1113 ----
NM_006850chr12968 234 1212 ----
NM_006854chr761844 1516 1429 1395 567 440 ------
NM_006870chr203728 314 272 ------
NM_006873chr263173 2795 2405 1399 1143 1066 11356 --12544
NM_006874chr451231 1021 276 214 180 ------
NM_006885chr1653582 3447 3297 420 82 11168 ----
NM_006908chr731406 410 332 1135 ----
NM_006910chr162391 364 ------
NM_006912chr132023 919 66 --31981 1693 35 --
NM_006915chrX52366 2181 1863 674 147 --11983 --
NM_006918chr11105883 5466 5194 4874 3997 3760 2358 858 636 508 12340 ----
NM_006920chr262073 1999 1911 1616 545 42 11937 ----
NM_006922chr271929 1773 846 559 296 166 40 --1263 12175
NM_006924chr1744434 4379 3734 618 --24400 1358 --
NM_006931chr1221545 497 ------
NM_006951chr103656 295 167 191 ----
NM_006956chr732268 2044 656 --2565 555 1205
NM_006965chr181407 ------
NM_006981chr933011 2652 860 ------
NM_006988chr2141092 1085 335 287 --11141 --
NM_007005chr931465 1172 492 ------
NM_007006chr1652941 2827 2394 2287 464 --11112 11098
NM_007007chr12124793 4367 3969 3362 3010 1864 1824 1193 1009 862 656 396 13184 --11126
NM_007008chr21862 ------
NM_007011chr1566863 6627 6287 5701 4567 2538 --12013 --
NM_007023chr251043 949 860 809 381 ------
NM_007034chr14907 710 395 172 ------
NM_007038chr21105492 5294 5100 4980 4761 4230 2194 1716 1543 489 14318 1593 --
NM_007039chr1471885 1690 1629 1585 1454 569 45 ------
NM_007054chr583862 3837 3638 3471 3286 2715 1410 283 --53870 2912 2778 2533 2491 1274
NM_007064chr321604 595 ------
NM_007107chr332157 888 391 ------
NM_007111chr131770 ------
NM_007114chr31163 ----23273 928
NM_007129chr131955 1919 ----
NM_007137chrX55289 5103 4182 497 63 31111 642 280 11708 --
NM_007146chr1732796 961 108 ----12887
NM_007156chrX----145 --
NM_007159chr311643 ------
NM_007170chr11954 2828 98 ----
NM_007172chr222294 180 --12095 12614
NM_007187chr131985 ------
NM_007191chr122538 90 ------
NM_007195chr1842692 1302 1240 470 23608 3572 22361 1437 --
NM_007198chr881636 1618 1570 1483 1293 1136 1102 419 1216 ----
NM_007202chr172665 98 ------
NM_007203chr962650 1516 1229 802 753 315 --13005 11602
NM_007207chr13845 350 168 ------
NM_007212chr152152 1864 1803 1529 188 ------
NM_007222chr81443 --31365 722 178 --
NM_007236chr1532174 1549 881 --11747 31972 1613 185
NM_007238chr20124894 4667 3779 3555 3116 1728 1705 828 757 733 518 210 11462 11374 --
NM_007245chr161922 ------
NM_007249chr13128029 7987 6644 5992 3544 3099 2188 2096 1764 1457 1129 870 37502 1859 426 23405 2453 --
NM_007276chr73993 824 90 ------
NM_007287chr332676 769 466 --1412 --
NM_007288chr332676 769 466 --1412 --
NM_007289chr332676 769 466 --1412 --
NM_007292chr1785172 4895 4380 3584 3495 1956 1364 1351 21654 92 94577 4442 4079 3835 3766 3647 3480 1962 994 --
NM_007315chr251432 1303 1058 1046 589 ------
NM_007331chr462645 2609 2436 2403 2393 58 --12062 --
NM_007350chr1244333 3531 1593 950 11602 ----
NM_007351chr441091 789 320 97 1740 ----
NM_007373chr1021471 483 --11838 --
NM_012071chr101276 ------
NM_012072chr2064399 3291 3257 1262 743 172 1981 1716 1833
NM_012081chr543405 2654 1013 685 13707 12687 --
NM_012082chr82893 88 --1153 --
NM_012089chr131448 1083 215 1446 ----
NM_012095chr10103470 3240 3166 2368 1160 1095 804 672 658 119 22515 469 23246 2582 --
NM_012096chr373400 2992 2734 616 534 264 131 1731 13189 --
NM_012097chr222053 908 ------
NM_012120chr632850 901 336 22416 135 41168 844 707 414 --
NM_012141chr1363948 3629 3599 702 670 155 1133 ----
NM_012153chr1142548 1973 858 293 22561 2178 1157 --
NM_012154chr83754 642 55 ----1187
NM_012156chr2043254 950 430 334 12759 --1794
NM_012164chr9137483 7214 6961 5248 5023 2343 2281 1829 1676 1169 705 437 81 25851 964 12479 17121
NM_012193chr1195292 4576 4195 4001 3855 1413 1036 562 338 24611 187 24064 782 --
NM_012199chr143884 3506 1470 808 44238 802 370 137 --13110
NM_012218chr1972885 2540 2262 2161 996 781 227 32022 770 330 ----
NM_012219chr353007 2099 1267 315 70 ------
NM_012234chr352737 2595 1327 475 315 1581 ----
NM_012238chr1031609 1511 1374 11566 ----
NM_012247chr105800 736 729 660 74 ------
NM_012249chr261125 773 648 293 271 62 1361 ----
NM_012250chr112518 331 ----11022
NM_012252chr7115390 4494 4313 4232 4222 3331 2144 1057 837 653 339 --11319 1223
NM_012255chr20141 1439 1100 --
NM_012262chr122104 1236 15245 11172 --
NM_012281chr762103 972 741 643 549 420 192 ----
NM_012290chr221631 215 --1441 --
NM_012294chr753802 2759 686 47 32 --1561 --
NM_012300chr531955 926 624 1320 ----
NM_012301chr771919 1894 1432 870 620 421 325 12181 ----
NM_012304chr531981 1846 662 --1573 --
NM_012307chr1821025 239 ------
NM_012309chr1134609 3714 1684 --13259 --
NM_012316chr184854 4352 3807 3411 2064 1955 1774 253 ------
NM_012329chr1741694 536 301 102 1291 1658 --
NM_012333chr131210 1165 407 193 ----
NM_012334chr564464 4316 4293 3019 1843 714 23609 2913 34726 1731 1552 11035
NM_012338chr711127 11017 ----
NM_012347chr642563 2273 1853 1188 12556 --12485
NM_012382chr573915 3515 3293 2811 1197 967 711 1778 --13484
NM_012399chr2241606 1468 694 423 1241 11979 --
NM_012406chr12171 1152 ----
NM_012413chr21395 1113 --1157
NM_012419chr6----2646 91 --
NM_012420chr1052019 1997 788 388 213 1449 11535 --
NM_012428chr15--1405 1853 --
NM_012431chr763323 3259 2881 2458 1365 1067 1815 13640 --
NM_012464chr472960 2509 2405 2157 1161 333 183 ------
NM_012471chrX61976 1582 1446 1213 755 599 11921 ----
NM_012479chr742437 2004 932 592 22773 460 32548 608 44 --
NM_012482chr1--1444 ----
NM_013229chr1242697 2146 515 123 --31009 842 711 --
NM_013231chr1474380 3647 3160 3056 200 151 85 23553 1661 23984 3370 --
NM_013233chr231438 944 570 ------
NM_013243chr1531033 410 123 ------
NM_013261chr463504 2595 1148 1124 1058 922 33479 2975 1086 --12847
NM_013269chr1253193 2992 2768 1763 681 13854 13420 --
NM_013275chr162776 127 ----2667 336
NM_013302chr16124493 4438 4423 4072 3649 3235 1409 1338 1211 1020 364 194 14676 34272 4136 562 13969
NM_013309chr1562296 1948 878 763 612 41 3455 248 228 12325 --
NM_013341chr232392 1861 377 1360 --1503
NM_013354chr851275 1022 388 266 36 --11383 --
NM_013357chr81177 --1598 --
NM_013374chr352776 2643 627 174 139 --1240 --
NM_013381chr123904 727 315 11656 ----
NM_013386chr131798 479 460 ------
NM_013396chr213140 122 91 --1347 1162
NM_013412chr251243 1105 1002 970 933 --1774 --
NM_013417chr9144 ------
NM_013423chrX41005 960 875 857 2468 145 ----
NM_013427chrX41005 960 875 857 2468 145 ----
NM_013437chr841107 998 953 70 ------
NM_013438chr951451 620 525 506 208 ------
NM_013444chrX2876 760 1420 ----
NM_013447chr1943347 3099 2701 467 73478 3435 3387 2577 1141 283 170 ----
NM_013448chr143503 179 122 2711 238 ----
NM_013989chr1495018 3872 3641 3580 1496 1291 1130 450 356 --11568 --
NM_013995chrX52395 2012 361 216 157 ------
NM_013996chr72449 405 ------
NM_013996chr72449 405 ------
NM_013997chr72449 405 ------
NM_013997chr72449 405 ------
NM_013998chr72449 405 ------
NM_013998chr72449 405 ------
NM_014007chr91363 21241 400 ----
NM_014011chr292202 1827 1689 919 884 437 217 198 66 ------
NM_014021chr132477 724 630 23145 604 ----
NM_014023chr1072903 2303 1929 1886 1079 529 311 ------
NM_014028chr673002 2612 2317 1342 761 585 386 ------
NM_014034chr631471 1253 496 ------
NM_014038chr7----1351 --
NM_014043chr331019 664 456 --11085 --
NM_014048chr16134431 4229 4128 4008 1951 1610 1253 1186 1149 445 351 194 84 24997 4294 ----
NM_014056chr311910 22360 347 21781 1455 --
NM_014058chr41260 --1266 --
NM_014089chr1372094 2058 2046 1520 821 749 244 --1429 --
NM_014106chr1542904 2207 644 400 11948 2840 707 1522
NM_014110chr141201 1056 481 359 ------
NM_014112chr885241 4438 4269 3430 1555 1510 1407 1313 --14780 --
NM_014117chr1662706 1702 793 200 127 64 --12616 --
NM_014141chr785008 4597 4472 4329 3894 2095 1732 1402 2467 410 24105 3960 15142
NM_014155chr11147445 7263 7139 7115 6843 6706 6564 6545 5722 2375 2366 2203 1524 1233 15259 21646 1323 --
NM_014160chr331352 1220 424 --2158 84 --
NM_014166chr131830 --181 --
NM_014181chr252932 2527 2054 645 638 --1962 --
NM_014191chr123808 415 239 1208 ----
NM_014232chr171609 ------
NM_014232chr171609 ------
NM_014240chr344167 4136 4107 1463 21640 513 13334 --
NM_014243chr471645 1368 629 603 542 341 231 2734 97 21448 650 --
NM_014250chr22----22095 1510 --
NM_014253chrX22464 1780 ----11001
NM_014263chr1031467 1263 1057 11412 ----
NM_014267chr112177 124 1665 ----
NM_014271chrX2206 50 ----1755
NM_014289chrX41429 1416 944 175 31143 501 318 1921 1441
NM_014294chr881449 1301 1190 1165 1000 568 423 53 11089 ----
NM_014309chr2255030 4232 3859 1544 77 --24100 1336 --
NM_014317chr101296 ------
NM_014331chr4127559 7521 7351 6663 6266 5297 5289 5207 4729 2798 885 90 --15603 1394
NM_014333chr1152804 2706 2061 1744 712 ------
NM_014334chr9127 ------
NM_014350chr52475 95 1872 ----
NM_014351chr2221442 218 ------
NM_014352chr1121479 1128 --21329 1190 --
NM_014361chr112137 121 ------
NM_014368chr961946 1568 1543 479 360 307 ------
NM_014372chr121970 444 1137 11395 --
NM_014388chr1155993 5643 5599 4859 4514 4276 3905 3781 2188 1989 1783 1762 761 435 323 186 23771 2052 --
NM_014415chr3--1168 11070 --
NM_014423chr575301 3780 1342 1099 758 576 221 --2738 718 --
NM_014426chr202588 492 ------
NM_014445chr351980 1783 631 512 389 --1374 11708
NM_014506chr941670 546 513 200 11456 1261 --
NM_014554chr1231735 1598 59 ------
NM_014573chr1741841 1201 252 38 11792 21656 311 1456
NM_014574chr1441545 1198 1095 92 ------
NM_014585chr241214 1151 986 240 ----168
NM_014586chr2164852 4365 4012 942 402 367 24247 1394 43344 3182 3046 2983 --
NM_014602chr3148 ------
NM_014606chr411186 ------
NM_014616chr352873 2354 1040 931 769 --22679 596 --
NM_014629chr831051 200 65 21233 1028 ----
NM_014630chr1563757 3085 3028 1332 878 858 1405 ----
NM_014635chr241685 1078 684 481 1582 ----
NM_014636chr973853 3747 3729 3621 3056 331 218 ------
NM_014647chr1641774 1590 877 798 21577 1414 ----
NM_014663chr111082 --1745 --
NM_014666chr511231 ------
NM_014667chr372333 2046 2011 1642 1561 926 214 --1760 1718
NM_014674chr333511 2490 721 --22794 492 --
NM_014676chr131514 657 189 ------
NM_014677chr851344 1090 876 418 86 ------
NM_014679chr113982 375 139 --11163 --
NM_014682chr852029 1930 500 350 104 --21862 506 --
NM_014683chr1721495 165 1800 161 --
NM_014685chr161404 ------
NM_014690chr743113 2601 2005 640 12364 12184 --
NM_014693chr3--1723 ----
NM_014702chr663119 1302 1182 799 538 74 --13418 129
NM_014711chr162738 490 41548 531 311 265 ----
NM_014721chr6116762 6643 6053 5249 4951 1894 1748 1699 1524 1295 1015 11205 16392 --
NM_014729chr822212 847 ----1713
NM_014733chr542016 817 598 22 ------
NM_014735chrX42014 1946 1548 391 --1185 --
NM_014738chr17--1984 ----
NM_014739chr694195 4117 3767 3455 2764 802 462 416 21 33349 894 125 11437 --
NM_014743chr443014 2944 939 452 1825 2749 306 --
NM_014748chr2--147 ----
NM_014755chr241276 754 572 393 13576 --14166
NM_014779chr3----1448 --
NM_014781chr831021 1002 54 ------
NM_014787chr142492 1972 1898 782 21047 29 31832 1135 607 --
NM_014795chr24907 448 325 189 ------
NM_014802chr1211015 ------
NM_014810chr123220 1336 11322 22939 169 --
NM_014812chr161531 1452 1357 1269 277 103 ------
NM_014819chr542152 1758 867 580 ------
NM_014820chr342096 2023 554 386 ------
NM_014826chr153421 3165 2668 1649 306 11481 23650 522 --
NM_014827chr1--21677 1547 ----
NM_014836chr1051327 587 407 218 74 ----11569
NM_014839chr152204 2087 1944 439 389 11626 ----
NM_014850chr333007 954 162 24833 639 --11040
NM_014862chr1564210 3423 1690 1566 1030 171 11073 12652 --
NM_014864chr164069 3218 2709 1251 1067 818 1465 21456 1314 --
NM_014876chr222646 68 1414 31845 842 708 --
NM_014877chr17137771 7699 7690 6593 5978 5124 2565 2093 1851 1599 1376 715 302 37011 5168 83 26175 6041 11797
NM_014883chr472379 2037 1720 1549 799 480 315 42019 705 431 337 1231 --
NM_014888chr721535 478 ------
NM_014893chrY112351 2177 2054 1689 1628 781 754 584 450 411 379 --11872 1646
NM_014897chr1742784 2537 954 823 1463 22733 2600 1565
NM_014898chr1941872 1693 769 667 --32069 1935 227 --
NM_014899chr552992 2977 1245 712 22 11975 22350 2236 --
NM_014900chr231006 725 24 ------
NM_014903chr1211558 11873 ----
NM_014904chr1073271 3009 1373 1203 690 107 89 23833 2994 ----
NM_014905chr22528 455 --11782 --
NM_014906chr1783673 3236 2922 2868 1252 954 431 208 23341 1637 23496 2985 21173 867
NM_014912chr1052363 1091 864 158 79 12391 ----
NM_014918chr1511634 ------
NM_014920chr683648 3088 2931 2787 2775 2706 2647 1170 1364 11535 12589
NM_014923chr1361956 1863 1651 900 812 31 --1114 --
NM_014932chr321480 760 --11592 --
NM_014939chr1831508 1118 60 1421 ----
NM_014946chr262983 2899 2039 967 763 99 3591 81 25 1451 --
NM_014947chr142998 987 464 193 22187 1239 --11186
NM_014949chr12811 182 ----1866
NM_014951chr1032562 2508 843 ----1221
NM_014961chr442030 1769 557 77 ------
NM_014962chr2042783 1094 1014 816 --11905 --
NM_014964chr1752270 2092 1841 899 148 --11930 --
NM_014969chr13982 382 69 1244 ----
NM_014978chr1021622 543 2521 460 ----
NM_014982chr1474273 2006 1754 1575 570 556 87 --11701 --
NM_014988chr442171 2046 1786 1091 2404 391 ----
NM_014989chr661560 1390 1336 1319 639 201 11660 11327 --
NM_014991chr433242 3106 2267 11314 21212 1016 --
NM_014992chr142752 70 ------
NM_014997chr742687 2185 221 82 12408 12617 --
NM_014999chr1221500 308 --2505 371 1146
NM_015000chr1273135 1225 601 421 272 134 118 --2403 160 --
NM_015008chr353190 1327 1268 643 329 13633 1657 --
NM_015017chr131217 1188 1065 --4825 494 360 298 --
NM_015020chr1653714 3619 3058 2610 1483 22699 1567 53477 3213 380 243 182 13069
NM_015024chr8--21205 414 11069 --
NM_015025chr242580 2216 1958 1676 1171 11844 --
NM_015026chr1264677 4410 3615 3474 3259 1505 --43680 1330 248 161 192
NM_015027chr1631443 1308 219 ------
NM_015032chr1352707 2659 2439 929 590 ------
NM_015039chr153787 2646 1721 1406 456 31537 1391 147 43870 3659 3639 2807 --
NM_015040chr283289 3147 2775 2365 1306 1291 658 72 ------
NM_015046chr922785 2628 2907 263 ----
NM_015054chr122544 181 ------
NM_015057chr131567 125 ----
NM_015068chr743329 2624 2410 1568 1381 13658 --
NM_015069chr163256 220 75 --1630 --
NM_015071chr5106022 5892 5178 2394 1714 1518 1218 972 496 198 35856 4810 4449 --25482 4559
NM_015072chr14----1413 --
NM_015074chr154076 4061 3596 1399 634 --14206 --
NM_015076chr6104509 4148 4019 3782 3752 1543 1301 860 758 467 --12874 --
NM_015091chr142782 298 1291 ----
NM_015093chr641737 1165 405 84 --11578 --
NM_015097chr372344 2199 2172 2071 1803 1560 576 1612 21823 511 1411
NM_015110chr962214 1974 1697 969 278 152 ------
NM_015115chr463101 2189 2173 993 907 670 ----1216
NM_015130chr431330 880 195 11174 ----
NM_015132chr721670 1231 --1572 --
NM_015138chr1562294 2258 1046 864 723 678 1395 ----
NM_015143chr4----1129 1113
NM_015147chr252289 2142 1169 937 670 1988 --1979
NM_015149chr141997 1705 485 392 ----1563
NM_015153chr6126 --1584 --
NM_015156chr1493621 3510 2908 1406 1133 667 529 388 210 33987 1232 979 ----
NM_015170chr83609 535 51 ----194
NM_015172chr12401 209 ----21636 1347
NM_015184chr3----1133 --
NM_015187chr46962 886 720 673 312 158 ------
NM_015191chr1172448 2283 2049 926 832 445 328 22129 2077 12111 22231 2040
NM_015192chr2052382 1171 812 491 66 ----12083
NM_015199chr352638 2297 1882 526 373 1677 ----
NM_015200chr432327 1745 355 ------
NM_015215chr162360 2327 626 596 165 144 ------
NM_015216chr541342 620 599 494 ----1319
NM_015230chr42753 80 1439 11552 1744
NM_015233chr1342682 2465 2009 342 ----1279
NM_015235chr1041681 310 297 265 11822 ----
NM_015236chr431065 991 351 11156 ----
NM_015239chr92522 27 1412 ----
NM_015247chr1695415 5191 4553 4413 4156 2036 1787 1757 871 25247 2062 11386 --
NM_015250chr921708 134 --146 1624
NM_015251chr163633 578 392 12160 --163
NM_015252chr22934 854 ------
NM_015262chr103176 89 32 ------
NM_015263chr153807 392 241 --150 --
NM_015265chr242400 2086 1774 392 1192 ----
NM_015267chr1241674 861 512 244 ----1392
NM_015269chr11528 2475 201 1233 --
NM_015271chr484206 3692 3374 3002 1666 742 463 42 23957 3335 21057 229 --
NM_015272chr1641989 1857 1827 639 11714 11380 --
NM_015275chr1241744 393 355 124 11398 --11875
NM_015277chr1851260 707 273 232 104 31812 1219 578 ----
NM_015291chr113100 23243 2492 --13520
NM_015296chr1341003 856 283 127 1435 ----
NM_015299chr1473548 3374 2807 2560 876 794 783 1944 --12518
NM_015308chr11188 ------
NM_015310chr8157935 7563 6426 5777 5719 5132 2982 2212 1886 1589 1543 1324 1063 813 788 47112 6669 5911 1687 27066 2270 17410
NM_015313chr1153355 1694 1628 862 562 21405 941 21345 27 --
NM_015314chr742314 885 715 189 22000 692 ----
NM_015317chr252571 2442 976 625 497 11926 12168 1852
NM_015323chr64618 280 238 82 ------
NM_015335chr123715 161 70 22285 2234 12539 --
NM_015336chr1232327 2170 133 ------
NM_015344chr832029 430 230 1662 ----
NM_015347chr1242386 1126 906 771 --1390 --
NM_015349chr663068 3027 2962 2194 755 446 12803 1194 --
NM_015355chr173578 180 41 --11497 31510 693 444
NM_015358chr213935 874 855 ------
NM_015359chr842854 2846 2131 914 21162 949 ----
NM_015360chr53176 151 63 --154 --
NM_015361chr21818 ------
NM_015365chrX73173 1609 1353 1295 1267 1238 813 21589 39 ----
NM_015375chr164890 4359 4274 3880 1977 507 13405 44753 3954 352 89 --
NM_015381chr2252025 2000 1665 816 354 ------
NM_015382chr141689 ------
NM_015385chr1053239 3139 3060 3024 2959 12869 ----
NM_015387chr262044 1650 1547 842 586 257 1818 ----
NM_015393chr443128 2677 400 159 --23275 288 12904
NM_015396chr321359 298 21123 452 1108 --
NM_015397chr941222 711 372 128 11714 11756 --
NM_015419chrX4988 927 415 270 1942 1740 --
NM_015435chr851460 1320 431 340 62 ------
NM_015436chr473335 2788 2695 2072 364 329 141 ------
NM_015446chr12596 409 ------
NM_015455chr533544 1426 880 --11588 --
NM_015458chr8124616 4598 4530 4467 4257 4147 3766 2011 1949 1536 1366 850 15313 ----
NM_015464chr72835 286 149 ----
NM_015477chr151929 ------
NM_015483chr731112 841 442 1177 ----
NM_015508chr311448 1584 --1238
NM_015509chr1211178 ------
NM_015531chr11------1110
NM_015541chr33907 405 40 1254 ----
NM_015542chr1021099 878 --1470 --
NM_015548chr63767 324 287 1119 --1969
NM_015550chr763094 3085 2574 2482 1257 649 ----13119
NM_015553chr655175 4940 4171 4109 3164 11467 24291 3323 --
NM_015554chr1582755 2057 1133 983 880 817 686 674 --151 12285
NM_015555chr621421 99 --11210 --
NM_015565chr2131744 337 223 1429 11934 1305
NM_015567chr1311281 ------
NM_015569chr131806 1117 866 11409 ----
NM_015570chr71673 ----11523
NM_015571chr642511 2174 1697 789 --1773 --
NM_015575chr211124 11286 23414 2548 1200
NM_015602chr12597 470 --21322 285 --
NM_015630chr22977 777 --21164 119 --
NM_015635chr952159 1773 1579 244 108 1555 11641 1899
NM_015640chr154133 1144 521 399 172 --24101 4042 11908
NM_015678chr1311281 ------
NM_015686chrX41742 875 462 364 1920 11787 --
NM_015695chr642124 1654 1536 368 ------
NM_015845chr185596 298 141 79 67 ------
NM_015850chr842158 2095 1790 428 11580 12400 --
NM_015852chr7123512 3275 2647 2470 2436 1110 808 690 606 522 438 354 1857 13334 --
NM_015886chr8124664 4386 4313 3627 2202 2126 2088 2076 1958 1576 957 723 14208 15416 11675
NM_015891chr641693 1334 681 659 196 ----
NM_015902chr81734 ----1949
NM_015904chr2------1307
NM_015906chr164351 4261 4135 3820 1464 109 --11369 12967
NM_015920chr152663 102 ----1546
NM_015995chr1573870 3476 3413 1109 856 759 705 21446 584 25405 5392 --
NM_016009chr1104315 4179 3968 3598 3574 3218 1758 1616 1219 859 11171 --1173
NM_016023chr821507 816 --12153 --
NM_016037chr141146 854 746 289 --31056 917 831 --
NM_016045chr2041685 1298 87 55 1379 ----
NM_016048chr51255 ------
NM_016053chr12123 ------
NM_016072chr1262249 2159 2049 397 112 85 ------
NM_016073chr151830 11073 ----
NM_016075chr1362904 1279 1040 986 694 229 --1428 --
NM_016076chr173059 2766 2265 2076 1267 723 279 ------
NM_016083chr6103732 3171 3117 2412 1523 1324 1121 351 276 199 11473 23822 781 --
NM_016090chr113237 172 139 ----11008
NM_016096chr831813 817 72 1120 --11331
NM_016097chr184854 795 446 188 1684 ----
NM_016103chr52459 319 ------
NM_016107chr541226 1079 529 468 --21289 1028 1500
NM_016120chrX1399 ------
NM_016132chr1532705 771 277 ----13119
NM_016133chr241613 1529 252 170 ------
NM_016152chr31818 ------
NM_016166chr151170 ------
NM_016205chr42507 133 ------
NM_016217chr62485 53 13032 1799 --
NM_016224chr631562 540 134 ------
NM_016226chr122190 170 ----1447
NM_016234chr103861 742 710 ----11016
NM_016248chr1383797 2776 2519 2478 1192 1113 610 339 ------
NM_016252chr23897 612 112 ----1342
NM_016255chr632861 821 522 --1589 12664
NM_016260chr2107265 6868 6097 5523 5425 5087 2532 2263 61 44 37459 6515 1227 1627 37308 6404 2830
NM_016271chr183515 78 61 12160 12303 --
NM_016277chr661434 1110 1055 476 144 31 1334 ----
NM_016287chr13790 609 95 11394 ----
NM_016303chrX1307 ------
NM_016308chr131494 568 100 ------
NM_016322chr932132 1982 1206 --21036 827 --
NM_016338chr51135 11126 1419 --
NM_016340chr551098 1081 1024 103 73 51136 910 315 272 185 ----
NM_016374chr141419 594 517 66 ------
NM_016374chr141419 594 517 66 ------
NM_016377chr621746 1619 ------
NM_016395chr1551824 1385 752 350 54 1412 ----
NM_016396chr1522719 266 22468 154 --11896
NM_016410chr92568 127 ------
NM_016422chr1142042 1990 1184 250 12372 1843 --
NM_016441chr242347 2029 426 154 --21646 591 --
NM_016451chr112304 31 ------
NM_016467chr241148 962 73 31 11256 ----
NM_016472chr141372 11203 21084 288 --
NM_016507chr1743228 275 210 118 ----12621
NM_016513chr683648 3088 2931 2787 2775 2706 2647 1170 1364 11535 12589
NM_016530chr1564142 3183 2879 2816 689 411 53999 3817 2836 1273 682 23850 24 --
NM_016531chr463725 3455 3448 3324 2997 598 23832 265 12987 14019
NM_016542chrX31362 607 327 --21537 214 --
NM_016545chr11736 1773 ----
NM_016578chr111501 1469 --1104
NM_016587chr73993 824 90 ------
NM_016603chr511484 1425 --1267
NM_016605chr532620 2100 534 --11087 --
NM_016620chr11936 --21320 127 --
NM_016626chr1851593 1482 603 498 26 ----1401
NM_016644chr51519 ------
NM_016651chr1411057 ------
NM_016654chr151228 --11045 1113
NM_016819chr32527 217 ------
NM_016823chr1721274 1008 183 ----
NM_016824chr1051674 1476 612 480 409 11286 11486 --
NM_016929chr654634 4266 3697 1522 1030 24176 32 2835 726 --
NM_016936chr1642058 2004 418 306 21654 648 ----
NM_016950chr421280 264 ------
NM_016952chr1173269 1262 1146 1017 512 296 48 11622 3765 700 575 13652
NM_016953chr2116054 5623 5348 5286 4969 4064 3957 1623 1247 1017 555 11886 74399 1821 1686 924 805 621 36 24259 701
NM_016954chrX3198 103 30 --1214 --
NM_017410chr1211127 ------
NM_017412chr841030 929 882 344 ----11360
NM_017415chr584500 3661 2988 1708 1681 1607 708 275 1598 14056 --
NM_017420chr1473672 3263 2576 1443 1363 1189 180 1371 1675 --
NM_017423chr451746 1495 592 324 180 ------
NM_017447chr2154348 3990 3001 537 269 21098 1075 11240 --
NM_017452chr2031118 1041 533 11083 11047 --
NM_017453chr2031118 1041 533 11083 11047 --
NM_017454chr2031118 1041 533 11083 11047 --
NM_017455chr15--1405 1853 --
NM_017488chr22609 498 11331 ----
NM_017522chr13346 178 51 21099 354 --11142
NM_017548chr352031 2016 1682 398 273 193 142 11409
NM_017569chr131265 ------
NM_017599chr1261994 1635 1301 657 122 96 --1407 --
NM_017610chr1532038 519 154 --157 --
NM_017628chr4125182 4493 4136 3592 2107 1996 1840 1240 1224 1083 660 597 11512 ----
NM_017633chr623913 777 --23813 2817 --
NM_017634chr841803 1665 1246 732 11353 --31780 1737 1682
NM_017637chr9179352 9341 9150 7145 6165 5860 2882 2725 2358 2316 1782 1406 1396 836 763 603 140 28493 1268 25787 5718 --
NM_017640chr6--1336 1888 --
NM_017641chr121141 ------
NM_017643chr1742853 2285 2183 388 1472 ----
NM_017644chr3105204 4464 3740 3465 1974 1661 948 686 161 64 14568 23923 1438 --
NM_017650chr785638 5221 4831 4786 3699 1812 472 149 11163 34108 4046 4022 --
NM_017651chr631482 1100 273 ------
NM_017658chr1464032 1789 1739 1186 182 47 24165 589 11724 13668
NM_017666chrX61890 1790 1595 1376 288 162 21975 1823 11580 --
NM_017672chr1531327 838 185 11385 ----
NM_017693chr1321378 270 21512 381 ----
NM_017694chr282096 1777 1470 675 478 214 164 109 ------
NM_017709chr132809 227 167 13129 1205 --
NM_017715chr71591 1235 ----
NM_017719chr352252 2163 1626 711 593 --2865 837 --
NM_017734chr1----1114 --
NM_017737chr151771 1727 1700 712 622 ------
NM_017745chrX197 ------
NM_017747chr51274 ------
NM_017752chrX31992 1653 597 ------
NM_017753chr93908 800 427 1823 ----
NM_017761chr11989 ------
NM_017762chr1542356 1975 1645 263 1630 1216 1678
NM_017768chr12960 669 ------
NM_017769chr1472934 2889 2459 2252 2023 577 353 ------
NM_017778chr861322 1271 1128 1064 367 332 ------
NM_017780chr8--1821 1645 --
NM_017811chr932091 1940 242 1300 11244 --
NM_017813chr874841 4312 4226 926 903 880 412 --22078 831 --
NM_017824chr1052597 1956 1828 435 24 1994 22204 808 --
NM_017831chr18114699 4161 3530 3330 2892 1736 1231 1026 928 759 326 11457 33759 3027 1799 --
NM_017845chr42220 176 ------
NM_017848chrX14304 1341 23566 2910 13427
NM_017849chr252961 2860 2350 710 49 12779 22413 1048 --
NM_017851chr152876 410 ------
NM_017857chr112666 190 --3175 148 121 --
NM_017902chr1085650 4467 4247 3663 1442 1435 487 475 12261 11122 --
NM_017915chr123935 450 114 1799 ----
NM_017919chr995806 4747 2329 2061 1813 1285 1128 528 482 --11344 --
NM_017938chrX92034 1918 1780 1616 1576 783 767 752 462 ------
NM_017944chr111667 --1198 12134
NM_017954chr761416 1226 664 561 415 80 ------
NM_017987chr1072173 2017 829 599 464 347 151 --11494 --
NM_017988chr121899 ------
NM_017994chr712878 23011 2392 ----
NM_018015chrX31147 994 105 --11063 126
NM_018017chr1072406 2364 2260 2065 873 702 286 ------
NM_018027chr1053064 2217 2127 796 474 --12539 --
NM_018030chr184859 771 339 130 ------
NM_018061chr1------11124
NM_018064chr61247 ------
NM_018078chr421019 734 ------
NM_018084chr272849 2759 2187 1004 551 490 254 --22694 108 --
NM_018085chr177261 7210 6893 6691 6343 5750 758 25263 3092 26990 1841 --
NM_018087chr12253 28 ----147
NM_018092chr1651625 1395 1210 1085 104 ------
NM_018103chr1175 ------
NM_018112chr91100 ------
NM_018120chr821202 115 1191 ----
NM_018121chr1013157 ----2819 82
NM_018126chr441598 1443 978 22 ------
NM_018133chr352192 1882 630 193 45 1212 ----
NM_018137chr111268 ------
NM_018155chr332375 936 24 12838 149 --
NM_018157chr1253205 2752 2350 665 198 23232 2843 ----
NM_018164chr12175 ------
NM_018171chr121640 ------
NM_018177chr431126 256 229 --1823 1211
NM_018179chr122648 131 ------
NM_018181chr1841837 1569 560 450 --1401 --
NM_018184chr361812 1789 1717 1522 1408 549 22116 576 ----
NM_018200chr1522309 2127 32409 2246 343 ----
NM_018217chr20146 ------
NM_018222chr1141831 1798 1556 650 1454 ----
NM_018225chr9105056 4963 4614 4405 4065 1891 1510 1328 461 355 13836 43897 1708 1573 525 --
NM_018227chr463067 3016 2714 1984 538 147 ------
NM_018244chr2021132 291 2920 84 11242 --
NM_018247chr642723 934 629 394 1158 ----
NM_018254chr152431 1865 1856 955 24 11570 ----
NM_018256chr2169 ----125
NM_018263chr232304 925 795 ------
NM_018285chr15--135 ----
NM_018286chr1731028 779 374 ------
NM_018287chr1051339 1260 1047 977 970 ----11107
NM_018293chr352927 2228 807 238 56 1332 --12828
NM_018299chr863329 1359 1281 825 133 105 32660 2505 1302 --12170
NM_018312chr1121445 655 --1301 137
NM_018313chr342241 2009 1821 679 2554 426 --1646
NM_018315chr431244 1220 410 1155 --1355
NM_018323chr42365 152 11156 ----
NM_018325chr92615 180 1368 1137 --
NM_018327chr202669 661 1400 --1175
NM_018330chr1021081 366 --1669 11668
NM_018339chr951811 1267 1140 627 259 --1106 11233
NM_018340chr1653169 1772 1081 404 184 --54033 3897 3834 3699 3651 11239
NM_018355chr191415 ------
NM_018362chr11113662 2811 2627 2561 1580 1287 745 492 480 443 239 --33306 2878 2745 --
NM_018364chr143442 3109 1284 435 --11579 --
NM_018373chr14116093 5777 5491 5303 4622 4256 1613 1526 1089 437 270 11545 25554 1878 26346 2121
NM_018374chr7155085 4896 4709 4530 4108 3852 3514 1977 1759 877 798 482 278 253 149 ------
NM_018383chr2----21721 1353 --
NM_018403chr364059 3626 3075 2991 1480 630 23481 346 13959 --
NM_018409chr492777 2296 913 756 659 600 120 100 63 33098 3051 235 ----
NM_018416chr1222662 146 1358 --12400
NM_018423chr121279 ----1450
NM_018431chr203582 574 244 1216 ----
NM_018433chr2--2191 157 129 --
NM_018439chr1862461 2395 2252 2084 1699 566 --22197 2027 22066 660
NM_018440chr8158646 7417 6971 6536 6383 5242 3355 3325 3237 2947 2866 2586 2299 1950 1208 ------
NM_018442chr1--174 ----
NM_018444chr861949 1930 1872 1720 594 75 21974 1555 ----
NM_018445chr152575 127 ------
NM_018448chr122237 28 ------
NM_018451chr131259 ----1786
NM_018469chr1721438 986 ------
NM_018475chr4171 ------
NM_018482chr832039 1588 495 196 --1527
NM_018490chr1131637 716 558 --21486 460 --
NM_018509chr1751726 1498 1402 1296 350 1121 ----
NM_018557chr22627 210 11188 1216 --
NM_018566chr184798 4681 4554 4082 3982 1361 673 195 1182 ----
NM_018569chr431004 560 135 ------
NM_018584chr11260 ------
NM_018590chr1061606 1405 1365 1200 666 204 1384 ----
NM_018638chr1275236 4916 4606 4399 4167 3531 1465 --25712 3434 --
NM_018640chr1252465 2347 1050 149 39 ------
NM_018650chr12621 177 ------
NM_018667chr165861 629 558 263 44 ------
NM_018686chr121343 196 ----
NM_018695chr542248 737 248 57 ------
NM_018703chr162391 364 ------
NM_018710chr841167 959 273 163 ------
NM_018712chr1111562 ------
NM_018717chr422744 612 1952 32658 2172 123 12235
NM_018890chr731406 410 332 1135 ----
NM_018898chr532142 2093 927 1127 12315 --
NM_018899chr532142 2093 927 1127 12315 --
NM_018900chr532142 2093 927 1127 12315 --
NM_018901chr532142 2093 927 1127 12315 --
NM_018902chr532142 2093 927 1127 12315 --
NM_018903chr532142 2093 927 1127 12315 --
NM_018904chr532142 2093 927 1127 12315 --
NM_018905chr532142 2093 927 1127 12315 --
NM_018906chr532142 2093 927 1127 12315 --
NM_018907chr532142 2093 927 1127 12315 --
NM_018908chr532142 2093 927 1127 12315 --
NM_018909chr532142 2093 927 1127 12315 --
NM_018910chr532142 2093 927 1127 12315 --
NM_018911chr532142 2093 927 1127 12315 --
NM_018912chr531466 703 303 ------
NM_018913chr531466 703 303 ------
NM_018914chr531466 703 303 ------
NM_018915chr531466 703 303 ------
NM_018916chr531466 703 303 ------
NM_018917chr531466 703 303 ------
NM_018918chr531466 703 303 ------
NM_018919chr531466 703 303 ------
NM_018920chr531466 703 303 ------
NM_018921chr531466 703 303 ------
NM_018922chr531466 703 303 ------
NM_018923chr531466 703 303 ------
NM_018924chr531466 703 303 ------
NM_018925chr531466 703 303 ------
NM_018926chr531466 703 303 ------
NM_018927chr531466 703 303 ------
NM_018928chr531466 703 303 ------
NM_018929chr531466 703 303 ------
NM_018931chr51211 --3721 586 274 --
NM_018945chr633016 2504 1404 11281 ----
NM_018951chr711093 1249 ----
NM_018963chr211966 --1403 11266
NM_018976chr1272858 2506 2477 2082 1845 1139 397 12004 ----
NM_018999chr10114827 4620 4398 4233 3599 3392 3374 3130 1978 1766 1369 14276 11955 --
NM_019001chr394334 4166 3284 3271 962 778 763 671 410 ------
NM_019004chr762026 1868 928 762 596 177 11532 133 --
NM_019022chr181129 23138 90 ----
NM_019027chr452578 2465 487 394 271 ------
NM_019028chr112311 160 ------
NM_019035chr431909 1875 1619 ------
NM_019042chr721037 319 --1874 --
NM_019049chr11693 1512 1620 --
NM_019050chr462026 1595 1570 595 363 218 ------
NM_019058chr101612 1540 --1655
NM_019072chr593994 3356 3096 2763 2613 1567 1400 1201 713 12648 33208 3013 1630 13005
NM_019087chr551642 1432 1109 630 88 ----11439
NM_019102chr71282 ------
NM_019102chr71282 ------
NM_019106chr2242471 2437 2266 2145 1419 23360 923 12722
NM_019117chrX4977 619 272 190 12461 ----
NM_019555chr331839 1555 1183 21615 1352 ----
NM_019556chrX2404 346 21150 186 --2595 171
NM_019590chr1081186 1120 577 433 410 396 208 199 1252 1543 1474
NM_019593chr20103173 3038 2788 2322 1200 930 663 462 338 312 --1143 --
NM_019597chrX----1211 --
NM_019600chr15------1719
NM_019605chr11735 ------
NM_019895chr31838 --1785 --
NM_019903chr1051674 1476 612 480 409 11286 11486 --
NM_020116chr42685 534 1696 2729 305 --
NM_020122chr274938 4572 4340 1022 728 575 371 35262 5161 4072 --12124
NM_020123chr1031577 1165 379 --1241 11000
NM_020130chr831433 897 270 1219 11276 --
NM_020132chr2164680 4116 3477 3413 3389 1271 13344 ----
NM_020141chr162270 2121 2016 1662 285 264 ----1193
NM_020147chr153919 732 341 134 ----
NM_020148chr1852856 2236 1889 909 559 22101 877 ----
NM_020154chr152275 88 1242 1231 --
NM_020159chr431533 1391 122 --11482 --
NM_020177chr553043 2607 2098 1016 678 --1443 --
NM_020182chr2031127 572 272 2803 750 --13332
NM_020193chr1151218 1156 997 238 148 --11374 --
NM_020198chr1721477 1297 1165 ----
NM_020199chr51814 --11095 --
NM_020204chr12177 154 --1624 1580
NM_020205chr132132 1300 693 1218 1957 --
NM_020240chr552126 2058 2044 2026 749 ----1940
NM_020245chr674472 3777 1120 1100 741 662 583 21631 692 ----
NM_020336chr2082893 1383 1219 1212 1158 632 425 45 12966 1925 --
NM_020337chr482688 2512 2393 2194 2004 520 228 122 13032 1269 --
NM_020342chr252200 996 624 493 444 --12399 --
NM_020347chr372288 911 719 573 508 439 258 ------
NM_020379chr12385 364 1227 ----
NM_020381chr661477 818 606 385 234 164 21666 1577 31877 1414 669 --
NM_020382chr121172 ------
NM_020390chr384502 3419 3063 3016 1522 1461 993 83 14711 31583 1193 1056 2407 48
NM_020405chr1783631 3517 2976 1537 1506 1433 1202 774 23609 1274 11783 --
NM_020416chr442669 1851 789 281 1119 11716 --
NM_020420chrY21542 575 ----1163
NM_020425chr631927 715 170 11918 ----
NM_020432chr722317 510 ------
NM_020440chr143054 2982 2269 556 13240 21213 244 --
NM_020443chr195809 4674 2018 1936 1644 1550 1288 740 303 --26007 353 25873 4524
NM_020445chr7------1686
NM_020456chr1351705 1488 802 396 271 22155 80 11768 --
NM_020463chr2--1369 ----
NM_020466chr694943 4802 4779 3910 3340 3316 1513 1034 541 ----1680
NM_020473chrX42014 1925 1273 408 ------
NM_020474chr1851695 747 513 203 112 --11549 --
NM_020482chr63559 232 150 1767 ----
NM_020532chr21862 ------
NM_020640chr352321 2291 886 795 729 11635 ----
NM_020645chr11----2526 166 --
NM_020647chr841882 1644 1481 61 11673 ----
NM_020651chr261463 1296 1175 723 360 25 --11156 --
NM_020654chr321415 1230 ------
NM_020686chr161346 22784 199 ----
NM_020689chr2011556 ----1429
NM_020698chr1262913 2843 2757 1054 139 78 --1938 --
NM_020699chr154836 4364 1864 1852 1740 23295 1244 ----
NM_020704chr772429 2293 1874 1829 947 570 274 12456 1841 1791
NM_020718chr1656625 6076 5827 4085 1582 14582 15526 --
NM_020726chr51211 ------
NM_020727chr2164002 3301 1414 828 790 719 --11062 --
NM_020734chr1232412 710 360 --1436 --
NM_020739chr1554251 3847 2908 1594 1581 --11134 11280
NM_020742chrX62424 2246 1077 598 397 201 12124 11939 --
NM_020747chr51792 ----1137
NM_020748chr17--1731 21452 1325 --
NM_020752chr1052859 2323 1138 728 618 1646 ----
NM_020755chr641398 1088 405 267 ------
NM_020760chr231641 1457 1374 1580 11865 --
NM_020766chrX53547 2809 1808 1120 352 --24499 4061 1681
NM_020769chrX5955 651 642 218 83 ------
NM_020770chr111332 ------
NM_020771chr631439 1269 973 11465 ----
NM_020772chr17128582 8481 5735 5368 5277 5258 3253 2217 1278 1135 232 34 36592 2882 1938 11300 --
NM_020773chr462599 2111 635 584 348 238 11688 ----
NM_020774chr1855717 4486 4301 2014 1391 11122 36259 4183 4096 --
NM_020782chr1254809 3103 1866 1322 570 11055 11519 24840 4079
NM_020791chr1731319 1114 341 160 196 --
NM_020794chr141339 572 546 129 ------
NM_020801chr51167 --2792 366 --
NM_020802chr1173352 3014 2501 1231 915 893 574 ------
NM_020805chr1861643 1485 653 589 439 142 ----1446
NM_020809chr1162079 1831 1624 1575 890 591 32317 562 294 ----
NM_020810chr1442490 661 434 426 --1787 --
NM_020824chr102250 147 --1160 --
NM_020841chr1263876 3673 2908 2832 2627 330 12826 --23239 452
NM_020844chr8127568 6071 5584 5520 5392 4860 2342 1930 1354 904 881 324 46295 6205 5440 121 56674 6422 2276 1406 910 --
NM_020853chr1242816 1098 925 695 ------
NM_020854chr1871453 1344 1148 1094 597 587 350 ------
NM_020858chr1511477 11577 1173 21976 1586
NM_020860chr45905 734 426 246 186 ------
NM_020861chr621289 940 --1909 --
NM_020866chr1321079 1038 ------
NM_020870chr41241 --11960 --
NM_020871chrX21772 135 12437 --12009
NM_020872chr331600 1442 221 ------
NM_020873chr32798 687 --1304 --
NM_020909chr254140 3361 537 491 187 13632 --1662
NM_020918chr1063552 2667 1005 987 499 251 23100 197 22462 2357 --
NM_020919chr24881 416 323 303 --1462 139
NM_020922chrX101561 1402 1365 1306 1270 1191 549 389 203 126 --1724 --
NM_020925chr131419 1182 986 145 11223 --
NM_020935chr253335 3206 2915 727 34 23353 3168 23492 1621 --
NM_020940chr1042798 2775 2658 2174 ------
NM_020948chr153612 3263 2342 692 361 13504 --11353
NM_020951chr19131993 1708 932 863 849 788 776 755 709 691 634 438 430 --31900 1771 1598 --
NM_020962chr1542265 2174 400 225 --1308 --
NM_020964chr1853721 3445 3074 3028 1501 --23643 3505 14046
NM_020987chr101889 1204 1880 --
NM_021003chr141127 ------
NM_021005chr1511034 1192 ----
NM_021007chr252337 2184 2054 864 43 ------
NM_021032chr31489 ------
NM_021033chr1342956 2863 2525 254 22558 107 53305 2494 519 186 116 176
NM_021038chr382999 2860 2821 2525 1069 957 830 188 --13348 --
NM_021047chr194570 533 508 158 ------
NM_021061chr883900 2849 1511 681 617 373 93 40 11057 41709 1574 911 710 --
NM_021069chr441871 1363 755 575 11443 ----
NM_021072chr541067 949 167 52 11761 ----
NM_021083chrX43600 2954 2781 2311 --12645 12658
NM_021088chr252147 1594 802 532 295 --11657 11792
NM_021111chr91559 1424 ----
NM_021116chr7149069 8832 8296 8264 7534 7397 7384 6825 6412 6047 5914 5646 635 366 18408 11098 11386
NM_021140chrX21160 770 1269 ----
NM_021145chr7153 11000 --1945
NM_021148chr752408 2372 1905 618 496 --31874 971 744 11649
NM_021155chr1932911 644 27 --2844 707 --
NM_021159chr491660 1611 1602 1456 1391 333 300 247 170 11097 21671 1157 --
NM_021161chr141109 ------
NM_021163chr773793 3157 1477 1458 814 768 393 ------
NM_021183chrX22549 758 --32366 2125 129 --
NM_021215chr201992 --11994 1229
NM_021238chr1281894 1871 1805 1760 1737 1611 152 68 12039 ----
NM_021249chr1411119 ------
NM_021255chr1484097 3485 3405 3225 2884 2736 1446 841 32898 1129 346 1816 --
NM_021619chr911111 ------
NM_021622chr1042398 1826 1579 375 --21677 1459 --
NM_021627chr31411 ------
NM_021629chr363602 3424 1958 1025 62 54 13781 ----
NM_021633chr14954 946 464 314 11360 1114 --
NM_021645chr1352225 2213 2038 1836 72 32111 1705 1670 ----
NM_021647chr464376 1819 1044 605 392 153 --14702 --
NM_021648chr662370 2086 1759 736 472 246 ----1275
NM_021705chr641392 1230 366 151 --1109 11371
NM_021783chrX11840 2681 124 12194 --
NM_021813chr665397 4181 3717 3622 1790 283 15031 1120 --
NM_021818chr1441324 1318 1025 324 ------
NM_021911chr545198 3628 2023 1251 --14166 14533
NM_021912chr1553849 3131 2574 2555 1260 23145 3059 11552 --
NM_021914chr1432027 320 280 ----1856
NM_021956chr61424 11040 1305 --
NM_021959chr6--1948 ----
NM_021960chr122735 813 21928 710 ----
NM_021961chr11117383 6589 6332 6060 4803 2058 1793 1376 1005 717 380 22891 318 25354 610 26675 2845
NM_021963chrX3769 708 515 --1683 --
NM_021964chr3105329 4266 2009 2001 1655 1647 1206 827 488 153 26257 424 --11316
NM_021998chrX21064 372 1218 --2271 207
NM_021999chr131265 ------
NM_022041chr1642456 781 580 447 --12546 12363
NM_022045chr82277 223 ------
NM_022048chr1575657 2269 1059 920 637 285 57 36008 5335 414 ----
NM_022051chr13575 213 182 ------
NM_022096chr202360 142 ------
NM_022114chr11784 --13701 24206 464
NM_022118chr132464 248 ------
NM_022130chr571278 1192 1105 595 574 379 100 ------
NM_022143chr7--1434 11131 --
NM_022166chr1666114 5265 4395 662 484 262 54971 2505 2292 2063 2034 16293 --
NM_022336chr261915 1610 1564 829 791 684 ------
NM_022343chr91996 1534 1182 --
NM_022351chr843189 3164 1164 233 33620 997 572 13430 --
NM_022459chr13106148 4967 4847 4435 4342 2160 2036 1612 1540 777 --16216 --
NM_022473chr1574362 4162 3520 1514 984 399 170 2785 670 13848 12697
NM_022477chr2021169 484 11716 21367 1232 --
NM_022483chr551964 1894 1643 683 470 --21900 1397 --
NM_022484chr731152 475 247 1422 ----
NM_022491chr1242972 2850 2476 2181 21404 904 1135 --
NM_022550chr52157 118 ------
NM_022552chr21787 1451 ----
NM_022566chr15------1557
NM_022658chr121931 11015 ----
NM_022664chr1172 ------
NM_022716chr141078 1049 362 103 2714 694 1345 --
NM_022719chr2283895 3792 3248 711 563 468 380 45 --11234 --
NM_022726chr621382 1286 ----11615
NM_022735chr141702 1339 380 268 --11321 1583
NM_022763chr362897 2607 2073 429 345 35 1116 ----
NM_022780chr221481 1208 ----11409
NM_022781chr952185 2061 1301 653 151 2971 351 1302 --
NM_022802chr104569 466 421 145 --11292 --
NM_022818chr1621222 205 11096 ----
NM_022824chr531960 1782 148 --1408 --
NM_022826chr21108 ------
NM_022828chr511453 --1310 --
NM_022832chr4102525 2484 2339 1859 1836 953 884 643 325 208 ------
NM_022841chr1532604 2589 1714 1124 22704 2186 --
NM_022843chr1341258 1134 215 140 ------
NM_022845chr1672145 1802 1694 1382 592 536 498 --2753 109 11829
NM_022875chr5--1464 ----
NM_022877chr5--1464 ----
NM_022893chr233062 2605 2015 1567 12284 12481
NM_022894chr261389 1363 1096 672 242 198 --1250 --
NM_022898chr1464573 1534 1102 988 941 750 13953 13938 14116
NM_022902chr52356 87 ------
NM_022912chr22683 584 22965 2569 13022 --
NM_022918chr1142050 1696 814 775 ------
NM_022970chr1021392 52 21476 358 ----
NM_022977chrX42215 2169 980 451 --1603 --
NM_023000chr1441577 1070 670 67 1323 1590 --
NM_023001chr1441577 1070 670 67 1323 1590 --
NM_023009chr11220 ------
NM_023012chr123726 607 271 --1613 1216
NM_023037chr132310 174 ----11048
NM_023071chr1271158 1135 1126 937 914 434 73 ------
NM_023074chr1931381 1022 846 ------
NM_023105chr842158 2095 1790 428 11580 12400 --
NM_023106chr842158 2095 1790 428 11580 12400 --
NM_023110chr842158 2095 1790 428 11580 12400 --
NM_023111chr842158 2095 1790 428 11580 12400 --
NM_023929chr852677 905 816 212 184 --22253 2057 --
NM_023943chr3--1187 ----
NM_024007chr52758 352 152 --1126
NM_024052chr172858 794 ------
NM_024061chr7------1631
NM_024069chr19--1697 ----
NM_024076chr1961753 1712 1671 1592 1563 1475 2673 454 --12275
NM_024165chr62231 75 ------
NM_024311chr172571 89 1167 ----
NM_024315chr72449 390 197 ----
NM_024345chr985911 5744 5269 5105 4303 3920 3903 1783 12243 --11365
NM_024411chr201613 ------
NM_024423chr1894230 3734 1434 1135 767 698 229 187 126 23538 3290 ----
NM_024490chr151566 ------
NM_024511chr462166 1227 1102 390 253 235 23212 760 32230 586 453 --
NM_024519chr16--2296 286 ----
NM_024524chr343090 2520 2236 240 22797 2785 ----
NM_024529chr111030 ------
NM_024539chrX4954 920 394 140 1821 ----
NM_024556chr112465 319 ----154
NM_024557chr1121307 1262 21592 374 --1291
NM_024567chr8187 ------
NM_024586chr1----2615 108 --
NM_024590chr431587 415 373 21229 749 1451 --
NM_024607chr854134 3324 1193 1170 182 1535 ----
NM_024626chr121612 1033 156 ----
NM_024635chr9------1256
NM_024639chr652152 2012 1920 765 614 2398 204 ----
NM_024641chr672747 2654 2578 2487 749 670 617 42560 2333 2317 141 12270 --
NM_024646chr1103969 3835 3625 3374 3200 3040 2975 2473 1315 279 --32664 2608 782 --
NM_024652chr1551034 941 389 235 51 ------
NM_024658chr141139 ------
NM_024665chr394565 4377 4248 4227 3605 1412 1350 1185 81 23643 3210 1112 --
NM_024674chr142673 665 630 405 22691 555 33076 2357 2163 --
NM_024686chr1----2546 374 --
NM_024699chr86940 860 789 713 72 46 ------
NM_024702chr173575 67 34 1274 ----
NM_024721chr842217 2005 591 214 --2105 74 --
NM_024740chr1184152 3641 3627 3001 1064 780 691 330 11167 23200 3064 12921
NM_024742chr162295 268 ----1666
NM_024761chr985259 5218 5080 4658 4585 4441 4044 1238 14305 2888 699 11890
NM_024770chr2116482 6431 5513 5176 4293 4140 2305 1552 1217 452 234 66271 6250 6203 6049 5233 4071 25718 1695 --
NM_024824chr1431679 1201 347 21594 72 1333 --
NM_024837chr1521685 1469 11572 ----
NM_024884chr1494072 2883 997 787 763 559 535 284 124 --21196 1060 --
NM_024887chr121640 644 ------
NM_024899chr181266 ------
NM_024908chr153590 187 136 --2513 377 --
NM_024920chr4----11023 --
NM_024930chr572686 2593 2353 1743 1128 475 193 --31931 1806 957 --
NM_024944chr2131119 1017 385 ------
NM_024946chr1631660 445 65 --11628 1206
NM_024947chr3139584 9555 9203 8716 7727 7693 7375 7136 6662 2261 1721 214 154 39074 1431 246 27573 7438 --
NM_024949chr454918 4469 2004 1932 682 11879 13697 --
NM_024953chr1222699 2184 12411 ----
NM_024963chr795902 5622 5126 4835 4135 3931 2132 2005 48 1543 14198 24363 4052
NM_024989chr2128046 8006 6997 2976 2836 2600 2252 1893 1181 688 418 355 11967 37710 2449 1466 12316
NM_024991chr1053239 3139 3060 3024 2959 12869 ----
NM_024993chr231429 1104 147 ------
NM_025040chr1962079 2054 1972 1520 989 262 ------
NM_025054chr883857 3673 3643 3326 3214 2864 1539 998 ------
NM_025073chr183998 3936 3799 3087 1252 1045 643 191 --11333 --
NM_025074chr453109 2977 2952 1246 416 12877 3831 196 102 --
NM_025125chr103651 454 267 1533 --1630
NM_025134chr1652297 1795 474 365 228 32554 781 391 12127 --
NM_025146chr312441 11841 ----
NM_025151chr852131 2100 1414 1370 171 1500 ----
NM_025154chr71195 11098 11345 --
NM_025160chr183776 3756 3260 2990 2614 844 602 259 11129 ----
NM_025181chr23598 234 40 --1211 --
NM_025184chrX2816 307 1162 ----
NM_025191chr153328 2980 2347 1226 242 11006 ----
NM_025203chr241479 1267 96 47 11147 ----
NM_025219chr203500 297 204 42440 2335 1534 1511 1353 11815
NM_025221chr441063 949 930 498 11255 11124 --
NM_025222chr383044 2798 2693 1956 1200 610 381 243 1524 ----
NM_025235chr1031941 1711 810 11374 1475 --
NM_025237chr1731386 1228 515 ----11258
NM_025238chr1521545 1009 1444 --11437
NM_025268chr141392 ------
NM_030579chr1633718 3122 794 172 ----
NM_030621chr1464118 3631 3536 1462 1126 445 44171 3583 1043 875 23968 806 23390 2740
NM_030623chr241285 594 145 115 --155 --
NM_030627chr573103 2945 2929 2885 2613 1055 180 43233 3094 3008 2860 21301 123 --
NM_030637chr144640 289 276 188 ------
NM_030639chrX41438 592 463 81 1326 161 --
NM_030640chr121269 128 ----
NM_030647chr776058 5464 5401 4814 4687 4091 1170 25288 1061 25313 1007 14106
NM_030648chr485131 5122 4162 3639 2168 1608 441 57 15592 14385 11236
NM_030653chr121927 ----1718
NM_030660chr1411022 --159 --
NM_030664chr1051823 1798 756 731 164 11909 ----
NM_030667chr122917 177 --21152 988 --
NM_030668chr122917 177 --21152 988 --
NM_030669chr122917 177 --21152 988 --
NM_030670chr1251949 788 674 581 384 --22184 2020 --
NM_030671chr1251949 788 674 581 384 --22184 2020 --
NM_030674chr1275361 4567 4340 1480 1096 836 726 45291 1872 460 93 14697 --
NM_030751chr1041698 1611 1407 508 11840 ----
NM_030751chr1041698 1611 1407 508 11840 ----
NM_030755chr1442514 2270 2187 1079 --22577 560 --
NM_030762chr1211911 --21896 1878 --
NM_030773chr2041801 1631 308 70 2526 36 31147 696 97 --
NM_030786chr12572 433 ------
NM_030806chr1159111 8758 8664 8414 7630 7039 6884 6676 6257 5733 3578 2830 1229 1044 869 48975 8560 1516 320 46132 3117 147 104 11704
NM_030816chr163692 3319 3260 3085 649 108 23222 2756 ----
NM_030881chr222905 40 11700 ----
NM_030885chr331443 542 201 11915 1473 --
NM_030906chr111232 1518 1465 --
NM_030917chr4149 ------
NM_030918chr174740 3934 3857 1589 1384 1133 124 14365 45294 3326 2101 1961 --
NM_030920chr121809 1792 192 1369 --
NM_030934chr131765 1496 465 ------
NM_030939chr62852 241 2834 762 ----
NM_030940chr92488 166 --1530 166
NM_030960chr6159 ----139
NM_030962chr1131582 1530 1064 1341 ----
NM_030963chr61631 ------
NM_031216chr1822219 1932 ------
NM_031243chr742185 2091 1917 1767 --1864 --
NM_031268chr1675235 4870 4791 3581 1325 830 583 23485 1039 ----
NM_031283chr21143 ------
NM_031291chr42503 56 ------
NM_031296chr462272 1866 1069 858 547 91 --31766 1054 921 --
NM_031305chr411435 1133 ----
NM_031314chr142733 375 11969 21541 1309 --
NM_031371chr141419 594 517 66 ------
NM_031371chr141419 594 517 66 ------
NM_031411chr532142 2093 927 1127 12315 --
NM_031418chr1142726 2512 873 506 --1299 --
NM_031419chr311380 --11083 --
NM_031422chr182460 183 ------
NM_031424chr20--143 1510 --
NM_031427chr14----24719 2240 13640
NM_031431chr1351282 681 329 167 71 21614 355 --1142
NM_031445chr2113373 3330 3124 2115 1105 1077 874 800 506 380 104 ------
NM_031461chr851553 830 778 268 259 ------
NM_031469chr662731 2617 1578 913 265 227 2605 490 22819 1466 --
NM_031479chr1211136 --1745 --
NM_031483chr2073490 3118 2682 2472 2271 678 375 1347 13500 --
NM_031844chr153942 3569 2538 1459 477 11343 ----
NM_031845chr263413 3102 2354 1414 1275 324 11123 13207 --
NM_031847chr263413 3102 2354 1414 1275 324 11123 13207 --
NM_031849chr532142 2093 927 1127 12315 --
NM_031857chr532142 2093 927 1127 12315 --
NM_031858chr1731396 1351 148 11149 ----
NM_031860chr532142 2093 927 1127 12315 --
NM_031862chr1731396 1351 148 11149 ----
NM_031935chr14873 294 228 119 ------
NM_032012chr9144885 4626 4308 4259 3819 3613 3269 1925 1911 1672 1649 1587 1294 318 --14349 --
NM_032013chr2021169 484 11716 21367 1232 --
NM_032047chr332425 1938 923 11579 21727 1666 --
NM_032088chr531466 703 303 ------
NM_032092chr531466 703 303 ------
NM_032102chr113746 372 286 ------
NM_032105chr187639 6533 5819 5596 3040 2423 1942 664 37591 5366 2850 --12502
NM_032116chr1385694 5056 3907 2321 1330 1250 835 719 14569 1898 --
NM_032121chrX72641 2154 2049 1726 779 715 427 1419 ----
NM_032124chr1811109 --2968 301 --
NM_032144chr221472 1354 21706 371 ----
NM_032145chr63397 241 89 ------
NM_032154chr1041018 865 54 47 1797 ----
NM_032160chr1863685 3308 1707 1218 767 423 21045 252 43881 3748 972 556 --
NM_032186chr11936 --21320 127 --
NM_032189chr1363669 3590 3309 3272 3217 1768 --1909 --
NM_032208chr263609 3598 3341 2681 2435 269 --32585 2519 210 --
NM_032219chr41115 ------
NM_032228chr1142586 2415 1127 211 13090 12787 13328
NM_032229chr1321175 361 1352 ----
NM_032246chr152967 828 ------
NM_032250chr94853 356 295 200 ------
NM_032256chr121254 ------
NM_032287chr2274265 3948 3114 1032 818 228 30 --11024 --
NM_032288chr332378 900 573 ------
NM_032291chr141725 660 602 181 1372 11420 --
NM_032312chr21823 ------
NM_032321chr283312 3013 3000 2341 2216 1025 930 706 --1593 --
NM_032364chr121182 --2388 245 --
NM_032373chr10104606 4432 4133 4125 4059 1807 1468 1322 851 334 11845 ----
NM_032379chr113760 161 120 ------
NM_032403chr531466 703 303 ------
NM_032424chr1141378 1093 515 232 ------
NM_032439chr10----11117 11266
NM_032440chr10102891 2879 2738 2542 2244 1053 849 430 401 50 1916 ----
NM_032449chr162825 2809 2721 2245 1050 589 22054 485 31893 1760 258 12910
NM_032457chr443666 3152 1256 741 11556 ----
NM_032458chrX22590 539 --12241 --
NM_032491chr1231255 990 930 ------
NM_032499chr1511678 1547 --1210
NM_032505chr321854 1098 ----12391
NM_032521chr2053142 2365 2199 947 562 --21135 1010 --
NM_032547chr421357 80 11393 ----
NM_032557chr4170 ------
NM_032558chr911496 11150 --1327
NM_032564chr111130 ------
NM_032582chr1721821 1188 11696 ----
NM_032622chr431468 376 64 ------
NM_032682chr353561 2914 627 454 121 1395 21459 337 --
NM_032689chr1961624 1589 578 557 485 393 11337 11297 --
NM_032717chr42408 155 1113 ----
NM_032778chr323032 137 21250 544 ----
NM_032812chr102242 38 ------
NM_032828chr19114875 4656 4196 4136 4073 3268 3056 1712 1683 1465 797 --84828 4437 4269 3253 3120 1911 1772 405 --
NM_032829chr1221166 774 ------
NM_032833chr131917 1669 844 12599 11732 --
NM_032839chr33507 56 49 1136 ----
NM_032842chr741364 455 250 242 1117 1518 --
NM_032858chr11103 --160 --
NM_032859chr1363473 2888 2466 2428 1244 417 --22943 755 --
NM_032873chr1194139 3438 3040 2975 1641 1529 1014 832 646 1266 23026 1716 14518
NM_032875chr171788 ------
NM_032918chr1221298 361 --11031 --
NM_032943chr113760 161 120 ------
NM_032949chr131519 ------
NM_032961chr431212 1136 260 ------
NM_032968chrX53009 2820 2727 607 136 ------
NM_032969chrX53009 2820 2727 607 136 ------
NM_032973chrY63004 2815 2722 2686 607 136 ------
NM_032975chr1873415 3024 2910 2755 2246 308 42 --1211 --
NM_032978chr1811174 ------
NM_032979chr1811174 ------
NM_032980chr1873415 3024 2910 2755 2246 308 42 --1211 --
NM_032981chr1811174 ------
NM_032983chr773088 2516 2079 1352 1190 1065 199 1383 32277 2142 765 1224
NM_032991chr451349 1011 490 281 258 1105 ----
NM_033020chr164351 4261 4135 3820 1464 109 --11369 12967
NM_033028chr151810 ------
NM_033030chr231117 1027 151 ------
NM_033055chr11277 1875 ----
NM_033081chr2071486 1251 934 529 442 421 377 21084 243 --11147
NM_033083chr343429 3102 1173 438 1613 ----
NM_033136chr541847 1205 528 41 ------
NM_033137chr541847 1205 528 41 ------
NM_033138chr782157 2125 1973 1627 824 584 499 155 ------
NM_033139chr782157 2125 1973 1627 824 584 499 155 ------
NM_033140chr782157 2125 1973 1627 824 584 499 155 ------
NM_033143chr473906 3782 3525 3210 911 632 384 23299 653 12943 --
NM_033157chr782157 2125 1973 1627 824 584 499 155 ------
NM_033181chr6103732 3171 3117 2412 1523 1324 1121 351 276 199 11473 23822 781 --
NM_033208chr161122 ------
NM_033211chr541528 1507 412 212 ----196
NM_033224chr7108055 7208 6730 6668 2428 2143 1705 1376 1016 21 17304 36867 6431 2944 --
NM_033225chr833082 2171 190 1180 1107 --
NM_033228chr52610 58 ------
NM_033276chr122270 238 ----126
NM_033285chr844468 2847 1094 655 --2677 251 --
NM_033290chrX93401 3342 2904 2705 2401 2325 1210 898 264 1232 ----
NM_033300chr13346 178 51 21099 354 --11142
NM_033326chr1162105 1755 881 620 401 101 --11836 --
NM_033331chr933613 3405 51 21121 1060 13288 --
NM_033360chr1294666 4254 3760 3653 3540 809 753 618 182 14199 23488 3316 13224
NM_033364chr362023 1631 1592 1383 565 546 ------
NM_033389chr1733708 830 587 24874 1701 13140 14808
NM_033402chr81553 ------
NM_033406chr111309 ----150
NM_033407chr12684 242 ------
NM_033425chr1173359 3167 2908 668 604 478 373 12927 ----
NM_033426chr1432741 632 252 22079 1102 12008 --
NM_033427chr71726 ----1822
NM_033429chr1532691 2577 676 12543 --22318 127
NM_033430chr443632 3432 280 177 134 13819 13691
NM_033437chr443632 3432 280 177 134 13819 13691
NM_033480chr642563 2273 1853 1188 12556 --12485
NM_033481chr642563 2273 1853 1188 12556 --12485
NM_033549chr53670 661 650 ------
NM_033631chr163893 3157 3076 2391 417 184 11042 13253 --
NM_033632chr431244 1220 410 1155 --1355
NM_033644chr531955 926 624 1320 ----
NM_033645chr531955 926 624 1320 ----
NM_033656chr21115541 4699 4665 4659 4304 4267 2106 1344 459 393 251 25523 427 15468 14070
NM_044472chr11647 ------
NM_052832chr862937 2498 2145 797 141 113 199 ----
NM_052851chr1321630 200 ----21972 852
NM_052867chr1321383 1135 ----21214 520
NM_052879chr1253500 2790 1552 1206 478 13435 12529 --
NM_052885chr1244539 1458 895 368 2460 209 ----
NM_052886chr821770 1763 --1367 --
NM_052900chr831634 435 332 1195 ----
NM_052905chr221702 1500 11559 2529 83 --
NM_052910chr1321943 1745 ----32034 2027 1532
NM_052911chr183876 239 93 1210 ----
NM_052923chr61103 ------
NM_052927chr551696 1605 1553 722 255 --11702 --
NM_052934chr11212 131 ----
NM_052937chr832748 582 275 2756 299 ----
NM_053016chr9168047 6924 6810 6237 6173 6042 5248 5170 4853 2737 2434 2426 2091 1566 1050 79 15422 35633 5363 565 15029
NM_053023chr1152706 2303 1154 1071 729 ----11213
NM_053024chr311014 11557 ----
NM_053025chr331750 1674 1167 ----1515
NM_053026chr331750 1674 1167 ----1515
NM_053027chr331750 1674 1167 ----1515
NM_053028chr331750 1674 1167 ----1515
NM_053031chr331750 1674 1167 ----1515
NM_053032chr331750 1674 1167 ----1515
NM_053042chr462846 2682 2123 2072 1182 760 1389 ----
NM_053043chr786433 6393 3992 1734 1645 1581 1573 1165 ----12443
NM_053056chr1152656 2448 936 831 674 1282 --12123
NM_054016chr121856 729 11535 ----
NM_054016chr121856 729 11535 ----
NM_054016chr121856 729 11535 ----
NM_054111chr64960 653 352 146 138 ----
NM_057158chr81604 ------
NM_057175chr441719 977 375 313 1517 1183 --
NM_057178chr1752398 1881 1809 488 32 22813 613 12038 --
NM_057180chr122190 170 ----1447
NM_057182chr19--192 ----
NM_057749chr831213 532 523 180 ----
NM_058170chr111332 ------
NM_058237chr141942 ------
NM_058241chr221984 1868 11964 12127 --
NM_058241chr221984 1868 11964 12127 --
NM_078483chr573575 3369 3133 1208 1189 334 22 ----21636 966
NM_078485chr62535 110 ----1137
NM_080597chr184859 771 339 130 ------
NM_080599chr1021099 878 --1470 --
NM_080617chr20--1304 ----
NM_080645chr651752 1514 1417 613 32 12006 --12144
NM_080664chr142370 23 --2568 433 --
NM_080666chr1421050 403 ------
NM_080676chr2063271 2986 2746 2569 825 420 1166 32801 2400 983 --
NM_080683chr43542 470 178 ------
NM_080684chr43542 470 178 ------
NM_080685chr43542 470 178 ------
NM_080743chr631610 492 189 ----12242
NM_080759chr1342213 1920 256 244 1413 ----
NM_080760chr1342213 1920 256 244 1413 ----
NM_080798chr10--1106 ----
NM_080799chr10--1106 ----
NM_080800chr10--1106 ----
NM_080801chr10--1106 ----
NM_080802chr10--1106 ----
NM_080803chr10--1106 ----
NM_080804chr10--1106 ----
NM_080805chr10--1106 ----
NM_080806chr10--1106 ----
NM_080807chr10--1106 ----
NM_080808chr10--1106 ----
NM_080809chr10--1106 ----
NM_080810chr10--1106 ----
NM_080811chr10--1106 ----
NM_080812chr10--1106 ----
NM_080813chr10--1106 ----
NM_080814chr10--1106 ----
NM_080815chr10--1106 ----
NM_080821chr2072089 1634 1596 539 471 431 48 ------
NM_080872chr854047 3091 2628 987 842 43908 2694 2601 1236 13329 1896
NM_080874chr41687 1627 ----
NM_080881chr51172 ------
NM_080927chr353014 2566 2341 321 91 12950 12550 --
NM_130385chr1132441 2281 1190 22351 553 ----
NM_130387chr35971 955 384 246 143 ------
NM_130391chr963153 2493 1379 740 359 130 33495 3305 253 133 --
NM_130392chr963153 2493 1379 740 359 130 33495 3305 253 133 --
NM_130393chr963153 2493 1379 740 359 130 33495 3305 253 133 --
NM_130434chr152354 156 21118 433 1746 --
NM_130435chr1022830 597 --32801 2258 2131 --
NM_130436chr2192470 2456 2432 2205 2103 1088 679 362 117 ------
NM_130438chr21113047 3033 3009 2782 2680 2086 1256 939 694 582 479 ------
NM_130439chr1042221 1858 348 126 ------
NM_130439chr1042221 1858 348 126 ------
NM_130798chr1521382 140 --11063 --
NM_130808chr31404 122 ----
NM_130809chr52494 254 ------
NM_130838chr1541406 1398 1163 212 --1659 --
NM_130839chr1541406 1398 1163 212 --1659 --
NM_130847chr1185374 5261 1874 1514 694 614 207 168 35496 1430 1092 34732 4622 4051 15095
NM_133264chr1793865 3815 3707 3680 3635 3317 2838 1174 713 ----13234
NM_133326chr12339 131 ------
NM_133329chr22269 187 --21469 90 --
NM_133334chr4145656 4960 4746 4526 4415 4160 4008 3946 1756 1103 594 483 297 31 1697 35145 4145 1468 --
NM_133370chr433049 1461 1196 --11451 --
NM_133372chr542290 1938 1878 897 --22075 319 11118
NM_133433chr54859 679 586 29 --1923 --
NM_133478chr262165 2142 1793 1635 970 850 1321 ----
NM_133496chr142976 1776 750 104 23659 3524 43174 3039 946 415 --
NM_133510chr14----1393 --
NM_133638chr551322 458 189 97 41 1432 ----
NM_133642chr2231052 848 297 ----1151
NM_133646chr2115230 4521 4475 4426 4417 4364 4029 1523 641 618 108 1176 ----
NM_133647chr1573177 2643 2491 2442 1307 570 181 12410 23388 2788 21288 191
NM_134447chr193544 413 67 ------
NM_138270chrX21251 831 13183 ----
NM_138288chr1432237 2038 1497 --11363 --
NM_138292chr1122310 2250 13512 12388 --
NM_138317chr141109 ------
NM_138318chr141109 ------
NM_138319chr1531028 967 511 ------
NM_138335chr42856 630 ------
NM_138376chr142191 139 ------
NM_138394chr2142 ------
NM_138423chr1532194 1961 484 --1547 --
NM_138426chr742069 1977 1560 648 ------
NM_138444chr1354009 3826 3187 504 173 21503 739 --2165 64
NM_138455chr8--1123 ----
NM_138457chr683172 2832 2616 1147 927 891 879 778 --22817 2679 --
NM_138459chr693681 3616 3558 3524 3318 2828 2420 1379 764 --12810 --
NM_138462chr92301 160 ------
NM_138468chr265728 4980 2428 1858 1600 1142 1713 --1255
NM_138473chr1244517 3333 3176 2006 23495 1305 13425 --
NM_138494chr752572 2249 1918 935 90 ----12296
NM_138558chr141201 1056 481 359 ------
NM_138571chr61480 ----1242
NM_138576chr1464573 1534 1102 988 941 750 13953 13938 14116
NM_138621chr253576 3131 1090 435 403 13805 11074 34161 3916 493
NM_138633chr621746 1619 ------
NM_138635chr773078 2567 2511 1160 934 606 288 --1668 --
NM_138638chr1432027 320 280 ----1856
NM_138693chr7196 ------
NM_138713chr16158276 8257 6138 5964 5773 3293 2854 2795 2386 1251 1201 1164 974 778 141 27782 6506 --15223
NM_138714chr16158276 8257 6138 5964 5773 3293 2854 2795 2386 1251 1201 1164 974 778 141 27782 6506 --15223
NM_138731chr1493500 2763 2695 1510 1258 1005 637 606 243 ----1212
NM_138735chr2----2992 326 --
NM_138771chr751371 1309 1269 611 469 --1438 --
NM_138779chr131183 ------
NM_138782chr55865 672 210 128 36 --11882 --
NM_138811chr731145 1028 391 ----1788
NM_138959chr175803 4163 1370 873 686 575 261 11207 ----
NM_138966chr183533 479 64 ----1133
NM_138969chr83975 929 539 ------
NM_138970chr1421594 467 ------
NM_138980chr4------1257
NM_138982chr4------1257
NM_139048chr32181 31 1260 ----
NM_139057chr1542800 2647 200 115 12111 22410 2276 --
NM_139072chr22140 40 2303 191 ----
NM_139135chr131306 835 315 ------
NM_139136chr122722 108 ------
NM_139168chr511398 11344 ----
NM_139182chr42753 80 1439 11552 1744
NM_139207chr1241727 489 234 71 1427 21524 1510 --
NM_139279chr263384 1357 1261 864 320 102 --13428 --
NM_139283chr1221769 1629 22366 1004 ----
NM_139312chr1031467 1263 1057 11412 ----
NM_139316chr72941 776 2356 102 ----
NM_139319chr1231330 1287 1256 ------
NM_139321chr2064230 4103 4024 1193 660 62 --21691 231 --
NM_144567chr152242 1794 1033 822 385 11115 52038 1994 1857 1018 885 --
NM_144571chr446095 5727 5115 393 --26678 4698 --
NM_144583chr221735 1169 192 --148
NM_144600chr1651538 1407 1304 294 140 11245 1492 --
NM_144609chr171157 ------
NM_144633chr341428 1291 472 46 1115 ----
NM_144664chr1132485 1993 839 ------
NM_144710chr221033 194 ------
NM_144721chr42424 315 --12665 12749
NM_144728chr13845 350 168 ------
NM_144729chr13845 350 168 ------
NM_144775chr1794637 4410 4295 4222 4012 3861 3642 3071 215 1946 ----
NM_144778chr1392681 2555 2219 1901 1882 1013 570 529 107 1913 1337 --
NM_144949chr292202 1827 1689 919 884 437 217 198 66 ------
NM_144967chrX1819 1295 1928 --
NM_144973chr1264402 4247 4147 3822 3600 838 24448 139 192 12099
NM_144979chr4------1553
NM_145037chr341486 244 231 185 164 ----
NM_145044chr321483 449 1432 11407 --
NM_145112chr1421327 1319 ------
NM_145117chr1132650 2235 212 ----1568
NM_145176chr673475 3289 3042 2632 1404 599 592 --23182 2839 --
NM_145251chr1441547 472 452 110 1501 ----
NM_145259chr266471 5990 5739 5571 2593 268 35874 5773 1170 25353 613 25083 2156
NM_145284chrX51711 1674 1555 673 427 22430 105 ----
NM_145307chr1073337 3316 2982 1817 1574 1339 1331 34466 4391 4272 14182 --
NM_145316chr6--1756 ----
NM_145320chr763094 3085 2574 2482 1257 649 ----13119
NM_145321chr763094 3085 2574 2482 1257 649 ----13119
NM_145322chr763094 3085 2574 2482 1257 649 ----13119
NM_145349chr1752188 1825 1619 585 308 --11888 12288
NM_145350chr1721540 1177 --11240 11640
NM_145351chr1762680 2317 2111 1077 800 511 --12380 12780
NM_145686chr253291 2952 2920 2877 2777 --11219 --
NM_145687chr253291 2952 2920 2877 2777 --11219 --
NM_145698chr1041964 1502 165 101 --11353 --
NM_145714chr161387 ------
NM_145753chr34679 582 568 520 1326 ----
NM_145808chr752585 2504 2386 1164 996 11242 ----
NM_145891chr162526 140 --1390 --
NM_145892chr162526 140 --1390 --
NM_145893chr1631161 648 262 --1512 --
NM_147150chr962650 1516 1229 802 753 315 --13005 11602
NM_147175chrX21394 141 11974 12209 --
NM_147181chr441063 949 930 498 11255 11124 --
NM_147182chr441063 949 930 498 11255 11124 --
NM_147183chr441063 949 930 498 11255 11124 --
NM_147202chr952099 1817 1708 1106 112 1672 ----
NM_148414chr161470 ------
NM_148415chr161410 ------
NM_148416chr161387 ------
NM_148894chr42775 460 1433 ----
NM_148904chr1----2615 108 --
NM_148905chr1----2615 108 --
NM_148906chr1----2615 108 --
NM_148907chr1----2615 108 --
NM_148908chr1----2615 108 --
NM_148909chr1----2615 108 --
NM_148921chr1752270 2092 1841 899 148 --11930 --
NM_152227chr202588 492 ------
NM_152233chr1411119 ------
NM_152253chr2293950 3365 3197 3135 2988 2974 2620 277 40 --22799 1106 --
NM_152261chr1262162 1968 1611 392 274 72 12108 ----
NM_152265chr121345 1176 171 ----
NM_152278chrX----1617 --
NM_152282chr311275 11232 ----
NM_152283chr53788 414 198 ------
NM_152317chr122228 36 ------
NM_152330chr141177 11035 --1198
NM_152352chr1842548 1162 422 181 13047 12789 --
NM_152363chr19--1213 ----
NM_152373chr12262 195 1172 1646 --
NM_152384chr24724 463 286 97 --1515 --
NM_152407chr572594 2502 2396 2358 2342 2137 308 --22713 1127 --
NM_152409chr592909 2684 1139 847 839 752 745 698 366 1717 ----
NM_152414chr8----11060 --
NM_152417chr82943 198 --11115 --
NM_152424chrX44304 3556 653 227 --24515 1062 --
NM_152429chr1021564 558 --1973 1488
NM_152436chr121362 ----186
NM_152455chr1582633 2251 2235 999 791 562 500 375 --3984 854 697 --
NM_152470chr1854015 3787 3304 3026 745 ------
NM_152529chr2124412 3741 3578 3300 3215 1670 1458 984 927 857 592 465 11638 --1831
NM_152556chr731995 934 339 32033 492 125 ----
NM_152594chr1551923 702 540 429 201 ----11793
NM_152608chr142353 1643 554 207 --42064 1657 751 617 --
NM_152622chr54779 545 460 136 --1983 --
NM_152624chr576889 5880 5165 4555 2284 1323 357 --36380 2046 461 --
NM_152629chr963556 3006 2961 2899 2542 1510 31222 722 118 1183 22613 1346
NM_152630chrX61579 1402 1115 1090 1061 348 --2598 123 --
NM_152636chr1133070 2821 2534 11116 174 --
NM_152638chr1221256 398 ------
NM_152641chr1242844 2624 2507 253 --32299 2262 656 --
NM_152673chr364378 2986 1601 955 559 495 33909 3600 3469 53446 1664 1206 1177 83 11390
NM_152678chr332687 1010 127 --32322 1764 308 --
NM_152688chr61816 ------
NM_152699chr333132 3105 2757 189 43734 2956 2820 2370 --
NM_152707chr102890 62 ----1860
NM_152716chr1131502 233 139 --11211 1417
NM_152734chr6115422 5290 5150 5007 4173 3852 1780 1770 1304 697 192 34256 935 919 ----
NM_152737chr621958 1387 --1314 --
NM_152745chr71854 --11114 --
NM_152748chr7158 ------
NM_152754chr773088 2918 2571 1428 719 591 246 13175 ----
NM_152756chr564083 1609 1394 1388 1217 35 --43535 3226 714 681 --
NM_152758chr832937 1147 817 ------
NM_152765chr82477 430 2770 591 21749 800 --
NM_152774chr732254 1982 434 ----11881
NM_152780chrX31243 1234 232 11266 ----
NM_152787chrX62753 1263 1145 1009 772 372 --11117 1203
NM_152789chr72397 72 --1241 --
NM_152835chr152774 1875 840 832 735 ------
NM_152838chr2033412 3136 195 1156 ----
NM_152914chr1784410 4354 3586 3054 992 806 720 637 24363 236 23783 3648 --
NM_152919chr1943347 3099 2701 467 73478 3435 3387 2577 1141 283 170 ----
NM_152924chr1566863 6627 6287 5701 4567 2538 --12013 --
NM_152996chr151434 557 545 226 51 ------
NM_152999chr774920 4712 4359 3416 3276 2006 297 1688 ----
NM_153020chr641476 1043 419 252 1496 ----
NM_153029chr1673825 3724 3658 3487 3156 2730 525 13859 23357 932 1203
NM_153035chr173236 3213 2964 371 355 195 173 --1722 --
NM_153042chr611609 --11809 1732
NM_153181chr183533 479 64 ----1133
NM_153182chr323032 137 21250 544 ----
NM_153188chr5145715 5263 5002 4727 4239 3985 3963 3568 1091 533 398 98 58 21 11550 ----
NM_153207chr1243182 2607 386 46 11015 32663 2557 1509 24025 1472
NM_153208chr161824 ------
NM_153235chr692427 1900 1742 1726 804 703 566 438 339 ----11981
NM_153240chr33930 150 108 ------
NM_153244chr102725 169 --1303 --
NM_153252chrX1309 1412 151 1300
NM_153260chr1531483 101 29 ------
NM_153267chr92620 274 ------
NM_153331chr31512 ------
NM_153333chrX------1629
NM_153354chr51186 2396 297 ----
NM_153365chr4----1848 --
NM_153371chr131541 --31646 738 604 12274
NM_153377chr121145 ------
NM_153450chr113899 690 198 1226 ----
NM_153456chr13105853 5301 5081 4497 4337 4177 4142 2381 1894 1322 ------
NM_153487chr634842 3779 289 44025 3711 1702 1622 33603 3544 1733 --
NM_153607chr532728 1959 263 11088 ----
NM_153616chr1511477 11577 1173 21976 1586
NM_153617chr1511477 11577 1173 21976 1586
NM_153618chr1511477 11577 1173 21976 1586
NM_153619chr1562715 1110 1082 1050 528 374 12815 11411 23214 2824
NM_153634chr122593 30 11622 21607 1150 --
NM_153645chr222294 180 --12095 12614
NM_153649chr142186 1928 1842 1470 1729 11532 --
NM_153689chr241809 784 725 469 ----21661 939
NM_153690chr31617 ------
NM_153702chr4187 --1240 --
NM_153705chr1172293 1718 1710 1070 777 89 38 ------
NM_153706chr51190 ------
NM_153712chr273763 3373 2716 2554 1390 972 362 --22327 330 --
NM_153715chr711093 1249 ----
NM_153748chr122722 108 ------
NM_153759chr21787 1451 ----
NM_153810chr1084516 4470 3598 3351 3344 1715 1392 868 2247 55 34746 4058 451 --
NM_153828chr21862 ------
NM_153831chr83842 756 105 ------
NM_170606chr721348 1342 21644 735 ----
NM_170665chr1243314 3246 1846 1213 13019 14323 14040
NM_170692chr13823 725 349 186 1340 --
NM_170695chr182333 171 ------
NM_170706chr153787 2646 1721 1406 456 31537 1391 147 43870 3659 3639 2807 --
NM_170731chr113442 222 111 ------
NM_170732chr113442 222 111 ------
NM_170733chr113442 222 111 ------
NM_170734chr113442 222 111 ------
NM_170735chr113442 222 111 ------
NM_170751chr621402 195 ------
NM_170752chr621402 195 ------
NM_171998chrX62410 2363 2277 1861 921 718 2984 326 ----
NM_171999chr182599 90 1793 --1548
NM_172037chr831390 1266 563 ------
NM_172070chr242212 1773 1746 1387 ------
NM_172071chr196434 5379 5288 4822 2369 2269 1392 967 392 26581 1680 24750 2332 --
NM_172103chr642239 1843 1664 1007 1181 ----
NM_172105chr642239 1843 1664 1007 1181 ----
NM_172127chr432014 1707 1490 --22049 233 --
NM_172128chr431970 1663 1446 --22005 189 --
NM_172159chr33885 817 494 11530 ----
NM_172160chr33885 817 494 11530 ----
NM_172169chr1051674 1667 1540 768 123 31832 1435 696 ----
NM_172170chr1051674 1667 1540 768 123 31832 1435 696 ----
NM_172171chr1051674 1667 1540 768 123 31832 1435 696 ----
NM_172173chr1051674 1667 1540 768 123 31832 1435 696 ----
NM_172196chr2--1167 ----
NM_172344chr22269 187 --21469 90 --
NM_172373chr131484 ----11297
NM_173039chr111250 ------
NM_173054chr72254 74 ------
NM_173074chr21233 ------
NM_173082chr611527 ------
NM_173083chr12429 26 ----11235
NM_173198chr933011 2652 860 ------
NM_173200chr933011 2652 860 ------
NM_173207chr182333 171 ------
NM_173208chr182333 171 ------
NM_173209chr182333 171 ------
NM_173210chr182333 171 ------
NM_173211chr182333 171 ------
NM_173214chr16158276 8257 6138 5964 5773 3293 2854 2795 2386 1251 1201 1164 974 778 141 27782 6506 --15223
NM_173354chr2132080 1419 40 31786 534 349 ----
NM_173463chr463439 2783 1215 638 234 94 11262 24414 2984 --
NM_173468chr4125864 5574 5557 4968 4837 4442 2401 2283 2112 1674 752 723 1857 23740 1816 --
NM_173469chr1531323 390 162 --190 --
NM_173473chr1032529 2179 970 1526 11033 12662
NM_173495chrX32043 830 282 22067 1681 --2762 352
NM_173497chr1041103 1027 449 269 ------
NM_173511chr223564 2582 11199 23353 1539 --
NM_173515chr6158 ------
NM_173519chr852019 1913 1401 321 135 1762 1835 --
NM_173545chr241926 1874 1624 462 ------
NM_173552chr32912 623 --12229 --
NM_173576chr101925 --1248 --
NM_173582chr1195057 4651 4204 1478 1108 1008 562 237 61 11673 --1947
NM_173602chr1241180 1033 253 107 12697 23672 21 --
NM_173607chr1422132 1670 1754 11627 --
NM_173609chr151611 ------
NM_173631chr1921205 948 ----1163
NM_173642chr1128817 8612 8501 8356 8238 7783 6944 6068 5715 2927 2904 1901 28648 6626 1402 --
NM_173645chr22467 45 ------
NM_173665chr52587 90 --1640 --
NM_173667chr531956 1932 827 1382 31608 960 765 --
NM_173694chrX82551 2474 2466 1964 1957 841 93 62 --11978 12572
NM_173808chr1134069 3940 3890 3867 3813 3003 2988 1573 1510 1469 1453 1045 184 ------
NM_173822chr211698 1419 ----
NM_173824chr3------1191
NM_173825chr363113 2465 2131 1974 1177 807 ----22802 298
NM_173827chr452832 1055 750 632 556 13194 31253 1118 947 --
NM_173829chr595525 4623 4063 4037 3980 1947 1415 813 589 34348 1404 733 15535 --
NM_173848chr81301 ------
NM_173851chr841440 1282 1158 908 12741 --13767
NM_173854chr132371 2271 1749 22336 1671 ----
NM_174886chr182333 171 ------
NM_174900chr431214 989 352 --1857 --
NM_174911chr873612 3173 2901 2780 2707 852 641 ------
NM_174934chr1132920 2795 27 ----13454
NM_175566chr112137 121 ------
NM_175610chr1541351 1097 190 183 --1103 --
NM_175624chr12127756 7119 6800 6440 5774 3063 3040 2454 1991 778 609 454 17237 27139 6940 --
NM_175625chr12127756 7119 6800 6440 5774 3063 3040 2454 1991 778 609 454 17237 27139 6940 --
NM_175629chr21787 1451 ----
NM_175736chr12106639 6320 5981 5828 5159 4875 1428 982 685 197 47555 7428 5110 635 ----
NM_175767chr561879 1706 1673 1547 595 68 11231 11386 --
NM_175854chr1311042 --164 12807
NM_175866chr131405 1257 1000 1382 1566 --
NM_175876chr172716 2639 2009 1995 960 269 90 21833 820 32214 391 277 --
NM_175884chr7--193 ----
NM_175920chr51203 1627 ----
NM_176814chr741423 1293 226 137 ------
NM_177414chr121744 1619 ----11357
NM_177424chr11518 --21868 320 --
NM_177438chr1464118 3631 3536 1462 1126 445 44171 3583 1043 875 23968 806 23390 2740
NM_177452chr1441600 976 697 85 11941 ----
NM_177553chr11--1877 ----
NM_177559chr2041158 1142 436 242 ------
NM_177560chr2041158 1142 436 242 ------
NM_177952chr141127 ------
NM_177966chr331930 1483 401 21401 1376 2599 464 --
NM_177968chr242139 817 659 490 --1204 --
NM_177974chr1532194 1961 484 --1547 --
NM_177985chr222053 908 ------
NM_177989chr3--1365 ----
NM_177996chr2043254 950 430 334 12759 --1794
NM_178006chr1321630 200 ----21972 852
NM_178007chr1321630 200 ----21972 852
NM_178011chr1073077 2902 2501 2445 1167 645 373 --1728 --
NM_178033chr1153 ------
NM_178042chr3--1365 ----
NM_178126chr1731733 1658 1546 --41882 898 837 569 --
NM_178140chr542218 2029 1861 111 1742 11855 --
NM_178150chr101279 ------
NM_178151chrX97301 7227 7022 6801 6286 6166 1706 1260 815 12783 35194 5051 1733 1662
NM_178152chrX97301 7227 7022 6801 6286 6166 1706 1260 815 12783 35194 5051 1733 1662
NM_178153chrX97301 7227 7022 6801 6286 6166 1706 1260 815 12783 35194 5051 1733 1662
NM_178313chr231852 399 241 1383 1288 --
NM_178423chr721066 224 ------
NM_178425chr721066 224 ------
NM_178426chr152115 1966 1807 1703 50 ------
NM_178427chr142015 1866 1707 1603 ------
NM_178505chr10113602 3452 3328 3206 2334 1244 927 653 289 195 55 1623 --13293
NM_178539chr1241891 1806 1354 437 ------
NM_178554chr373425 3397 3005 2881 2869 772 705 ----11363
NM_178584chr221033 194 ------
NM_178585chr433242 3106 2267 11314 21212 1016 --
NM_180989chr1352082 1793 1549 675 137 ----22063 2056
NM_181077chr1531933 787 462 ----1390
NM_181332chrX62424 2246 1077 598 397 201 12124 11939 --
NM_181339chr12968 234 1212 ----
NM_181353chr201592 ------
NM_181354chr83650 545 358 11305 1136 --
NM_181358chr183833 2723 1664 1347 882 280 181 124 1564 ----
NM_181443chr2042783 1094 1014 816 --11905 --
NM_181453chr241685 1078 684 481 1582 ----
NM_181471chr7128 ------
NM_181481chr1876566 5563 2619 2447 2015 1714 1171 34756 4436 1637 11020 --
NM_181482chr1876566 5563 2619 2447 2015 1714 1171 34756 4436 1637 11020 --
NM_181483chr1876566 5563 2619 2447 2015 1714 1171 34756 4436 1637 11020 --
NM_181504chr563968 2942 2892 1443 1368 1017 21352 100 12686 --
NM_181523chr563968 2942 2892 1443 1368 1017 21352 100 12686 --
NM_181524chr563968 2942 2892 1443 1368 1017 21352 100 12686 --
NM_181645chr113697 516 223 ------
NM_181659chr2032870 922 51 11049 --12975
NM_181659chr2032870 922 51 11049 --12975
NM_181661chr81104 ------
NM_181672chrX41850 1818 1612 1386 ----12048
NM_181673chrX41850 1818 1612 1386 ----12048
NM_181712chr131715 388 205 1455 ----
NM_181714chr651936 1575 1520 721 284 11853 ----
NM_181723chr872099 1722 885 553 512 296 193 12189 11968 --
NM_181762chrX181 1453 ----
NM_181777chrX181 1453 ----
NM_181787chr873730 2401 1557 1366 1300 1030 653 11170 12480 12616
NM_181836chr532139 779 726 ----1708
NM_181861chr1242697 2146 515 123 --31009 842 711 --
NM_181868chr1242697 2146 515 123 --31009 842 711 --
NM_181869chr1242782 2231 600 208 174 31094 927 796 --
NM_181876chr442669 1851 789 281 1119 11716 --
NM_181886chr41996 ------
NM_181887chr41996 ------
NM_181888chr41996 ------
NM_181889chr41996 ------
NM_181890chr41996 ------
NM_181891chr41996 ------
NM_181892chr411043 ------
NM_181893chr41996 ------
NM_182314chrX11752 21668 679 1174 --
NM_182485chr452880 2563 668 437 155 12618 ----
NM_182515chr19106387 5533 5102 4663 4389 4124 1984 1789 1542 1097 --76335 5353 5300 5165 4248 1852 1305 11579
NM_182524chr41241 --1609 --
NM_182540chrX1614 ------
NM_182565chr171233 ------
NM_182607chrX31634 1174 406 --2603 469 --
NM_182609chr1941309 1223 1092 351 --11043 --
NM_182641chr1721581 1366 --11605 1680
NM_182643chr852391 2043 2020 1981 109 --1135 --
NM_182646chr452880 2563 668 437 155 12618 ----
NM_182648chr143503 179 122 2711 238 ----
NM_182691chr731070 370 89 ------
NM_182692chr731070 370 89 ------
NM_182715chr71442 1851 ----
NM_182734chr2062629 2037 1059 738 313 25 ----12330
NM_182763chr122724 802 21917 699 ----
NM_182765chr1052204 2050 558 484 405 ------
NM_182767chr1221774 524 11486 ----
NM_182798chr521001 307 ------
NM_182799chr521001 307 ------
NM_182801chr521001 307 ------
NM_182830chr1421805 757 21962 333 1267 1912
NM_182848chr132575 222 11446 ----
NM_182896chr33736 554 415 --11614 --
NM_182898chr7106581 6408 4940 4908 2588 1611 1099 1090 1060 514 14822 45895 4159 1972 1406 --
NM_182899chr7106581 6408 4940 4908 2588 1611 1099 1090 1060 514 14822 45895 4159 1972 1406 --
NM_182907chr611532 ------
NM_182948chr153163 2432 2082 2005 1117 ------
NM_182964chr1132650 2235 212 ----1568
NM_182972chr162812 2610 1771 933 846 730 ------
NM_182975chr12209 38 ------
NM_182978chr183713 608 518 --1244 --
NM_183004chr1473563 3384 2949 2846 907 743 112 23304 2808 ----
NM_183050chr632414 493 276 12171 5818 684 478 343 253 --
NM_183078chr683741 3655 3098 2692 1320 880 473 162 22532 541 32634 1076 943 1601
NM_183227chr661434 1110 1055 476 144 31 1334 ----
NM_183234chr1511517 1581 ----
NM_183235chr1511517 1581 ----
NM_183236chr1511517 1581 ----
NM_183238chr1243004 2886 1148 512 1406 11537 1704
NM_183353chrX1399 ------
NM_183376chr1542642 966 857 839 1273 1580 --
NM_183380chr63767 324 287 1119 --1969
NM_183387chr141651 1327 --249 22
NM_183398chr5----21229 989 1236
NM_183399chr5----21229 989 1236
NM_183400chr5----21229 989 1236
NM_183401chr5----21229 989 1236
NM_183419chr851460 1320 431 340 62 ------
NM_194247chr274094 3341 2806 1487 314 66 21 24428 1285 54513 3980 1716 1237 160 --
NM_194278chr1483674 2680 1404 1224 1191 1008 363 292 23130 2955 12886 --
NM_194282chr473031 2840 2832 2771 2705 1985 1015 32803 934 413 21214 1080 --
NM_194283chr543009 1304 302 106 23894 1478 ----
NM_194291chr852832 1160 1140 736 655 ------
NM_194301chr1431046 971 438 ------
NM_194314chr1115372 5279 5218 4963 4288 2095 1939 1832 1593 1207 1188 ------
NM_194317chr252603 2305 2278 970 90 ------
NM_194328chr952185 2061 1301 653 151 2971 351 1302 --
NM_194329chr952185 2061 1301 653 151 2971 351 1302 --
NM_194330chr952185 2061 1301 653 151 2971 351 1302 --
NM_194332chr952185 2061 1301 653 151 2971 351 1302 --
NM_194356chr121559 12261 2761 622 1347
NM_194434chr1852232 1299 1198 658 459 15258 55635 5436 4528 4274 722 --
NM_194449chr181745 ----1286
NM_194454chr741757 1425 1360 430 11685 11287 --
NM_194455chr741757 1425 1360 430 11685 11287 --
NM_194456chr741757 1425 1360 430 11685 11287 --
NM_194463chrX4954 920 394 140 1821 ----
NM_197941chr562623 2537 2283 651 527 485 --1706 --
NM_197968chr13------1269
NM_197970chr231117 1027 151 ------
NM_198081chr642249 1876 381 223 --1643 12778
NM_198123chr831634 435 332 1195 ----
NM_198124chr831634 435 332 1195 ----
NM_198128chr183515 78 61 12160 12303 --
NM_198158chr362415 2263 1919 704 534 195 --11122 --
NM_198159chr362415 2263 1919 704 534 195 --11122 --
NM_198177chr362415 2263 1919 704 534 195 --11122 --
NM_198178chr362415 2263 1919 704 534 195 --11122 --
NM_198181chr1562922 2695 2420 2265 1941 962 --22766 736 --
NM_198217chr133414 223 55 ------
NM_198218chr133414 223 55 ------
NM_198219chr133414 223 55 ------
NM_198220chr20143 ------
NM_198225chr1051327 587 407 218 74 ----11569
NM_198261chr123726 607 271 --1613 1216
NM_198262chr123726 607 271 --1613 1216
NM_198268chr183833 2723 1664 1347 882 280 181 124 1564 ----
NM_198269chr183833 2723 1664 1347 882 280 181 124 1564 ----
NM_198270chrX103524 3508 3198 3139 2819 2666 1311 527 443 208 --11343 --
NM_198279chrX3993 815 32 --3808 213 183 --
NM_198281chr422510 926 1609 1120 --
NM_198320chr1295131 4888 4464 4225 4014 3828 1834 737 67 24191 911 15091 11635
NM_198353chr41420 --150 --
NM_198400chr1562713 2655 1177 1147 950 486 22485 969 ----
NM_198404chr132799 724 ----1108
NM_198428chr7----2798 731 --
NM_198450chrX61508 885 804 157 36 24 --21702 1571 --
NM_198465chrX3929 590 344 --1186 --
NM_198503chr142205 724 623 340 11539 ----
NM_198513chr831606 664 473 ----1166
NM_198581chr2176714 6683 6345 6030 5541 5111 4977 4914 4805 4774 4550 1488 1312 1151 894 498 81 26803 6133 35739 5274 1242 16547
NM_198714chr12517 496 1403 ----
NM_198715chr1115903 5712 4715 4040 3840 2107 2063 1523 1310 1095 1032 --46148 1874 795 477 11921
NM_198793chr384015 3813 3020 2713 2676 2599 1332 926 ------
NM_198798chr202360 142 ------
NM_198829chr731406 410 332 1135 ----
NM_198859chr333421 3393 148 14170 13898 --
NM_198896chr1131616 1497 1365 31850 545 522 171 --
NM_198900chr12106639 6320 5981 5828 5159 4875 1428 982 685 197 47555 7428 5110 635 ----
NM_198904chr561990 1523 777 487 312 277 11693 ----
NM_198990chr743208 894 740 717 22293 911 ----
NM_199000chr731945 1840 1807 --1717 --
NM_199003chr821081 54 ------
NM_199050chr2133916 3779 637 43626 3337 2595 241 ----
NM_199051chr12295 46 ------
NM_199072chr722717 2244 ------
NM_199131chr1042517 2282 1126 228 23347 832 13043 --
NM_199132chr1931535 812 510 12145 21732 1598 --
NM_199160chr961887 1509 1484 420 301 248 ------
NM_199169chr2031127 572 272 2803 750 --13332
NM_199170chr2031127 572 272 2803 750 --13332
NM_199171chr2031127 572 272 2803 750 --13332
NM_199188chr1253500 2790 1552 1206 478 13435 12529 --
NM_199190chr1253500 2790 1552 1206 478 13435 12529 --
NM_199229chr251541 1456 528 326 184 ------
NM_199320chr442816 2677 1970 103 11844 11987 --
NM_199320chr442816 2677 1970 103 11844 11987 --
NM_199324chr423140 2928 13437 --2842 422
NM_199327chr411177 --1336 --
NM_199344chr1--192 ----
NM_199355chr1621587 595 ------
NM_199436chr262983 2899 2039 967 763 99 3591 81 25 1451 --
NM_199454chr11784 --13701 24206 464
NM_199462chr164890 4359 4274 3880 1977 507 13405 44753 3954 352 89 --
NM_199464chr133598 506 130 ------
NM_199478chrX3657 423 263 --11575 --
NM_199482chr262044 1650 1547 842 586 257 1818 ----
NM_199487chr2021132 291 2920 84 11242 --
NM_199511chr3392 56 42 --2799 682 --
NM_199512chr3392 56 42 --2799 682 --
NM_201266chr232524 2360 62 12294 ----
NM_201269chr11936 --21320 127 --
NM_201279chr232524 2360 62 12294 ----
NM_201413chr213843 788 225 ----1901
NM_201414chr213843 788 225 ----1901
NM_201437chr831079 1064 408 ------
NM_201438chr121104 ----1340
NM_201532chr111570 ------
NM_201533chr111570 ------
NM_201545chr161199 1182 457 449 297 21 1527 ----
NM_201548chr221488 1407 --11186 --
NM_201559chr651933 1016 786 575 116 162 ----
NM_201570chr1041649 219 195 92 --1687 --
NM_201571chr1041649 219 195 92 --1687 --
NM_201572chr1041649 219 195 92 --1687 --
NM_201590chr1041649 219 195 92 --1687 --
NM_201591chr441850 1430 1307 474 --1423 11663
NM_201592chr441850 1430 1307 474 --1423 11663
NM_201593chr1041649 219 195 92 --1687 --
NM_201596chr1041649 219 195 92 --1687 --
NM_201597chr1041649 219 195 92 --1687 --
NM_201613chr125610 580 188 134 38 ------
NM_201624chr131217 1188 1065 --4825 494 360 298 --
NM_201627chr5366 57 46 ------
NM_201999chr451231 1021 276 214 180 ------
NM_203282chr1941723 646 477 74 --11780 --
NM_203301chr144685 657 524 415 ------
NM_203304chr19--1151 ----
NM_203307chr1941734 1239 683 162 --21626 1436 --
NM_203327chr2063971 3730 1822 1380 891 295 --1925 --
NM_203341chr11689 1763 1129 --
NM_203349chr1551701 1357 531 502 461 ----1426
NM_203350chr111394 11631 ----
NM_203351chr1752455 2436 1586 316 180 11966 ----
NM_203354chr14181 --1767 --
NM_203355chr14181 --1767 --
NM_203356chr14181 --1767 --
NM_203364chr112788 183 ------
NM_203379chr103861 742 710 ----11016
NM_203380chr103861 742 710 ----11016
NM_203382chr541498 540 436 429 --1491 1526
NM_203391chrX31766 1515 1313 1188 ----
NM_203394chr1252673 2649 1691 842 408 22199 1702 1527 --
NM_203399chr11813 ------
NM_203401chr11813 ------
NM_203403chr941227 321 238 214 ------
NM_203406chr562498 2018 918 891 732 657 ----1953
NM_203446chr2172942 2500 2369 2297 1904 492 423 22042 803 ----
NM_203459chr162539 2423 995 576 548 337 22145 66 ----
NM_203463chr254511 3935 1177 948 480 --23005 1950 --
NM_205768chr142085 1432 714 311 1798 ----
NM_205860chr143028 2396 777 415 --12905 12252
NM_205861chr121640 644 ------
NM_206594chr1113451 2949 2888 2718 2447 1284 1251 1244 947 817 115 ------
NM_206595chr1113451 2949 2888 2718 2447 1284 1251 1244 947 817 115 ------
NM_206853chr683945 3734 3384 3164 2779 842 236 177 --14079 13319
NM_206854chr695206 4995 4645 4425 4040 2103 1497 1438 631 --25340 791 14580
NM_206855chr696171 5960 5610 5390 5005 2462 2403 1596 591 --26305 1756 15545
NM_206866chr2182789 2396 2280 1058 1047 824 676 587 2386 356 22700 316 --
NM_206876chr241371 665 565 173 1484 12558 --
NM_206909chr8157935 7563 6426 5777 5719 5132 2982 2212 1886 1589 1543 1324 1063 813 788 47112 6669 5911 1687 27066 2270 17410
NM_206927chr113760 161 120 ------
NM_206928chr113760 161 120 ------
NM_206929chr113760 161 120 ------
NM_206930chr113760 161 120 ------
NM_207012chr10103470 3240 3166 2368 1160 1095 804 672 658 119 22515 469 23246 2582 --
NM_207015chr342339 910 641 130 11963 ----
NM_207043chr122236 569 --1532 --
NM_207044chr122236 569 --1532 --
NM_207047chr122236 569 --1532 --
NM_207121chr20--143 1510 --
NM_207123chr41706 --1636 --
NM_207292chr382999 2860 2821 2525 1069 957 830 188 --13348 --
NM_207293chr382999 2860 2821 2525 1069 957 830 188 --13348 --
NM_207294chr382999 2860 2821 2525 1069 957 830 188 --13348 --
NM_207295chr382999 2860 2821 2525 1069 957 830 188 --13348 --
NM_207296chr382999 2860 2821 2525 1069 957 830 188 --13348 --
NM_207297chr383024 2885 2846 2550 1094 982 855 213 --13373 --
NM_207299chr93908 800 427 1823 ----
NM_207303chr1073853 3408 2962 2935 1482 1424 806 12747 23712 2839 --
NM_207304chr1382568 2442 2106 1788 1769 900 457 416 1800 21023 224 --
NM_207317chr5------1306
NM_207361chr13106284 6166 5887 5478 5231 4390 3961 1799 1088 854 21490 933 25753 4742 11570
NM_207372chr1032429 1781 295 1713 ----
NM_207381chr1541119 896 800 42 11036 1271 --
NM_207390chr19273 65 --2849 708 --
NM_207396chr141655 1633 1251 165 --4668 532 364 228 --
NM_207406chr486299 5147 4959 4080 2475 1477 1275 223 31339 1193 566 35166 5012 582 --
NM_207429chr112461 33 1126 22200 524 12086
NM_207520chr21862 ------
NM_207521chr21862 ------
NM_207578chr11251 ------
NM_207660chr1431679 1201 347 21594 72 1333 --
NM_207661chr1431679 1201 347 21594 72 1333 --
NM_207662chr1431679 1201 347 21594 72 1333 --
NM_212464chr1551672 1663 1546 267 221 21888 680 --1142
NM_212543chr31101 ------
NM_212559chrX2612 209 ------
NM_213589chr2114746 4633 3735 2039 1803 1404 1210 990 735 724 45 34971 3721 1101 24166 1272 11620
NM_213594chr1231255 990 930 ------
NM_213609chr33937 282 165 ----1894
NM_213651chr131798 479 460 ------