TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-21-3p
miRNA Sequence: CAACACCAGUCGAUGGGCUGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_004491chr1954325 4253 1543 1157 1147 ----14131
NM_006924chr174949 814 794 302 --34186 4144 2844 --
NM_024947chr349289 7348 3381 768 15975 59193 8910 7238 6160 5852 --