TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-21-5p
miRNA Sequence: UAGCUUAUCAGACUGAUGUUGA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000037chr811554 ------
NM_000055chr32467 290 ------
NM_000070chr15----1491 --
NM_000084chrX126473 6283 6050 5906 5459 2375 2349 1194 1150 1104 947 200 15002 --1709
NM_000092chr234264 3067 1538 14009 23446 1657 --
NM_000109chrX22238 694 ------
NM_000125chr653997 3926 1705 408 381 1333 1789 11518
NM_000139chr1142269 761 689 265 1641 ----
NM_000176chr522610 2435 --13050 --
NM_000208chr1974468 4313 4022 3388 1627 481 370 --23675 1309 11053
NM_000212chr1742106 2059 1985 1613 12476 2888 243 --
NM_000214chr2031548 298 119 --11625 11241
NM_000216chrX43602 2726 239 42 --22518 675 --
NM_000217chr1265132 1367 1308 941 863 750 --1935 --
NM_000222chr432062 2052 523 --2796 586 --
NM_000232chr413153 11081 23222 2207 --
NM_000259chr1575146 4908 4617 4586 2354 1592 1462 --55340 2347 687 376 180 26203 5182
NM_000286chr17----2805 645 --
NM_000289chr12160 --1295 --
NM_000314chr1011122 --1436 12013
NM_000321chr1321624 1476 ------
NM_000328chrX1138 ------
NM_000332chr666202 5476 4552 2039 1231 1097 170 ----
NM_000340chr331362 1244 613 1169 2988 444 --
NM_000362chr2232519 2380 46 ----22392 1039
NM_000388chr331278 941 795 ----1833
NM_000393chr2128 --22046 701 --
NM_000397chrX2719 390 12150 12541 1165
NM_000408chr222956 448 --33136 2334 2264 --
NM_000430chr1763271 2400 1138 747 131 76 ------
NM_000461chr362979 1689 1579 1504 921 800 --34638 4241 3661 --
NM_000493chr631057 974 87 2349 131 ----
NM_000495chrX1439 11012 ----
NM_000508chr41890 ------
NM_000551chr341906 500 301 124 11565 11695 11344
NM_000555chrX96682 6216 5202 4949 2853 2569 2215 1994 737 --11638 16527
NM_000572chr14837 392 251 174 ----1308
NM_000582chr4--1371 ----
NM_000596chr71171 ------
NM_000615chr1111100 ----1513
NM_000618chr1266545 6304 5572 4054 4029 1642 --2615 101 24542 4510
NM_000618chr1266545 6304 5572 4054 4029 1642 --2615 101 24542 4510
NM_000633chr1854991 4980 4916 4818 1952 1726 ----
NM_000719chr1286103 5447 4747 2673 2080 1817 1666 686 12679 ----
NM_000745chr152734 119 182 ----
NM_000780chr81246 ------
NM_000791chr542861 866 231 26 12491 ----
NM_000800chr521479 127 ----11603
NM_000809chr498684 6977 5730 5616 3523 3478 1444 1024 131 --13158 --
NM_000813chr544047 3581 1587 1473 11549 --23502 1619
NM_000814chr1544048 3681 1223 540 ----1421
NM_000817chr21790 ------
NM_000826chr442278 1904 1892 1751 ------
NM_000831chr176193 4281 4146 2198 1976 1781 737 --11917 --
NM_000833chr161419 11438 ----
NM_000839chr3------1389
NM_000844chr33986 863 197 ------
NM_000859chr531596 491 484 --1305 --
NM_000868chrX12301 --12189 --
NM_000891chr171158 1697 --1231
NM_000901chr442551 2062 1629 34 --11585 --
NM_000933chr20--1493 1296 --
NM_000940chr7173 ------
NM_000961chr2063762 3689 3492 3099 3012 2756 ----1374
NM_000963chr152480 1995 913 703 197 ------
NM_000965chr32861 317 ------
NM_001001349chr1711520 ----11334
NM_001001396chr174295 3552 2807 1481 1186 470 150 --23945 2842 22897 662
NM_001001419chr574909 4098 3925 737 616 381 81 ----14467
NM_001001420chr574909 4098 3925 737 616 381 81 ----14467
NM_001001433chr201773 --2669 299 --
NM_001001481chr882653 1367 1046 1001 914 277 107 52 1878 ----
NM_001001483chr11--1364 ----
NM_001001484chr10------22278 2040
NM_001001664chr25661 479 426 346 81 22627 520 13667 --
NM_001001711chr111896 ----161
NM_001001890chr2153734 3534 2691 638 583 ----13679
NM_001001974chr1022166 1488 --1137 11779
NM_001002255chr6--1344 ----
NM_001002257chr242775 2592 720 66 --23377 3299 --
NM_001002838chrX11342 --1287 --
NM_001002860chr1434663 3279 595 11522 24172 3442 11790
NM_001002919chr21133 ------
NM_001003652chr18108373 7874 7456 7118 6303 6210 3419 2299 2022 1356 25605 3283 18436 21972 1341
NM_001003674chr1875549 1644 1326 907 859 120 106 16813 25001 1772 --
NM_001003675chr1875549 1644 1326 907 859 120 106 16813 25001 1772 --
NM_001003679chr142174 1825 1664 441 --12057 --
NM_001003712chr1284064 3944 3730 3340 3221 3176 939 833 22624 203 32857 1063 626 --
NM_001004051chrX1239 1269 ----
NM_001004065chr953768 3519 3102 1481 1208 ------
NM_001004317chr633601 3300 1571 13222 1676 --
NM_001004342chr165682 5034 4432 1060 1037 73 14696 ----
NM_001004360chr23783 442 407 11865 21806 1461 --
NM_001004419chr1274594 4310 4117 2871 2798 612 142 ------
NM_001004431chr17--1228 1173 --
NM_001005386chr211589 --31761 1673 282 --
NM_001005474chr341389 1038 593 101 ------
NM_001005502chr1294693 4443 4070 3278 2061 1047 1007 355 158 --14475 --
NM_001005505chr321558 119 ------
NM_001005609chrX13804 13525 ----
NM_001006945chr11558 ----165
NM_001006946chr22707 584 1576 ----
NM_001007024chr1744298 3682 3074 161 ------
NM_001007025chr1744298 3682 3074 161 ------
NM_001007075chr451141 1023 690 397 250 --11000 --
NM_001007098chr1191 1604 ----
NM_001007102chr651418 1386 1209 451 179 1233 11586 --
NM_001007214chr141317 1174 711 76 1355 ----
NM_001007246chr212157 61 1211 --11800
NM_001007559chr1841482 1363 146 127 ------
NM_001007794chr11720 ------
NM_001008239chr1853813 3119 2810 2709 1095 ------
NM_001008405chr7186 --1125 --
NM_001008408chr775403 5133 4979 4574 2259 1899 29 34142 1468 1225 ----
NM_001008495chr832270 1533 845 ------
NM_001008539chr843767 2021 976 934 --24368 569 11782
NM_001008540chr21494 152 ----
NM_001008738chr542265 2228 792 721 12846 12450 --
NM_001008895chr1311148 --11385 --
NM_001008925chr453338 2749 2571 1382 597 21420 1349 --12938
NM_001009554chr423355 802 1876 24692 1313 --
NM_001009554chr423355 802 1876 24692 1313 --
NM_001009555chr441754 1117 549 111 ----1210
NM_001009571chr761369 1274 1239 1168 667 134 ------
NM_001009881chr1--1635 ----
NM_001009882chr1--1635 ----
NM_001009894chr1271207 1171 443 320 226 217 207 --1599 --
NM_001009899chr341608 1009 391 372 ----12553
NM_001010867chr1126648 6112 5866 5587 4815 4240 2211 1273 1089 829 569 368 ------
NM_001010888chrX34054 1321 1052 14330 13010 --
NM_001010891chr5106772 5363 4941 4794 4763 4395 2414 1333 820 565 26477 2401 11302 --
NM_001010895chr931554 540 259 11681 ----
NM_001010927chr61598 2411 155 ----
NM_001010984chr132507 2384 1696 12357 12003 --
NM_001011513chr473144 2939 2567 2506 1362 967 524 --43991 3259 1271 235 1950
NM_001011515chr42426 352 --1311 --
NM_001011516chr42426 352 --1311 --
NM_001011658chrX42089 1968 1603 722 171 1578 --
NM_001011666chr796438 6280 6008 5719 5075 4345 953 899 633 15026 26080 5844 --
NM_001011708chr222936 2651 1989 ----
NM_001011722chr11397 ------
NM_001011722chr11397 ------
NM_001012267chr951871 1587 1551 1336 1230 --1232 --
NM_001012393chr1153154 2002 1612 1188 345 14528 14212 --
NM_001012398chr162883 291 ------
NM_001012420chr1552950 2856 2166 451 144 --2780 345 12715
NM_001012423chr1552950 2856 2166 451 144 --2780 345 12715
NM_001012751chr103686 632 149 ------
NM_001013031chr103835 445 300 1490 ----
NM_001013399chr6----2431 147 --
NM_001013406chr71572 --11326 21277 501
NM_001013438chr31823 170 ----
NM_001013620chr1297787 7056 6663 6030 2964 2320 2002 1634 1140 18340 26687 303 --
NM_001013632chr1177 ------
NM_001014434chr13844 715 287 ------
NM_001014797chr1096855 6138 5931 5098 5000 2793 2508 472 237 --35282 2571 1787 --
NM_001015045chr432535 1634 724 32165 2035 1663 --11939
NM_001015048chr1442982 1167 742 718 1797 --12572
NM_001015049chr1442982 1167 742 718 1797 --12572
NM_001015877chrX62364 2345 2029 374 338 162 1293 21004 617 1611
NM_001017371chr22483 69 ------
NM_001017395chr343583 3165 2340 1284 12301 ----
NM_001017440chr747925 3160 1822 1769 22717 1036 26871 874 --
NM_001017923chr143667 390 219 ------
NM_001017926chr851746 1501 1267 1221 417 ------
NM_001017995chr574407 4258 4041 3769 3592 3345 1281 14789 ----
NM_001018054chr121062 450 ------
NM_001018065chr9115693 5220 4512 4075 2034 1860 1845 1198 984 970 476 --14111 11510
NM_001018066chr9115693 5220 4512 4075 2034 1860 1845 1198 984 970 476 --14111 11510
NM_001018067chr1104642 4586 3853 3743 3714 3635 3521 3479 1213 938 --23243 894 --
NM_001018068chr1104642 4586 3853 3743 3714 3635 3521 3479 1213 938 --23243 894 --
NM_001018069chr1104642 4586 3853 3743 3714 3635 3521 3479 1213 938 --23243 894 --
NM_001018074chr522610 2435 --13050 --
NM_001018075chr522610 2435 --13050 --
NM_001018076chr522610 2435 --13050 --
NM_001018077chr522610 2435 --13050 --
NM_001020658chr11620 ------
NM_001020658chr11620 ------
NM_001023567chr154783 714 453 144 --1345 12102
NM_001024094chr522610 2435 --13050 --
NM_001024649chr562986 1933 991 973 829 606 ------
NM_001024668chr121874 ------
NM_001024807chr191241 ------
NM_001024847chr34983 708 142 129 --21765 212 --
NM_001024855chr34679 638 617 373 1409 ----
NM_001024956chr1175167 4825 4476 4359 1998 1557 1432 24512 330 15120 35178 4255 1085
NM_001025068chr321398 324 21676 342 ----
NM_001025069chr321398 324 21676 342 ----
NM_001025076chr1055798 5387 1549 1318 804 --1964 --
NM_001025077chr1067156 6745 5043 2907 2676 2162 --12322 --
NM_001025079chr374073 3533 3414 3119 2806 1296 162 13989 24152 3087 12753
NM_001025105chr511271 11358 ----
NM_001025266chr364722 4466 4372 4158 1857 872 1625 ----
NM_001025356chr1243010 2853 2539 913 183 ----
NM_001025580chrX74208 4001 3578 2993 1102 1012 830 13909 ----
NM_001025616chr42604 450 ----1368
NM_001029858chr61569 --13312 --
NM_001029863chr642612 864 828 383 23151 732 ----
NM_001029875chr553008 2697 2484 2110 496 1945 ----
NM_001030007chr1663918 2894 2654 1350 570 314 13776 ----
NM_001030055chr1454481 3464 1492 1206 184 24394 3197 --14515
NM_001031684chr221261 586 1503 11498 --
NM_001031685chr13874 639 257 1600 ----
NM_001031695chr2284876 4571 4012 3357 1816 1281 932 819 14802 --13712
NM_001031696chr191294 ------
NM_001031700chr442390 1691 1629 294 12496 ----
NM_001031723chr4157 ------
NM_001031732chr433536 2373 2332 22314 1163 ----
NM_001031804chr1654118 3893 3436 662 37 --43604 3114 3077 1702 13008
NM_001031812chr532173 1959 541 ------
NM_001032288chr2021576 1042 --1195 --
NM_001032393chrX1192 ------
NM_001033047chr422076 1917 1486 ----
NM_001033049chr212916 331 --22297 2040 --
NM_001033057chr342144 1742 547 391 ------
NM_001033112chr52853 819 ------
NM_001033503chr51177 ------
NM_001033566chr17166 1367 ----
NM_001033568chr17166 1367 ----
NM_001033578chr842319 2231 308 37 11965 21922 216 --
NM_001033925chr1031387 1368 183 --2413 39 --
NM_001034841chr1684292 3983 3645 1661 1639 1467 1087 979 --15069 11097
NM_001034852chr1441533 621 249 110 11286 ----
NM_001034915chr831501 343 268 21225 198 ----
NM_001034954chr1042918 1983 985 850 1481 ----
NM_001034955chr1042918 1983 985 850 1481 ----
NM_001034956chr1042918 1983 985 850 1481 ----
NM_001034957chr1042918 1983 985 850 1481 ----
NM_001035260chr1051583 404 354 317 142 11352 ----
NM_001037164chr732012 596 519 11715 ----
NM_001037174chr251753 814 797 649 565 1208 ----
NM_001037339chr131296 307 43 --1482 --
NM_001037340chr131296 307 43 --1482 --
NM_001037341chr131296 307 43 --1482 --
NM_001037341chr131296 307 43 --1482 --
NM_001037954chr1153249 2893 2200 1019 945 12923 ----
NM_001038493chr2------11555
NM_001039199chr2094444 1949 1258 676 590 576 161 145 139 24829 2006 11987 --
NM_001039538chr243339 2622 2273 614 1523 2473 45 12311
NM_001039547chr387808 7601 6565 5996 5403 5340 4988 1455 15223 3565 541 115 16900
NM_001039569chr273115 2644 2505 2076 618 308 54 13266 ----
NM_001039618chr1185948 5604 5536 4728 4700 3896 3631 2181 11532 ----
NM_001039693chr253902 3745 3708 3022 732 11440 ----
NM_001039937chr1353798 2776 1573 1254 455 24020 3202 23674 3637 11051
NM_001040001chr651398 1300 712 647 253 ------
NM_001040057chr741225 1003 957 431 ------
NM_001040058chr4--1371 ----
NM_001040060chr4--1371 ----
NM_001040142chr21911 ------
NM_001040143chr21911 ------
NM_001040147chr18----1699 --
NM_001040152chr784725 4632 4325 4101 3986 3792 3748 582 11237 21501 1430 --
NM_001040157chr422239 825 12607 --1443
NM_001040159chr421044 307 11228 1271 --
NM_001040214chr642252 2162 963 375 22052 627 ----
NM_001040284chr1654008 3749 2218 1927 242 25832 4684 --14203
NM_001040402chr462905 2464 2140 1040 996 945 11097 1644 --
NM_001040429chr1352991 2839 2730 1312 1053 ----13224
NM_001040440chr51144 149 --1241
NM_001040441chr185448 4851 4405 4223 4080 3471 2038 1352 --24299 3628 --
NM_001040446chr532060 1996 398 22663 1714 22654 2334 --
NM_001040633chr72709 147 ------
NM_001040647chr741399 1376 748 450 2593 442 --1147
NM_001040648chr741399 1376 748 450 2593 442 --1147
NM_001040665chr774301 3645 1702 1336 1138 997 353 13537 23296 3043 14182
NM_001040876chr431579 1512 25 ------
NM_001041chr3152 ------
NM_001042355chr1633635 1924 937 24274 267 11678 --
NM_001042404chr11495 ------
NM_001042412chr1633635 1924 937 24274 267 11678 --
NM_001042414chr131242 ------
NM_001042453chrX21167 464 1281 187 --
NM_001042473chr1021947 233 12191 2688 338 1385
NM_001042481chr1462535 1973 1711 1663 593 586 --165 --
NM_001042510chr841854 1785 1526 1415 ------
NM_001042511chr841854 1785 1526 1415 ------
NM_001042517chr131887 ------
NM_001042533chr353230 3051 2954 2554 2192 ------
NM_001042537chrX1187 1104 1864 --
NM_001042552chr151411 1043 1024 927 336 1364 ----
NM_001042555chr1254689 4396 4315 3988 3647 --31058 705 392 14492
NM_001042599chr2117683 7336 7258 7113 7043 6182 5132 2594 1734 1092 918 25720 2382 --12186
NM_001042601chr342890 2736 2535 996 1274 --11254
NM_001042604chr364581 4309 3907 3715 947 378 43184 1229 138 23 33521 1531 1497 --
NM_001042646chr311327 1126 12021 --
NM_001042669chr42604 450 ----1368
NM_001042683chr61498 11738 --1556
NM_001042749chrX21704 561 ----1208
NM_001042750chrX21704 561 ----1208
NM_001042751chrX21704 561 ----1208
NM_001042762chr75759 278 200 169 106 ------
NM_001043318chr1453874 3786 2949 2745 1028 ------
NM_001044385chr253822 3197 2858 1449 741 13987 11305 --
NM_001044722chr532173 1959 541 ------
NM_001044723chr532173 1959 541 ------
NM_001046chr552882 2740 2313 1046 979 ------
NM_001079874chr121395 613 1619 ----
NM_001083620chr432276 1902 1890 ------
NM_001099678chr3136349 6326 6178 6165 5881 4573 4565 4452 1957 1918 1463 877 311 14061 25167 1360 16396
NM_001100108chr177053 6272 2877 2479 1411 780 187 --27946 5213 --
NM_001106chr3119642 9344 9171 8986 7614 7251 6325 3507 1541 541 263 26871 2327 37666 6052 3632 --
NM_001124chr111461 ------
NM_001126chr12355 108 ------
NM_001128chr1663918 2894 2654 1350 570 314 13776 ----
NM_001146chr861930 939 658 627 271 117 ------
NM_001160chr1242648 1081 1043 541 ----12046
NM_001173chr1454481 3464 1492 1206 184 24394 3197 --14515
NM_001186chr2142825 2363 610 297 1585 13275 --
NM_001198chr61505 136 ----
NM_001201chr473573 3515 3285 1582 473 414 142 --23916 1568 --
NM_001204chr2147647 7164 6383 5982 5886 5363 4823 2999 1839 1052 965 548 525 203 14692 37530 7501 537 17317
NM_001206chr932096 2077 685 13061 22038 789 1826
NM_001219chr731850 1822 398 ------
NM_001237chr421146 911 ------
NM_001237chr421146 911 ------
NM_001238chr191200 ------
NM_001256chr1752365 1925 840 754 90 ------
NM_001259chr785716 4646 2289 1863 1659 1183 822 23 15835 25008 2361 --
NM_001262chr11133 ------
NM_001263chr42307 184 ------
NM_001284chr5154 ------
NM_001289chrX31234 1043 333 ----1301
NM_001304chr1752887 2482 1091 624 32 12903 --1262
NM_001310chr1212093 13047 42601 558 459 441 --
NM_001316chr201421 ------
NM_001329chr1041191 645 597 242 ------
NM_001351chr321226 421 154 2725 120 --
NM_001356chrX21952 1831 1604 --1789
NM_001364chr1154539 3938 1739 1420 531 --13770 --
NM_001378chr2----1335 --
NM_001387chr552996 2714 2117 1952 121 --12256 --
NM_001399chrX13804 13525 ----
NM_001401chr921057 522 ------
NM_001402chr652056 1463 771 711 88 1202 ----
NM_001412chrX42855 1491 640 475 31240 973 859 ----
NM_001418chr11----1259 --
NM_001418chr11----1259 --
NM_001419chr1984343 1669 1568 1429 725 654 454 205 34176 3971 215 ----
NM_001432chr473661 3055 2594 2375 1494 355 302 1243 ----
NM_001438chr142701 2234 1278 905 --11201 --
NM_001453chr61322 ------
NM_001482chr153877 783 133 ------
NM_001498chr6----11061 --
NM_001527chr6104685 4334 3678 3454 3425 3286 3179 1951 1658 293 13659 ----
NM_001546chr641264 1143 560 298 11423 ----
NM_001553chr4----177 --
NM_001608chr24956 933 880 864 ------
NM_001616chr253472 3334 2317 964 729 32447 708 58 ----
NM_001618chr1187 ------
NM_001621chr712505 22299 384 12574 --
NM_001621chr712505 22299 384 12574 --
NM_001656chr532052 669 268 ------
NM_001661chr17--1577 1520 --
NM_001663chr1442668 2637 1901 721 ------
NM_001677chr11286 ----141
NM_001684chr154012 3269 1198 903 187 --23662 2559 22614 379
NM_001695chr864001 3155 3102 2762 1626 490 11084 161 --
NM_001701chr921557 1118 1632 ----
NM_001729chr4----1379 --
NM_001730chr1321329 1235 ------
NM_001730chr1321329 1235 ------
NM_001746chr562986 1933 991 973 829 606 ------
NM_001753chr71153 1173 11315 --
NM_001754chr2153734 3534 2691 638 583 ----13679
NM_001755chr1632094 1743 488 22243 2142 ----
NM_001777chr374073 3533 3414 3119 2806 1296 162 13989 24152 3087 12753
NM_001781chr121710 --1957 1212
NM_001792chr184865 318 194 79 1355 1131 --
NM_001802chr162805 196 ----1639
NM_001830chrX83898 3768 3671 3560 3123 2789 1136 908 11288 ----
NM_001854chr111047 --1198 --
NM_001858chr674817 4780 1922 1746 715 556 123 --35147 3181 681 --
NM_001874chr1294693 4443 4070 3278 2061 1047 1007 355 158 --14475 --
NM_001892chr511271 11358 ----
NM_001904chr31893 2708 110 ----
NM_001918chr1148881 8658 8312 8072 7966 7182 6184 3030 2933 2851 2018 753 521 33 39308 7988 3091 29070 2358 --
NM_001924chr1--1478 ----
NM_001931chr112906 277 ----1133
NM_001938chr141589 688 507 141 ----11700
NM_001939chrX11367 ------
NM_001949chr662876 2662 2289 2198 1275 690 1570 12596 --
NM_001951chr82519 199 ------
NM_001969chr1493802 3621 3086 2671 1525 1051 727 388 335 13736 ----
NM_001977chr421207 533 11225 ----
NM_001981chr162227 2185 2110 1799 1762 260 ------
NM_002006chr485656 5512 4658 4649 4234 4208 4134 3679 --14073 --
NM_002009chr1572765 2756 2243 957 924 799 480 --1991 --
NM_002015chr1332757 1305 340 --13325 1456
NM_002024chrX21604 165 11844 1610 --
NM_002025chrX139239 8978 7022 5902 5747 3076 2778 2161 2059 1905 1754 574 161 --18605 --
NM_002063chrX11048 ------
NM_002069chr741350 1324 1296 260 ------
NM_002086chr1712162 ------
NM_002092chr464959 4915 4091 3852 3823 1439 33156 1900 1702 --13517
NM_002106chr4----1353 --
NM_002107chr11498 ------
NM_002126chr1773967 3845 3256 2606 929 670 640 21155 477 21162 540 --
NM_002128chr1352401 2183 1606 924 638 --11813 --
NM_002137chr73920 816 343 ----1552
NM_002139chrX1128 ------
NM_002147chr171635 ------
NM_002154chr52513 48 ------
NM_002158chr233278 1029 763 ----22594 797
NM_002190chr61819 2416 261 ----
NM_002207chr3--1237 1517 --
NM_002210chr253598 3236 2807 2789 1241 --22827 173 --
NM_002214chr743749 3594 1884 1443 24861 729 32158 1150 687 --
NM_002223chr1244017 3316 782 453 22918 1469 12928 1739
NM_002245chr1--1489 ----
NM_002247chr1031590 1444 202 ----1461
NM_002264chr354516 3831 3715 3460 251 ------
NM_002267chr1332319 841 806 --1585 --
NM_002268chr351896 672 435 420 391 --1408 --
NM_002270chr585149 5139 4597 4361 2044 1971 1404 487 21649 1450 35552 4443 2259 13983
NM_002310chr5106014 5840 5149 1990 1669 1290 1232 995 878 856 1134 35943 2343 41 15470
NM_002336chr12104979 4827 4571 4179 3183 3107 1986 1362 871 795 11599 15048 --
NM_002345chr12------1589
NM_002351chrX41605 1290 1194 1183 189 21552 462 --
NM_002356chr622508 944 --1733 --
NM_002372chr51496 ------
NM_002374chr243339 2622 2273 614 1523 2473 45 12311
NM_002397chr522011 1872 12152 1198 11529
NM_002398chr2------11335
NM_002399chr1531363 1061 937 ------
NM_002408chr14----1740 --
NM_002500chr211189 ------
NM_002515chr1431975 674 579 --1485 --
NM_002526chr641684 1356 1336 238 ------
NM_002527chr12----195 --
NM_002543chr121984 160 11199 --
NM_002545chr1153154 2002 1612 1188 345 14528 14212 --
NM_002547chrX43815 3699 3075 1150 ------
NM_002570chr1511222 --1305 11026
NM_002577chr342715 1365 1133 681 ------
NM_002581chr931253 1022 397 15389 ----
NM_002590chr131552 156 ----
NM_002594chr2032447 2396 1821 ------
NM_002595chr123609 531 507 --11951 --
NM_002600chr131296 307 43 --1482 --
NM_002628chr31474 ----1301
NM_002645chr1132038 937 588 1504 ----
NM_002648chr6--1837 ----
NM_002655chr874117 4059 3565 3472 604 192 165 23927 3497 65107 4828 4366 4147 1484 1383 --
NM_002656chr65917 883 446 308 280 ------
NM_002670chr31476 11575 ----
NM_002701chr6193 ------
NM_002709chr273569 3559 3315 3196 385 189 62 --12841 --
NM_002710chr12--1801 --11004
NM_002711chr72644 157 --1140 136
NM_002716chr1143052 1044 941 764 --12306 --
NM_002721chr91396 ------
NM_002731chr172940 2270 2055 945 820 381 25 ------
NM_002734chr1732014 705 384 ------
NM_002736chr7----1168 2500 329
NM_002737chr1796506 6451 5004 4957 2173 1605 1523 1399 772 --1976 --
NM_002740chr352651 2590 2378 2256 1863 12308 ----
NM_002755chr151697 ------
NM_002758chr172503 357 ------
NM_002760chrY35687 4436 1132 1923 1475 13814
NM_002822chr1221826 415 --11405 --
NM_002823chr21520 ------
NM_002825chr73265 119 79 ------
NM_002835chr71565 129 ----
NM_002837chr1233762 1706 236 --21649 1350 --
NM_002852chr3------1532
NM_002873chr5------1483
NM_002874chr942393 1795 684 514 --12228 --
NM_002890chr5--31008 185 127 ----
NM_002892chr142601 193 --2688 182 --
NM_002897chr2----2688 167 --
NM_002906chr1112320 12359 135 --
NM_002922chr11179 2567 526 ----
NM_002940chr431579 1512 25 ------
NM_002941chr321399 1203 ------
NM_002942chr32938 459 1528 1382 --
NM_002971chr321143 279 --2939 893 --
NM_002973chr12--1516 ----
NM_002982chr17--1145 ----
NM_002990chr161285 1663 22365 1754 --
NM_002997chr22707 584 1576 ----
NM_002998chr81880 1724 ----
NM_003017chr631293 1191 550 --2398 95 --
NM_003022chrX31137 394 224 --193 --
NM_003030chr341956 1801 1710 391 11873 ----
NM_003034chr1277167 6936 6878 6636 3150 1367 771 32095 1645 1042 12240 --
NM_003036chr11201 --11251 1300
NM_003045chr1344575 4508 1937 230 11111 24562 1032 --
NM_003046chr843767 2021 976 934 --24368 569 11782
NM_003060chr511321 ------
NM_003068chr81755 ------
NM_003071chr331800 1371 44 --1197 --
NM_003074chr342090 817 517 277 2543 443 142 --
NM_003079chr171147 1840 1978 --
NM_003106chr321065 686 ------
NM_003108chr256307 6131 5637 5352 1725 --14905 --
NM_003111chr22483 69 ------
NM_003112chr753112 3000 2701 2112 554 --1229 --
NM_003113chr22781 46 ------
NM_003114chr84664 335 299 217 ------
NM_003129chr8------1215
NM_003135chr5--1348 1291 1278
NM_003136chr14--1271 ----
NM_003137chr662112 2064 1962 671 340 305 21716 539 ----
NM_003144chr622082 1694 --11598 --
NM_003155chr822686 149 22066 1738 --1514
NM_003182chr71213 ------
NM_003182chr71213 ------
NM_003199chr1841458 1442 907 684 15262 12228 --
NM_003221chr623975 3039 --21023 777 --
NM_003222chr201252 1191 1303 --
NM_003234chr31700 --11948 --
NM_003242chr34983 708 142 129 --21765 212 --
NM_003246chr1522036 612 --11268 --
NM_003262chr374690 3970 1621 1342 1219 930 31 35236 5014 4780 --14292
NM_003269chr621107 342 ------
NM_003272chr12630 147 --1692 --
NM_003274chr2142986 2603 1168 1124 --11096 12352
NM_003298chr365410 4804 4031 2345 958 612 ----35112 4837 4773
NM_003338chr1021381 760 --21720 1355 11799
NM_003339chr531168 544 94 11245 11076 --
NM_003340chr421373 173 ----11040
NM_003349chr2021576 1042 --1195 --
NM_003350chr81644 ------
NM_003369chr111376 --12447 --
NM_003373chr1051548 1351 537 467 253 --1289 11915
NM_003375chr101396 ------
NM_003385chr2------1409
NM_003387chr21270 12946 22368 255 --
NM_003390chr1121148 833 ------
NM_003392chr353843 3583 3518 3453 1592 23886 3552 ----
NM_003406chr831883 1369 256 11779 ----
NM_003407chr191619 ------
NM_003410chrX1550 13066 --12862
NM_003411chrY1503 ----11383
NM_003423chr1922409 747 ----11840
NM_003454chr162214 58 ----11269
NM_003463chr643070 3017 2495 1064 ------
NM_003467chr21494 152 ----
NM_003468chr283622 3452 3151 1242 1036 873 824 537 --1584 1737
NM_003473chr1021114 893 ------
NM_003478chr1143336 3288 3180 485 ------
NM_003488chr171988 ------
NM_003489chr2153263 3099 2959 2867 997 --12109 --
NM_003566chr1223115 2153 --23210 2947 12180
NM_003567chr11333 ------
NM_003574chr1865438 3722 1860 1187 999 924 25734 2199 44635 4298 3965 131 --
NM_003580chr81524 ------
NM_003583chr1273448 2628 1515 1397 698 238 194 ----12563
NM_003589chr1311148 --11385 --
NM_003590chr283953 3906 3863 3644 3583 2702 409 179 --11354 --
NM_003592chr71479 ------
NM_003615chr363919 3383 3228 1295 892 146 ------
NM_003620chr1731099 1057 384 --1200 --
NM_003626chr1121109 519 ------
NM_003631chr10157 189 ----
NM_003633chr522186 620 --32485 1839 34 --
NM_003648chr211910 --12597 --
NM_003659chr2146 --1127 --
NM_003663chr322853 1196 --12449 --
NM_003672chr111500 ------
NM_003679chr153302 2921 2632 2621 547 12848 ----
NM_003701chr131783 1718 ----
NM_003718chr71346 ------
NM_003722chr342647 2334 2027 274 --11668 --
NM_003758chr151212 ------
NM_003758chr151212 ------
NM_003763chr201773 --2669 299 --
NM_003772chr1111035 --2902 854 --
NM_003774chr1283258 3155 3089 2988 2679 729 524 365 32869 791 675 127 --
NM_003784chr18----1699 --
NM_003795chr62598 47 ------
NM_003799chr1853577 1820 1329 1298 874 --1497 --
NM_003800chr622091 530 ------
NM_003809chr171536 ------
NM_003812chr2186 ------
NM_003825chr152496 80 1519 ----
NM_003829chr92310 134 ------
NM_003861chr1462768 2400 2378 2358 2093 1927 --12817 --
NM_003872chr222839 2306 22649 2409 ----
NM_003887chr2----12294 --
NM_003899chr1321757 891 1219 1268 1801
NM_003930chr7--1215 ----
NM_003932chr2241914 1767 1444 722 --11628 --
NM_003941chr721745 783 11605 ----
NM_003948chr432257 1955 1796 22588 336 12178 --
NM_003966chr566976 6533 2069 1365 381 218 22795 1793 35169 2877 2423 --
NM_003971chr17----196 --
NM_003972chr1031216 436 73 --11103 --
NM_003983chr1623156 1457 34126 3855 156 23790 572 --
NM_004004chr13--1245 11088 --
NM_004006chrX22238 694 ------
NM_004007chrX22238 694 ------
NM_004009chrX22238 694 ------
NM_004010chrX22238 694 ------
NM_004011chrX22238 694 ------
NM_004012chrX22238 694 ------
NM_004013chrX22238 694 ------
NM_004014chrX22238 694 ------
NM_004015chrX22238 694 ------
NM_004016chrX22152 608 ------
NM_004017chrX22238 694 ------
NM_004018chrX22152 608 ------
NM_004020chrX22238 694 ------
NM_004021chrX22152 608 ------
NM_004022chrX22152 608 ------
NM_004023chrX22152 608 ------
NM_004060chr52818 119 3870 432 91 ----
NM_004061chr5--1170 ----
NM_004071chr2--171 ----
NM_004075chr121568 168 ----
NM_004079chr152438 2234 1785 1069 368 1784 12151 --
NM_004085chrX------1712
NM_004094chr1432820 1948 1850 12956 2991 429 1739
NM_004100chr631086 619 282 11841 ----
NM_004124chr1423500 1236 --12363 --
NM_004133chr821670 569 --1481 1416
NM_004136chr1543194 2462 1101 499 ------
NM_004161chr221552 638 11469 ----
NM_004171chr1179536 5947 2682 2366 2353 1501 383 --11582 --
NM_004181chr4--1292 ----
NM_004229chrX22094 1402 ------
NM_004235chr91870 ------
NM_004251chrX1253 ------
NM_004272chr541989 1304 787 68 11501 ----
NM_004274chr1422260 941 ----12389
NM_004281chr10158 ------
NM_004290chr52209 192 ------
NM_004293chr943836 3246 1370 250 22772 370 ----
NM_004327chr2232459 1002 916 ------
NM_004330chr15------1835
NM_004331chr82485 88 --12551 --
NM_004338chr1875549 1644 1326 907 859 120 106 16813 25001 1772 --
NM_004380chr1612500 ------
NM_004384chr532173 1959 541 ------
NM_004392chr1331697 718 663 ------
NM_004393chr31489 --1572 --
NM_004397chr1112774 --23510 1003 --
NM_004411chr72608 255 ------
NM_004412chr10105893 5785 4657 4409 4279 4060 3823 1965 1725 1460 --36010 5651 4423 --
NM_004430chr821771 590 12268 ----
NM_004438chr242619 2353 2253 330 --11273 12288
NM_004458chrX32653 870 678 ------
NM_004464chr463234 2709 1611 1145 847 493 ------
NM_004496chr14------1992
NM_004500chr1431855 1733 1665 --1352 --
NM_004501chr144129 3695 3412 1650 3907 522 76 14063 --
NM_004504chr222837 1874 1249 11188 --
NM_004506chr61234 ------
NM_004516chr191221 ------
NM_004524chr17--1246 ----
NM_004529chr921421 467 ------
NM_004543chr2186 --1166 --
NM_004576chr5----1371 --
NM_004586chrX75369 4586 3542 2040 1824 1431 38 --24492 3972 --
NM_004612chr944079 1532 1166 1078 --24208 4191 --
NM_004631chr121062 450 ------
NM_004681chrY1660 1185 ----
NM_004694chr172896 184 1847 ----
NM_004703chr1742489 1955 1690 883 ----1858
NM_004705chr113799 772 630 ------
NM_004719chr1232100 1780 678 --11830 --
NM_004726chrX54798 4765 1726 1174 709 54979 3821 3703 3531 2039 25414 686 13574
NM_004730chr531956 220 128 1562 ----
NM_004734chr1313267 12597 11210 --
NM_004736chr131663 1444 832 ------
NM_004744chr43526 160 76 13933 1494 --
NM_004745chr896423 6191 5873 5266 4958 4797 2654 2249 866 16161 21286 714 --
NM_004768chr12877 333 11123 ----
NM_004774chr1732966 2206 62 --155 --
NM_004788chr1142524 1887 1015 540 --11670 --
NM_004792chr2145 ------
NM_004796chr1432308 2261 1905 ------
NM_004798chr2053586 2964 1344 1252 764 --11199 --
NM_004801chr211092 ------
NM_004808chr1042362 2246 1278 594 --13235 --
NM_004815chr1114924 4682 4631 3032 1964 1649 1170 1022 996 521 390 ------
NM_004817chr92667 538 ------
NM_004824chr621204 1196 ----1977
NM_004831chr191691 ------
NM_004842chr62623 417 193 11505 --
NM_004857chr1463978 3614 1759 1324 622 408 1468 23168 327 24668 393
NM_004860chr171436 ------
NM_004863chr1484883 3945 2021 1934 1824 1694 566 541 13503 13954 15331
NM_004869chr1831262 598 222 11476 21332 550 --
NM_004871chr1744298 3682 3074 161 ------
NM_004873chr1442982 1167 742 718 1797 --12572
NM_004884chr1511407 ------
NM_004896chr1051498 319 269 232 57 11267 ----
NM_004904chr796438 6280 6008 5719 5075 4345 953 899 633 15026 26080 5844 --
NM_004912chr71572 --11326 21277 501
NM_004932chr511781 --1174 --
NM_004949chr1842075 1496 850 224 --11358 --
NM_004956chr773883 1763 1297 1263 1168 705 277 14018 ----
NM_004976chr1135131 4310 1995 ------
NM_004985chr1233509 2972 1024 13636 ----
NM_004993chr141384 ----11405
NM_004996chr1611700 11669 ----
NM_004999chr633589 3574 1772 --41654 992 761 397 --
NM_005045chr71195 --1718 --
NM_005056chr1284038 3725 3667 3609 3551 1831 1183 524 ----1207
NM_005063chr1062973 1247 776 401 391 185 22518 423 23186 934 --
NM_005065chr1495352 4314 4101 3857 1873 1633 680 196 175 24939 474 1348 14861
NM_005082chr1773788 3425 3087 2845 2669 2654 1051 --21297 820 --
NM_005095chr142054 1749 847 85 ----1387
NM_005109chr322464 2392 ------
NM_005113chr14--1134 ----
NM_005119chr131237 1030 1021 ------
NM_005121chr1752911 2547 726 455 292 23564 69 13340 --
NM_005153chr16----1510 --
NM_005156chr955123 3553 3311 1208 1131 12127 ----
NM_005160chr2266314 2671 2618 2226 1995 1937 --25602 5429 --
NM_005164chr1211923 21980 83 32690 2628 2305 12181
NM_005166chr191241 ------
NM_005168chr211261 ----21647 258
NM_005190chr6----2431 147 --
NM_005221chr71281 ------
NM_005227chr11513 ------
NM_005233chr312244 ------
NM_005235chr2117683 7336 7258 7113 7043 6182 5132 2594 1734 1092 918 25720 2382 --12186
NM_005238chr1153242 1294 1121 659 623 1916 ----
NM_005249chr14173 ----2910 329
NM_005254chr152480 279 --1140 --
NM_005259chr22984 94 1229 1581 21525 128
NM_005316chr112444 345 ----1227
NM_005339chr443116 3098 2707 1214 1250 13065 --
NM_005359chr1825413 1919 1524 ----
NM_005370chr1911174 ----1204
NM_005378chr21346 ------
NM_005402chr741805 1268 255 56 --11503 11610
NM_005406chr181466 ------
NM_005426chr13874 639 257 1600 ----
NM_005433chr18--1493 ----
NM_005455chr151776 1530 1505 589 450 --11183 --
NM_005461chr2031660 1619 1361 ------
NM_005471chr531285 478 114 ------
NM_005494chr72565 533 ------
NM_005497chr1775693 4976 2185 1448 1348 1339 45 1424 1888 --
NM_005502chr952629 2228 2050 1165 1063 13173 1651 --
NM_005504chr1286125 6094 5557 5286 5146 4195 1499 246 11178 25894 5660 2873 338
NM_005506chr452486 2407 2257 187 36 1972 2982 665 --
NM_005509chr511849 11690 --1521
NM_005511chr92977 128 ------
NM_005520chr52600 594 1618 ----
NM_005530chr1551458 1404 1136 1124 1118 1300 ----
NM_005539chr101247 ------
NM_005542chr731908 1702 1484 ------
NM_005578chr363299 1348 680 561 545 398 ----21253 578
NM_005587chr151907 1733 ----
NM_005596chr975678 4699 4435 4413 921 578 562 25406 4152 --26452 449
NM_005599chr12588 278 21266 418 ----
NM_005602chr31864 ------
NM_005607chr81272 --1157 --
NM_005611chr1611319 ------
NM_005613chr192169 2097 1689 1370 893 885 858 224 83 2705 425 ----
NM_005618chr6144 ------
NM_005623chr171169 ------
NM_005626chr11416 ------
NM_005637chr1841482 1363 146 127 ------
NM_005659chr222460 147 ------
NM_005665chr154676 4510 3156 1827 949 13771 --11542
NM_005669chr522312 144 11985 ----
NM_005685chr71150 ------
NM_005711chr5----1431 --
NM_005715chr61567 12581 12191 --
NM_005721chr21149 ----1838
NM_005722chr211589 --31761 1673 282 --
NM_005738chr732012 596 519 11715 ----
NM_005746chr751842 1083 1009 449 209 ------
NM_005748chr1273459 2984 2672 2656 2376 2152 792 ------
NM_005749chr173730 287 89 ------
NM_005752chr1611213 1354 ----
NM_005754chr51115 ------
NM_005765chrX--1758 ----
NM_005776chr141635 ------
NM_005779chr521045 589 ------
NM_005813chr232509 1688 127 --21743 286 --
NM_005822chr642298 1789 1677 333 11883 ----
NM_005826chr11445 ------
NM_005828chr1784675 4502 4388 1660 1451 990 952 624 ----14323
NM_005832chr321427 78 ------
NM_005862chr321060 686 ------
NM_005877chr2222192 1812 --1976 --
NM_005880chr1621164 1015 --2404 267 --
NM_005885chr521575 1180 1105 --11509
NM_005898chr1162988 2954 2359 2069 1113 673 ----13051
NM_005901chr18108373 7874 7456 7118 6303 6210 3419 2299 2022 1356 25605 3283 18436 21972 1341
NM_005903chr574909 4098 3925 737 616 381 81 ----14467
NM_005904chr1851311 1105 1026 917 29 ----11129
NM_005907chr651471 1262 421 381 113 --11577 --
NM_005923chr61565 ------
NM_005935chr421371 532 11285 14916 --
NM_005941chr844103 4052 3162 2971 --12764 --
NM_005955chr144225 1464 1257 624 1225 --11231
NM_005966chr251947 795 685 284 71 1871 12040 --
NM_005977chr132929 916 --2402 365 --
NM_005999chr141493 542 425 371 11267 1475 1511
NM_006007chr993993 2954 2846 2803 1692 1665 836 625 551 ------
NM_006030chr321558 119 ------
NM_006036chr21526 22278 105 1517 --
NM_006039chr17----1789 --
NM_006080chr772868 2756 2321 1873 1094 553 407 1699 1179 --
NM_006089chrX11512 --1637 21629 1553
NM_006090chr11720 ------
NM_006095chr443863 290 164 117 23613 2901 ----
NM_006100chr33601 477 457 1562 1210 1238
NM_006108chr1121850 253 21811 1542 1713 --
NM_006113chr121395 613 1619 ----
NM_006114chr19------1450
NM_006152chr12140 --1207 --
NM_006153chr32472 131 ------
NM_006154chr1532794 1837 288 1977 ----
NM_006158chr8------11471
NM_006194chr1441036 511 478 235 ------
NM_006203chr575072 4271 1677 1010 916 538 467 11388 15250 24952 4710
NM_006223chrX171 --2413 25 --
NM_006226chr21997 --187 --
NM_006246chr141398 --1453 --
NM_006251chr531225 50 37 12540 --12429
NM_006252chr1146720 6394 6064 5384 5086 4860 4744 2614 1814 1660 1535 1438 400 223 --17576 --
NM_006256chr152147 2079 1004 233 204 --11965 --
NM_006265chr82950 553 --11563 --
NM_006267chr2138 11568 ----
NM_006277chr22707 574 ------
NM_006283chr863648 1791 1698 1383 1159 264 ----11910
NM_006292chr11129 ----182
NM_006298chr663427 2743 2665 2637 2620 803 ------
NM_006306chrX105828 5317 5090 2294 1160 734 465 421 227 40 25205 757 44999 4002 1355 810 --
NM_006313chr122429 266 ------
NM_006315chr454089 4060 3463 1700 385 1426 13323 --
NM_006321chr312257 11541 ----
NM_006322chr134948 783 291 215 ------
NM_006330chr82361 179 ------
NM_006335chr11859 --1403 1117
NM_006345chr42931 352 11108 ----
NM_006350chr51358 ------
NM_006353chr6--1107 ----
NM_006359chrX1187 1104 1864 --
NM_006364chr142930 165 --11250 --
NM_006380chr1783350 1691 1557 1261 1108 934 541 172 --14119 --
NM_006393chr1093242 3100 2880 1372 993 802 585 481 24 23705 1765 11781 --
NM_006420chr2053377 2887 2316 1027 771 1641 ----
NM_006424chr4--11727 --11568
NM_006430chr2------1447
NM_006434chr1042918 1983 985 850 1481 ----
NM_006457chr473144 2939 2567 2506 1362 967 524 --43991 3259 1271 235 1950
NM_006464chr2114635 4393 4366 3680 3235 3174 2886 1765 1547 1275 1176 --13441 --
NM_006475chr13--2669 427 ----
NM_006482chr1273448 2628 1515 1397 698 238 194 ----12563
NM_006489chr1431975 674 579 --1485 --
NM_006520chrX2441 147 --11371 --
NM_006526chr2022118 423 --1113 --
NM_006534chr2043398 1091 555 118 12292 12466 --
NM_006540chr821469 1260 1494 ----
NM_006544chr1495683 5048 4974 4907 4380 3884 3859 1723 1493 11439 34087 1330 1009 --
NM_006546chr1746302 1855 1132 933 --36013 5807 1321 --
NM_006549chr1282965 2377 2299 2232 2200 1862 1165 632 ------
NM_006559chr13981 393 34 1455 --11105
NM_006561chr1055798 5387 1549 1318 804 --1964 --
NM_006575chr1431339 1303 1086 ------
NM_006591chr1151856 1255 1212 517 82 --11419 --
NM_006593chr21144 ------
NM_006595chr1131816 734 621 --21626 91 --
NM_006599chr1657356 2982 2364 1245 833 26959 2758 17863 --
NM_006603chrX21704 561 ----1208
NM_006612chr171446 ------
NM_006614chr353441 2861 2508 575 437 ----13250
NM_006618chr11469 --11106 --
NM_006620chr651186 904 610 438 182 14052 11082 13939
NM_006626chr922289 221 ------
NM_006628chr1594340 3709 3342 1564 1395 1347 1206 929 216 --11513 --
NM_006629chr18--1161 22412 2177 --
NM_006633chr51515 ------
NM_006646chr1362803 2775 2706 2582 2161 857 --2477 223 --
NM_006654chr1254689 4396 4315 3988 3647 --31058 705 392 14492
NM_006667chrX11029 --1119 --
NM_006670chr63422 70 54 ------
NM_006699chr12744 644 ----11013
NM_006717chr953037 2382 994 794 698 1260 11034 --
NM_006718chr65917 883 446 308 280 ------
NM_006729chrX34285 4227 99 14305 1126 --
NM_006734chr62275 174 1104 ----
NM_006735chr71371 ------
NM_006750chr16107431 7284 6548 6434 5961 5438 5283 2156 1735 1681 27109 5005 15408 11638
NM_006754chr73962 390 268 ------
NM_006774chr751708 1604 1381 1293 166 ------
NM_006775chr611138 ------
NM_006777chrX22889 486 --42277 1164 1096 454 --
NM_006793chr101123 ------
NM_006806chr21--1350 ----
NM_006825chr122967 184 ------
NM_006827chr1453266 3001 2373 1010 570 12420 13171 --
NM_006852chr1712606 --22904 1104 --
NM_006857chr21332 ------
NM_006884chr341956 1801 1710 391 11873 ----
NM_006885chr1654275 4183 2986 2840 1034 --1804 --
NM_006910chr16----1326 --
NM_006912chr162219 1989 1949 1786 656 319 --22347 2265 --
NM_006915chrX42310 2108 864 576 32438 1993 1664 1233 1878
NM_006918chr1175167 4825 4476 4359 1998 1557 1432 24512 330 15120 35178 4255 1085
NM_006920chr221416 665 --11952 1482
NM_006922chr222318 728 11967 ----
NM_006924chr1754050 3167 3132 2799 1234 44463 4277 3981 3364 ----
NM_006939chr1411022 --1136 --
NM_006947chr411403 --11627 --
NM_006981chr942270 1027 961 24 --12723 --
NM_006999chr51615 --1411 1547
NM_007006chr1633512 3203 3009 12648 23312 1115 --
NM_007007chr1263641 3610 3214 3113 1237 820 14153 ----
NM_007008chr22894 205 ----1662
NM_007017chr5----1776 --
NM_007026chr17--1506 ----
NM_007035chr12----2654 38 --
NM_007084chr1321210 989 ------
NM_007106chr1332509 1732 218 12062 12664 11137
NM_007111chr133867 819 145 1116 ----
NM_007114chr323315 38 22494 2191 ----
NM_007124chr631734 777 719 1628 ----
NM_007125chrY21270 1079 --11393 --
NM_007137chrX65458 5313 5210 4582 4080 3430 --12122 1295
NM_007150chrX21548 1468 11400 11943 1454
NM_007175chr863185 3115 2715 2379 2230 202 --11432 --
NM_007187chr131390 ------
NM_007191chr122165 141 128 ----
NM_007195chr1863510 2651 2443 738 405 69 ------
NM_007203chr953768 3519 3102 1481 1208 ------
NM_007207chr11109 1294 ----
NM_007212chr11677 --11807 --
NM_007214chr621209 351 --2540 459 --
NM_007222chr851746 1501 1267 1221 417 ------
NM_007249chr13109302 8711 8238 5860 3469 3318 3220 2941 1376 307 22637 453 19028 --
NM_007315chr211486 ------
NM_007345chr1811495 ----1547
NM_007347chr1543156 2163 547 508 1233 ----
NM_007373chr10----1193 --
NM_007375chr122189 831 12562 1190 --
NM_012081chr532614 421 39 --13139 11294
NM_012084chrX1544 ------
NM_012090chr1--1154 ----
NM_012097chr251753 814 797 649 565 1208 ----
NM_012104chr1163834 3260 3021 2908 943 914 11170 11010 --
NM_012104chr1163834 3260 3021 2908 943 914 11170 11010 --
NM_012110chr4--1220 ----
NM_012137chr152243 1994 1076 193 138 --22372 364 --
NM_012141chr1353798 2776 1573 1254 455 24020 3202 23674 3637 11051
NM_012155chr191222 ------
NM_012158chr1321800 543 11187 ----
NM_012193chr1195086 4977 4769 3366 1904 1808 979 863 353 13430 24938 3767 --
NM_012214chr285553 4428 2021 1655 1484 1115 542 183 --24273 4261 --
NM_012215chr1031406 1367 503 ------
NM_012234chr32907 424 13138 12418 --
NM_012249chr262950 2625 2568 933 417 184 11078 ----
NM_012259chr61411 --1508 11131
NM_012262chr181972 1796 1606 1482 1120 842 759 183 13254 11646 --
NM_012268chr191294 ------
NM_012287chr334558 3590 3173 --33334 1766 1713 14262
NM_012290chr251676 1425 1269 569 58 ------
NM_012294chr764026 3972 2629 2490 1581 688 144 1424 --
NM_012309chr1153716 1716 947 876 42 34994 3607 3020 ----
NM_012316chr175528 5067 4542 4059 1301 1017 949 ------
NM_012322chr71104 1154 ----
NM_012325chr204566 559 391 112 1362 1171 --
NM_012334chr594504 4141 4052 3480 867 641 507 187 59 21741 981 ----
NM_012338chr71174 ------
NM_012347chr682924 2892 2211 420 359 340 266 255 170 ----
NM_012382chr564322 3815 3617 3596 3112 1343 33362 2932 1464 14434 1186
NM_012388chr1563144 2360 2295 2132 1206 197 --1889 --
NM_012395chr753095 2924 916 246 37 ------
NM_012414chr1--1700 ----
NM_012416chr921043 54 ------
NM_012419chr61174 ------
NM_012420chr1032269 405 30 12241 12248 --
NM_012434chr631374 1280 82 21314 202 1301 --
NM_012446chr5------1482
NM_012454chr61598 2411 155 ----
NM_012463chr122536 221 --11712 1233
NM_012467chr16------135
NM_013229chr1242648 1081 1043 541 ----12046
NM_013255chr7106249 6092 6022 5352 3014 2934 2029 1859 1547 360 1205 18554 18244
NM_013257chr842319 2231 308 37 11965 21922 216 --
NM_013262chr631374 964 377 ------
NM_013269chr1264521 4237 4044 2798 539 69 ------
NM_013286chr343250 1530 665 160 ----13630
NM_013293chr72699 593 ------
NM_013308chr31187 1381 ----
NM_013309chr1562614 1951 1879 1863 558 513 ------
NM_013336chr311992 ------
NM_013341chr222936 2651 1989 ----
NM_013354chr81958 ------
NM_013357chr81688 ------
NM_013372chr1553133 2631 2248 2197 502 ------
NM_013374chr342261 2204 377 65 ----21097 568
NM_013411chr131817 1053 740 41953 947 755 632 ----
NM_013446chr741239 1180 1102 406 ------
NM_013448chr14----2726 203 --
NM_013958chr81374 1408 ----
NM_013959chr81374 1408 ----
NM_013961chr81374 1408 ----
NM_013962chr81374 1408 ----
NM_013996chr71213 ------
NM_013996chr71213 ------
NM_013997chr71213 ------
NM_013997chr71213 ------
NM_013998chr71213 ------
NM_013998chr71213 ------
NM_014000chr1051548 1351 537 467 253 --1289 11915
NM_014011chr272390 2131 2082 761 614 111 91 ----11615
NM_014016chr341713 1464 1347 321 ----1477
NM_014021chr1103240 3227 3088 3060 2986 2336 1194 1106 555 56 ------
NM_014028chr673059 2806 2621 2299 678 576 285 22914 769 11253 --
NM_014057chr91163 ------
NM_014112chr865082 4615 4043 1956 1855 581 ------
NM_014155chr1154682 1909 1387 809 751 26989 568 34898 2318 1929 --
NM_014159chr32488 198 ------
NM_014176chr1156 ------
NM_014181chr232226 1070 904 ------
NM_014243chr441703 1630 1523 456 12082 ----
NM_014253chrX12109 --11743 --
NM_014264chr41420 --127 1530
NM_014279chr91716 ------
NM_014283chr111322 11210 --1177
NM_014294chr811309 2395 205 ----
NM_014309chr2284866 4561 4002 3347 1806 1271 922 809 14792 --13702
NM_014321chr16--1787 ----
NM_014331chr476751 6405 2732 2278 2245 1294 1203 --12853 --
NM_014333chr111905 --12627 --
NM_014335chr1541347 1213 1012 344 ------
NM_014372chr162096 1635 1573 672 612 484 ----1713
NM_014382chr321798 504 --11354 --
NM_014386chr5----1301 --
NM_014393chr811645 1119 11881 --
NM_014394chr1031164 399 204 ------
NM_014415chr331376 1307 1261 11124 ----
NM_014423chr565632 4942 4827 1259 1035 324 1250 11062 1905
NM_014452chr64833 447 285 233 ------
NM_014456chr101394 ----1249
NM_014478chr741399 1376 748 450 2593 442 --1147
NM_014494chr1632289 2182 1689 12156 3707 384 251 --
NM_014503chr12--1412 ----
NM_014504chr721614 430 ----11702
NM_014522chrX1122 ------
NM_014563chrX42089 1968 1603 722 171 1578 --
NM_014574chr142594 417 1172 ----
NM_014612chr911422 ------
NM_014636chr934069 3737 1095 1603 ----
NM_014637chr831218 354 160 --1493 --
NM_014646chr1843152 2271 824 276 --33145 1240 1192 12180
NM_014660chr72733 58 --2819 139 --
NM_014666chr511143 1919 ----
NM_014676chr11620 ------
NM_014677chr81930 ------
NM_014682chr82787 590 --11919 11809
NM_014699chr161371 ------
NM_014701chr1512599 --23406 2945 11253
NM_014702chr642516 1348 924 915 11037 22721 230 --
NM_014709chr21422 --2136 65 --
NM_014717chr191757 1731 ----
NM_014721chr6127258 6133 5007 4725 2765 2667 2624 1583 1289 1162 639 288 24732 2349 15696 12487
NM_014735chrX----32100 846 831 --
NM_014739chr643283 2912 946 86 1528 34083 3650 901 --
NM_014755chr244257 3472 1349 313 --23548 363 13057
NM_014757chr512146 --12236 --
NM_014765chr162516 2119 1835 691 588 339 --11886 --
NM_014774chr183251 3232 3179 2361 2035 804 428 344 22566 853 ----
NM_014776chr1262721 2073 782 472 439 36 --22932 2200 --
NM_014779chr3--11170 1419 --
NM_014781chr81311 ----11217
NM_014787chr122773 364 32270 641 125 ----
NM_014803chr1042410 2388 1906 525 12465 12869 --
NM_014812chr11495 ------
NM_014819chr542174 1736 350 189 --1721 12080
NM_014824chr1111625 ------
NM_014828chr1452345 2061 2033 758 218 12550 ----
NM_014830chr1223768 1379 --33614 962 163 --
NM_014832chr1331964 1680 1282 ------
NM_014841chr621073 983 ------
NM_014848chr152702 604 ------
NM_014869chr321461 1150 ------
NM_014871chr12177 ------
NM_014873chr134022 3424 56 24118 1766 14236 11014
NM_014875chr11762 ------
NM_014877chr1787443 6493 6472 6183 4863 2348 1673 1487 16653 1509 --
NM_014881chr102351 33 ------
NM_014883chr432535 1634 724 32165 2035 1663 --11939
NM_014892chr6--1109 ----
NM_014897chr1772627 2177 2110 635 471 355 175 --21976 258 --
NM_014900chr2------1438
NM_014903chr1262337 2275 2145 1751 1643 527 ------
NM_014904chr1083974 3119 1045 874 714 513 291 237 22712 581 --1887
NM_014906chr1722504 2497 13545 ----
NM_014912chr1033568 2240 548 --31427 1306 593 1962
NM_014924chr1462002 848 822 782 741 391 184 ----
NM_014932chr32561 454 1268 ----
NM_014936chr622517 657 21119 749 12746 --
NM_014946chr262617 2466 2135 980 480 94 1246 ----
NM_014952chr152495 105 --11637 --
NM_014953chr1384275 3885 3515 2737 2685 1416 828 640 --13734 --
NM_014961chr4185 --1216 --
NM_014974chr1021780 301 ----1701
NM_014982chr1444481 4299 3690 3460 1219 25116 133 --
NM_014990chr14--21067 351 11153 --
NM_014991chr423018 982 1675 --12785
NM_014996chr3----171 --
NM_015000chr1222804 2077 ----22783 383
NM_015001chr11820 ------
NM_015002chr1222063 147 --12131 11679
NM_015008chr343583 3165 2340 1284 12301 ----
NM_015009chr3198 ------
NM_015020chr1673871 3590 2553 1561 963 516 270 11310 13672 --
NM_015025chr23692 297 215 22489 978 ----
NM_015026chr121291 --21696 656 23795 3411
NM_015027chr1651846 1568 581 317 152 1235 ----
NM_015049chr252303 828 451 355 159 ----12924
NM_015051chr972500 2083 1209 1146 853 654 24 --13238 --
NM_015056chr2172177 1808 983 424 374 220 98 --1108 --
NM_015057chr132600 510 ------
NM_015059chr1532801 1577 592 --12957 23980 1568
NM_015062chr101262 ------
NM_015068chr783577 3484 3177 2953 2838 2644 2600 1253 189 2353 282 --
NM_015070chr1311168 --1413 --
NM_015071chr572232 2053 1768 1300 450 146 28 36180 1748 1202 15870 --
NM_015074chr174709 4479 3102 3048 1818 1792 1532 ------
NM_015090chr1156177 5759 5657 4566 4436 4028 2380 2311 2165 2071 794 640 491 452 237 ------
NM_015092chr1663826 3780 3503 3302 2932 1280 11415 14090 --
NM_015093chr621713 182 ----11858
NM_015097chr342327 2023 1992 1744 --11469 --
NM_015115chr462905 2464 2140 1040 996 945 11097 1644 --
NM_015132chr721859 139 ------
NM_015137chr862075 547 509 327 242 62 --1500 --
NM_015138chr1511772 ------
NM_015139chr1137 ------
NM_015143chr41428 ------
NM_015147chr262931 2420 2278 2244 2125 879 12527 12967 --
NM_015155chr1033302 807 242 12755 ----
NM_015156chr1433753 3272 2559 13318 --12638
NM_015176chr161396 1221 457 357 106 98 1284 ----
NM_015191chr1162456 2379 1847 949 524 226 --22167 582 --
NM_015192chr202842 708 --22727 613 --
NM_015198chr71241 ------
NM_015199chr312658 ------
NM_015200chr421847 998 ------
NM_015208chr1833796 1177 1107 --12968 --
NM_015216chr521474 1334 --1331 --
NM_015247chr1633635 1924 937 24274 267 11678 --
NM_015265chr252665 2008 1061 1001 904 --1203 --
NM_015269chr1--1635 ----
NM_015271chr463091 2828 2750 2634 1214 950 13690 11546 --
NM_015272chr1631777 347 221 ------
NM_015275chr1232016 1512 431 --11821 --
NM_015278chr632708 2264 713 1800 1606 --
NM_015296chr132898 380 ------
NM_015310chr8108092 7922 7009 6920 6893 6761 6465 5508 1869 1793 16350 28283 1310 12327
NM_015313chr1164604 3627 3372 1822 1414 595 --23945 2925 --
NM_015317chr252687 2617 1042 874 531 ------
NM_015319chr12--1179 ----
NM_015326chr11110 1570 ----
NM_015335chr1232468 2035 221 12045 ----
NM_015336chr1221723 445 12533 ----
NM_015344chr82837 146 12096 1450 --
NM_015347chr1242930 2608 1049 627 166 ----
NM_015349chr652587 2398 372 280 243 --32227 2062 1985 --
NM_015355chr1721527 1444 --21320 584 --
NM_015365chrX74208 4001 3578 2993 1102 1012 830 13909 ----
NM_015382chr14----1149 --
NM_015385chr1042918 1983 985 850 1481 ----
NM_015387chr2--21711 162 1172 --
NM_015393chr453240 3141 1168 73 49 13739 2792 432 --
NM_015394chr12--11590 32454 791 68 --
NM_015416chr121874 ------
NM_015435chr831139 378 78 --1418 --
NM_015436chr453157 2568 2390 1201 416 21239 1168 --12757
NM_015446chr151601 1562 1369 1039 137 ------
NM_015455chr512945 12893 33548 1066 776 --
NM_015460chr362133 1917 1883 1790 1595 213 ------
NM_015469chr9--1111 ----
NM_015475chr231113 324 128 ------
NM_015523chr111275 ------
NM_015548chr63823 632 49 ------
NM_015550chr711017 1430 12207 12597
NM_015554chr1572385 2332 2218 2190 646 129 75 ------
NM_015560chr352876 2678 2464 2286 746 ------
NM_015564chr523335 35 13209 1632 --
NM_015565chr2112074 1517 ----
NM_015569chr164693 3992 3642 2946 1267 1010 1320 ----
NM_015571chr642011 1662 817 436 --12601 --
NM_015602chr131357 480 366 ------
NM_015634chr10--1473 ----
NM_015640chr1104642 4586 3853 3743 3714 3635 3521 3479 1213 938 --23243 894 --
NM_015678chr1331539 1438 353 21652 1519 ----
NM_015691chrX32838 2152 2146 ----12863
NM_015711chr19--1123 ----
NM_015713chr863594 2682 2501 1242 1210 583 --1628 --
NM_015726chr111448 ------
NM_015833chr212916 331 --22297 2040 --
NM_015878chr83787 678 44 ------
NM_015888chr143055 2379 2062 1147 ------
NM_015906chr144382 4154 3166 1313 11038 13104 14105
NM_015975chrX41860 1322 301 181 --1586 --
NM_015990chr451141 1023 690 397 250 --11000 --
NM_016002chr14809 623 508 80 --2693 270 --
NM_016009chr1114556 4424 4165 4074 3949 3170 1958 1802 1789 903 247 11436 ----
NM_016018chr852622 2437 1125 672 204 --1525 --
NM_016021chr653025 2235 2202 345 133 12010 123 --
NM_016040chr142771 2615 2342 981 1419 1811 --
NM_016042chr91325 ----1137
NM_016045chr2011774 --1124 --
NM_016061chr221524 1445 1286 ----
NM_016078chr1721076 161 1735 ----
NM_016083chr643708 3126 2757 49 ------
NM_016096chr841854 1785 1526 1415 ------
NM_016103chr51177 ------
NM_016107chr52908 882 1423 ----
NM_016120chrX1415 1396 ----
NM_016131chr221918 1717 --1905 --
NM_016132chr1542936 648 447 250 33086 2207 747 ----
NM_016133chr211607 ----11630
NM_016141chr31575 ------
NM_016152chr32861 317 ------
NM_016156chr1122015 1544 --11493 --
NM_016162chr121759 ------
NM_016201chr32465 322 11715 ----
NM_016203chr72709 147 ------
NM_016206chr3138008 7665 6743 5543 5514 5486 5461 2855 2716 2451 1793 281 26 11137 28370 5438 18669
NM_016221chr52861 147 22183 2005 --12260
NM_016224chr651503 1432 666 358 340 ------
NM_016227chr111322 11210 --1177
NM_016230chr61541 ------
NM_016231chr1721413 495 11371 --11438
NM_016255chr672941 2695 2634 2478 1339 1159 758 1727 ----
NM_016260chr245010 1839 689 420 26450 5842 35249 5047 4803 --
NM_016271chr183782 723 706 ----1177
NM_016275chr332805 2482 1107 ------
NM_016282chr92727 317 ------
NM_016289chr212103 ------
NM_016306chr33110 42 34 ------
NM_016315chr241591 1479 1447 740 ------
NM_016322chr932781 1103 260 --1424 --
NM_016328chr71150 ------
NM_016376chr1723936 535 1552 43977 1671 1597 430 --
NM_016377chr62623 417 193 11505 --
NM_016383chrX1204 1172 ----
NM_016401chr112209 102 ------
NM_016448chr151876 1425 550 52 27 ----11388
NM_016480chr52853 819 ------
NM_016488chr1251717 1475 1378 1330 631 --1270 --
NM_016542chrX21167 464 1281 187 --
NM_016545chr11247 ------
NM_016578chr111533 ------
NM_016586chr142406 171 ------
NM_016613chr442390 1691 1021 294 12496 --11032
NM_016623chr81514 ------
NM_016651chr1411148 ------
NM_016654chr152480 279 --1140 --
NM_016836chr2----2688 167 --
NM_016839chr2----2688 167 --
NM_016929chr663037 3028 1782 1402 1370 941 21338 878 24350 3181 --
NM_016950chr421044 307 11228 1271 --
NM_017420chr1452916 2435 1432 1115 656 ----11203
NM_017423chr432058 2020 1852 11460 11804 --
NM_017437chr1462394 2199 880 393 177 69 1761 ----
NM_017519chr61205 ------
NM_017522chr121062 450 ------
NM_017548chr31571 --1847 --
NM_017563chr376248 5918 4185 2459 1922 1574 353 --1537 12541
NM_017577chr331595 1461 217 ------
NM_017595chr1711520 ----11334
NM_017599chr1232078 1304 89 ------
NM_017628chr4104626 4577 4427 4108 3830 3529 3223 1936 1038 292 --25138 1507 --
NM_017632chr41339 ------
NM_017633chr61141 --33816 3444 921 11472
NM_017635chr1121314 1101 ------
NM_017637chr989109 8061 7397 6551 6176 3072 2166 1706 29287 1163 --12236
NM_017643chr17----22170 947 --
NM_017644chr375091 4605 4491 3483 3287 1445 659 21659 956 ----
NM_017650chr755800 5777 4586 4413 2367 22386 2147 ----
NM_017658chr1443546 1334 388 297 ------
NM_017660chr1953375 3183 2405 454 205 13143 1493 --
NM_017666chrX3716 354 59 --1451 --
NM_017672chr1511110 --11258 --
NM_017684chr1531413 689 59 --2350 309 --
NM_017693chr1381257 1170 1021 288 197 189 151 85 ------
NM_017697chr81343 1198 ----
NM_017709chr152922 2623 393 307 179 33889 1417 363 ----
NM_017719chr322092 399 31624 1610 590 ----
NM_017734chr11142 ------
NM_017737chr11201 1473 ----
NM_017739chr1----1554 --
NM_017742chr1841763 1728 1528 662 ------
NM_017752chrX--21896 547 ----
NM_017761chr141432 1419 1324 1041 --21018 339 --
NM_017769chr1452824 1144 1077 1018 626 1162 1777 12955
NM_017786chr8----1596 --
NM_017799chr1451929 1720 731 451 124 --11303 --
NM_017811chr921184 875 ------
NM_017813chr843973 3579 3541 1810 15585 25640 1742 --
NM_017831chr1884216 3587 3424 3264 3172 1033 993 765 13766 --13303
NM_017848chrX24528 3094 ------
NM_017864chr8171 ------
NM_017919chr965363 2320 2260 1737 1458 934 ------
NM_017925chr931523 1427 731 ------
NM_017944chr1122786 2030 22882 699 ----
NM_017954chr761369 1274 1239 1168 667 134 ------
NM_017987chr1031892 1830 1385 ------
NM_017994chr732075 712 553 ------
NM_018014chr2------11098
NM_018027chr101435 ------
NM_018030chr183834 691 42 ------
NM_018036chr1434340 3423 1764 --13848 --
NM_018045chr162620 2133 1133 810 709 605 --1494 --
NM_018046chr531906 298 282 11333 ----
NM_018048chr1221954 544 ------
NM_018084chr233292 2133 1292 12805 --2921 718
NM_018085chr1137857 7543 7359 7327 6425 5503 5471 5112 5038 2326 1817 847 667 --24986 1591 --
NM_018086chr241891 1769 1599 130 1541 1706 --
NM_018092chr163509 473 439 --21587 1318 --
NM_018098chr31265 ------
NM_018125chr11397 ------
NM_018133chr3--1134 ----
NM_018171chr121955 ------
NM_018181chr1851853 1794 1742 165 103 ------
NM_018191chr1332119 1833 210 --21682 583 --
NM_018200chr1552547 2153 992 893 35 --22387 194 --
NM_018211chr142188 1763 1481 382 ------
NM_018214chr631094 848 239 ------
NM_018221chr2----1405 --
NM_018227chr412850 12030 22509 2221 --
NM_018229chr142915 471 1848 ----
NM_018230chr14594 534 83 42 ------
NM_018241chr41154 --1718 --
NM_018247chr653039 2946 2783 2739 1998 --12121 --
NM_018254chr13814 405 142 1415 ----
NM_018257chr2042282 817 810 584 --12378 --
NM_018266chr3--11024 ----
NM_018299chr882653 1367 1046 1001 914 277 107 52 1878 ----
NM_018302chr452012 745 709 560 28 --1204 --
NM_018307chr17166 1367 ----
NM_018313chr342537 2323 2090 188 --22260 1026 1162
NM_018323chr431846 1249 501 ------
NM_018325chr921596 485 21131 129 1502 21614 1062
NM_018327chr203676 370 283 ------
NM_018330chr1051523 1451 1255 375 258 --11458 --
NM_018361chr842569 1526 1440 787 1752 12699 --
NM_018362chr1152942 2798 1355 1095 653 13521 ----
NM_018364chr122620 1349 44059 1078 495 78 12690 --
NM_018372chr11558 ----165
NM_018375chr1411499 1373 --11638
NM_018394chr351503 1034 994 568 149 ------
NM_018403chr374074 3980 3617 1427 1404 1043 798 24054 261 21644 53 --
NM_018409chr443187 555 347 162 --12361 --
NM_018420chr142618 2091 293 233 12890 --1397
NM_018429chr532267 2184 2018 --1134 22409 706
NM_018440chr898304 7942 7075 5951 2290 2146 2051 1068 186 22858 1974 38429 6366 2545 21198 1008
NM_018452chr6_random62818 2705 2570 2367 1402 1084 --12850 --
NM_018460chr21150 ------
NM_018464chr101367 ------
NM_018566chr164532 4502 4408 2020 651 543 34604 3583 3337 21834 1762 34584 3948 71
NM_018569chr431424 1131 67 ----11535
NM_018590chr1031671 1442 404 11603 ----
NM_018638chr12125593 5581 5406 4351 3654 3628 3580 1411 1078 707 386 354 --21316 377 --
NM_018672chr175617 590 581 334 127 1324 ----
NM_018691chr531069 1029 376 ------
NM_018703chr16----1326 --
NM_018710chr8--156 --1309
NM_018712chr1121323 1071 11260 ----
NM_018834chr51754 2258 188 ----
NM_018844chr73328 215 76 --1367 --
NM_018932chr52537 512 ------
NM_018948chr121206 478 11309 ----
NM_018970chr742794 548 370 239 ------
NM_018976chr1252466 2226 1033 610 144 --11938 --
NM_018979chr1222000 635 ------
NM_018992chr1611665 --11541 --
NM_018999chr1094610 4185 4155 3649 1587 1283 1259 1185 522 --34725 3999 3294 13898
NM_019001chr364581 4309 3907 3715 947 378 43184 1229 138 23 33521 1531 1497 --
NM_019004chr731483 1470 318 1793 21956 272 --
NM_019006chr151567 ------
NM_019022chr1843043 2813 2365 1257 ------
NM_019028chr11--1364 ----
NM_019041chr632411 2080 934 --1427 1242
NM_019045chrX4806 681 214 37 ------
NM_019049chr1--1292 --1497
NM_019050chr422305 688 21632 811 12173 --
NM_019053chr1021065 320 ------
NM_019072chr531442 506 355 43969 3181 2734 910 12935 --
NM_019083chr121461 385 11519 21488 1437 --
NM_019091chr21846 11131 ----
NM_019094chr1273827 3775 3721 3368 2639 1513 192 ------
NM_019096chr61435 ----1101
NM_019106chr2242512 1016 496 252 13080 --12583
NM_019117chrX73024 2439 1342 1320 1083 961 469 22189 865 22415 1238 --
NM_019556chrX2948 482 ------
NM_019595chr22707 574 ------
NM_019597chrX1192 ------
NM_019617chr21129 ------
NM_019845chr21584 ------
NM_019862chr1611700 11669 ----
NM_019891chr131343 1070 960 1216 ----
NM_019898chr1611700 11669 ----
NM_019899chr1611700 11669 ----
NM_019900chr1611700 11669 ----
NM_020062chr201925 1737 --127
NM_020116chr421585 1342 --1627 --
NM_020159chr41632 --11631 --
NM_020177chr543033 515 138 63 12673 --12056
NM_020204chr13844 715 287 ------
NM_020205chr133415 2185 45 1495 11331 12709
NM_020209chr19------184
NM_020228chr1152140 1936 1876 271 53 ------
NM_020311chr2--1766 ----
NM_020317chr1124 ------
NM_020336chr2053588 2567 1500 1289 280 ------
NM_020337chr41239 23119 313 ----
NM_020341chr201228 ------
NM_020342chr241701 1615 930 665 ------
NM_020346chr1121324 641 ----1286
NM_020357chr321427 1417 ------
NM_020390chr3114509 4374 4156 3755 3256 3032 1201 1129 383 94 67 11392 1726 --
NM_020432chr732323 1710 57 2909 507 ----
NM_020440chr123135 3045 22672 971 ----
NM_020443chr1104976 4502 4302 2424 2148 2020 1956 1916 1899 1639 36661 6437 4277 12214 --
NM_020463chr241097 504 218 60 --11376 --
NM_020466chr6114972 4107 3917 3240 1913 1343 1053 962 937 652 524 13430 13807 --
NM_020478chr811554 ------
NM_020532chr22894 205 ----1662
NM_020546chr522814 1930 11091 22169 415 --
NM_020630chr101178 ------
NM_020640chr31285 ----1848
NM_020651chr211142 --11625 143
NM_020654chr31117 ------
NM_020666chr51819 ------
NM_020673chr20147203 7109 6871 6798 6463 5747 5378 4965 4697 2630 2180 1211 954 287 --54737 3025 2857 1249 688 --
NM_020689chr20--1353 --11303
NM_020699chr165195 4282 4257 4201 3426 803 14834 --25361 3512
NM_020704chr722051 452 --12550 --
NM_020718chr1656202 5815 1464 1306 219 15432 ----
NM_020728chr733015 857 637 --1882 --
NM_020732chr61205 ------
NM_020744chr2----184 --
NM_020752chr1032566 1935 693 ----1931
NM_020760chr231681 1277 193 21794 465 ----
NM_020766chrX64254 1731 1718 1197 1173 723 11396 44221 3495 877 404 --
NM_020768chr533203 2942 1015 --2657 409 --
NM_020772chr1798668 8332 6079 3403 2940 2059 1741 1145 110 28100 6883 27583 6622 --
NM_020774chr1876017 5679 5452 5030 2010 1048 705 15008 21406 59 --
NM_020782chr1284612 3728 3647 3638 3366 1629 1561 1303 11722 1142 --
NM_020784chr141125 ------
NM_020791chr172973 453 ----1488
NM_020794chr1--11530 1274 --
NM_020803chr452405 2178 2071 1817 1694 11663 --1605
NM_020805chr1841893 1832 780 135 1664 11426 11865
NM_020813chr1942371 2160 1030 273 22474 2279 --12107
NM_020819chr6----189 --
NM_020821chr1531413 689 59 --2350 309 --
NM_020826chr1131235 798 161 11456 12299 --
NM_020830chr243065 2950 915 669 --12334 1281
NM_020841chr1284064 3944 3730 3340 3221 3176 939 833 22624 203 32857 1063 626 --
NM_020853chr1242316 2069 2021 419 11120 12349 --
NM_020868chr23783 442 407 11865 21806 1461 --
NM_020870chr421877 108 12005 ----
NM_020890chr31190 ------
NM_020920chr14--1408 ----
NM_020921chr1453615 3434 2742 2522 829 12508 12928 --
NM_020922chrX11342 --1287 --
NM_020927chr1652285 1829 1502 945 496 1133 ----
NM_020935chr284338 4092 4020 3008 1795 1598 1089 350 ------
NM_020940chr1062406 2071 2012 535 413 270 1788 ----
NM_020947chr1651971 1694 1454 958 210 ------
NM_020962chr1552306 2107 1966 275 126 12469 ----
NM_020981chr2----1133 --
NM_021005chr15----1473 --
NM_021007chr21911 ------
NM_021033chr1343190 2621 959 404 --11355 --
NM_021083chrX73159 3119 2875 2583 773 123 74 --13578 --
NM_021090chr2254679 4076 3427 1472 1251 14296 ----
NM_021110chr82784 567 --1751 --
NM_021111chr911000 ----11145
NM_021120chrX52712 2025 978 173 141 1385 ----
NM_021132chr1021352 297 ------
NM_021140chrX21148 1017 --1200 --
NM_021145chr721118 466 ------
NM_021155chr192545 197 125 ----
NM_021159chr411479 1245 ----
NM_021176chr211566 ------
NM_021183chrX21873 269 ------
NM_021190chr11427 ------
NM_021191chr1252366 2307 2017 1900 134 167 11590 11747
NM_021194chr1175 1266 ----
NM_021239chr1431378 1053 241 ------
NM_021240chr92669 529 ------
NM_021255chr1443831 3785 1342 1052 13220 1896 --
NM_021574chr2232459 1002 916 ------
NM_021622chr1022166 1488 --1137 11779
NM_021629chr353994 3407 1346 1080 822 14437 ----
NM_021633chr1--11222 11110 --
NM_021643chr21117 ------
NM_021647chr423355 802 1876 24692 1313 --
NM_021815chr253063 1190 1105 838 254 1516 23053 754 1863
NM_021818chr142937 24 11103 ----
NM_021911chr544047 3581 1587 1473 11549 --23502 1619
NM_021912chr1544048 3681 1223 540 ----1421
NM_021914chr1462173 1918 1789 1599 683 554 --1524 1332
NM_021935chr31916 ------
NM_021951chr91783 ------
NM_021961chr1166907 4780 4652 4577 1114 844 11373 36663 1657 1437 --
NM_021964chr3104207 2582 2388 2373 2253 2066 1953 1861 373 121 ------
NM_021988chr2021576 1042 --1195 --
NM_021998chrX21505 1214 ------
NM_022037chr21994 --1829 --
NM_022048chr1575540 5499 5305 5109 1465 1387 1094 1397 15217 --
NM_022051chr11268 ----1228
NM_022091chr652778 2682 2280 1709 1042 --1646 --
NM_022116chr75759 278 200 169 106 ------
NM_022121chr631195 983 837 ------
NM_022137chr1441533 621 249 110 11286 ----
NM_022140chr541861 780 480 418 ------
NM_022143chr71191 ------
NM_022173chr21994 --1829 --
NM_022340chr393511 3290 3013 2402 749 711 682 506 469 ------
NM_022351chr842821 1401 1167 543 1705 23054 635 --
NM_022442chr2021576 1042 --1195 --
NM_022458chr711943 --22562 684 1813
NM_022459chr1336310 6253 6072 --24758 525 --
NM_022473chr1554377 2978 1496 180 140 --24067 1764 --
NM_022476chr162883 291 ------
NM_022483chr531969 1877 768 11283 11433 --
NM_022484chr7130 11342 ----
NM_022497chr332991 962 182 --22822 1263 --
NM_022650chr5--31008 185 127 ----
NM_022716chr152755 2277 1259 1014 702 32101 776 690 ----
NM_022731chr1--1219 ----
NM_022735chr1------2408 266
NM_022739chr171998 --11098 --
NM_022771chr1231067 392 334 11027 ----
NM_022776chr331425 1164 292 ------
NM_022780chr21379 11456 --1112
NM_022781chr932345 962 434 ------
NM_022802chr1041191 645 597 242 ------
NM_022818chr1631650 275 173 1222 ----
NM_022826chr22454 38 ------
NM_022831chr171824 1566 1305 1290 1191 670 517 ------
NM_022841chr1542510 2202 479 193 2829 302 1365 --
NM_022845chr1632048 1697 442 22197 2096 ----
NM_022893chr213104 ----1605
NM_022894chr211153 ------
NM_022900chr72963 949 1293 ----
NM_022977chrX32653 870 678 ------
NM_023000chr142601 193 --2688 182 --
NM_023001chr142601 193 --2688 182 --
NM_023016chr222859 997 ----12186
NM_023927chr521353 1105 ----11099
NM_023929chr821021 956 ------
NM_024052chr1722063 2023 1248 --12901
NM_024344chr15----1491 --
NM_024345chr9106057 6038 5839 4833 4503 3712 2133 1765 1078 608 25230 1283 45465 5065 795 97 --
NM_024408chr133583 3028 2832 --13705 --
NM_024416chr91163 ------
NM_024420chr1------1166
NM_024423chr1834278 3258 2680 1532 ----
NM_024429chr72709 147 ------
NM_024511chr463519 2971 2723 1160 770 594 --12371 12469
NM_024524chr321136 419 1942 ----
NM_024539chrX2495 208 1506 ----
NM_024545chr22240 189 --1659 --
NM_024556chr112491 411 ------
NM_024574chr41158 ------
NM_024595chr1--1374 ----
NM_024612chr171213 --1741 --
NM_024613chr84649 522 332 76 --1204 --
NM_024665chr334133 1652 1378 --24171 3037 12888
NM_024680chr111210 --1567 --
NM_024692chr231195 456 213 21701 671 123 --
NM_024715chr541766 1712 564 189 ------
NM_024744chr242013 775 715 423 11947 ----
NM_024761chr985337 4188 3413 3309 2106 1737 479 328 ------
NM_024770chr2116752 5489 2579 1835 1045 956 869 709 362 270 135 1284 12245 --
NM_024824chr1421403 170 ------
NM_024854chr121161 2308 238 11312 --
NM_024884chr1494312 3577 1360 770 541 531 493 345 260 --11535 14131
NM_024920chr431419 1014 57 11137 11185 --
NM_024921chrX41728 1366 782 719 ----11442
NM_024941chr561254 1222 1130 975 360 22 ------
NM_024944chr212415 117 --1343 --
NM_024945chr931029 324 277 ----1179
NM_024947chr3139612 8583 8332 8326 7703 7581 6638 6571 6003 2820 2665 2320 1677 47722 7101 7007 3651 28737 2883 --
NM_024949chr443485 1839 770 396 14467 1758 11146
NM_024953chr1252838 1016 1009 1002 479 12453 ----
NM_024989chr276383 5349 3021 2964 2386 1615 439 --16105 --
NM_024991chr1042918 1983 985 850 1481 ----
NM_024993chr221604 1157 --1223 --
NM_025054chr844168 3477 2568 1211 13659 ----
NM_025069chr81186 ------
NM_025073chr164479 4286 4134 799 612 325 1997 ----
NM_025114chr12------152
NM_025126chr122500 204 ------
NM_025134chr161713 --31650 552 182 --
NM_025141chr152481 459 ------
NM_025146chr362686 2309 2092 1851 1753 550 --11800 --
NM_025147chr2--2936 388 11046 --
NM_025152chr1441488 1363 682 380 1151 ----
NM_025154chr711125 ------
NM_025160chr142754 2620 1560 1375 13733 ----
NM_025264chr2--142 ----
NM_030621chr1432896 1321 990 --1458 --
NM_030623chr231410 1199 157 --1321 --
NM_030625chr1042451 1909 1897 1690 --1436 --
NM_030627chr553984 2627 2577 595 40 14014 ----
NM_030647chr795911 5269 5108 2378 2287 1543 1464 1177 1144 12388 34657 957 866 1638
NM_030648chr465373 5178 4306 1555 1507 1336 1806 ----
NM_030650chr2103826 3695 3641 2888 1353 791 770 522 362 277 --13726 --
NM_030660chr141384 ----11405
NM_030664chr10------22278 2040
NM_030674chr1275482 4843 4517 1560 1125 1019 940 --11624 --
NM_030751chr1031862 1748 405 11836 ----
NM_030751chr1031862 1748 405 11836 ----
NM_030759chr101668 ------
NM_030791chr1451527 656 215 184 90 1190 ----
NM_030806chr1108308 8290 8273 7827 7565 3502 1569 1049 660 497 --12751 --
NM_030816chr153229 3053 2813 2726 890 --13245 --
NM_030817chr1263301 2809 2638 2398 1455 900 12838 11145 --
NM_030820chr62721 413 ------
NM_030885chr342273 1652 600 515 11767 ----
NM_030917chr4--1168 ----
NM_030920chr152056 1972 1494 1340 413 --11697 --
NM_030948chr6162 ------
NM_030949chr61392 1453 ----
NM_031217chr112217 116 ------
NM_031243chr73920 816 343 ----1552
NM_031267chr71346 ------
NM_031305chr42604 450 ----1368
NM_031314chr1431855 1733 1665 --1352 --
NM_031365chr222347 29 ------
NM_031366chr222347 29 ------
NM_031372chr471616 1570 1558 1361 1345 558 335 ------
NM_031417chr1921977 1715 1851 12084 --
NM_031419chr341389 1038 593 101 ------
NM_031422chr18----148 --
NM_031427chr1461993 1964 1957 1401 1207 927 35930 1465 983 ----
NM_031442chrX42719 1105 359 217 --1847 --
NM_031453chr1042171 1964 961 220 12412 12202 --
NM_031468chr747925 3160 1822 1769 22717 1036 26871 874 --
NM_031469chr643843 1121 381 295 1653 1848 --
NM_031480chr62169 64 1229 ----
NM_031492chr111164 1425 ----
NM_031844chr144129 3695 3412 1650 3907 522 76 14063 --
NM_031845chr243339 2622 2273 614 1523 2473 45 12311
NM_031847chr243339 2622 2273 614 1523 2473 45 12311
NM_031898chr17--137 ----
NM_031919chr9139 ------
NM_031922chr6------1480
NM_031942chr221170 946 ------
NM_032012chr934769 716 552 23480 1596 --1862
NM_032042chr552342 2289 2255 973 905 ------
NM_032047chr351906 1735 850 404 189 --1791 --
NM_032102chr1143002 2992 2954 652 12526 21156 918 --
NM_032132chr12231 128 ------
NM_032138chr13--1501 1619 --
NM_032144chr22552 389 21420 1224 ----
NM_032175chr521609 581 11446 ----
NM_032189chr1374539 3534 3407 3195 3151 1989 764 14490 13263 --
NM_032199chr1033127 1293 1009 ------
NM_032208chr233429 3261 1275 --1930 --
NM_032221chr2061562 1308 407 189 105 39 ------
NM_032228chr1153209 3061 1354 607 72 1527 ----
NM_032229chr1321021 68 --1855 --
NM_032373chr1055540 4473 3816 3697 895 --1506 --
NM_032438chr651418 1386 1209 451 179 1233 11586 --
NM_032440chr1062964 2802 2582 2398 2128 1015 1343 ----
NM_032446chr533686 2940 1077 ----12921
NM_032457chr442659 1064 441 380 11543 12515 --
NM_032458chrX82694 2675 2359 704 668 492 221 150 1623 21334 947 1941
NM_032466chr841629 1534 1156 1146 ------
NM_032468chr841629 1534 1156 1146 ------
NM_032505chr311123 22153 613 ----
NM_032510chr1832302 713 375 12222 ----
NM_032521chr2042882 2534 626 101 13050 12113 --
NM_032558chr931472 1102 1058 ------
NM_032663chr1251801 1399 761 668 387 21986 1270 ----
NM_032682chr342334 1104 639 390 --12388 --
NM_032717chr41990 --1966 --
NM_032778chr353230 3051 2954 2554 2192 ------
NM_032796chrX3551 280 248 --1533 --
NM_032810chr1031190 587 277 1139 ----
NM_032828chr1994839 4451 4328 3388 1866 1500 1444 1159 413 34374 3587 1681 11970 --
NM_032832chr661248 1110 555 378 241 65 ------
NM_032859chr1333039 1403 396 22461 2453 --13795
NM_032876chr1462234 1786 670 418 412 238 11475 ----
NM_032883chr201594 ------
NM_032906chr4187 ------
NM_032949chr131552 156 ----
NM_032961chr421365 926 ------
NM_032973chrY1394 --11002 --
NM_033012chr131783 1718 ----
NM_033014chr91163 ------
NM_033020chr144382 4154 3166 1313 11038 13104 14105
NM_033044chr1--1154 ----
NM_033081chr20--11180 ----
NM_033132chr1331743 36 24 ------
NM_033136chr521660 308 ----11784
NM_033137chr521660 308 ----11784
NM_033143chr453565 3040 1476 1178 824 ------
NM_033181chr643708 3126 2757 49 ------
NM_033211chr511569 --1772 --
NM_033222chr921024 91 --11412 --
NM_033224chr786875 3183 2319 2287 1887 1726 1094 1087 22590 86 --12793
NM_033225chr832230 741 137 ------
NM_033290chrX23631 1067 --1310 --
NM_033300chr121062 450 ------
NM_033326chr111150 1347 12141 --
NM_033380chrX1439 11012 ----
NM_033381chrX1439 11012 ----
NM_033393chr472848 2804 2355 2243 2115 2106 1136 --12703 --
NM_033394chr231052 511 484 --11514 --
NM_033425chr1153249 2893 2200 1019 945 12923 ----
NM_033427chr7----1630 --
NM_033429chr1552896 2780 989 751 400 ------
NM_033480chr682924 2892 2211 420 359 340 266 255 170 ----
NM_033481chr682924 2892 2211 420 359 340 266 255 170 ----
NM_033505chr254915 2457 1338 760 451 11818 ----
NM_033512chr843063 2167 1879 751 ------
NM_033516chr951522 517 369 150 92 ------
NM_033624chr1222063 147 --12131 11679
NM_033656chr2164704 4408 4048 2071 2026 311 21362 935 15001 25408 5319
NM_052832chr851209 1184 465 320 119 --12590 11054
NM_052864chr431782 1597 656 22072 474 ----
NM_052885chr1234739 4328 509 34888 4194 3213 13319 1731
NM_052897chr12--1318 ----
NM_052900chr8--31246 725 433 --1548
NM_052910chr133482 142 123 11941 1616 1713
NM_052918chr1031034 644 499 1689 ----
NM_052925chr19--1843 ----
NM_052927chr552148 2105 1859 1400 445 --11528 1761
NM_052953chr3162 1226 ----
NM_053016chr9126548 6282 6262 5747 5163 4921 3215 2382 2312 1888 1792 1242 36130 2943 1480 1553 --
NM_053024chr31324 --162 1623
NM_053043chr775403 5133 4979 4574 2259 1899 29 34142 1468 1225 ----
NM_053056chr112594 358 --11240 --
NM_057159chr921057 522 ------
NM_057169chr1262721 2073 782 472 439 36 --22932 2200 --
NM_057170chr1262721 2073 782 472 439 36 --22932 2200 --
NM_057175chr412102 ------
NM_057182chr191200 ------
NM_057749chr81361 ----11081
NM_058170chr131110 1049 155 ----11326
NM_078474chr152481 459 ------
NM_078476chr641857 1835 1814 63 ------
NM_078483chr554087 2960 2792 2685 1322 11176 ----
NM_078626chr11133 ------
NM_080546chr931527 828 451 11635 ----
NM_080597chr183834 691 42 ------
NM_080629chr111047 --1198 --
NM_080630chr111047 --1198 --
NM_080672chr201446 ------
NM_080743chr662450 1759 710 606 564 416 22272 2159 --142
NM_080759chr1331697 718 663 ------
NM_080760chr1331697 718 663 ------
NM_080867chr14125060 5035 4902 4814 4666 4205 3841 3447 3353 1377 1023 931 ------
NM_080868chr1121 ------
NM_080927chr352702 2490 575 501 354 ------
NM_130387chr3--1132 ----
NM_130798chr152496 80 1519 ----
NM_130831chr352876 2678 2464 2286 746 ------
NM_130832chr352876 2678 2464 2286 746 ------
NM_130833chr352876 2678 2464 2286 746 ------
NM_130834chr352876 2678 2464 2286 746 ------
NM_130835chr352876 2678 2464 2286 746 ------
NM_130836chr352876 2678 2464 2286 746 ------
NM_130837chr352876 2678 2464 2286 746 ------
NM_130847chr11115528 5487 5389 5102 4853 4593 4514 4424 1868 1764 1161 14919 ----
NM_133334chr476259 5780 5696 4382 4153 1396 1275 ------
NM_133338chr5------1483
NM_133339chr5------1483
NM_133340chr5------1483
NM_133341chr5------1483
NM_133342chr5------1483
NM_133343chr5------1483
NM_133344chr5------1483
NM_133370chr433536 2373 2332 22314 1163 ----
NM_133372chr542265 2228 792 721 12846 12450 --
NM_133445chr963593 3237 2426 1377 678 235 --22966 1026 --
NM_133631chr321399 1203 ------
NM_133646chr245302 4012 2113 1954 12076 --11161
NM_134428chr93363 74 59 ------
NM_138286chr1974189 3057 2926 2877 2740 1658 288 12676 ----
NM_138319chr1511222 --1305 11026
NM_138333chr942000 823 329 222 ----1813
NM_138335chr41691 --2929 710 --
NM_138348chr585196 4840 4825 2643 2536 2294 1434 1219 --25041 4719 --
NM_138357chr1011632 --1193 --
NM_138385chr4------11388
NM_138395chr23862 854 109 11179 1118 --
NM_138409chr641153 958 168 159 11377 ----
NM_138437chrX1239 1269 ----
NM_138444chr1394436 4071 4051 3956 3651 3121 1712 1591 1576 --13084 --
NM_138473chr1265039 4113 4028 3936 1174 242 ------
NM_138559chr2------11088
NM_138633chr62623 417 193 11505 --
NM_138638chr1462173 1918 1789 1599 683 554 --1524 1332
NM_138713chr1657356 2982 2364 1245 833 26959 2758 17863 --
NM_138714chr1657356 2982 2364 1245 833 26959 2758 17863 --
NM_138731chr14103795 3663 3605 3592 3043 3032 3013 1265 1064 396 43982 1357 1232 754 --13103
NM_138735chr211092 ------
NM_138768chr113744 260 139 1855 ----
NM_138779chr131254 ------
NM_138782chr531626 581 452 21832 493 2639 412 --
NM_138970chr1432308 2261 1905 ------
NM_138971chr1163834 3260 3021 2908 943 914 11170 11010 --
NM_138971chr1163834 3260 3021 2908 943 914 11170 11010 --
NM_138972chr1163834 3260 3021 2908 943 914 11170 11010 --
NM_138972chr1163834 3260 3021 2908 943 914 11170 11010 --
NM_138973chr1163834 3260 3021 2908 943 914 11170 11010 --
NM_138973chr1163834 3260 3021 2908 943 914 11170 11010 --
NM_139076chr451450 1390 1119 227 96 183 11248 11030
NM_139160chr11----124 --
NM_139168chr541945 1331 617 348 ------
NM_139245chr321340 250 --11152 --
NM_139321chr2042905 1091 841 834 23497 3186 1246 --
NM_144567chr162446 2002 955 625 538 206 12836 ----
NM_144571chr464952 4644 2716 2421 1369 96 16200 ----
NM_144578chr1494727 4261 3955 3837 2169 1302 1217 590 463 35152 4670 1126 11996 14823
NM_144583chr211347 1159 ----
NM_144632chr221897 1784 11767 ----
NM_144642chr31539 1475 ----
NM_144664chr1132500 972 162 ------
NM_144684chr1952844 2291 2009 1845 1090 ------
NM_144710chr231485 555 175 ----1961
NM_144728chr11109 1294 ----
NM_144729chr11109 1294 ----
NM_144778chr131996 --1717 --
NM_144949chr272390 2131 2082 761 614 111 91 ----11615
NM_144982chr12174 ----1817
NM_145005chr92833 307 1330 ----
NM_145011chr1042142 2040 1985 194 ------
NM_145014chr111336 ------
NM_145055chr1853813 3119 2810 2709 1095 ------
NM_145207chr495312 4793 4353 3885 1192 1110 739 667 641 --1193 11417
NM_145251chr14191 ------
NM_145259chr245023 2834 950 312 46568 4613 4583 460 25461 285 16157
NM_145284chrX22226 2024 ------
NM_145305chrX------11069
NM_145307chr1084301 4050 3855 3350 3177 630 531 293 11804 11664 1124
NM_145315chr6--1165 ----
NM_145320chr711017 1430 12207 12597
NM_145321chr711017 1430 12207 12597
NM_145322chr711017 1430 12207 12597
NM_145341chr101394 ----1249
NM_145690chr831883 1369 256 11779 ----
NM_145698chr1021947 233 12191 2688 338 1385
NM_145805chr15--2565 512 ----
NM_145808chr7103123 3074 2887 2807 2412 837 698 555 442 230 --22588 1097 --
NM_145810chr221170 946 ------
NM_145891chr1611442 31581 557 348 ----
NM_145892chr1611442 31581 557 348 ----
NM_145893chr1611564 31703 679 470 ----
NM_147128chr721375 358 ------
NM_147150chr953768 3519 3102 1481 1208 ------
NM_147156chr1031205 414 304 --2320 239 --
NM_147189chr83366 250 85 21551 939 22371 1525 --
NM_148174chr83787 678 44 ------
NM_152261chr1261690 926 489 397 277 198 --12166 --
NM_152263chr196022 5764 4562 4234 2178 957 792 286 182 ------
NM_152275chr262246 899 841 674 272 184 ------
NM_152284chr82699 628 ----137
NM_152330chr1462535 1973 1711 1663 593 586 --165 --
NM_152375chr122569 2259 11948 ----
NM_152384chr2172 ------
NM_152388chr253822 3197 2858 1449 741 13987 11305 --
NM_152414chr821401 1029 11285 1330 --
NM_152417chr84881 350 274 124 1399 --1374
NM_152422chr931871 1200 463 1184 169 --
NM_152424chrX54594 2960 1053 921 885 ----1658
NM_152493chr11320 ------
NM_152519chr231502 550 146 ------
NM_152522chr22745 729 1408 ----
NM_152542chr441843 1417 829 494 ------
NM_152549chr51144 149 --1241
NM_152581chrX3416 350 310 ------
NM_152594chr1522062 1604 --124 --
NM_152608chr132334 2076 909 --12208 12521
NM_152609chr11485 --1408 --
NM_152622chr573337 2320 1138 1071 1058 967 244 11265 ----
NM_152624chr576892 6601 2953 2796 2253 670 231 --14969 --
NM_152638chr121814 21282 974 21275 373 --
NM_152641chr1232409 433 354 --12561 --
NM_152667chr2061255 1205 1199 1018 468 165 11466 ----
NM_152672chr31196 ------
NM_152682chr441775 1237 251 145 --1422 --
NM_152686chr562380 2199 1818 1485 806 372 1224 ----
NM_152704chr134386 271 224 74 ------
NM_152729chr621569 1512 --1113 --
NM_152745chr71939 1828 1779 --
NM_152756chr521680 1152 13465 1922 1608
NM_152758chr852834 2709 1077 546 66 --22799 2207 --
NM_152787chrX43073 2744 2456 926 1767 12435 --
NM_152789chr741225 1003 957 431 ------
NM_152793chr784567 4520 3676 1831 1776 1759 762 291 --23598 172 --
NM_152835chr152814 2520 2423 862 598 11872 22513 1004 --
NM_152879chr211910 --12597 --
NM_152903chr1321876 50 --1913 1469
NM_152910chr132496 135 ------
NM_152995chr4----148 --
NM_152996chr122010 1492 22021 1838 ----
NM_152999chr774301 3645 1702 1336 1138 997 353 13537 23296 3043 14182
NM_153005chr62169 64 1229 ----
NM_153013chr552464 2071 1933 709 337 ------
NM_153020chr611121 ------
NM_153042chr651552 480 449 267 189 ------
NM_153050chr2254679 4076 3427 1472 1251 14296 ----
NM_153051chr2254679 4076 3427 1472 1251 14296 ----
NM_153182chr353230 3051 2954 2554 2192 ------
NM_153188chr585149 5139 4597 4361 2044 1971 1404 487 21649 1450 35552 4443 2259 13983
NM_153207chr1253971 3138 2511 982 319 --13820 --
NM_153208chr161907 ------
NM_153223chr52293 115 ------
NM_153240chr31157 ------
NM_153261chr1621366 51 1280 ----
NM_153262chr152918 2290 478 334 135 11209 23017 912 --
NM_153267chr91676 ----1105
NM_153331chr31443 ------
NM_153354chr51907 ----1756
NM_153365chr482675 2666 2379 2346 2085 1967 709 484 --12188 --
NM_153371chr1352188 1494 874 747 274 1171 ----
NM_153456chr1375445 4803 4245 3910 2227 1854 241 45851 2181 1878 1541 12122 16333
NM_153607chr542822 2591 2212 145 32561 1956 1227 22182 1154 --
NM_153682chr21----147 --
NM_153686chr462336 1984 541 370 255 61 1671 31945 1833 1772 --
NM_153688chr1631468 1293 599 --31456 735 247 11164
NM_153810chr1074940 4446 3812 3460 2032 1709 607 --11293 --
NM_153828chr22894 205 ----1662
NM_153831chr81272 --1157 --
NM_170600chr91359 ------
NM_170606chr71675 ------
NM_170674chr1531363 1061 937 ------
NM_170675chr1521039 737 1273 ----
NM_170676chr1521039 737 1273 ----
NM_170677chr1531363 1061 937 ------
NM_170709chr842319 2231 308 37 11965 21922 216 --
NM_170710chr412135 1649 2657 540 --
NM_170751chr621204 1196 ----1977
NM_170752chr621204 1196 ----1977
NM_170754chr12--1179 ----
NM_171998chrX72301 2283 2208 1826 366 355 258 --22226 447 --
NM_172020chr7--31845 1480 1391 ----
NM_172070chr222048 655 --21641 65 --
NM_172071chr197192 6405 5327 5274 2514 2383 1838 1491 1099 ----11387
NM_172103chr631086 619 282 11841 ----
NM_172105chr631086 619 282 11841 ----
NM_172216chr1282965 2377 2299 2232 2200 1862 1165 632 ------
NM_172218chr84664 335 299 217 ------
NM_172232chr175617 590 581 334 127 1324 ----
NM_172240chr1251288 1259 950 308 249 ------
NM_172315chr1531363 1061 937 ------
NM_172316chr1531363 1061 937 ------
NM_172373chr131271 1399 ----
NM_173054chr71195 --1718 --
NM_173087chr15----1491 --
NM_173088chr15----1491 --
NM_173089chr15----1491 --
NM_173090chr15----1491 --
NM_173164chr16----189 --
NM_173198chr942270 1027 961 24 --12723 --
NM_173200chr942270 1027 961 24 --12723 --
NM_173214chr1657356 2982 2364 1245 833 26959 2758 17863 --
NM_173355chr21290 --1769 1210
NM_173468chr445853 5059 4533 843 15836 24797 4297 --
NM_173469chr15------1159
NM_173470chrX22388 886 32575 1151 181 ----
NM_173519chr8--11876 1656 --
NM_173531chr1983599 2979 2972 2894 2839 2657 1306 486 22742 302 1524 --
NM_173552chr341589 422 225 197 22422 287 11979 --
NM_173557chr181543 ------
NM_173562chr662920 2576 2281 2259 1308 1140 --12952 --
NM_173576chr1022081 1631 --1276 21827 1653
NM_173582chr1156237 5093 4189 2000 1587 36061 5055 1669 33975 3963 172 --
NM_173607chr1442108 1516 338 35 --1577 --
NM_173642chr168699 7882 6773 3413 3402 1470 11770 --1762
NM_173683chr82164 37 --1185 --
NM_173797chr511324 ------
NM_173808chr184414 3052 3033 2785 1412 1058 599 551 23219 1094 13932 14399
NM_173822chr221946 293 11343 --22126 1545
NM_173829chr585377 4950 4761 4378 4007 3806 2027 1187 --1304 14415
NM_173848chr82618 181 ------
NM_174938chr9--1138 1170 1346
NM_175061chr7----11591 --
NM_175736chr1296609 6508 5820 5730 5581 5214 911 569 413 17091 17812 --
NM_175861chr12106008 5452 5126 4159 4048 2324 1347 1027 560 438 --14453 --
NM_175863chr61205 ------
NM_175866chr12921 582 --1435 --
NM_175876chr142505 1043 754 71 ----1161
NM_175910chr1912332 ------
NM_176081chr10105893 5785 4657 4409 4279 4060 3823 1965 1725 1460 --36010 5651 4423 --
NM_176083chr10105893 5785 4657 4409 4279 4060 3823 1965 1725 1460 --36010 5651 4423 --
NM_176812chr202658 281 ------
NM_177438chr1432896 1321 990 --1458 --
NM_177985chr251753 814 797 649 565 1208 ----
NM_177990chr201228 ------
NM_177995chr931871 1200 463 1184 169 --
NM_178009chr132459 98 ------
NM_178011chr1043018 1227 650 200 12499 ----
NM_178120chr2------11377
NM_178123chr23755 734 106 --1299 --
NM_178140chr542539 857 723 569 --2781 761 12465
NM_178151chrX96682 6216 5202 4949 2853 2569 2215 1994 737 --11638 16527
NM_178152chrX96682 6216 5202 4949 2853 2569 2215 1994 737 --11638 16527
NM_178153chrX96682 6216 5202 4949 2853 2569 2215 1994 737 --11638 16527
NM_178424chr5--1207 1513 --
NM_178470chrX41663 1485 686 350 ----1546
NM_178507chr111790 ------
NM_178566chr921588 195 ------
NM_178584chr231485 555 175 ----1961
NM_178585chr423018 982 1675 --12785
NM_178819chr81256 ------
NM_180989chr1321999 1786 --1545 --
NM_181265chr412135 1649 2657 540 --
NM_181351chr1111100 ----1513
NM_181354chr811366 11344 --11553
NM_181358chr163574 2981 1711 1670 1507 1158 14048 1947 --
NM_181361chr321427 78 ------
NM_181481chr1875549 1644 1326 907 859 120 106 16813 25001 1772 --
NM_181482chr1875549 1644 1326 907 859 120 106 16813 25001 1772 --
NM_181483chr1875549 1644 1326 907 859 120 106 16813 25001 1772 --
NM_181504chr574164 3353 2888 2588 831 206 95 --21113 867 --
NM_181523chr574164 3353 2888 2588 831 206 95 --21113 867 --
NM_181524chr574164 3353 2888 2588 831 206 95 --21113 867 --
NM_181655chr171202 --1296 --
NM_181659chr2043398 1091 555 118 12292 12466 --
NM_181659chr2043398 1091 555 118 12292 12466 --
NM_181674chr5----1371 --
NM_181675chr5----1371 --
NM_181676chr5----1371 --
NM_181677chr5----1371 --
NM_181678chr5----1371 --
NM_181726chr4--1204 160 --
NM_181787chr823204 3069 12990 11189 --
NM_181838chr531168 544 94 11245 11076 --
NM_181861chr1242648 1081 1043 541 ----12046
NM_181868chr1242648 1081 1043 541 ----12046
NM_181869chr1242733 1166 1128 626 ----12131
NM_181886chr421373 173 ----11040
NM_181887chr421373 173 ----11040
NM_181888chr421373 173 ----11040
NM_181889chr421373 173 ----11040
NM_181890chr421373 173 ----11040
NM_181891chr421373 173 ----11040
NM_181892chr421420 220 ----11087
NM_181893chr421373 173 ----11040
NM_182485chr4190 13765 ----
NM_182488chr131774 ------
NM_182493chr1664756 3525 1924 1544 699 426 11530 11114 --
NM_182503chr674730 4013 3764 3561 3426 1915 1785 24628 4399 1494 --
NM_182515chr1975690 5308 4611 1995 1380 1019 749 ----12472
NM_182551chr242775 2592 720 66 --23377 3299 --
NM_182569chr171241 ------
NM_182606chr41897 1136 ----
NM_182646chr4190 13765 ----
NM_182648chr14----2726 203 --
NM_182689chr11329 ------
NM_182690chr11391 ------
NM_182715chr73962 390 268 ------
NM_182756chr22562 151 ----2496 144
NM_182765chr1031979 1740 126 ------
NM_182767chr1251676 1619 1424 410 78 --2468 376 --
NM_182797chr20--1513 1316 --
NM_182898chr796438 6280 6008 5719 5075 4345 953 899 633 15026 26080 5844 --
NM_182899chr796438 6280 6008 5719 5075 4345 953 899 633 15026 26080 5844 --
NM_182907chr61505 136 ----
NM_182944chr14------192
NM_182948chr172940 2270 2055 945 820 381 25 ------
NM_182972chr132676 2105 275 12314 ----
NM_182975chr11776 ----11125
NM_182976chr12768 245 ------
NM_183004chr1493802 3621 3086 2671 1525 1051 727 388 335 13736 ----
NM_183043chr132929 916 --2402 365 --
NM_183044chr132929 916 --2402 365 --
NM_183244chr201446 ------
NM_183246chr201446 ------
NM_183353chrX1415 1396 ----
NM_183376chr1532498 2231 1740 22522 1025 ----
NM_183380chr63823 632 49 ------
NM_183397chr2083542 3312 3138 1935 1606 821 636 310 13485 24465 3397 --
NM_183398chr52209 192 ------
NM_183399chr52209 192 ------
NM_183400chr52209 192 ------
NM_183401chr52209 192 ------
NM_183419chr831139 378 78 --1418 --
NM_194071chr795224 4824 3850 3409 2170 2063 1905 1689 846 15208 1972 --
NM_194247chr264273 4031 3347 3080 3055 2935 14077 24182 3447 11807
NM_194250chr21175 ------
NM_194271chr122500 204 ------
NM_194278chr1453874 3786 2949 2745 1028 ------
NM_194285chr1132270 1124 692 --11339 1269
NM_194291chr832946 2811 1023 ----12415
NM_194298chr1031765 1290 1259 11981 ----
NM_194301chr14--2895 179 1981 --
NM_194317chr211746 12658 --11857
NM_194328chr932345 962 434 ------
NM_194329chr932345 962 434 ------
NM_194330chr932345 962 434 ------
NM_194332chr932345 962 434 ------
NM_194434chr1865438 3722 1860 1187 999 924 25734 2199 44635 4298 3965 131 --
NM_194454chr71572 --11326 21277 501
NM_194455chr71572 --11326 21277 501
NM_194456chr71572 --11326 21277 501
NM_194463chrX2495 208 1506 ----
NM_198077chr13510 126 65 ------
NM_198086chr1462234 1786 670 418 412 238 11475 ----
NM_198087chr162214 58 ----11269
NM_198088chr162214 58 ----11269
NM_198123chr8--31246 725 433 --1548
NM_198124chr8--31246 725 433 --1548
NM_198128chr183782 723 706 ----1177
NM_198268chr163574 2981 1711 1670 1507 1158 14048 1947 --
NM_198269chr163574 2981 1711 1670 1507 1158 14048 1947 --
NM_198273chr51934 12272 --1974
NM_198279chrX1494 ----11057
NM_198281chr453285 1364 1097 979 682 12659 13369 --
NM_198316chr12--1179 ----
NM_198320chr1294693 4443 4070 3278 2061 1047 1007 355 158 --14475 --
NM_198336chr731820 1614 1396 ------
NM_198353chr41208 ------
NM_198395chr51115 ------
NM_198399chr321398 324 21676 342 ----
NM_198400chr1532794 1837 288 1977 ----
NM_198465chrX62466 2019 1909 1136 629 46 --32738 1921 1061 --
NM_198467chr71631 ------
NM_198503chr121958 439 12083 ----
NM_198507chr5--2516 109 ----
NM_198513chr831956 1895 435 --1256 --
NM_198549chr142933 2596 2582 139 --21194 790 --
NM_198570chr71313 ------
NM_198715chr1166055 5787 5670 4938 4910 4426 3994 3856 2397 1803 1716 1670 1102 1064 706 574 --36115 4792 3822 --
NM_198793chr374069 3529 3410 3115 2802 1292 158 13985 24148 3083 12749
NM_198794chr1431339 1303 1086 ------
NM_198859chr353900 3760 3316 2007 1351 23837 396 14491 --
NM_198900chr1296609 6508 5820 5730 5581 5214 911 569 413 17091 17812 --
NM_199039chr451141 1023 690 397 250 --11000 --
NM_199040chr1273827 3775 3721 3368 2639 1513 192 ------
NM_199133chr52406 251 ------
NM_199138chr134386 271 224 74 ------
NM_199144chr2021576 1042 --1195 --
NM_199189chr51754 2258 188 ----
NM_199203chr2021576 1042 --1195 --
NM_199229chr2----21460 451 --
NM_199246chr52818 119 3870 432 91 ----
NM_199320chr452482 2413 1924 510 304 22556 101 21107 1097 --
NM_199320chr452482 2413 1924 510 304 22556 101 21107 1097 --
NM_199324chr432790 2413 2351 --3343 335 260 --
NM_199328chr211872 ----1160
NM_199421chr14125060 5035 4902 4814 4666 4205 3841 3447 3353 1377 1023 931 ------
NM_199436chr262617 2466 2135 980 480 94 1246 ----
NM_199437chr1152140 1936 1876 271 53 ------
NM_199438chr1152140 1936 1876 271 53 ------
NM_199439chr1152140 1936 1876 271 53 ------
NM_199482chr2--21711 162 1172 --
NM_201266chr222839 2306 22649 2409 ----
NM_201278chr1122015 1544 --11493 --
NM_201279chr222839 2306 22649 2409 ----
NM_201280chr641390 1306 652 572 ------
NM_201281chr1122015 1544 --11493 --
NM_201629chr92667 538 ------
NM_203282chr19--11248 --11524
NM_203350chr151671 1425 1400 484 345 --11078 --
NM_203403chr93980 271 171 ------
NM_203406chr532920 2161 138 --1203 --
NM_203434chr93965 926 113 ------
NM_203446chr2142503 1932 899 202 ------
NM_203458chr143638 3391 1029 654 --23422 297 --
NM_203459chr142309 1846 193 120 --2848 707 --
NM_203463chr264161 4115 3923 2996 1305 392 1691 21296 63 --
NM_203488chr14126 ----1314
NM_203506chr1712162 ------
NM_206594chr142701 2234 1278 905 --11201 --
NM_206595chr142701 2234 1278 905 --11201 --
NM_206853chr653973 3529 2704 1588 314 ------
NM_206854chr685234 4790 3965 3401 1575 1123 936 514 11051 ----
NM_206855chr6116199 5755 4930 4366 3943 2540 2088 1901 1479 646 601 12016 ----
NM_206866chr2142825 2363 610 297 1585 13275 --
NM_206876chr273569 3559 3315 3196 385 189 62 --12841 --
NM_206907chr531225 50 37 12540 --12429
NM_206909chr8108092 7922 7009 6920 6893 6761 6465 5508 1869 1793 16350 28283 1310 12327
NM_207303chr1053691 3324 3057 395 228 ------
NM_207304chr131883 --1604 --
NM_207337chr122879 364 2352 126 ----
NM_207361chr1346255 5065 2389 1335 16161 11540 --
NM_207372chr1012394 --11656 --
NM_207406chr496382 6363 5954 5213 1955 1387 991 343 278 --1432 --
NM_207435chr12----122 --
NM_207520chr22894 205 ----1662
NM_207521chr22894 205 ----1662
NM_207645chr111490 ----11049
NM_207647chr922570 2249 22427 2042 1532 --
NM_207660chr1421403 170 ------
NM_207661chr1421403 170 ------
NM_207662chr1421403 170 ------
NM_212460chr732012 596 519 11715 ----
NM_212465chr15----1491 --
NM_212471chr1732014 705 384 ------
NM_212472chr1732014 705 384 ------
NM_212558chr973659 3152 2946 1106 639 393 159 --2413 373 --
NM_213589chr275123 4905 4654 4174 1700 1456 389 15468 1773 --
NM_213609chr31844 ------