TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-211-3p
miRNA Sequence: GCAGGGACAGCAAAGGGGUGC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr531333 178 25 ------
NM_000038chr521496 1281 21644 1587 1428 --
NM_000052chrX73371 3321 1112 745 570 562 432 --1576 --
NM_000053chr1371768 1541 677 526 503 489 118 11566 42072 1593 604 256 --
NM_000081chr111231 --11362 --
NM_000084chrX206921 6547 6275 5939 5875 5819 5806 5372 5357 4853 2548 2215 2096 1999 1750 1219 725 532 161 124 21864 829 25229 538 --
NM_000088chr172969 317 1999 ----
NM_000092chr284243 3052 3016 2933 1633 593 156 116 ------
NM_000097chr31783 --1488 --
NM_000109chrX21067 49 ----11964
NM_000110chr12932 74 ------
NM_000114chr201207 1399 1454 --
NM_000125chr651559 1287 1202 1161 37 1841 --1794
NM_000129chr61982 ----11323
NM_000134chr42423 111 ------
NM_000138chr1552448 1783 1764 1012 856 12232 ----
NM_000141chr1041313 1038 497 309 1994 ----
NM_000151chr1731683 1364 1272 --11777 --
NM_000161chr1431393 713 118 --1653 11962
NM_000165chr621042 463 1418 1472 --
NM_000167chrX171 --1381 --
NM_000168chr763321 3218 2586 2237 2221 1293 ------
NM_000189chr262223 1970 1880 756 594 47 12307 2303 142 --
NM_000192chr1231506 1490 472 1549 1389 --
NM_000202chrX103917 3886 3544 3298 3253 2638 2547 2500 2446 1525 22616 1508 --1433
NM_000208chr1994544 4398 3986 3556 3515 1370 560 395 125 11842 21297 1034 14011
NM_000212chr1772238 1965 1811 1745 984 900 292 --2654 58 1381
NM_000216chrX43903 3094 1626 1354 31599 764 318 ----
NM_000217chr1274205 3785 3691 2077 1879 1853 1266 43822 3535 2107 1617 ----
NM_000220chr113803 704 35 1911 ----
NM_000222chr452097 1371 1303 428 292 ----12006
NM_000227chr181415 ------
NM_000232chr442691 2674 914 533 12197 ----
NM_000237chr841345 755 606 272 21446 120 --11418
NM_000245chr722103 1966 11803 ----
NM_000248chr332921 1954 357 ------
NM_000253chr411049 179 ----
NM_000259chr1596010 5802 4438 4006 3882 2259 1869 1155 908 24522 1994 ----
NM_000266chrX2401 209 ------
NM_000267chr1783461 3442 3318 3288 2441 727 106 65 --171 --
NM_000276chrX61713 798 511 437 407 322 11509 1598 1843
NM_000278chr1061598 1568 888 877 836 544 21962 913 31692 1669 1653 --
NM_000284chrX61934 1908 1869 1501 1249 268 ------
NM_000288chr6----1262 --
NM_000297chr431967 1823 495 ------
NM_000304chr172940 925 ------
NM_000314chr1012679 22561 133 ----
NM_000318chr852392 1052 914 654 505 22679 762 12719 --
NM_000319chr125406 366 251 210 168 1204 ----
NM_000332chr6117047 6904 6372 5816 5555 2853 1687 1567 1163 435 426 36656 5473 2298 ----
NM_000334chr1792207 2127 2089 1944 1849 1809 760 563 328 1118 11468 --
NM_000337chr5136517 6502 6469 6111 5782 4262 4237 4162 2149 1379 1258 776 502 11080 1838 15117
NM_000340chr321115 1085 21015 73 ----
NM_000346chr1721580 361 ------
NM_000361chr2042125 1994 1738 447 11933 12060 --
NM_000362chr2263628 2270 1434 1293 1250 825 12579 11256 1681
NM_000367chr632177 1763 1432 22122 1457 ----
NM_000368chr9104810 4119 1815 1407 709 453 312 266 132 81 13400 24092 2957 --
NM_000378chr112827 784 --1183 --
NM_000379chr251214 1178 1169 417 351 ----11073
NM_000399chr102194 91 2940 820 1857 --
NM_000408chr222180 800 ------
NM_000412chr31272 --1299 --
NM_000428chr1472470 2442 2257 2135 1827 433 259 1575 ----
NM_000430chr1762532 2523 2472 1177 342 99 ------
NM_000435chr194951 869 130 67 --1816 --
NM_000439chr542434 538 418 223 22386 1031 11859 --
NM_000441chr762352 2123 1744 1434 299 21 ------
NM_000442chr1771240 917 806 446 248 65 26 11148 1475 --
NM_000447chr1----1414 --
NM_000449chr161268 1052 1024 979 434 239 ------
NM_000461chr373675 3581 1760 1712 1297 1228 1118 --2301 131 --
NM_000476chr951347 1286 553 267 193 1610 ----
NM_000489chrX32911 703 262 1175 1537 --
NM_000503chr821382 1329 1396 ----
NM_000505chr5129 ------
NM_000522chr71412 ------
NM_000525chr1121483 1323 --1197 1431
NM_000533chrX31503 474 161 21834 765 1221 --
NM_000544chr6_cox_hap172748 2622 2553 2326 494 373 209 33108 2290 558 160 1104
NM_000555chrX187298 7290 7004 6972 5930 5665 5624 5575 5529 4830 2944 2757 1617 923 843 699 447 165 22309 2297 ----
NM_000557chr203420 52 24 1147 1426 --
NM_000578chr241546 1441 1329 1307 ----1104
NM_000598chr711528 11357 ----
NM_000599chr254052 3066 2834 1063 637 14591 ----
NM_000610chr1172262 2200 1941 1049 745 603 430 1320 1381 --
NM_000618chr1264946 4062 2384 2060 1264 762 22393 353 1290 --
NM_000618chr1264946 4062 2384 2060 1264 762 22393 353 1290 --
NM_000621chr1351323 1286 1152 970 568 ------
NM_000633chr1875229 4449 3622 3399 3199 2079 562 --1538 --
NM_000635chr1941586 602 323 270 --2495 234 --
NM_000663chr1653102 1255 1142 750 195 11176 1356 12536
NM_000668chr441362 1235 473 294 11374 ----
NM_000684chr102812 198 1344 ----
NM_000687chr203675 282 120 1465 2532 39 --
NM_000693chr1521566 487 ------
NM_000719chr12136655 6630 5935 5704 5116 4920 4767 4474 4422 4225 2537 1105 47 12649 21344 561 --
NM_000723chr1771638 1390 1296 1075 504 472 406 ------
NM_000725chr123831 782 328 1873 ----
NM_000726chr221028 373 --11071 --
NM_000756chr8----1442 --
NM_000783chr102397 217 ------
NM_000793chr1454942 4052 3213 1492 1126 23317 1145 13278 1462
NM_000795chr113710 286 43 1314 ----
NM_000800chr541390 641 420 281 ------
NM_000801chr202984 29 2893 102 ----
NM_000809chr4129030 9014 7533 6925 6760 6009 3670 3323 3207 3173 755 470 48840 3412 634 161 ----
NM_000813chr5105485 5295 5010 4640 4624 4329 1848 1089 591 408 --45275 5078 1075 193 --
NM_000814chr1563192 3173 2649 1676 1361 561 43873 3384 3108 1314 12798 --
NM_000816chr5--1667 1648 --
NM_000817chr221094 997 ------
NM_000818chr101526 ----1128
NM_000826chr452403 2057 1813 459 117 ------
NM_000827chr572001 1919 1832 1712 772 577 176 1148 --1290
NM_000829chr1132036 1859 1780 12253 ----
NM_000831chr1155912 5671 5627 5595 4616 4156 4100 2049 1764 1503 1065 994 910 725 706 14106 36073 5601 4304 --
NM_000833chr1621285 231 ------
NM_000838chr652612 1789 626 546 239 ------
NM_000840chr7----1383 --
NM_000842chr112518 273 ------
NM_000861chr352345 2118 2092 1832 1730 ------
NM_000866chr32471 249 21514 1349 1570 --
NM_000868chrX42584 1715 785 621 ------
NM_000870chr561350 1148 561 427 249 206 --2433 269 1279
NM_000872chr1041442 1138 1002 69 21469 1419 1546 --
NM_000875chr15166935 5744 4923 4895 4573 4377 2801 2391 1525 1480 1131 847 342 212 179 153 25845 5173 32179 419 308 --
NM_000876chr631233 579 450 1175 ----
NM_000891chr1763058 2968 2844 1124 995 918 ------
NM_000899chr1221704 1678 24020 611 1421 --
NM_000901chr42494 40 --21003 244 --
NM_000917chr102874 793 ------
NM_000919chr51518 ------
NM_000922chr111145 ------
NM_000933chr2041383 545 518 177 ------
NM_000945chr251495 821 531 112 84 151 11561 --
NM_000948chr6137 ------
NM_000956chr142286 62 ------
NM_000958chr51484 1975 ----
NM_000961chr2083671 2440 1359 668 531 512 440 122 23939 3731 ----
NM_000962chr993016 2275 1998 1923 1252 935 886 498 199 1556 32786 2242 416 --
NM_000963chr131986 988 712 11881 ----
NM_000964chr1751183 1172 162 129 52 ------
NM_000966chr122989 128 2362 176 ----
NM_000983chr151376 1309 414 81 73 ------
NM_000990chr11103995 3914 2491 1428 1048 949 645 462 387 46 1551 13349 --
NM_001001132chr2151332 1033 927 578 263 --1939 --
NM_001001323chr1222937 818 --1767 --
NM_001001331chr342740 1079 269 167 12114 ----
NM_001001342chr1061226 1192 1058 1039 1020 325 1171 ----
NM_001001344chrX32294 2191 852 12051 12059 --
NM_001001389chr1172262 2200 1941 1049 745 603 430 1320 1381 --
NM_001001390chr1172262 2200 1941 1049 745 603 430 1320 1381 --
NM_001001391chr1172262 2200 1941 1049 745 603 430 1320 1381 --
NM_001001392chr1172308 2246 1987 1095 791 649 476 1366 1427 --
NM_001001394chr23245 64 53 ------
NM_001001433chr2073141 2948 2856 2709 2188 874 522 ----12923
NM_001001436chr161193 ------
NM_001001481chr8103198 3087 2619 2547 2430 1239 1090 896 722 329 1732 ----
NM_001001484chr1021523 873 22476 150 ----
NM_001001522chr113323 163 45 ------
NM_001001549chr742608 2376 2152 1013 1855 ----
NM_001001550chr742608 2376 2152 1013 1855 ----
NM_001001555chr742608 2376 2152 1013 1855 ----
NM_001001557chr812181 --2760 521 --
NM_001001664chr2--22858 1000 12641 --
NM_001001701chr452270 2194 2170 2139 1476 ------
NM_001001713chr212337 71 ------
NM_001001790chr92386 64 ------
NM_001001791chr1041579 1545 283 273 --140 --
NM_001001890chr2143995 3064 2869 2717 ------
NM_001001924chr851861 1771 1490 1314 684 129 1669 --
NM_001001925chr851861 1771 1490 1314 684 129 1669 --
NM_001001931chr851861 1771 1490 1314 684 129 1669 --
NM_001001936chr1041059 975 467 163 ----21107 879
NM_001001971chr1041285 1238 514 70 ------
NM_001001995chrX31806 1560 1335 1579 ----
NM_001002032chr17163 --1278 170
NM_001002233chr831826 1450 1431 --21953 795 --
NM_001002243chr21298 ------
NM_001002257chr293246 3218 2874 2563 2259 723 476 469 421 22765 183 ----
NM_001002259chr122127 110 ------
NM_001002265chr103170 87 25 --1266 --
NM_001002266chr103170 87 25 --1266 --
NM_001002295chr104979 972 246 50 --142 --
NM_001002762chr1052859 2539 2162 940 263 ------
NM_001002838chrX31348 1162 610 ------
NM_001002840chr72589 165 ------
NM_001002860chr1454290 4004 3794 743 318 --13451 14280
NM_001002909chr1731577 219 198 --11834 --
NM_001003406chr2252476 2259 1251 697 457 --33081 2560 1058 12767
NM_001003407chr10104936 4860 3415 3170 3126 1702 1443 1075 972 611 44794 4579 3893 1740 24759 757 --
NM_001003408chr10104936 4860 3415 3170 3126 1702 1443 1075 972 611 44794 4579 3893 1740 24759 757 --
NM_001003652chr18178410 8332 8316 7918 7404 7386 6326 6134 5836 5710 2711 2029 1617 867 529 456 73 38249 5722 609 36436 6288 1825 --
NM_001003674chr1845618 4545 2507 498 11582 14720 --
NM_001003675chr1845618 4545 2507 498 11582 14720 --
NM_001003676chr1171041 755 645 365 224 161 147 ------
NM_001003679chr121550 293 1618 ----
NM_001003690chr64416 333 311 97 1152 ----
NM_001003698chr631551 1365 1238 --1583 --
NM_001003699chr631551 1365 1238 --1583 --
NM_001003712chr122786 291 11258 ----
NM_001003760chr633396 943 159 23267 2842 ----
NM_001003794chr3133036 2771 2475 2261 2109 2098 1904 1199 1029 665 578 381 333 22301 416 22445 2439 --
NM_001003796chr223923 352 28 --1831 --
NM_001003800chr993349 3284 1487 1311 1247 1044 819 801 396 ------
NM_001003810chr41154 ----1130
NM_001003891chr223911 597 114 ------
NM_001003940chr15113649 3613 3588 2627 1430 1258 1048 1011 600 338 180 1140 ----
NM_001003942chr15113649 3613 3588 2627 1430 1258 1048 1011 600 338 180 1140 ----
NM_001003943chr15113653 3617 3592 2631 1434 1262 1052 1015 604 342 184 1144 ----
NM_001004065chr953895 3171 3033 426 339 23747 2512 --13616
NM_001004196chr33908 804 34 --1943 --
NM_001004304chr1293224 2430 2305 2169 2136 1255 1103 935 225 11139 42286 2093 2073 245 --
NM_001004313chr1722049 1921 1747 ----
NM_001004342chr1145054 4776 4684 4386 4202 3814 3808 2103 2007 1875 1615 1195 802 316 14749 65759 5093 1974 1819 1752 1601 --
NM_001004346chr421030 167 ------
NM_001004360chr241678 1520 1294 235 ----1390
NM_001004419chr12104435 4255 4210 4101 3597 1506 1426 1408 522 491 24094 4030 ----
NM_001005158chr32452 390 ------
NM_001005159chr32452 390 ------
NM_001005207chr171221 ------
NM_001005366chr122186 88 2886 388 ----
NM_001005375chrY21827 1785 ------
NM_001005386chr242163 1970 821 103 --11556 --
NM_001005404chr1784434 3669 3505 3362 3319 1381 228 176 33014 545 275 21734 734 1565
NM_001005463chr1031840 840 732 ------
NM_001005473chr545515 2047 1545 1107 26253 1271 --1102
NM_001005474chr321238 539 --1434 --
NM_001005476chr21748 ------
NM_001005502chr1284795 4423 3418 1685 1609 1161 906 523 21221 121 14187 --
NM_001005505chr381799 1700 1476 1164 1140 379 328 97 ------
NM_001005527chr341201 384 233 171 --1410 --
NM_001005609chrX83554 3519 3140 2486 1030 778 541 38 --33326 2926 293 --
NM_001005746chr221028 373 --11071 --
NM_001005747chr221028 373 --11071 --
NM_001005845chr83342 227 188 ------
NM_001005849chr171398 ------
NM_001005861chr31791 ------
NM_001006115chr382639 2626 2358 2252 2129 1975 1816 1113 1672 12155 --
NM_001006612chrX--165 1180 --
NM_001006613chrX--165 1180 --
NM_001006614chrX--165 1180 --
NM_001006617chr951302 1110 1093 999 335 ------
NM_001006619chr951302 1110 1093 999 335 ------
NM_001006620chr951302 1110 1093 999 335 ------
NM_001006621chr951302 1110 1093 999 335 ------
NM_001006656chr1931220 583 296 11697 ----
NM_001006684chrX1125 ------
NM_001006938chrX3789 746 110 181 1581 --
NM_001006946chr241422 1376 1228 726 2182 63 ----
NM_001007023chr1454942 4052 3213 1492 1126 23317 1145 13278 1462
NM_001007024chr1754218 3925 3092 537 179 11559 34103 999 883 --
NM_001007025chr1754218 3925 3092 537 179 11559 34103 999 883 --
NM_001007067chr821015 997 11005 ----
NM_001007068chr821015 997 11005 ----
NM_001007069chr821015 997 11005 ----
NM_001007070chr821015 997 11005 ----
NM_001007098chr13939 119 112 ------
NM_001007156chr156750 721 682 424 401 22 ------
NM_001007226chr1771492 1290 1156 1141 1110 1009 495 11302 ----
NM_001007227chr1771492 1290 1156 1141 1110 1009 495 11302 ----
NM_001007228chr1771492 1290 1156 1141 1110 1009 495 11302 ----
NM_001007229chr1771492 1290 1156 1141 1110 1009 495 11302 ----
NM_001007230chr1771492 1290 1156 1141 1110 1009 495 11302 ----
NM_001007237chr142737 938 751 58 ------
NM_001007245chr71185 ------
NM_001007246chr212172 121 ------
NM_001007277chr1131031 430 184 2305 256 2393 278 --
NM_001007471chr91635 181 ----
NM_001007538chr13123 11171 ----
NM_001007544chr12503 349 ------
NM_001007553chr121141 446 --11037 --
NM_001007794chr11539 ------
NM_001008239chr1893227 2755 2357 2351 1389 663 619 504 462 --1930 --
NM_001008392chr383577 3391 3333 2821 2624 1161 993 78 1803 23366 3031 12220
NM_001008539chr895300 5066 4275 4236 4206 3653 2071 1100 610 ------
NM_001008541chr1022273 2258 21801 391 12010 --
NM_001008541chr1022273 2258 21801 391 12010 --
NM_001008564chr131400 11935 ----
NM_001008660chr1131526 372 89 --11280 11039
NM_001008701chr19142968 2895 2887 2848 2804 2495 2481 1199 1183 818 529 522 503 367 1604 1633 --
NM_001008707chr1411386 ------
NM_001008708chr22566 491 ------
NM_001008738chr532344 2254 1050 22366 2327 ----
NM_001008895chr1331221 547 291 1421 ----
NM_001008925chr463437 2566 1201 346 240 60 22739 1214 11041 12929
NM_001009185chr51130 1571 ----
NM_001009554chr4114576 4032 2908 1765 1373 1283 1064 955 525 266 51 13281 ----
NM_001009554chr4114576 4032 2908 1765 1373 1283 1064 955 525 266 51 13281 ----
NM_001009555chr421091 23 1681 ----
NM_001009566chr14908 528 521 225 --11337 --
NM_001009569chr101118 ----11120
NM_001009899chr365840 4727 4700 2409 1974 1236 15395 25225 1179 --
NM_001009958chr71479 1467 --1493
NM_001009959chr242510 1872 535 397 ------
NM_001009960chr732699 1787 769 --12107 --
NM_001009993chr2114275 3928 3686 3665 3474 3028 2881 1566 985 884 791 --14141 --
NM_001010852chr61148 ------
NM_001010861chr132775 2595 2115 --12553 --
NM_001010862chrX103133 3099 2878 2826 2495 2145 1102 733 469 197 ------
NM_001010867chr1156493 6098 5770 5099 4520 4477 2456 2313 2089 2047 1972 1519 640 213 204 11762 66055 5921 5718 1908 389 317 --
NM_001010888chrX83762 3308 3145 1582 1261 1065 1015 478 --13042 --
NM_001010895chr91458 1378 1778 1785
NM_001010917chr1082068 1924 1717 1538 602 470 184 155 2795 214 11813 --
NM_001010924chr1061007 996 853 774 247 135 ------
NM_001010927chr62569 103 ------
NM_001010971chr12964 937 --1884 --
NM_001010980chr1113363 2983 2729 2489 2261 1051 888 730 521 197 74 1136 ----
NM_001010984chr13511 278 33 22156 256 ----
NM_001011513chr494023 3107 3034 2857 2802 1596 1249 348 211 22945 256 ----
NM_001011537chr382162 1888 1672 1607 1495 915 401 265 ------
NM_001011658chrX42105 1962 1954 201 ------
NM_001011666chr774735 4510 4439 4236 2408 2099 54 25142 1721 --11700
NM_001011708chr252886 2711 1162 1144 882 11956 11168 --
NM_001011713chr1421384 341 ------
NM_001012267chr941565 637 472 439 --2610 383 --
NM_001012393chr1154846 4186 3790 3613 3525 --11435 --
NM_001012398chr162170 35 ------
NM_001012420chr151731 --42028 1865 1037 178 --
NM_001012423chr151731 --42028 1865 1037 178 --
NM_001012478chr193586 490 470 ------
NM_001012512chr18194 ------
NM_001012513chr181105 ------
NM_001012514chr25196 157 126 61 35 --11059 --
NM_001012516chr25196 157 126 61 35 --11059 --
NM_001012643chr196511 194 153 129 101 73 ----1531
NM_001012732chr41157 ----11219
NM_001012753chr1931106 477 125 ------
NM_001012755chrX51725 1375 297 212 47 11096 34365 3100 1167 --
NM_001012756chr1932996 1199 110 12560 1276 --
NM_001012761chr541078 957 478 402 --22288 245 --
NM_001012968chrX72688 2506 2420 2145 531 521 317 1951 1928 12178
NM_001012977chrX51175 1163 897 289 130 11318 ----
NM_001013031chr1073313 2622 1096 841 654 546 454 ------
NM_001013398chr711528 11357 ----
NM_001013399chr61922 ------
NM_001013415chr421063 49 ------
NM_001013437chr181457 ------
NM_001013438chr32269 169 ------
NM_001013615chr171215 1082 1074 818 421 189 150 --31198 850 162 --
NM_001013622chr471162 379 317 255 193 132 70 --21130 926 --
NM_001013624chr173515 425 45 3874 866 375 ----
NM_001013635chr1251184 859 829 285 257 --1880 --
NM_001013690chr1261769 1012 573 521 387 36 11543 1538 1554
NM_001013693chr142280 1902 1832 87 1261 42689 2186 2138 307 1852
NM_001013693chr142280 1902 1832 87 1261 42689 2186 2138 307 1852
NM_001014797chr1077917 7208 5479 2781 2771 2344 1808 47243 3029 2499 2103 11542 --
NM_001014809chr45823 339 291 191 62 1327 ----
NM_001014812chr15------1114
NM_001014839chr14909 767 740 733 168 ----
NM_001014841chr14909 767 740 733 168 ----
NM_001014972chr21234 ------
NM_001015045chr441916 464 389 359 1787 1682 --
NM_001015048chr1453255 3150 2476 1196 239 --13139 --
NM_001015049chr1453255 3150 2476 1196 239 --13139 --
NM_001015053chr17111544 1531 1496 1453 1114 543 275 265 249 234 105 --11595 --
NM_001015877chrX32326 812 705 --33028 2635 556 --
NM_001015880chr1021367 1131 21283 498 ----
NM_001015882chr9------1868
NM_001015887chr32732 440 21555 624 ----
NM_001017368chr1782512 2185 2091 1003 768 552 481 442 1313 11027 --
NM_001017371chr2164 ------
NM_001017395chr383219 2975 2834 2553 2387 523 265 240 --11289 --
NM_001017415chr11117 ------
NM_001017416chr11117 ------
NM_001017440chr7247795 7592 7451 7337 6740 6555 6372 6253 6188 5564 3178 2820 2148 2072 1867 1852 1615 1607 1554 1012 900 686 426 183 32159 1764 1342 11045 11595
NM_001017523chr1221897 1802 11496 1141 --
NM_001017962chr102874 793 ------
NM_001017973chr55385 84 72 33 27 ------
NM_001017974chr55385 84 72 33 27 ------
NM_001017979chr43232 168 96 --1285 --
NM_001017981chr224623 572 247 41 ------
NM_001017995chr574553 3734 2975 1420 734 370 256 --24098 38 --
NM_001017999chr142151 1718 474 249 --1897 --
NM_001017999chr142151 1718 474 249 --1897 --
NM_001018000chr142151 1718 474 249 --1897 --
NM_001018000chr142151 1718 474 249 --1897 --
NM_001018001chr142151 1718 474 249 --1897 --
NM_001018009chr32829 281 ------
NM_001018050chr22123397 2766 2567 2489 2401 2354 1281 1122 987 686 333 253 22550 2527 11385 --
NM_001018052chr22123397 2766 2567 2489 2401 2354 1281 1122 987 686 333 253 22550 2527 11385 --
NM_001018053chr161903 1547 551 536 256 207 --1413 --
NM_001018054chr11992 ------
NM_001018064chr961781 1514 725 437 286 239 --11341 --
NM_001018065chr985737 5688 5630 4904 4616 895 759 687 34928 3801 426 24115 1103 --
NM_001018066chr985737 5688 5630 4904 4616 895 759 687 34928 3801 426 24115 1103 --
NM_001018072chr1221897 1802 11496 1141 --
NM_001018108chr1531900 233 142 1278 1893 --
NM_001018111chr753069 1406 1398 974 890 33601 2551 1014 ----
NM_001020658chr121657 1488 ------
NM_001020658chr121657 1488 ------
NM_001020818chr19101875 1838 1823 1735 1549 1185 571 215 153 110 --21849 543 --
NM_001020819chr19101875 1838 1823 1735 1549 1185 571 215 153 110 --21849 543 --
NM_001020820chr19101875 1838 1823 1735 1549 1185 571 215 153 110 --21849 543 --
NM_001020821chr19101875 1838 1823 1735 1549 1185 571 215 153 110 --21849 543 --
NM_001023560chr61126 1156 ----
NM_001023567chr1521721 934 --21886 178 --
NM_001023587chr31338 1716 ----
NM_001024218chr14--1852 ----
NM_001024455chrX51652 1033 718 533 336 2837 391 12256 --
NM_001024463chr1541050 736 367 101 1403 ----
NM_001024649chr542482 2195 541 463 11839 ----
NM_001024660chr321116 360 21219 110 ----
NM_001024666chrX3543 536 447 --1115 --
NM_001024680chr251668 1453 1408 1351 1294 ----11186
NM_001024808chr1282366 2130 2020 1902 1815 893 739 542 12208 1222 --
NM_001024809chr1751183 1172 162 129 52 ------
NM_001024847chr352292 933 598 124 95 1501 1672 --
NM_001024855chr321502 156 ------
NM_001024934chr6146 165 ----
NM_001024935chr6146 165 ----
NM_001024936chr6146 165 ----
NM_001024948chr143489 2484 1157 328 13295 --11291
NM_001025068chr321670 144 --11268 --
NM_001025069chr321670 144 --11268 --
NM_001025076chr10105887 5521 4804 4798 4690 3963 1874 1532 502 22 21950 1292 35554 2106 89 15793
NM_001025077chr10147245 6879 6162 6156 6048 5321 2890 1860 1390 1171 979 950 444 22 12650 26912 1447 17151
NM_001025079chr373356 2714 2620 2584 2554 1513 658 12660 ----
NM_001025081chr184469 306 243 220 11005 --11561
NM_001025090chr184469 306 243 220 11005 --11561
NM_001025092chr184469 306 243 220 11005 --11561
NM_001025101chr184469 306 243 220 11005 --11561
NM_001025107chr182679 2316 2100 1943 1799 947 687 480 22492 2268 ----
NM_001025107chr182679 2316 2100 1943 1799 947 687 480 22492 2268 ----
NM_001025109chr16957 420 330 200 182 52 --21042 930 --
NM_001025233chr1242281 1711 1074 458 22434 628 11015 --
NM_001025248chr1531286 1164 495 ------
NM_001025249chr1531286 1164 495 ------
NM_001025252chr853003 2269 393 307 211 --12263 --
NM_001025253chr853003 2269 393 307 211 --12263 --
NM_001025366chr641804 330 244 133 11420 ----
NM_001025366chr641804 330 244 133 11420 ----
NM_001025367chr641804 330 244 133 11420 ----
NM_001025367chr641804 330 244 133 11420 ----
NM_001025368chr641804 330 244 133 11420 ----
NM_001025368chr641804 330 244 133 11420 ----
NM_001025369chr641820 346 260 149 11436 ----
NM_001025369chr641820 346 260 149 11436 ----
NM_001025370chr641804 330 244 133 11420 ----
NM_001025370chr641804 330 244 133 11420 ----
NM_001025580chrX73742 3486 2616 385 346 322 35 ------
NM_001025595chr411561 --1493 --
NM_001025596chr113472 111 46 1129 ----
NM_001025603chr161268 1052 1024 979 434 239 ------
NM_001025780chr9--11378 ----
NM_001029835chr72402 342 ------
NM_001029858chr632122 844 62 22156 676 32572 2550 733 --
NM_001029863chr641194 1161 1010 505 1434 1535 --
NM_001029871chr2061742 1434 569 295 283 23 21734 442 ----
NM_001029875chr552659 2234 2077 1861 529 11927 ----
NM_001029883chr263074 2504 2381 1959 652 519 1345 ----
NM_001029884chr642609 1857 650 337 12494 ----
NM_001029955chr443236 2835 486 208 ----1643
NM_001029998chr431126 1006 288 1526 ----
NM_001030006chr1792237 2132 1998 1870 1073 620 561 246 179 12509 ----
NM_001030007chr1663741 3015 1451 1305 412 295 12824 1372 --
NM_001030055chr1431634 1477 280 1988 ----
NM_001030272chr111423 ------
NM_001030273chr111423 ------
NM_001030287chr12874 90 ------
NM_001031680chr182255 2021 1940 1841 1629 781 642 176 12115 31997 1761 939 --
NM_001031685chr13340 133 42 ------
NM_001031690chr762244 2102 2060 1172 841 451 --22786 2054 12279
NM_001031695chr2265189 5148 4983 4382 3852 1610 --44069 3565 1139 796 44873 4848 4177 1771
NM_001031711chr561598 1483 1209 590 308 227 --11434 --
NM_001031804chr1634122 3464 1227 ------
NM_001031812chr532319 1428 72 1476 ----
NM_001032221chr951788 1658 1418 499 79 --2422 416 --
NM_001032280chr641493 1337 637 95 --1684 --
NM_001032282chr811275 ------
NM_001032283chr1221095 409 ------
NM_001032284chr1221095 409 ------
NM_001032288chr2031139 1076 409 --2999 372 --
NM_001032293chr171493 1195 ----
NM_001032296chr1342745 2223 911 186 11031 22140 1914 --
NM_001032363chr152115 2001 1879 1771 182 1331 1799 1269
NM_001032363chr152115 2001 1879 1771 182 1331 1799 1269
NM_001032393chrX1718 ------
NM_001032394chr621050 26 1670 11062 --
NM_001032730chr11683 ------
NM_001032999chr20134100 3799 3410 3343 2044 1890 1335 1189 912 256 246 202 164 45101 1195 803 327 ----
NM_001033025chr151113 507 360 237 111 --11163 --
NM_001033044chr131654 512 346 11520 --1631
NM_001033045chr264074 3168 1016 459 326 117 33976 1160 102 ----
NM_001033047chr452177 865 591 322 257 1193 ----
NM_001033049chr2182253 1733 928 749 607 574 552 236 1613 21954 1702 --
NM_001033056chr131654 512 346 11520 --1631
NM_001033057chr342045 2039 1833 666 ------
NM_001033059chr661549 1443 658 638 564 224 --1759 --
NM_001033081chr121817 227 2458 201 1418 --
NM_001033082chr121817 227 2458 201 1418 --
NM_001033087chr2062895 2160 1019 784 672 251 --12038 --
NM_001033112chr51726 ------
NM_001033117chr3114435 4291 3928 3899 3888 3550 3393 3380 1916 1087 893 34525 4406 3660 11260 --
NM_001033551chr1792617 2582 1057 1036 979 679 575 501 456 3435 302 187 23561 668 11411
NM_001033557chr231301 1243 37 ------
NM_001033564chr62420 358 ------
NM_001033566chr172667 22 ------
NM_001033568chr172667 22 ------
NM_001033723chr882631 2610 2467 2405 2197 1988 1768 745 ------
NM_001033756chr641738 264 178 67 11354 ----
NM_001033756chr641738 264 178 67 11354 ----
NM_001033925chr1021342 50 22144 449 ----
NM_001034837chr54741 658 289 137 ----1183
NM_001034838chr54741 658 289 137 ----1183
NM_001034845chr421438 162 1464 ----
NM_001034850chr511519 11600 ----
NM_001034915chr831239 557 449 ------
NM_001034954chr1062668 2206 1291 1028 786 495 12008 --12119
NM_001034955chr1062668 2206 1291 1028 786 495 12008 --12119
NM_001034956chr1062668 2206 1291 1028 786 495 12008 --12119
NM_001034957chr1062668 2206 1291 1028 786 495 12008 --12119
NM_001035chr121195 66 ------
NM_001035005chr183655 205 65 ----178
NM_001035254chr9102506 2333 1723 1580 958 930 591 558 552 41 1738 ----
NM_001035511chr121760 27 2664 222 21481 1436 --
NM_001035512chr121867 134 2771 329 21588 1543 --
NM_001035513chr121867 134 2771 329 21588 1543 --
NM_001035521chr23739 89 23 ------
NM_001037131chr231004 847 109 1444 ----
NM_001037132chr732137 1919 1888 ------
NM_001037133chr732137 1919 1888 ------
NM_001037163chr71349 --1103 --
NM_001037164chr741551 475 196 42 1660 ----
NM_001037174chr241937 1899 615 606 ------
NM_001037317chr132775 2595 2115 --12553 --
NM_001037331chr181360 ----2913 755
NM_001037334chr181625 32260 631 564 ----
NM_001037339chr131207 678 381 138 ----
NM_001037340chr131207 678 381 138 ----
NM_001037341chr131207 678 381 138 ----
NM_001037341chr131207 678 381 138 ----
NM_001037639chr3----137 --
NM_001037872chr21597 129 ----
NM_001037954chr1183399 2773 2286 720 677 363 224 45 1806 ----
NM_001038633chr111161 2910 71 ----
NM_001038702chr5--11886 11095 --
NM_001038707chr172155 841 822 590 573 460 442 189 21462 315 --
NM_001038707chr172155 841 822 590 573 460 442 189 21462 315 --
NM_001039199chr20114879 4644 4166 3851 3576 3335 1719 1661 1608 1067 98 55054 4838 4796 3816 1184 11579 11255
NM_001039348chr221035 960 1787 ----
NM_001039349chr221035 960 1787 ----
NM_001039459chr72199 94 11142 ----
NM_001039465chr141451 ------
NM_001039479chr14122045 1987 1976 1616 1588 1553 975 444 392 276 178 38 2964 812 22245 1517 --
NM_001039538chr253410 2915 2718 1030 796 ------
NM_001039547chr3117486 6386 6167 6088 2913 2606 2392 1837 1005 625 553 16984 23067 969 --
NM_001039550chr22758 183 ------
NM_001039570chr22144156 4066 3952 3828 3632 1758 1743 1670 1463 1305 1204 872 250 32 2263 82 13483 --
NM_001039571chr22144156 4066 3952 3828 3632 1758 1743 1670 1463 1305 1204 872 250 32 2263 82 13483 --
NM_001039574chr15934 918 908 820 110 ------
NM_001039580chr484523 4492 4422 3257 1838 1325 1080 945 23915 800 ----
NM_001039585chr131613 113 82 1968 13657 --
NM_001039590chrX74013 3573 2466 1523 1091 859 829 ------
NM_001039591chrX74013 3573 2466 1523 1091 859 829 ------
NM_001039618chr11105292 3770 3677 2245 1586 1408 1335 1260 1109 236 1206 ----
NM_001039690chr1652368 2066 1494 86 40 ------
NM_001039693chr293987 3954 3893 3717 3640 2907 2576 1560 1197 1584 ----
NM_001039709chr20134100 3799 3410 3343 2044 1890 1335 1189 912 256 246 202 164 45101 1195 803 327 ----
NM_001039840chrX95948 5812 5686 5258 5013 4323 4263 4013 3725 14953 14150 11592
NM_001039916chr1231011 116 82 2973 93 --1489
NM_001039917chr1231011 116 82 2973 93 --1489
NM_001039918chr1231011 116 82 2973 93 --1489
NM_001039919chr1231011 116 82 2973 93 --1489
NM_001039920chr1231011 116 82 2973 93 --1489
NM_001039937chr1383295 2928 2754 2735 2703 2673 2547 1003 ------
NM_001040002chr173601 305 151 1120 ----
NM_001040056chr163665 187 36 3765 635 598 ----
NM_001040100chr32432 167 ------
NM_001040108chr1492962 2468 2456 2410 2241 2108 1253 881 140 11159 --1115
NM_001040110chr731751 599 89 21428 1272 11224 --
NM_001040135chr72785 53 ------
NM_001040142chr231657 949 917 ------
NM_001040143chr231657 949 917 ------
NM_001040144chr1652368 2066 1494 86 40 ------
NM_001040146chr1652368 2066 1494 86 40 ------
NM_001040152chr741195 1176 1165 345 11274 --13643
NM_001040158chr51538 ------
NM_001040167chr741186 1018 384 26 ------
NM_001040172chr561350 1148 561 427 249 206 --2433 269 1279
NM_001040173chr561350 1148 561 427 249 206 --2433 269 1279
NM_001040181chr32980 964 ------
NM_001040182chr32980 964 ------
NM_001040183chr32980 964 ------
NM_001040199chr32980 964 ------
NM_001040200chr32980 964 ------
NM_001040214chr632311 2042 1882 1259 ----
NM_001040272chr941868 1495 473 396 --11882 --
NM_001040273chr1032066 2003 425 21750 755 11772 --
NM_001040280chr641113 1018 507 115 129 ----
NM_001040284chr1664733 4346 2315 1016 844 30 25762 5277 --15245
NM_001040402chr431047 1018 362 ------
NM_001040424chr2152962 1164 953 912 416 --1846 --
NM_001040429chr1363445 2735 2281 1247 1196 40 --22424 1374 --
NM_001040440chr52569 172 ------
NM_001040446chr582097 2032 944 842 729 717 97 58 1816 ----
NM_001040450chr1562758 2631 2508 1844 1145 993 1383 ----
NM_001040453chr1562758 2631 2508 1844 1145 993 1383 ----
NM_001040458chr53480 241 136 1612 125 --
NM_001040619chr121324 540 172 ----
NM_001040624chr842172 2065 2041 1877 --22287 286 --
NM_001040625chr842172 2065 2041 1877 --22287 286 --
NM_001040626chr842172 2065 2041 1877 --22287 286 --
NM_001040627chr842172 2065 2041 1877 --22287 286 --
NM_001040628chr842172 2065 2041 1877 --22287 286 --
NM_001040629chr842172 2065 2041 1877 --22287 286 --
NM_001040630chr842172 2065 2041 1877 --22287 286 --
NM_001040653chr362522 2409 1927 1013 239 202 2602 280 3966 822 816 --
NM_001040708chr831019 922 381 ------
NM_001040709chr1102441 1786 1679 981 899 823 646 551 437 352 --1498 1289
NM_001040712chr963254 3208 3180 2660 90 58 12532 --1496
NM_001040715chr1661086 867 370 247 183 169 1135 1836 --
NM_001042353chr203556 394 382 --2482 58 --
NM_001042355chr16124928 4818 4550 4237 4221 3924 3705 2148 2142 879 820 676 44760 1873 1195 1163 24782 3438 1169
NM_001042361chr1011527 1181 ----
NM_001042364chr1011527 1181 ----
NM_001042365chr1011527 1181 ----
NM_001042387chr1011527 1181 ----
NM_001042388chr18127 1276 ----
NM_001042393chr1011527 1181 ----
NM_001042396chr1011527 1181 ----
NM_001042397chr1011527 1181 ----
NM_001042404chr121591 118 1392 ----
NM_001042412chr16124928 4818 4550 4237 4221 3924 3705 2148 2142 879 820 676 44760 1873 1195 1163 24782 3438 1169
NM_001042413chr9104069 3731 2592 1584 1087 610 513 286 211 202 44063 2575 1139 852 ----
NM_001042424chr432581 2345 557 12508 21138 222 --
NM_001042425chr641493 1337 637 95 --1684 --
NM_001042473chr10----12102 --
NM_001042476chr1651995 1848 1766 1633 118 12159 ----
NM_001042486chr2041371 530 407 169 --11552 --
NM_001042492chr1783461 3442 3318 3288 2441 727 106 65 --171 --
NM_001042494chr1543465 3415 3157 751 11006 ----
NM_001042495chr1543465 3415 3157 751 11006 ----
NM_001042496chr1543465 3415 3157 751 11006 ----
NM_001042497chr1543465 3415 3157 751 11006 ----
NM_001042498chrX3370 357 189 ----1723
NM_001042506chrX61185 1173 1109 897 289 130 11304 ----
NM_001042510chr871936 1498 1409 590 450 433 225 ------
NM_001042511chr871936 1498 1409 590 450 433 225 ------
NM_001042533chr353203 2967 2667 2417 131 --11293 --
NM_001042537chrX72328 2173 1661 498 433 409 193 11571 --192
NM_001042555chr1264286 3533 3518 1294 1278 896 13380 11198 --
NM_001042599chr2207630 7138 6718 6466 6438 5937 5763 5756 5560 5268 5159 5043 2802 2547 2114 965 447 409 225 69 25585 5446 22338 1489 --
NM_001042601chr353062 2922 2838 319 220 13019 ----
NM_001042603chr1253886 3278 1806 1563 1431 24640 1951 11453 11166
NM_001042646chr361713 1574 1384 1230 305 107 21673 518 ----
NM_001042681chr132044 270 206 2307 186 ----
NM_001042682chr132044 270 206 2307 186 ----
NM_001042682chr132044 270 206 2307 186 ----
NM_001042683chr62168 108 ------
NM_001042728chr122989 128 2362 176 ----
NM_001042749chrX21370 724 ------
NM_001042750chrX21370 724 ------
NM_001042751chrX21370 724 ------
NM_001042762chr731105 935 29 ------
NM_001043351chr142094 881 778 143 1787 1168 --
NM_001044305chr631575 1393 47 ------
NM_001044385chr2124071 3811 3718 3649 3636 3609 3064 1614 1488 1207 831 786 13710 13334 13933
NM_001044722chr532319 1428 72 1476 ----
NM_001044723chr532319 1428 72 1476 ----
NM_001046chr52427 222 ------
NM_001048183chr173737 3579 2353 1278 1136 483 434 63720 3476 3233 2893 2577 690 ----
NM_001049chr1462326 2021 1509 633 468 266 12229 ----
NM_001066chr192175 2052 1926 1334 571 284 223 128 79 ----1277
NM_001068chr3261 49 ------
NM_001074chr4--197 ----
NM_001078chr12604 146 4232 107 73 53 ----
NM_001079874chr121892 1715 21418 626 ----
NM_001083620chr452401 2055 1811 458 117 ------
NM_001083621chr1104177 4109 3945 3581 3354 1067 959 830 81 29 24608 503 23504 1138 --
NM_001094chr173669 201 182 ------
NM_001095chr1241828 1251 392 166 ------
NM_001100108chr1208322 7878 7767 6164 5945 5282 5144 3110 2484 2340 2213 2195 2075 1796 1087 893 844 809 750 67 36688 6005 136 25232 5194 --
NM_001106chr3169585 8101 7993 7569 7562 7166 6735 6612 3374 3304 2805 2661 2198 1276 1080 315 --38134 7927 2856 18671
NM_001109977chr41529 1109 1627 --
NM_001111chr182679 2316 2100 1943 1799 947 687 480 22492 2268 ----
NM_001117chr1821618 671 1832 1559 --
NM_001119chr451493 1343 449 346 338 --2377 80 --
NM_001122631chr113571 552 260 ----1629
NM_001122679chr531333 178 25 ------
NM_001124chr11----1691 --
NM_001126chr1--132 ----
NM_001128chr1663741 3015 1451 1305 412 295 12824 1372 --
NM_001146chr842004 1994 1577 186 ------
NM_001148chr441798 1697 739 226 11358 ----
NM_001160chr1232740 2440 223 22467 1816 ----
NM_001163chr961021 954 895 879 814 72 ------
NM_001167chrX65288 4131 2460 1918 1206 1050 11974 ----
NM_001173chr1431634 1477 280 1988 ----
NM_001175chr125405 161 96 79 71 ------
NM_001178chr111423 ------
NM_001189chr42883 783 1336 ----
NM_001191chr2041214 1181 146 43 1333 ----
NM_001198chr642095 803 620 434 ------
NM_001200chr2011154 11062 ----
NM_001204chr256917 2670 2259 2200 1239 11046 16698 1461
NM_001205chr5--1415 --163
NM_001206chr941200 1193 472 154 1232 --1244
NM_001217chr191101 ------
NM_001218chr1572185 1713 1018 418 154 98 68 22576 906 12633 --
NM_001219chr771882 1768 1563 1553 1462 896 275 1158 ----
NM_001222chr1041659 1493 1315 393 --1190 --
NM_001256chr1742593 2334 1052 62 ----22754 406
NM_001259chr7105465 5174 4624 4446 1649 1629 1310 1000 901 367 ------
NM_001273chr122587 183 ------
NM_001280chr193613 97 27 ----1579
NM_001282chr1792237 2132 1998 1870 1073 620 561 246 179 12509 ----
NM_001283chr74678 469 432 270 ------
NM_001292chr152889 764 --198 1186
NM_001300chr103448 350 132 ------
NM_001304chr1753810 2371 1141 141 54 --13016 --
NM_001310chr1242445 2060 516 118 11079 ----
NM_001313chr45823 339 291 191 62 1327 ----
NM_001315chr65897 813 777 489 306 12181 ----
NM_001316chr201372 ------
NM_001319chr192838 830 11071 ----
NM_001331chr11112777 2647 2228 2189 1884 1793 1027 967 729 301 173 1448 ----
NM_001332chr521138 450 ------
NM_001343chr521334 637 --1295 --
NM_001346chr372650 2508 1758 897 551 510 396 21962 933 ----
NM_001347chr471527 1316 572 491 452 433 38 --1463 --
NM_001356chrX21647 1622 ------
NM_001357chr11274 --122 --
NM_001363chrX3727 549 241 --1609 --
NM_001364chr11114531 3874 3352 3307 3282 3169 1822 1286 1140 894 339 34472 3329 3204 13274 --
NM_001365chr172634 239 ------
NM_001382chr114149 87 68 35 146 ----
NM_001386chr862024 2015 1784 832 821 173 --11637 --
NM_001387chr592900 2514 2314 2210 2101 2088 2049 805 745 22859 2626 ----
NM_001390chr1863308 2673 1455 998 977 333 --2678 644 1604
NM_001396chr2121099 915 12820 ----
NM_001397chr152592 2369 986 541 513 11830 ----
NM_001399chrX83554 3519 3140 2486 1030 778 541 38 --33326 2926 293 --
NM_001400chr131240 351 77 --1183 --
NM_001401chr911362 --1148 --
NM_001402chr631965 1718 308 --1559 --
NM_001406chr1791624 1478 1266 667 422 299 248 187 66 21651 279 1233 --
NM_001407chr341681 1644 1482 385 11508 1626 --
NM_001408chr131511 1123 1093 ------
NM_001418chr111662 1524 ----
NM_001418chr111662 1524 ----
NM_001419chr1984433 3576 3521 3167 1785 1316 484 277 23353 1752 33701 3302 1940 --
NM_001420chr1952814 2567 2513 1229 1194 --22888 137 --
NM_001429chr221111 --1876 --
NM_001432chr463192 1411 1197 758 572 403 21234 239 ----
NM_001438chr133142 682 555 --13304 1173
NM_001439chr151113 507 360 237 111 --11163 --
NM_001448chrX51542 1450 1443 505 380 --1204 --
NM_001449chrX31053 98 57 --1876 --
NM_001453chr641671 1209 1165 387 ------
NM_001455chr664879 4615 1607 817 467 240 23929 1117 ----
NM_001461chr13487 217 116 1464 ----
NM_001495chr85895 810 779 303 158 ------
NM_001497chr942685 2428 1965 82 --22597 60 --
NM_001521chr23739 89 23 ------
NM_001542chr142737 938 751 58 ------
NM_001543chr5174655 4040 4002 3872 3290 3269 1838 1680 1572 1491 734 606 559 450 348 302 267 13337 34378 1864 391 --
NM_001546chr641482 1194 487 232 ------
NM_001550chr71185 ------
NM_001552chr172960 880 1792 1102 --
NM_001555chrX2109 101 1176 ----
NM_001560chrX42102 1868 1031 1002 21974 309 ----
NM_001584chr111984 ------
NM_001587chrX61713 798 511 437 407 322 11509 1598 1843
NM_001614chr17------1131
NM_001614chr17------1131
NM_001616chr222353 108 ------
NM_001620chr11167 ----1710
NM_001634chr661549 1443 658 638 564 224 --1759 --
NM_001642chr1131258 1199 850 ----11031
NM_001649chrX62497 2144 1829 1794 721 333 21649 513 2492 462 --
NM_001650chr1832739 2693 1071 13628 ----
NM_001655chr112729 132 11520 11794 --
NM_001659chr12172676 2625 2515 2432 2402 1998 1729 1063 911 735 676 448 418 389 364 358 167 42563 2542 2224 2085 ----
NM_001660chr31203 ------
NM_001663chr1421757 332 1703 ----
NM_001664chr32984 196 ------
NM_001668chr132280 499 91 ------
NM_001674chr12874 90 ------
NM_001678chr1751774 1752 1362 499 476 2729 142 --155
NM_001682chr1222651 532 --1481 --
NM_001683chr342740 1079 269 167 12114 ----
NM_001686chr12234 27 ------
NM_001690chr32648 143 22552 66 ----
NM_001693chr841101 1036 379 316 31194 1047 445 --1358
NM_001695chr874223 3814 2964 1538 1272 768 278 --133 --
NM_001699chr1951234 520 360 162 151 ------
NM_001701chr931357 1333 1013 11168 ----
NM_001703chr11187 --1246 --
NM_001707chr72697 307 1171 1293 --
NM_001709chr1122607 2551 1230 11897 --
NM_001714chr12--2470 202 ----
NM_001717chr155608 528 504 442 284 ------
NM_001731chr123749 666 342 ------
NM_001742chr72321 46 ------
NM_001744chr52582 55 ------
NM_001745chr531175 825 68 1161 ----
NM_001746chr542482 2195 541 463 11839 ----
NM_001753chr741762 665 164 54 21521 733 ----
NM_001754chr2143995 3064 2869 2717 ------
NM_001755chr1611883 --12005 --
NM_001759chr1294000 3833 3340 3211 1644 1159 1131 1064 49 24302 3742 --14788
NM_001768chr231060 94 64 21190 876 1900 --
NM_001773chr161323 1058 566 548 418 105 --21408 1296 --
NM_001777chr373356 2714 2620 2584 2554 1513 658 12660 ----
NM_001796chr16----1239 --
NM_001806chr1912530 --12900 --
NM_001810chr205701 663 568 561 66 ------
NM_001826chr12350 46 ------
NM_001829chr42616 389 ------
NM_001830chrX53505 2522 1361 1102 424 ----11618
NM_001839chr12663 33 ------
NM_001854chr121499 547 ----1443
NM_001859chr963465 3293 3068 1558 623 71 --11282 1174
NM_001874chr1284795 4423 3418 1685 1609 1161 906 523 21221 121 14187 --
NM_001895chr2041203 781 381 295 2228 58 ----
NM_001921chr41157 ----11219
NM_001933chr1481152 1010 982 369 295 273 193 60 --1175 --
NM_001935chr22924 760 1308 1861 --
NM_001938chr13266 178 46 ------
NM_001941chr1873810 2637 2486 2461 1172 934 235 --1759 --
NM_001945chr541352 1056 1050 1005 ------
NM_001946chr12121 ------
NM_001948chr1531286 1164 495 ------
NM_001949chr6102478 2302 2058 1137 1128 842 706 306 289 81 ------
NM_001956chr14517 153 93 82 ------
NM_001957chr421750 442 190 11431 --
NM_001980chr1222226 1622 131 ----
NM_001981chr11118 22322 46 ----
NM_001987chr1263109 1585 1216 1117 510 500 --1534 --
NM_001995chr441152 519 508 323 1361 ----
NM_001999chr541333 1271 327 122 ------
NM_002006chr4135018 4633 4587 3753 2020 1946 1418 1183 801 665 558 475 466 ------
NM_002015chr1362595 2482 2392 2103 1259 182 23064 2404 ----
NM_002017chr1121408 1262 ------
NM_002023chr13363 246 136 31478 1447 1233 ----
NM_002024chrX52022 1685 1435 882 309 ------
NM_002025chrX198989 8330 8048 7517 6974 6953 6942 6588 6334 6173 5822 2374 2365 2089 1862 1431 795 778 280 28755 647 29217 8300 --
NM_002026chr22744 36 1182 ----
NM_002028chr142466 275 11315 ----
NM_002035chr1853237 3122 1458 852 456 12431 ----
NM_002040chr2141196 774 765 401 12874 ----
NM_002045chr35364 151 123 90 55 ------
NM_002051chr104979 972 246 50 --142 --
NM_002052chr841131 1022 554 28 --1281 --
NM_002056chr21814 ------
NM_002063chrX2358 137 ------
NM_002065chr131654 512 346 11520 --1631
NM_002069chr721651 62 11397 ----
NM_002072chr93753 317 35 ------
NM_002074chr131645 1088 197 1555 1584 --
NM_002076chr1273182 3162 2520 873 781 220 33 11119 1214 12062
NM_002077chr971871 1633 1564 1511 861 539 154 ------
NM_002079chr104475 451 56 40 ------
NM_002081chr261700 1642 1452 1098 565 294 --21762 1104 --
NM_002091chr18194 ------
NM_002092chr464967 4918 4800 4780 1726 728 --23242 1162 --
NM_002095chr81295 --1289 --
NM_002101chr2--125 1326 1428
NM_002103chr193715 206 39 --2448 172 --
NM_002107chr1164 --1492 --
NM_002114chr61459 ------
NM_002126chr1783391 2931 2576 1251 532 389 211 51 ------
NM_002129chr41143 ------
NM_002135chr122488 366 ------
NM_002138chr41154 ----1130
NM_002139chrX2580 121 ------
NM_002140chr921080 204 --21149 414 --
NM_002145chr17242 23 ------
NM_002146chr1721200 117 ------
NM_002147chr173923 727 156 --1639 --
NM_002148chr22657 144 --1567 --
NM_002157chr21151 ------
NM_002158chr222874 2520 13761 ----
NM_002167chr12354 145 ------
NM_002188chr52696 261 --1539 --
NM_002193chr221656 609 ------
NM_002199chr42993 918 181 ----
NM_002204chr1731347 1170 412 1199 ----
NM_002205chr123929 839 371 3300 272 30 ----
NM_002207chr3146 ------
NM_002221chr182871 2754 2357 2232 2205 1088 938 69 42963 2635 1163 696 62469 1171 829 472 465 277 --
NM_002222chr311169 ------
NM_002227chr14948 387 266 43 --11263 --
NM_002229chr193408 371 157 ------
NM_002232chr131003 909 148 ------
NM_002240chr21281 52 ------
NM_002241chr162936 947 856 818 515 35 1438 ----
NM_002247chr1031959 909 83 --22345 527 --
NM_002252chr21173 ------
NM_002254chr252036 1568 885 770 371 1472 ----
NM_002264chr364137 3772 3706 3404 1665 180 14467 ----
NM_002267chr1332417 263 256 12232 1760 1859
NM_002268chr311810 ------
NM_002270chr595436 5405 4251 4114 1641 1627 1472 1027 41 ------
NM_002271chr1331519 796 627 11939 1206 --
NM_002283chr124763 520 113 26 ------
NM_002293chr142229 2080 214 125 12621 ----
NM_002298chr1311446 --4622 566 560 430 --
NM_002309chr22122877 2756 2727 2384 2250 2057 2000 1139 1133 729 477 285 --22898 968 12763
NM_002310chr5146350 5850 5613 5481 4611 4191 2189 2073 1942 1887 1620 1362 1044 970 ------
NM_002313chr10104936 4860 3415 3170 3126 1702 1443 1075 972 611 44794 4579 3893 1740 24759 757 --
NM_002333chr1931007 440 83 ------
NM_002334chr1151962 1797 131 34 21 21591 409 160 --
NM_002336chr1241804 1692 1664 1046 13093 1672 --
NM_002349chr23542 270 162 ------
NM_002355chr1251111 1030 265 175 89 ------
NM_002358chr41151 153 ----
NM_002359chr17163758 3711 3515 3005 2947 2898 2888 2761 1634 1603 1491 1142 1131 739 126 71 22845 1686 33981 3312 2781 13851
NM_002373chr1551323 1227 179 161 71 ------
NM_002374chr253410 2915 2718 1030 796 ------
NM_002375chr392057 1750 1623 1608 1516 774 542 370 184 --1214 --
NM_002376chr14--148 ----
NM_002381chr22924 229 --192 --
NM_002382chr142840 229 --11188 --
NM_002385chr184469 306 243 220 11005 --11561
NM_002390chr1741877 830 402 366 11288 1776 --
NM_002395chr621525 1037 ------
NM_002398chr221087 181 ------
NM_002399chr1521332 898 ------
NM_002401chr1741870 1692 558 442 --32220 1896 717 --
NM_002402chr731003 864 22 1345 ----
NM_002406chr53826 768 31 1359 ----
NM_002408chr142719 536 ------
NM_002409chr22103160 2509 2411 1054 969 887 752 404 85 67 12164 3798 661 295 --
NM_002430chr2252570 1762 751 677 354 12602 21893 1014 --
NM_002444chrX81438 1362 1310 1264 754 231 179 42 ------
NM_002457chr11----1123 --
NM_002469chr122342 58 ------
NM_002472chr17188 ------
NM_002478chr113467 235 50 1522 ----
NM_002479chr1127 --1496 --
NM_002480chr12192 ------
NM_002481chr1157568 7454 7224 6766 6700 6638 4925 3096 2857 2798 1642 1539 858 305 163 37156 6574 984 171 --
NM_002486chr931762 926 244 ------
NM_002499chr1522245 912 --2527 447 --
NM_002501chr19113930 2988 2600 1250 1172 1147 902 878 597 79 31 --43949 1585 1566 987 --
NM_002505chr621512 572 21136 528 ----
NM_002507chr1741913 1487 1286 206 11434 ----
NM_002508chr141606 1568 545 362 31985 1683 418 ----
NM_002509chr202175 79 ------
NM_002515chr141441 21731 1609 ----
NM_002518chr221163 149 ------
NM_002520chr5177 ------
NM_002522chr1772847 1498 1375 1097 738 207 74 ----2629 189
NM_002545chr1154846 4186 3790 3613 3525 --11435 --
NM_002547chrX94102 3985 1519 1433 762 658 351 238 142 23067 343 13184 --
NM_002556chr1161970 1660 1625 1532 1341 110 ------
NM_002569chr1541370 990 356 40 1328 1287 --
NM_002576chr1131050 143 92 1114 ----
NM_002577chr333506 2575 432 1138 ----
NM_002581chr984870 4695 1981 1826 1027 849 565 459 15585 14197 --
NM_002588chr541720 1376 1273 383 --11167 11588
NM_002592chr201226 ------
NM_002594chr2042429 2271 2084 901 32340 1540 459 ----
NM_002595chr1241750 718 470 218 21280 648 ----
NM_002599chr1171068 939 462 327 142 113 23 ------
NM_002600chr131207 678 381 138 ----
NM_002601chr22331 320 ----1392
NM_002605chr154319 83 77 37 158 ----
NM_002607chr72246 47 181 1962 --
NM_002608chr2231344 1133 565 1426 174 --
NM_002609chr561714 582 487 355 323 85 11505 2717 573 --
NM_002610chr22609 393 ------
NM_002612chr71410 161 ----
NM_002613chr16154896 4449 4056 3675 3666 3622 3421 1907 1527 1521 1420 1353 591 549 232 --31704 1435 754 --
NM_002628chr321145 123 1335 ----
NM_002635chr12--1106 1362 --
NM_002636chr6--1411 1156 --
NM_002644chr15407 280 182 93 23 ------
NM_002645chr112640 364 3968 667 278 ----
NM_002646chr141854 883 180 82 ------
NM_002649chr741696 1488 399 146 21228 1185 11355 1292
NM_002651chr15839 712 334 323 214 1870 ----
NM_002655chr854490 2017 1354 1236 567 11964 ----
NM_002657chr20123195 3042 2992 2867 2468 1511 1464 1369 1340 1297 1288 1158 --2870 842 --
NM_002687chr14174 ------
NM_002698chr1992793 2593 2376 2315 2034 1194 1129 995 345 12834 1334 --
NM_002699chr131069 596 272 11047 ----
NM_002705chr162269 67 --1783 --
NM_002706chr22584 526 ------
NM_002709chr233110 1023 879 ------
NM_002714chr62940 851 --2227 147 --
NM_002715chr52916 816 2828 281 ----
NM_002716chr11113486 3470 3147 2839 2779 2627 2516 849 404 397 196 33115 507 237 23221 895 --
NM_002717chr8269 34 ------
NM_002718chr352571 2325 2211 2035 1912 2652 350 ----
NM_002719chr1441494 867 578 72 21869 1684 ----
NM_002731chr12841 102 22739 685 180 --
NM_002734chr1732136 890 115 12215 ----
NM_002736chr721722 753 ------
NM_002737chr17176210 6179 5888 5852 5802 5047 4453 4146 4138 4075 2664 1651 1436 803 671 508 168 --44285 4122 2391 2127 --
NM_002738chr1621134 24 1720 ----
NM_002745chr2284071 3998 3207 2759 1546 1334 580 318 --34448 3917 1258 --
NM_002753chr41548 ------
NM_002755chr151690 --2327 84 --
NM_002776chr1971904 1780 1488 774 735 326 195 21953 362 ----
NM_002787chr71209 --1588 --
NM_002790chr1255 27 ------
NM_002815chr17122 ------
NM_002819chr1931109 353 329 ------
NM_002826chr15790 697 339 287 94 --1265 --
NM_002827chr2031698 1373 1268 --11291 --
NM_002829chr9171 149 11080 --
NM_002833chr1541204 1160 1117 498 --21328 640 --
NM_002835chr71222 --1619 --
NM_002836chr203490 427 179 1536 ----
NM_002838chr11487 ------
NM_002839chr963254 3208 3180 2660 90 58 12532 --1496
NM_002840chr141336 1221 265 185 ------
NM_002843chr1133326 2546 1140 1218 22181 900 --
NM_002848chr1241314 1042 870 184 11236 ----
NM_002849chr124958 822 170 83 ------
NM_002850chr1931142 768 198 ------
NM_002855chr1173049 2671 1476 1382 817 766 625 11026 12677 --
NM_002857chr182128 1027 1020 969 862 627 371 168 22424 24 11691 --
NM_002858chr141016 555 434 236 ------
NM_002859chr1271832 1795 1608 1300 1159 532 394 11749 ----
NM_002863chr141112 ------
NM_002867chr15759 296 163 95 61 ------
NM_002868chr1282093 1819 1749 1676 1658 616 366 328 --21589 393 11714
NM_002869chr111384 ------
NM_002874chr942482 2003 876 699 --22098 405 --
NM_002886chr365175 3568 2053 1436 1347 580 23551 247 13778 13313
NM_002891chr151140 --1126 --
NM_002892chr14----11103 --
NM_002895chr202905 67 1856 1775 --
NM_002902chr151678 ------
NM_002904chr6121 ------
NM_002912chr6--2361 170 ----
NM_002924chr12591 231 ------
NM_002930chr18298 21 133 ----
NM_002945chr172785 644 ------
NM_002955chr631551 1365 1238 --1583 --
NM_002958chr31791 ------
NM_002959chr164145 2912 2861 423 259 61 33998 3493 3130 ----
NM_002968chr163905 71 35 ------
NM_002975chr195231 172 92 51 24 1189 ----
NM_002997chr241422 1376 1228 726 2182 63 ----
NM_003001chr121867 134 2771 329 21588 1543 --
NM_003010chr1751946 1754 1544 592 172 ------
NM_003011chr96625 421 389 243 205 131 11137 31660 1362 54 --
NM_003021chr1941062 817 155 31 ----1982
NM_003026chr93506 422 371 ------
NM_003027chr15--2374 97 ----
NM_003028chr9103838 3799 3781 3586 2656 2515 2469 2359 343 140 22505 238 12489 22980 729
NM_003029chr121230 255 ----11311
NM_003030chr311358 11375 ----
NM_003043chr384204 4139 3448 3094 2977 906 476 35 33762 2872 2670 --11538
NM_003045chr13134864 4567 3419 3341 3201 1878 1610 1373 1219 1046 889 551 277 1263 14854 --
NM_003046chr895300 5066 4275 4236 4206 3653 2071 1100 610 ------
NM_003047chr141294 978 902 546 2577 86 31254 586 365 --
NM_003060chr541069 920 879 81 ------
NM_003071chr361901 1831 1443 1437 1384 1375 --1426 --
NM_003074chr372133 1966 1872 1739 1404 291 71 1164 11690 --
NM_003076chr1241422 1375 1045 680 11683 11536 --
NM_003077chr171158 --162 --
NM_003081chr203436 389 187 1238 ----
NM_003091chr203243 232 201 ------
NM_003099chr15145940 5620 5530 4555 2522 2266 2181 2124 1377 1085 769 732 209 121 26213 797 --14259
NM_003100chr52455 407 ------
NM_003107chr61454 11799 ----
NM_003108chr2117267 5581 5103 5027 2001 1866 1808 1613 1135 253 51 45686 4971 867 373 ----
NM_003111chr2164 ------
NM_003112chr712668 ------
NM_003113chr2------1324
NM_003128chr292708 1960 1743 910 881 355 272 99 85 --12777 --
NM_003131chr651881 823 804 408 255 --1571 --
NM_003133chr12807 280 ------
NM_003137chr64732 525 507 486 --11697 --
NM_003139chr112721 54 --1609 --
NM_003144chr62619 322 ------
NM_003145chr11194 ------
NM_003155chr841093 909 860 108 12121 ----
NM_003156chr1171331 1232 359 164 157 56 37 --1319 --
NM_003161chr1733128 1406 1069 ------
NM_003165chr961887 1757 1517 1215 598 178 --2521 515 --
NM_003173chrX41199 393 268 190 11243 1520 --
NM_003178chr331874 1754 213 12159 1179 --
NM_003185chr2041225 496 243 120 ------
NM_003186chr113323 163 45 ------
NM_003188chr62834 552 ------
NM_003189chr152845 1335 327 180 123 --23256 382 --
NM_003199chr1874467 2231 1767 1703 1495 811 804 ------
NM_003200chr1951763 919 686 664 192 1895 22208 594 --
NM_003204chr1741763 1737 607 245 1624 ----
NM_003214chr641100 499 462 161 11225 1547 --
NM_003216chr2293134 2912 2815 2716 1074 921 508 376 63 --3687 576 331 1185
NM_003217chr1261700 1659 1549 1302 1242 201 --1418 --
NM_003220chr641493 1337 637 95 --1684 --
NM_003221chr683883 3620 3519 3244 2953 2774 1346 799 --23283 3111 --
NM_003222chr2031195 1090 329 1286 11121 --
NM_003223chr163643 288 119 ------
NM_003234chr382305 2204 2115 2048 860 688 559 278 32384 490 328 1348 --
NM_003236chr252396 2386 2375 2149 1383 12790 ----
NM_003242chr352292 933 598 124 95 1501 1672 --
NM_003246chr1521319 100 2668 342 ----
NM_003247chr63704 109 49 --176 --
NM_003250chr171324 ------
NM_003253chr2141808 1514 564 43 1768 ----
NM_003255chr1771922 1828 834 490 430 248 82 --1292 12626
NM_003262chr343671 1908 1233 150 --23693 1461 1443
NM_003275chr921138 472 ------
NM_003290chr1931171 835 76 11023 1315 --
NM_003298chr3146017 5820 5709 5340 5198 4207 3997 2238 1668 1525 1262 1210 868 115 32205 737 182 1378 1758
NM_003304chr31419 ------
NM_003309chr641880 1648 576 565 ------
NM_003314chr51147 4444 407 294 179 ----
NM_003319chr2--1981 --1644
NM_003336chrX2404 131 ------
NM_003337chr531193 478 126 ------
NM_003338chr102753 485 ------
NM_003339chr5164 ------
NM_003342chr1762695 2020 986 974 687 72 ------
NM_003348chr1231521 252 128 11443 ----
NM_003349chr2031139 1076 409 --2999 372 --
NM_003368chr11117 ------
NM_003371chr94739 635 460 68 2751 615 ----
NM_003373chr1081555 1354 1284 1259 603 523 502 371 11869 ----
NM_003374chr51197 ------
NM_003376chr641804 330 244 133 11420 ----
NM_003376chr641804 330 244 133 11420 ----
NM_003385chr2--1352 ----
NM_003387chr251812 1149 405 379 76 12423 --1358
NM_003390chr112800 313 ------
NM_003392chr384058 3940 2969 2708 1543 1523 460 135 11042 ----
NM_003400chr22342 30 ------
NM_003405chr223535 140 64 --1686 --
NM_003406chr831484 1228 539 ------
NM_003409chr182325 175 ------
NM_003410chrX43026 2902 2277 1939 1251 1562 --
NM_003413chrX21825 265 ------
NM_003418chr3--2315 57 ----
NM_003423chr1911015 12649 ----
NM_003427chr62679 446 1492 1116 --
NM_003432chr52118 73 ------
NM_003453chr131676 ------
NM_003454chr1621342 1126 ------
NM_003457chr171493 1195 ----
NM_003458chr3133999 3961 3558 3550 3405 3304 3246 3174 3049 2800 1019 281 62 ------
NM_003462chr131402 373 57 1112 --11440
NM_003466chr24956 889 619 135 22348 859 1354 --
NM_003468chr243017 2803 2776 1305 --24139 1249 11315
NM_003470chr1681864 1581 1362 1271 1165 356 325 158 --31534 315 301 --
NM_003471chr332360 2302 122 ------
NM_003472chr641131 434 229 99 ----11074
NM_003478chr1163123 2938 2797 2369 1208 121 ----12768
NM_003482chr1262600 2122 1732 574 554 229 21064 55 22673 523 --
NM_003483chr1262949 2779 2495 2471 1029 486 12238 ----
NM_003487chr17------130
NM_003489chr2143445 2631 1029 895 1795 12849 --
NM_003505chr731639 732 615 1744 --1169
NM_003508chr72301 41 ------
NM_003559chr17153601 3437 3194 3061 2905 2710 2579 2507 1597 1473 1356 1290 1130 844 484 --12856 --
NM_003563chr1771492 1290 1156 1141 1110 1009 495 11302 ----
NM_003566chr1242541 2304 920 753 23187 2650 ----
NM_003574chr1895330 3924 3607 3492 1773 1591 1215 438 249 ------
NM_003576chr1342745 2223 911 186 11031 22140 1914 --
NM_003583chr1263574 2907 800 785 773 670 11343 ----
NM_003589chr1331221 547 291 1421 ----
NM_003590chr252710 955 636 227 204 ------
NM_003602chr72438 378 --2444 285 1332
NM_003603chr421979 226 ------
NM_003607chr183884 3789 3440 3409 1646 1101 1085 39 11589 1422 --
NM_003612chr153517 397 91 ----1466
NM_003615chr33828 818 302 1376 ----
NM_003620chr172924 806 ----2271 247
NM_003628chr21748 ------
NM_003629chr173017 2951 2816 2185 813 432 30 1830 13036 --
NM_003632chr174833 299 286 219 ------
NM_003633chr522437 1889 1412 21883 259 --
NM_003636chr121812 1191 --2383 50 --
NM_003637chr151141 492 419 289 32 11208 21528 1489 11454
NM_003644chr17125792 5716 5596 4817 4351 4343 4191 4000 2036 1278 1086 414 --45729 5203 4720 294 1219
NM_003651chr121487 ------
NM_003654chr111114 --1265 1162
NM_003660chr191311 ------
NM_003663chr343058 1143 706 340 33513 2283 2203 --13425
NM_003664chr5----1469 --
NM_003670chr341478 1322 1175 1026 11394 ----
NM_003671chr993077 2798 2584 2273 2227 1202 920 745 733 13470 22246 316 --
NM_003672chr13483 423 104 ------
NM_003677chr1222163 881 12042 21979 287 --
NM_003685chr193811 357 269 2396 382 ----
NM_003714chr542570 2422 2359 1989 ------
NM_003716chr3155 1187 1281 --
NM_003722chr322211 2095 12293 --11992
NM_003735chr541720 1376 1273 383 --11167 11588
NM_003736chr541720 1376 1273 383 --11167 11588
NM_003743chr242142 1834 1609 1474 32304 1939 1787 ----
NM_003749chr1321596 952 11666 1907 --
NM_003758chr1521614 1082 1376 ----
NM_003758chr1521614 1082 1376 ----
NM_003759chr493800 3386 918 743 578 427 375 319 273 13056 13136 --
NM_003762chr131227 951 460 1962 ----
NM_003763chr2073141 2948 2856 2709 2188 874 522 ----12923
NM_003768chr191745 1633 1562 747 601 595 555 545 194 1529 ----
NM_003774chr1243236 3225 740 248 1883 13093 --
NM_003787chr1821702 1512 11312 --1139
NM_003800chr63916 763 498 ------
NM_003816chr81397 ------
NM_003821chr84574 406 212 53 ------
NM_003842chr862435 2407 1896 1889 623 34 12285 ----
NM_003858chr141625 ------
NM_003860chr11--1244 1338 --
NM_003861chr1462827 2654 2332 2056 860 573 22144 715 ----
NM_003862chr52332 250 ------
NM_003870chr1562106 1977 1464 482 280 68 ------
NM_003872chr252003 1876 1165 940 243 12667 ----
NM_003873chr102721 211 1662 ----
NM_003877chr121176 ----1858
NM_003884chr331686 597 495 11138 ----
NM_003887chr242256 1943 348 339 2804 705 138 --
NM_003888chr1541359 102 59 45 1623 ----
NM_003895chr2131581 591 276 ------
NM_003913chr662667 1519 830 627 556 463 33813 3535 1382 ----
NM_003924chr441548 1417 1229 232 ------
NM_003927chr181725 ------
NM_003930chr732032 825 96 ------
NM_003931chr6146 165 ----
NM_003939chr10103559 3419 2922 2674 963 692 649 481 406 119 11010 ----
NM_003947chr331233 1084 103 1405 124 --
NM_003948chr442623 2423 975 693 12329 1967 --
NM_003949chr1761931 1882 1712 1686 1348 256 --11742 --
NM_003958chr693879 3410 3202 2991 2640 2485 1307 521 453 23032 1123 ----
NM_003966chr5207269 7140 6611 6171 6024 5627 5229 5182 3069 2959 2697 2669 2094 1946 1346 1338 1263 897 776 41 57302 4793 2625 1041 392 11403 --
NM_003971chr174638 249 127 38 ------
NM_003975chr1----1105 --
NM_003980chr621372 69 --11016 --
NM_003981chr154702 678 354 35 --1837 --
NM_003983chr16144458 4271 4192 3657 3243 2699 1781 1304 1040 915 612 549 475 369 31606 823 404 23197 1155 --
NM_003987chr1061598 1568 888 877 836 544 21962 913 31692 1669 1653 --
NM_003988chr1051675 1645 954 913 621 12039 31769 1746 1730 --
NM_003989chr1061534 1504 824 813 772 480 21898 849 31628 1605 1589 --
NM_003990chr1061534 1504 824 813 772 480 21898 849 31628 1605 1589 --
NM_003992chr151271 ------
NM_003994chr1221704 1678 24020 611 1421 --
NM_003998chr4--1499 ----
NM_004006chrX21067 49 ----11964
NM_004007chrX21067 49 ----11964
NM_004009chrX21067 49 ----11964
NM_004010chrX21067 49 ----11964
NM_004011chrX21067 49 ----11964
NM_004012chrX21067 49 ----11964
NM_004013chrX21067 49 ----11964
NM_004014chrX21067 49 ----11964
NM_004015chrX21067 49 ----11964
NM_004016chrX1981 ----11878
NM_004017chrX21067 49 ----11964
NM_004018chrX1981 ----11878
NM_004020chrX21067 49 ----11964
NM_004021chrX1981 ----11878
NM_004022chrX1981 ----11878
NM_004023chrX1981 ----11878
NM_004024chr121233 449 172 ----
NM_004028chr1832739 2693 1071 13628 ----
NM_004035chr1764412 3888 3180 1819 1094 415 11078 1539 --
NM_004036chr24257 233 176 78 --1266 1480
NM_004037chr14658 643 351 103 --3142 109 83 --
NM_004040chr211167 11029 ----
NM_004050chr1472676 2331 2058 912 763 744 586 --11810 11725
NM_004055chr1162053 2006 1731 898 209 97 21433 789 3747 476 143 --
NM_004063chr81121 1653 ----
NM_004074chr111162 ------
NM_004075chr121573 --1579 --
NM_004080chr7------11287
NM_004081chrY21827 1785 ------
NM_004087chr331517 1511 458 --11327 11263
NM_004090chr1782932 2614 2545 2239 2170 1100 624 353 32122 1121 249 53217 2841 2661 2450 203 --
NM_004093chr1352643 2570 1309 491 205 12185 12707 --
NM_004094chr1432801 722 50 ------
NM_004100chr62708 609 ------
NM_004105chr221035 960 1787 ----
NM_004112chr1761256 1240 1102 557 433 29 1290 1361 --
NM_004114chrX2929 74 ------
NM_004124chr1463457 2779 2300 2278 530 112 --13516 --
NM_004130chr31541 1648 ----
NM_004134chr52442 216 2639 65 ----
NM_004136chr1521002 334 ------
NM_004157chr32894 282 --196 --
NM_004161chr22462 251 1263 ----
NM_004170chr91753 ------
NM_004171chr11128770 8595 6788 6212 6193 5950 3854 3655 1695 1438 922 646 59251 9201 6454 6416 1647 39018 3703 2285 --
NM_004185chr12164 64 1217 ----
NM_004187chrX51302 560 219 141 117 11331 ----
NM_004199chr55385 84 72 33 27 ------
NM_004200chr1182865 2797 2571 2289 2097 1216 1066 226 1247 --11161
NM_004229chrX1345 11927 ----
NM_004232chr1831548 850 301 11320 13179 --
NM_004233chr641113 1018 507 115 129 ----
NM_004235chr92748 253 ------
NM_004236chr15128 ------
NM_004252chr174692 579 528 255 3641 511 157 ----
NM_004253chr92951 186 ------
NM_004262chr431269 1155 366 21325 1180 ----
NM_004263chr271638 1606 1565 1486 1246 692 276 2193 152 51420 1378 1124 487 408 --
NM_004272chr52765 47 21816 300 --11676
NM_004274chr142543 271 ------
NM_004279chr751979 1898 1736 699 374 1181 ----
NM_004293chr93726 347 286 12404 ----
NM_004302chr1282287 2188 2166 2121 774 765 752 486 --12223 --
NM_004308chr11101895 1706 1698 1466 1450 310 300 215 190 32 --11480 --
NM_004311chr1072908 2763 2526 2258 1200 800 415 1180 ----
NM_004319chr162456 2309 697 380 151 144 21087 296 ----
NM_004323chr952569 2408 2070 650 615 12019 2206 61 --
NM_004326chr161139 1013 965 341 326 29 --1953 --
NM_004338chr1845618 4545 2507 498 11582 14720 --
NM_004339chr215639 364 207 197 33 21763 1595 11301 --
NM_004342chr732291 2133 2107 ------
NM_004350chr182255 2021 1940 1841 1629 781 642 176 12115 31997 1761 939 --
NM_004356chr114550 454 435 162 ------
NM_004364chr193501 371 218 --11014 --
NM_004370chr641959 1840 676 651 ------
NM_004379chr2--21325 360 1618 --
NM_004380chr162913 194 2649 432 11636 --
NM_004384chr532319 1428 72 1476 ----
NM_004385chr52531 56 ------
NM_004389chr22229 203 ------
NM_004391chr381900 1888 1696 1622 1457 1448 670 562 11423 11859 --
NM_004392chr1342258 1738 1646 90 1107 ----
NM_004393chr351970 1503 773 365 158 11650 21787 719 --
NM_004395chr55712 541 505 305 276 ------
NM_004397chr1144081 3598 1559 596 1404 ----
NM_004408chr92493 377 ------
NM_004411chr73791 584 71 ------
NM_004417chr52128 102 154 ----
NM_004420chr1141896 1530 613 459 --32339 1940 1578 --
NM_004423chr392441 2009 1813 1697 706 666 591 235 54 22703 2147 1267 --
NM_004426chr1241772 1679 709 197 11319 ----
NM_004427chr111113 172 ----
NM_004429chrX31167 557 149 ------
NM_004430chr811698 --11740 1925
NM_004434chr1411386 ------
NM_004436chr13147 83 45 ----1579
NM_004438chr221166 858 1346 ----
NM_004440chr651897 1622 1566 573 107 ------
NM_004441chr331292 1207 818 21030 433 ----
NM_004450chr142402 277 ------
NM_004454chr331546 885 94 --1140 --
NM_004455chr11437 --11093 --
NM_004457chr221265 185 ------
NM_004458chrX21941 1755 32438 2284 1657 12275 --
NM_004459chr1731789 1528 511 ------
NM_004468chr1--1165 --1403
NM_004469chrX2360 27 --1163 1354
NM_004475chr17101192 1130 1016 961 840 380 329 243 156 144 --1745 --
NM_004481chr192468 2457 2289 1695 873 849 530 504 497 12625 --12226
NM_004482chr21752 ------
NM_004487chr321071 795 11243 1969 --
NM_004491chr1993796 3129 3005 1282 668 504 442 429 273 24243 44 ----
NM_004494chr161220 1194 1065 807 270 244 --138 --
NM_004496chr142291 241 ------
NM_004497chr192582 542 1593 ----
NM_004499chr51395 ------
NM_004500chr1441982 1927 647 128 11385 ----
NM_004501chr153892 3458 1624 491 118 12896 ----
NM_004503chr121669 --1634 --
NM_004505chr172357 52 1429 ----
NM_004514chr1752625 1135 1022 992 435 11929 1854 23073 1159
NM_004516chr193995 960 840 --187 --
NM_004519chr8127 ------
NM_004520chr53537 261 120 ------
NM_004527chr173601 305 151 1120 ----
NM_004529chr92572 342 ------
NM_004555chr161182 --198 --
NM_004566chr1042461 1674 792 245 --31624 961 203 1564
NM_004569chr141197 ------
NM_004573chr156813 688 522 505 200 50 ------
NM_004580chr1511623 11684 ----
NM_004586chrX75419 3896 3663 1851 1594 345 195 --2869 133 --
NM_004588chr11113709 3646 3467 3455 3241 2890 2839 2784 2640 652 406 12517 1260 1512
NM_004592chr121167 ------
NM_004593chr32895 71 ------
NM_004598chr593188 2786 1125 871 865 816 635 95 59 11107 13128 --
NM_004603chr75736 345 305 185 140 ------
NM_004606chrX3310 35 21 ------
NM_004612chr954613 4097 1611 699 189 1445 34532 3524 1583 --
NM_004615chrX2790 625 --1168 --
NM_004620chr114528 180 150 54 ------
NM_004630chr1141132 947 894 746 1904 ----
NM_004631chr11992 ------
NM_004637chr32243 31 1455 ----
NM_004640chr6137 ------
NM_004641chr101118 ----11120
NM_004654chrY2480 65 ------
NM_004663chr1521390 1280 ------
NM_004670chr1021367 1131 21283 498 ----
NM_004684chr41269 ------
NM_004685chr1312319 --22221 982 --
NM_004686chr831561 569 311 1616 ----
NM_004687chr1761735 1345 810 436 133 76 11706 1742 --
NM_004694chr172777 721 ------
NM_004703chr1741887 1681 1564 283 --12122 --
NM_004709chrX2542 492 11299 ----
NM_004717chr751400 571 375 107 55 11212 ----
NM_004719chr1242129 1762 882 503 ------
NM_004723chr11137 1781 1118 1355
NM_004725chr1021323 522 11078 11395 11056
NM_004726chrX65170 4489 3632 1338 1087 733 33544 2054 444 ----
NM_004730chr541519 765 223 89 --1539 --
NM_004733chr31606 ------
NM_004742chr331568 654 262 1329 11810 --
NM_004744chr463592 2930 2689 1578 625 328 --13839 --
NM_004745chr8136224 5522 4952 4626 4431 2326 1781 1668 1153 794 589 575 421 56001 2246 1913 1886 514 45008 4898 4892 4268 --
NM_004750chr192304 28 ------
NM_004772chr52586 507 --11160 --
NM_004774chr1722824 865 42887 1172 987 431 1223 --
NM_004776chr2093274 2747 1199 1024 982 913 855 485 375 --22398 2209 --
NM_004779chr51246 1385 ----
NM_004783chr162518 480 ------
NM_004788chr112273 85 11931 ----
NM_004796chr1452323 2198 2005 1658 743 --1935 --
NM_004798chr2093182 3110 3101 2923 2723 2548 1261 847 168 43508 3430 931 693 22564 921 --
NM_004801chr231594 1426 455 21166 421 ----
NM_004805chr221414 294 21207 230 ----
NM_004807chr282285 2140 2035 1900 1776 622 375 295 ------
NM_004808chr1032934 2485 273 22594 700 ----
NM_004815chr154035 4013 3508 1571 1110 --13370 --
NM_004821chr54658 595 559 187 ------
NM_004822chr1793827 3600 3081 2862 1507 1498 1490 1465 305 --53475 3232 3213 1224 765 12567
NM_004831chr193784 300 156 ------
NM_004834chr273008 2703 2685 2219 326 153 67 ----1333
NM_004839chr153616 455 181 ------
NM_004844chr32829 281 ------
NM_004845chrX73811 3379 3320 1317 1158 1095 321 13188 23371 1360 --
NM_004850chr251621 1456 1081 624 154 1107 ----
NM_004857chr1444380 3584 1920 615 ------
NM_004859chr1722603 1076 1770 ----
NM_004863chr1475197 5093 4082 3768 1627 1056 910 13681 2970 309 --
NM_004866chr531895 154 115 ------
NM_004867chrX----124 --
NM_004871chr1754218 3925 3092 537 179 11559 34103 999 883 --
NM_004873chr1453255 3150 2476 1196 239 --13139 --
NM_004879chr113909 308 62 2183 134 2271 156 --
NM_004884chr1531567 228 222 11442 1207 --
NM_004893chr51538 ------
NM_004897chr101147 179 ----
NM_004898chr422627 1951 1652 1131 --
NM_004899chr22152 39 ----1416
NM_004902chr203861 617 123 1627 ----
NM_004904chr774735 4510 4439 4236 2408 2099 54 25142 1721 --11700
NM_004905chr13273 179 61 ------
NM_004921chr142183 1673 243 184 11906 ----
NM_004924chr197875 840 832 362 342 305 103 --1927 --
NM_004932chr531587 533 92 11335 ----
NM_004938chr95997 939 376 153 100 ------
NM_004947chr331963 1851 1717 12600 ----
NM_004953chr31299 ------
NM_004956chr783253 3149 3103 3075 3014 3001 815 138 21597 634 1461 --
NM_004964chr1384 37 27 ------
NM_004975chr202952 221 ------
NM_004976chr11154446 4333 3885 3646 3231 3174 2006 1579 1509 1480 1358 564 531 464 397 44435 3961 3694 1374 --1316
NM_004978chr191597 1581 1571 1483 524 408 387 217 59 1368 1266 11303
NM_004985chr1253388 2965 853 711 106 2511 466 12751 --
NM_004992chrX178515 8247 7661 6359 6163 5976 5721 5433 5320 2366 2293 2071 2010 1511 1062 674 58 47525 2514 2507 1205 12228 --
NM_004992chrX178515 8247 7661 6359 6163 5976 5721 5433 5320 2366 2293 2071 2010 1511 1062 674 58 47525 2514 2507 1205 12228 --
NM_004993chr14--2555 462 --11318
NM_004999chr674514 3993 3940 3135 1729 1229 1012 13656 11545 --
NM_005008chr223923 352 28 --1831 --
NM_005010chr732137 1919 1888 ------
NM_005011chr731751 599 89 21428 1272 11224 --
NM_005017chr3259 21 ------
NM_005020chr71527 1534 1521 --
NM_005023chr511424 ------
NM_005028chr1052036 1905 1664 1563 117 12326 12272 --
NM_005030chr162272 266 ------
NM_005044chrX64052 3712 3010 811 269 125 --24220 3659 --
NM_005045chr71730 ------
NM_005053chr191151 ----1558
NM_005056chr1254130 3522 2050 1807 1675 24884 2195 11697 11410
NM_005063chr1053276 3247 2506 1553 22 21394 388 32902 1474 796 --
NM_005068chr641373 1300 1219 136 138 ----
NM_005070chr21236 ------
NM_005077chr93408 371 345 ------
NM_005078chr1551741 1333 1167 410 348 --1316 --
NM_005079chr853003 2269 393 307 211 --12263 --
NM_005080chr224915 781 302 232 ------
NM_005093chr20134100 3799 3410 3343 2044 1890 1335 1189 912 256 246 202 164 45101 1195 803 327 ----
NM_005096chrX61190 1086 418 381 136 59 1349 --11258
NM_005099chr12172 136 1523 --11297
NM_005105chr162063 1641 1534 632 384 179 ------
NM_005109chr332596 143 53 --22288 1014 --
NM_005110chr52735 183 1559 1728 --
NM_005114chr43632 528 235 ------
NM_005116chr20134148 4097 4066 3539 1679 1338 984 969 765 407 305 210 53 24318 1473 12847 12921
NM_005119chr12154 24 --11081 --
NM_005126chr342210 1536 312 131 1200 1736 --
NM_005134chr18127 1276 ----
NM_005135chr1543465 3415 3157 751 11006 ----
NM_005137chr2231915 837 732 1200 164 11628
NM_005151chr181625 32260 631 564 ----
NM_005153chr162765 520 1274 ----
NM_005154chr151465 ------
NM_005156chr944709 3572 1523 1152 ------
NM_005157chr951925 1743 714 473 373 --2247 219 --
NM_005159chr1541894 1399 894 601 11598 ----
NM_005161chr11122121 2085 1910 1560 1379 859 729 696 424 402 378 89 --11446 --
NM_005168chr211298 1587 21494 1240 --
NM_005169chr111603 --146 --
NM_005180chr1041220 545 526 242 1367 ----
NM_005186chr114506 478 227 106 --1274 --
NM_005187chr164688 356 347 256 11277 ----
NM_005188chr11237361 7317 7285 7028 6495 6456 5932 5745 5693 5447 2921 2834 2736 2366 2261 1798 1738 1409 1292 346 226 118 84 25208 1686 25538 401 --
NM_005190chr61922 ------
NM_005197chr1475278 4982 4568 3822 1741 1733 1716 --14855 --
NM_005207chr2233527 646 21 --13147 13509
NM_005219chr5111630 1578 1377 1349 1123 731 626 585 414 291 134 --1482 --
NM_005220chr1741306 1288 1256 447 11099 ----
NM_005224chr192698 579 ------
NM_005229chrX71092 1013 931 798 497 202 130 --21285 1047 --
NM_005231chr1121349 1288 11139 ----
NM_005235chr2207630 7138 6718 6466 6438 5937 5763 5756 5560 5268 5159 5043 2802 2547 2114 965 447 409 225 69 25585 5446 22338 1489 --
NM_005240chr12619 562 ------
NM_005243chr221117 ------
NM_005252chr142298 189 --198 --
NM_005256chr111945 1671 ----
NM_005257chr1841285 1171 483 456 ------
NM_005259chr21258 1302 ----
NM_005263chr13321 79 57 ------
NM_005266chr151631 1513 751 379 68 21809 389 21750 1313 --
NM_005274chr12159 143 ------
NM_005277chr4--1642 ----
NM_005311chr742608 2376 2152 1013 1855 ----
NM_005312chr9122660 2476 2404 2270 2131 1952 1830 1814 1087 974 944 172 32144 1846 1069 1691 1405
NM_005316chr11----1982 21083 699
NM_005324chr1742040 1457 1302 319 ------
NM_005329chr1631574 796 108 ------
NM_005336chr272156 1966 1877 1729 1460 868 342 12082 2646 552 1373
NM_005339chr444143 3841 665 156 1246 1573 --
NM_005342chrX42043 447 137 24 12544 12144 --
NM_005374chr1772428 2269 2091 1920 1803 655 417 32111 2002 252 22187 116 1882
NM_005378chr22760 558 ------
NM_005381chr21126 ------
NM_005388chr951435 1142 255 108 71 --1337 --
NM_005392chr941590 1363 348 147 1496 ----
NM_005397chr753069 1406 1398 974 890 33601 2551 1014 ----
NM_005398chr102530 483 11447 ----
NM_005406chr1811377 --1142 11583
NM_005407chr1461386 1258 480 275 239 124 --1387 1147
NM_005409chr42973 420 1200 ----
NM_005412chr12------1502
NM_005415chr23314 254 55 --1485 --
NM_005417chr2061853 1432 1270 651 252 104 --21497 282 --
NM_005426chr13340 133 42 ------
NM_005430chr124843 825 656 372 1999 ----
NM_005433chr1832373 907 688 ------
NM_005436chr1073119 2995 2668 1638 608 245 79 --12546 --
NM_005439chr123510 451 134 ------
NM_005445chr102201 124 ------
NM_005458chr962188 1883 805 705 534 206 --1798 --
NM_005461chr2041479 1266 60 48 11339 190 --
NM_005465chr12634 59 ------
NM_005474chr17111544 1531 1496 1453 1114 543 275 265 249 234 105 --11595 --
NM_005477chr1522212 806 11715 12170 --
NM_005477chr1522212 806 11715 12170 --
NM_005479chr1031186 1012 613 11591 ----
NM_005494chr71231 1666 ----
NM_005497chr1776138 5578 4785 4682 4334 851 402 15324 14526 --
NM_005499chr19171 ------
NM_005502chr932496 2424 2248 --1328 --
NM_005504chr1295978 5224 4867 4483 2446 1627 1546 615 419 21768 551 11293 --
NM_005513chr351466 1276 1236 205 120 --11031 --
NM_005517chr111069 31328 558 278 11239 --
NM_005522chr751372 1034 283 101 40 ----1394
NM_005523chr731502 639 551 11098 ----
NM_005530chr1551384 1179 559 485 169 ------
NM_005537chr132846 784 ------
NM_005544chr22789 754 ------
NM_005546chr562223 2095 1991 952 798 551 21819 651 1238 1135
NM_005552chr142183 149 ----1200
NM_005561chr133766 50 43 4398 372 346 270 1757 2321 296
NM_005562chr131458 519 185 31469 193 144 11095 --
NM_005563chr13839 716 579 ------
NM_005569chr2271553 1432 563 523 310 94 66 11080 ----
NM_005578chr374370 3347 3201 2056 1272 364 276 13417 2511 97 12049
NM_005584chr132575 48 ------
NM_005587chr152277 206 ------
NM_005595chr12875 287 1367 ----
NM_005596chr9114203 4145 4107 2007 1414 1106 925 814 620 500 393 15920 25705 4736 --
NM_005599chr141363 1188 1048 157 --11467 --
NM_005603chr1831494 319 142 ------
NM_005604chr632463 773 130 32176 822 412 154 12031
NM_005609chr111258 ------
NM_005610chr11619 1797 --1834
NM_005625chr821015 997 11005 ----
NM_005627chr61116 2802 235 ----
NM_005639chr1231276 179 82 ------
NM_005644chr12368 76 ------
NM_005647chrX93222 2778 2749 2603 2505 2357 653 635 410 --22245 132 --
NM_005649chr51492 160 1480 --
NM_005652chr1621197 43 1983 1799 --
NM_005655chr811275 ------
NM_005664chr1551036 785 247 184 66 ------
NM_005665chr164451 4146 3862 3250 1902 603 ------
NM_005669chr562217 390 351 336 33 24 1832 ----
NM_005682chr1641272 1247 419 295 ------
NM_005685chr71126 ------
NM_005686chr151080 635 494 477 339 1177 1622 --
NM_005688chr341047 861 50 24 ------
NM_005708chr131377 ------
NM_005711chr521047 879 1263 ----
NM_005721chr2------11047
NM_005722chr242163 1970 821 103 --11556 --
NM_005724chr151184 ------
NM_005725chr131828 1560 525 21892 274 ----
NM_005730chr12113251 3243 3065 2889 2784 1459 1182 1136 1072 981 733 12746 12280 13109
NM_005737chr272880 2819 1988 1157 716 527 158 --11925 12592
NM_005738chr741551 475 196 42 1660 ----
NM_005740chr222815 41 1138 ----
NM_005742chr22633 606 1279 ----
NM_005748chr1243117 2549 2299 2222 13427 1207 1587
NM_005749chr17--170 ----
NM_005754chr51270 1181 ----
NM_005759chr294697 4403 3481 3358 1901 1893 1390 1041 818 --14320 --
NM_005779chr553326 3295 3040 393 320 --13602 --
NM_005780chr1321018 713 1798 ----
NM_005786chr184891 885 159 113 --11074 --
NM_005789chr1741943 1776 1325 117 12067 11331 --
NM_005796chr161251 ------
NM_005801chr172196 40 ------
NM_005802chr91256 ------
NM_005808chr383577 3391 3333 2821 2624 1161 993 78 1803 23366 3031 12220
NM_005813chr222000 1927 21644 1609 ----
NM_005814chr13942 97 58 1952 31151 1141 177 --
NM_005817chr192293 34 1186 --1669
NM_005822chr63648 121 91 12200 ----
NM_005828chr17134700 3915 3871 3805 3780 3670 3530 2023 1965 1540 1506 259 46 --34552 354 150 --
NM_005832chr311031 ------
NM_005840chrX137032 6563 5199 5095 4762 3058 2449 2407 2037 673 659 622 466 54701 2599 2497 2100 1098 35896 2516 125 26253 5546
NM_005841chr43929 872 99 ------
NM_005850chr13221 82 54 ------
NM_005859chr51443 ------
NM_005862chr31391 ------
NM_005863chr1031424 493 191 ------
NM_005866chr92865 770 --1119 --
NM_005871chr103884 672 28 ------
NM_005877chr2262497 2141 1841 936 710 214 --2687 28 --
NM_005885chr52170 43 1228 ----
NM_005888chr12--1106 1362 --
NM_005895chr12113711 3579 2925 2742 2643 2525 1277 1083 1074 403 306 13747 ----
NM_005898chr1153089 2300 2227 1067 863 ------
NM_005901chr18178410 8332 8316 7918 7404 7386 6326 6134 5836 5710 2711 2029 1617 867 529 456 73 38249 5722 609 36436 6288 1825 --
NM_005906chr611158 158 ----
NM_005909chr553907 2927 2911 248 220 --13620 --
NM_005911chr23496 192 94 --1367 --
NM_005920chr1123708 3485 2906 2897 2414 1491 1234 1198 1142 980 739 69 133 63014 2912 2359 1222 1037 532 --
NM_005933chr1162518 2354 2196 2072 812 272 2847 440 ----
NM_005934chr1972579 2379 2348 2079 1835 235 159 --1668 --
NM_005935chr475218 4388 3999 3951 1931 1811 1755 33414 1885 1159 --11133
NM_005937chr1793670 3601 2728 1672 1482 1115 942 820 677 --33176 1409 408 --
NM_005941chr834197 3762 220 1557 --23316 948
NM_005944chr33908 804 34 --1943 --
NM_005955chr1155112 5093 4979 4930 4491 4265 4091 4034 3971 3874 1703 1491 1045 814 760 43906 3492 3372 1632 1752 --
NM_005962chr1022273 2258 21801 391 12010 --
NM_005962chr1022273 2258 21801 391 12010 --
NM_005964chr172484 382 31291 1001 103 ----
NM_005966chr252405 2326 1872 237 25 ------
NM_005968chr19------1257
NM_005990chr5112752 2418 2149 1955 1811 1770 667 466 440 365 62 22562 244 --1175
NM_005996chr1241108 621 549 539 --1309 11351
NM_006011chr15134211 4077 3969 3680 3458 3375 3327 3141 2904 2874 1266 1131 39 14094 33998 1118 921 --
NM_006015chr12205 144 --31047 1034 363 --
NM_006022chr131889 ------
NM_006024chr71198 1787 ----
NM_006030chr381799 1700 1476 1164 1140 379 328 97 ------
NM_006032chr141190 ------
NM_006037chr254045 3094 3078 1830 780 --64377 3104 1277 887 449 41 --
NM_006038chr2031457 1402 259 --1341 --
NM_006039chr1721051 414 ------
NM_006040chr1631241 978 49 ----162
NM_006047chr2042982 2518 886 749 --21273 540 --
NM_006048chr13501 267 187 1437 ----
NM_006051chr55229 214 123 113 104 193 1222 --
NM_006054chr1141112 488 453 338 1585 11639 --
NM_006055chr243048 2985 2463 1237 ------
NM_006080chr722377 1151 1890 ----
NM_006089chrX31346 589 167 ------
NM_006090chr11539 ------
NM_006095chr434286 1787 1656 24273 476 13313 --
NM_006106chr1152668 2628 997 874 156 --12683 --
NM_006107chr17--1464 1492 --
NM_006108chr1162039 1844 844 479 266 219 11653 1511 1622
NM_006113chr121892 1715 21418 626 ----
NM_006116chr2251591 1497 1372 1253 1056 --21324 515 --
NM_006134chr2131222 1184 320 2271 245 ----
NM_006135chr141410 571 462 182 ------
NM_006139chr252150 1901 697 540 198 11964 ----
NM_006141chr1632788 1882 1089 ------
NM_006148chr1772610 2268 929 622 538 250 225 --41144 586 443 86 --
NM_006153chr32206 198 ------
NM_006154chr1521905 320 ------
NM_006158chr831583 1248 357 ------
NM_006159chr121566 ------
NM_006162chr1831560 1183 590 ------
NM_006166chr1262553 2207 2198 2148 1966 918 1131 12544 --
NM_006177chr143901 690 77 1993 ----
NM_006178chr1751537 1454 1084 1003 268 ------
NM_006180chr961781 1514 725 437 286 239 --11341 --
NM_006186chr221052 911 ------
NM_006191chr124767 695 311 121 ------
NM_006195chr931359 949 485 123 ----
NM_006198chr21--1249 ----
NM_006201chrX3440 93 82 --21073 242 11182
NM_006203chr555435 4661 4004 3831 1652 45121 3921 1585 507 ----
NM_006206chr422553 22 --11795 --
NM_006212chr1114540 4252 4239 2164 2061 1724 1132 990 442 341 334 14169 11286 --
NM_006216chr22653 65 ------
NM_006223chrX2416 127 ------
NM_006224chr1792429 1799 1582 915 736 618 501 432 272 12410 42396 2067 933 857 --
NM_006226chr21441 1359 ----
NM_006237chr1332117 165 126 1157 ----
NM_006238chr6112033 1804 1685 1458 759 540 248 229 199 160 22 --31934 1514 610 --
NM_006241chr321586 554 --11723 --
NM_006245chr64869 834 201 170 ----11053
NM_006246chr142320 147 1521 ----
NM_006251chr512244 23352 615 --12266
NM_006252chr134973 879 347 27463 666 15181 17607
NM_006259chr41128 --1739 --
NM_006264chr41482 ------
NM_006265chr821037 469 ------
NM_006267chr251245 752 698 602 350 ------
NM_006268chr114869 391 355 247 --11182 --
NM_006277chr22546 141 1526 ----
NM_006279chr11937 ----1204
NM_006281chr82942 283 ----1968
NM_006281chr82942 283 ----1968
NM_006282chr2094766 4686 4247 3421 2964 1520 1376 424 102 23791 3579 14308 11412
NM_006288chr1141141 784 744 380 164 ----
NM_006306chrX85925 4973 4795 4453 3950 739 59 46 34377 1520 185 --13995
NM_006307chrX--182 ----
NM_006309chr3134 ------
NM_006310chr17--11280 1146 --
NM_006312chr123883 766 158 ------
NM_006313chr122195 37 ------
NM_006321chr331857 1644 876 --1685 --
NM_006323chr41489 ------
NM_006325chr12--1234 ----
NM_006328chr113470 184 98 --2532 497 --
NM_006335chr12331 319 1884 ----
NM_006345chr411386 ------
NM_006352chr121498 95 12008 ----
NM_006353chr651244 1211 540 496 135 1274 1942 --
NM_006359chrX72328 2173 1661 498 433 409 193 11571 --192
NM_006363chr203168 157 76 1439 ----
NM_006367chr15826 785 685 676 112 21045 771 1347 --
NM_006371chr3134958 4766 3977 3824 3711 3350 3215 2059 1128 647 566 135 59 44823 4118 3678 3414 23323 2111 --
NM_006373chr1761242 948 460 447 423 255 1167 2366 127 --
NM_006375chrX31477 122 99 ------
NM_006380chr1723059 2959 12747 24421 2965 --
NM_006386chr2222438 2345 --11944 --
NM_006387chr1921154 57 ------
NM_006389chr116949 395 383 231 172 110 11016 ----
NM_006411chr64924 904 331 96 1883 ----
NM_006420chr2073343 3125 2694 2532 1337 1180 691 3897 764 348 ----
NM_006421chr83253 163 93 ------
NM_006430chr2175 1400 ----
NM_006434chr1062668 2206 1291 1028 786 495 12008 --12119
NM_006454chr483075 2423 2337 2142 1166 874 551 21 12193 32795 2113 1212 --
NM_006457chr494023 3107 3034 2857 2802 1596 1249 348 211 22945 256 ----
NM_006465chr153551 484 418 2724 380 1537 --
NM_006469chr111132 ------
NM_006471chr18299 30 ------
NM_006472chr151119 875 810 57 50 1283 191 --
NM_006480chr52196 109 --198 1482
NM_006482chr1263574 2907 800 785 773 670 11343 ----
NM_006489chr141441 21731 1609 ----
NM_006500chr1141072 372 51 28 1360 ----
NM_006516chr121431 1053 --11577 --
NM_006517chrX41565 1489 401 137 11504 11526 --
NM_006519chr6138 1287 ----
NM_006526chr2021597 822 21485 756 --1271
NM_006532chr1952026 1459 591 244 183 21999 193 3604 549 203 --
NM_006534chr2053123 2255 785 538 509 ------
NM_006538chr254079 3737 3494 2918 1360 23297 552 ----
NM_006539chr16----187 166
NM_006544chr1445341 2015 1057 35 25247 2212 15471 --
NM_006546chr17105936 5923 5158 5122 4597 4096 2506 2288 1055 784 12012 35453 5036 2628 1869
NM_006547chr71604 41684 1485 1419 186 1159 --
NM_006549chr1242971 1893 870 125 12565 ----
NM_006555chr731963 1546 779 --21374 136 1417
NM_006557chr931493 1148 111 ------
NM_006559chr121242 73 ------
NM_006560chr113472 111 46 1129 ----
NM_006561chr10105887 5521 4804 4798 4690 3963 1874 1532 502 22 21950 1292 35554 2106 89 15793
NM_006565chr16134 1441 --1219
NM_006566chr182440 360 ------
NM_006572chr1783129 2993 2492 2190 1111 1091 607 351 ------
NM_006575chr14--11067 ----
NM_006591chr116643 626 553 502 458 382 ------
NM_006599chr16108153 7440 7144 6983 6835 5905 3152 1520 672 394 75384 3269 2543 2244 1793 1157 1023 ----
NM_006601chr122894 48 177 ----
NM_006603chrX21370 724 ------
NM_006609chr222088 1930 2596 62 22507 2213 12338
NM_006614chr353427 2923 2679 2636 1367 ----1389
NM_006618chr141382 1155 529 337 ------
NM_006621chr162016 1667 1641 506 336 209 --11881 --
NM_006622chr51486 1221 ----
NM_006624chr1011605 --11837 --
NM_006626chr972685 2402 941 910 790 322 253 31893 1795 1703 ----
NM_006628chr1544093 4027 817 497 ------
NM_006633chr51777 ------
NM_006640chr1751829 1784 1377 1365 707 11908 ----
NM_006646chr1362537 2186 787 747 648 58 1917 1368 --
NM_006651chr42566 552 --1541 --
NM_006654chr1264286 3533 3518 1294 1278 896 13380 11198 --
NM_006658chr73416 173 48 --1921 --
NM_006670chr61143 ------
NM_006675chr12153366 3263 3252 3209 3107 2882 2722 2667 2469 1316 1167 1086 1000 941 223 22254 631 ----
NM_006682chr752541 2045 1876 439 181 ------
NM_006690chr2061995 1973 1688 1654 592 541 --22002 1528 --
NM_006698chr2041292 565 421 375 1114 11148 --
NM_006699chr142604 1820 850 656 22073 323 ----
NM_006700chr123782 665 577 --132 --
NM_006706chr51219 ------
NM_006717chr983306 3299 3126 2746 2440 1143 1069 121 12968 21228 104 --
NM_006720chr10104936 4860 3415 3170 3126 1702 1443 1075 972 611 44794 4579 3893 1740 24759 757 --
NM_006722chr332921 1954 357 ------
NM_006727chr52160 92 ------
NM_006729chrX65188 4851 4571 4018 1344 936 13669 13544 --
NM_006732chr1961778 1546 1375 658 178 117 31340 664 290 11850 --
NM_006736chr251768 1382 1193 555 545 --2500 199 --
NM_006749chr851165 1005 983 889 124 11111 ----
NM_006750chr16127942 7607 7303 7082 7024 6708 6066 4905 3066 634 426 374 45624 5342 1482 464 26224 1432 1536
NM_006761chr17--131 1130 --
NM_006762chr141289 1181 217 109 --11241 --
NM_006763chr172002 1929 1695 1628 1303 454 425 --11884 --
NM_006766chr842631 2507 1933 1845 ------
NM_006769chr11527 ------
NM_006772chr661547 1396 1191 1106 120 36 11209 ----
NM_006774chr71149 ----198
NM_006775chr63814 353 205 22510 436 ----
NM_006777chrX92874 2421 2340 2332 1793 910 777 722 577 2274 165 1692 --
NM_006783chr132249 79 2267 197 ----
NM_006788chr1841517 711 547 437 1514 1702 --
NM_006795chr1121576 1159 --21504 159 --
NM_006805chr541449 187 159 106 ------
NM_006807chr171107 ------
NM_006814chr2092477 2250 2092 2012 879 827 696 489 223 12382 ----
NM_006815chr122436 236 21029 497 ----
NM_006823chr831075 400 314 1536 ----
NM_006827chr1453031 2252 1062 833 446 --12208 --
NM_006832chr142906 805 ------
NM_006838chr1231468 399 225 --1671 --
NM_006851chr1232813 2611 383 1940 ----
NM_006852chr1762778 2467 1919 1024 872 822 1944 --1342
NM_006854chr751640 1563 1531 545 31 21281 389 ----
NM_006856chr1261137 1073 735 421 401 313 ------
NM_006861chr1232039 68 39 --21851 1703 --
NM_006874chr4----11140 --
NM_006884chr311358 11375 ----
NM_006885chr1664242 3346 1368 1078 1051 256 22873 2761 ----
NM_006888chr1432562 1353 722 23459 3034 ----
NM_006895chr241940 1929 1774 196 11512 ----
NM_006896chr73827 387 24 ----1756
NM_006898chr23680 227 186 ------
NM_006899chr20----1134 --
NM_006908chr731306 1003 33 11515 ----
NM_006912chr152148 1571 405 375 159 11017 ----
NM_006914chr931431 1322 350 ------
NM_006922chr231754 481 158 --1321 --
NM_006924chr1784405 3837 3685 3528 1732 1550 1442 1220 ------
NM_006925chr141451 ------
NM_006931chr1251808 1541 1530 800 194 ------
NM_006937chr171398 ------
NM_006940chr1251584 1302 1252 1244 638 ------
NM_006941chr2251045 851 792 783 63 ------
NM_006947chr411180 --11202 --
NM_006948chr2152429 1901 722 698 87 ------
NM_006950chrX7882 643 361 317 212 45 30 1274 1378 --
NM_006955chr1033417 2326 850 22709 947 1856 --
NM_006981chr972914 2427 808 742 458 441 90 ------
NM_006990chr132158 1796 1665 2774 131 11899 1961
NM_006993chr10--287 53 ----
NM_006999chr541395 592 350 324 11540 ----
NM_007005chr911385 ----11096
NM_007006chr1611369 22312 1223 142 --
NM_007007chr1253885 3544 3175 1773 539 ------
NM_007010chr1741609 743 708 196 ------
NM_007011chr1586477 5882 4228 1240 1162 642 407 165 46562 5851 5738 360 12668 26795 2560
NM_007023chr221024 780 ------
NM_007034chr11751 ------
NM_007038chr2175880 5430 3846 3814 2386 836 149 --14662 --
NM_007039chr1421577 1473 11682 12195 --
NM_007050chr20196980 6486 6161 5751 5468 5302 2046 2024 2006 1731 1369 1313 1092 1024 1013 935 783 756 746 38050 5592 1619 36658 6564 2492 --
NM_007051chr1--134 ----
NM_007064chr321116 360 21219 110 ----
NM_007067chr1751589 1371 1162 246 76 11336 ----
NM_007073chr622953 1130 13251 ----
NM_007084chr1331175 596 566 ------
NM_007106chr1322372 2355 12631 12520 --
NM_007111chr133876 624 568 ------
NM_007114chr332778 2246 2065 22204 251 ----
NM_007122chr12543 403 ----1133
NM_007124chr631769 752 102 21731 31 ----
NM_007150chrX41685 1379 409 111 31888 1554 744 ----
NM_007158chr121141 446 --11037 --
NM_007166chr1131526 372 89 --11280 11039
NM_007170chr15823 790 605 359 87 ------
NM_007174chr1261896 1716 926 594 483 224 --1600 --
NM_007175chr863016 2501 827 618 507 71 22304 94 ----
NM_007187chr131172 ------
NM_007192chr1431042 1016 282 ------
NM_007203chr953895 3171 3033 426 339 23747 2512 --13616
NM_007212chr15808 628 497 351 345 ------
NM_007216chr111844 --1256 --
NM_007218chr82702 187 ------
NM_007220chrX64879 4817 4629 3774 3688 558 ------
NM_007232chr202362 167 --1641 --
NM_007236chr1572375 2133 2062 1892 797 438 21 ------
NM_007238chr2094633 4289 4107 3928 3145 1344 415 367 313 --34592 3672 1640 14853
NM_007245chr162642 122 --1712 --
NM_007249chr13118222 8015 7708 7412 6958 6307 5936 2796 2426 1292 851 48616 6680 6602 2506 22734 735 28799 7299
NM_007259chr13463 399 347 ------
NM_007271chr641703 1214 1157 397 --1375 --
NM_007279chr193586 490 470 ------
NM_007281chr41189 135 ----
NM_007282chr31674 ------
NM_007283chr3133036 2771 2475 2261 2109 2098 1904 1199 1029 665 578 381 333 22301 416 22445 2439 --
NM_007286chr572116 1836 1732 854 575 471 215 --1732 --
NM_007292chr1764412 3888 3180 1819 1094 415 11078 1539 --
NM_007294chr1731162 169 98 --1496 --
NM_007295chr1731162 169 98 --1496 --
NM_007296chr1731162 169 98 --1496 --
NM_007297chr1731162 169 98 --1496 --
NM_007298chr1731162 169 98 --1496 --
NM_007299chr1731162 169 98 --1496 --
NM_007300chr1731162 169 98 --1496 --
NM_007302chr1731162 169 98 --1496 --
NM_007303chr1731162 169 98 --1496 --
NM_007304chr1731162 169 98 --1496 --
NM_007305chr1731162 169 98 --1496 --
NM_007313chr951925 1743 714 473 373 --2247 219 --
NM_007341chr212337 71 ------
NM_007345chr181496 22171 1681 ----
NM_007350chr1264586 4393 3741 3232 3213 100 13259 --13106
NM_007358chr121829 1685 --11571 --
NM_007361chr14------1113
NM_007363chrX2427 235 1228 ----
NM_007365chr182088 1663 1399 878 822 628 558 320 3834 597 156 32112 238 211 1815
NM_007368chr1351307 1075 582 553 245 ------
NM_007373chr1011595 1684 ----
NM_007375chr142151 906 535 308 ------
NM_012064chr1231119 1107 938 ------
NM_012069chrX92548 2506 930 901 894 620 275 133 58 --1815 1589
NM_012072chr2094546 4271 3919 3648 3427 1505 1458 1187 341 34049 3589 2964 13178 21644 189
NM_012074chr144305 149 118 21 11080 ----
NM_012081chr522516 162 12567 ----
NM_012083chr103935 837 61 ------
NM_012089chr121476 597 11245 ----
NM_012090chr11932 11208 ----
NM_012095chr1033480 2442 1046 12940 33270 2483 1329 --
NM_012097chr241937 1899 615 606 ------
NM_012102chr132044 270 206 2307 186 ----
NM_012104chr1173164 3084 3078 2690 1000 880 434 11408 1395 13287
NM_012104chr1173164 3084 3078 2690 1000 880 434 11408 1395 13287
NM_012115chr61406 ------
NM_012134chr151417 1265 255 112 89 ----1196
NM_012137chr152905 1933 1911 1886 556 22798 82 2420 408 --
NM_012141chr1383295 2928 2754 2735 2703 2673 2547 1003 ------
NM_012153chr1172373 2174 1039 1017 967 927 583 22380 97 11759 --
NM_012156chr20153408 3328 3163 2916 2634 2552 2489 2331 2241 1382 1275 1052 777 405 202 --11371 12967
NM_012164chr9106837 6690 6281 5998 5842 5179 4732 861 808 792 26466 912 36801 6784 1524 --
NM_012175chr11186 1868 ----
NM_012180chr42669 168 ------
NM_012188chr521046 857 --11021 --
NM_012192chr1142437 702 527 136 --32312 487 124 --
NM_012193chr1195287 4798 4550 4343 3684 2135 1627 1287 676 33484 3477 1910 ----
NM_012199chr1134608 4342 4302 4082 3638 3255 3050 2891 1822 1640 1170 784 640 53103 1804 1377 677 196 24482 1763 --
NM_012210chr911052 1343 --11390
NM_012214chr2126368 6160 5008 4520 2296 2166 2128 2004 1782 1369 530 30 25912 736 12160 15096
NM_012215chr1041884 1336 377 35 --11947 --
NM_012223chr221310 36 11209 ----
NM_012229chr101186 --2485 73 --
NM_012232chr1772113 1916 1804 1675 460 401 242 11696 11681 --
NM_012234chr393711 3659 2728 2718 1387 1125 1056 596 81 ------
NM_012244chr1471478 1319 1159 556 512 103 56 ------
NM_012247chr102949 174 1651 ----
NM_012249chr283271 3097 2525 2271 1366 1289 1179 161 22857 829 ----
NM_012250chr1121156 143 ----11287
NM_012252chr754812 4724 4212 3959 374 1254 1697 --
NM_012259chr621459 263 ------
NM_012261chr204702 620 467 30 ------
NM_012262chr134301 659 205 34160 3237 2038 ----
NM_012279chr521328 379 31803 810 520 --1640
NM_012281chr72936 381 ------
NM_012287chr354094 3792 955 910 662 22993 445 ----
NM_012288chr6165440 5385 4986 4966 4190 3965 3559 2042 1292 1207 1069 538 431 321 88 74 12032 ----
NM_012290chr221546 153 ------
NM_012294chr793447 3326 3237 2558 2529 1559 1435 944 78 ------
NM_012297chr431829 872 300 ------
NM_012300chr552082 1713 923 684 553 ------
NM_012301chr751555 1533 1464 875 610 ------
NM_012302chr11120 1441 ----
NM_012304chr552479 2163 2155 899 874 22237 279 1971 --
NM_012307chr182811 684 ------
NM_012308chr1191991 1925 797 686 675 562 453 126 113 --12373 --
NM_012311chr101628 --1208 --
NM_012316chr1155038 4275 4168 3880 3872 1683 1656 1643 1459 1319 1309 1070 972 696 156 --33804 998 623 12121
NM_012324chr223760 300 235 1481 2729 290 --
NM_012326chr24864 247 76 52 ------
NM_012328chr711443 1202 11308 --
NM_012329chr171533 11442 ----
NM_012330chr1031115 383 244 ------
NM_012333chr131300 1184 336 ------
NM_012334chr554057 3967 1323 773 405 ------
NM_012346chr192520 31 11361 11140 --
NM_012347chr633035 2459 235 --12130 --
NM_012382chr524437 3504 12887 ----
NM_012384chr2052375 2221 1552 909 47 --1436 1866
NM_012392chr15658 554 499 89 44 --1293 --
NM_012398chr1992919 2841 2585 2431 2170 1136 783 369 254 ------
NM_012399chr2241965 1693 1444 1344 ------
NM_012402chr113414 279 208 1319 1958 --
NM_012416chr941171 822 436 100 ------
NM_012419chr61577 --180 --
NM_012425chr1052663 2299 2107 2062 73 ------
NM_012428chr15------130
NM_012432chr1--162 2276 89 --
NM_012433chr21276 ------
NM_012445chr44529 506 337 142 ------
NM_012448chr1772170 2145 2059 1882 1829 1674 730 22044 915 22176 491 --
NM_012454chr62569 103 ------
NM_012455chr291341 1077 1047 497 216 143 118 63 32 21163 168 31246 1096 234 --
NM_012461chr145638 587 539 492 468 --1276 --
NM_012471chrX21652 53 31801 367 320 ----
NM_012479chr752186 1973 784 395 272 12577 --1555
NM_012486chr1----1414 --
NM_013229chr1232740 2440 223 22467 1816 ----
NM_013230chrY11607 1285 ----
NM_013231chr1463212 1445 1425 1028 702 369 34292 3866 3305 24131 2733 --
NM_013246chr112705 122 1778 ----
NM_013247chr22112 45 ------
NM_013255chr798676 8337 7150 6406 5936 2002 1565 1002 928 27827 3372 16442 23258 1387
NM_013261chr473729 3423 746 277 269 116 61 21066 1030 ----
NM_013269chr12104362 4182 4137 4028 3524 1433 1353 1335 449 418 24021 3957 ----
NM_013272chr151152 ------
NM_013279chr1172301 1843 1738 1688 614 518 230 22223 907 32075 2017 859 --
NM_013280chr114823 784 771 734 1859 ----
NM_013281chr203582 385 264 ------
NM_013283chr51670 ------
NM_013309chr1562678 2195 2031 1764 905 125 195 2954 161 --
NM_013313chr2253546 2252 856 166 150 13071 13364 1834
NM_013316chr72911 795 1903 ----
NM_013320chr121189 ------
NM_013333chr193359 119 53 ------
NM_013341chr252886 2711 1162 1144 882 11956 11168 --
NM_013354chr851404 372 360 157 65 ------
NM_013372chr1563083 2962 981 947 546 442 22922 2825 1211 --
NM_013381chr122271 212 11503 ----
NM_013386chr14515 369 258 50 --1637 --
NM_013396chr2131407 272 63 ------
NM_013399chr1641735 1148 710 60 ------
NM_013400chr721029 45 ------
NM_013433chr1951923 1348 756 715 280 --21578 1544 --
NM_013434chr251724 801 768 588 468 --11968 --
NM_013434chr251724 801 768 588 468 --11968 --
NM_013437chr821090 234 ------
NM_013438chr9--1538 11585 --
NM_013446chr731349 542 187 51298 1257 1220 449 167 11406 --
NM_013448chr141603 1690 ----
NM_013449chr12122437 2111 1206 1187 812 711 625 534 528 330 315 223 --32953 2099 690 --
NM_013937chr621045 827 1289 1421 --
NM_013951chr24956 889 619 135 22348 859 1354 --
NM_013952chr241033 966 696 212 22425 936 1431 --
NM_013953chr241033 966 696 212 22425 936 1431 --
NM_013979chr5--1415 --163
NM_013986chr221117 ------
NM_013989chr1454942 4052 3213 1492 1126 23317 1145 13278 1462
NM_013992chr241033 966 696 212 22425 936 1431 --
NM_013995chrX2358 23 11989 11700 --
NM_014000chr1081555 1354 1284 1259 603 523 502 371 11869 ----
NM_014003chr162328 155 --1138 --
NM_014011chr242551 1951 1756 806 ----12014
NM_014016chr331271 503 180 --1590 --
NM_014021chr133039 2967 131 --21253 1120 --
NM_014023chr1042755 2050 1951 374 --12198 --
NM_014028chr653349 3266 2781 2752 507 1555 12187 --
NM_014034chr631127 470 407 161 ----
NM_014057chr91367 21526 606 11267 --
NM_014059chr132274 21 ------
NM_014079chr311046 --1200 --
NM_014089chr131400 11935 ----
NM_014106chr1511919 11908 132 --
NM_014109chr831157 409 39 1144 ----
NM_014112chr854908 4814 4699 710 683 1670 --14427
NM_014117chr1652365 2248 1038 416 375 12531 1934 --
NM_014155chr11156327 6038 5976 5850 5719 5631 5371 4869 4688 2208 2183 1596 869 544 154 --15095 --
NM_014157chr16124026 2975 2869 2798 1384 1350 1256 1220 1045 973 684 90 21568 1295 1695 --
NM_014178chr141571 1384 ----
NM_014181chr232826 2197 1936 ------
NM_014189chr451493 1343 449 346 338 --2377 80 --
NM_014190chr451845 1695 698 690 318 --2729 432 --
NM_014191chr122833 722 170 ----
NM_014211chr541451 1420 407 301 11141 ----
NM_014213chr2------1168
NM_014216chr1441429 1032 482 342 2467 140 ----
NM_014231chr1271842 1829 1715 478 238 165 21 --11939 --
NM_014232chr1771455 1173 1160 340 311 228 60 2295 243 ----
NM_014232chr1771455 1173 1160 340 311 228 60 2295 243 ----
NM_014233chr1751895 1630 1429 1351 90 11399 31657 766 667 --
NM_014240chr373786 3087 2877 1436 806 659 207 24198 1477 1122 --
NM_014245chr34447 223 189 130 ------
NM_014246chr2231642 580 412 ----12334
NM_014253chrX32112 634 557 ------
NM_014258chr20144 ------
NM_014268chr1831338 1270 1164 ------
NM_014271chrX1592 --128 --
NM_014275chr53933 820 569 --1307 --
NM_014283chr131371 338 288 1997 11059 --
NM_014284chr14909 767 740 733 168 ----
NM_014286chr9143523 3232 2902 2747 2439 2254 1351 1271 1175 966 943 465 458 307 --13251 --
NM_014292chr22101580 1469 551 444 414 404 316 301 273 96 11863 11768 --
NM_014294chr831383 1363 1334 ------
NM_014309chr2265179 5138 4973 4372 3842 1600 --44059 3555 1129 786 44863 4838 4167 1761
NM_014316chr1651995 1848 1766 1633 118 12159 ----
NM_014319chr1241882 1643 412 51 1120 ----
NM_014329chr162278 109 ------
NM_014331chr477465 5474 5169 5063 2624 2505 2348 22275 666 --22074 242
NM_014333chr113894 581 325 ----12296
NM_014342chr1141380 1318 1266 509 1273 ----
NM_014344chr111841 1622 1322 --
NM_014345chr62908 427 1878 ----
NM_014351chr22182 1591 ----
NM_014352chr1131522 510 252 --1947 --
NM_014365chr123351 143 24 153 ----
NM_014368chr941916 1771 1345 401 2414 233 11432 --
NM_014374chr721029 45 ------
NM_014381chr1492962 2468 2456 2410 2241 2108 1253 881 140 11159 --1115
NM_014388chr165128 4997 4375 2320 1572 892 45904 5728 5496 5205 35362 3840 3819 1166
NM_014393chr822311 215 ------
NM_014397chr941405 1323 1077 217 11282 ----
NM_014405chr1752192 1940 1488 389 120 1285 2479 443 1254
NM_014415chr311221 ------
NM_014418chr1471891 1728 1372 693 239 204 196 --1683 1167
NM_014423chr554686 4530 2235 2103 1653 12109 11848 --
NM_014431chr1031584 349 121 ------
NM_014445chr322161 1696 21940 60 11570 --
NM_014447chr411560 --1493 --
NM_014455chr11430 ------
NM_014488chr111680 197 1460 --
NM_014491chr71772 ------
NM_014494chr1642076 915 867 110 11860 ----
NM_014497chr21234 ------
NM_014507chr22------11027
NM_014515chr12--1118 ----
NM_014517chr331250 779 294 ------
NM_014548chr1531537 1329 389 ----21530 1382
NM_014554chr1261972 1450 691 579 547 310 12253 ----
NM_014563chrX42105 1962 1954 201 ------
NM_014570chr224248 207 186 27 --1236 --
NM_014571chr162859 2387 2280 865 477 384 12657 32194 690 549 --
NM_014572chr1321599 422 11504 ----
NM_014575chr31491 1538 ----
NM_014586chr2194554 4040 3795 3400 3286 1922 1609 1530 1023 34451 4063 1620 24009 3464 --
NM_014591chr1061088 846 236 157 108 29 2922 357 1859 --
NM_014592chr54741 658 289 137 ----1183
NM_014607chr23188 126 117 --2643 199 1604
NM_014612chr9196 ------
NM_014613chr5102755 2699 2268 2038 1935 889 754 704 255 37 2995 495 ----
NM_014615chr1683247 2879 2811 2770 2724 901 591 528 13165 ----
NM_014618chr92326 30 ------
NM_014628chr64416 333 311 97 1152 ----
NM_014630chr1593965 3672 3148 2429 535 472 423 401 267 31001 754 545 1604 --
NM_014633chr113188 162 30 ------
NM_014634chr2253091 2790 2751 453 41 1645 33536 2290 1384 --
NM_014636chr994103 3386 3301 3281 3112 2734 723 666 262 11057 11442 --
NM_014655chr161853 1725 1639 792 556 493 12262 1242 22333 321
NM_014659chr1541050 736 367 101 1403 ----
NM_014660chr72801 129 ------
NM_014661chr1083937 3893 1182 1138 826 606 517 299 23754 115 22577 320 11041
NM_014663chr111122 --1313 191
NM_014665chr8103515 3298 2859 2344 599 352 297 186 113 42 --43348 2705 2428 697 --
NM_014666chr52823 418 1365 1388 --
NM_014667chr362401 2385 2283 2122 1681 252 1751 12183 --
NM_014670chr22323 94 --1626 --
NM_014674chr373845 3508 3465 1088 782 327 156 23651 1076 ----
NM_014676chr121657 1488 ------
NM_014682chr82898 487 ------
NM_014686chr1942456 2053 657 135 12212 ----
NM_014689chr21537 ------
NM_014690chr762244 2102 2060 1172 841 451 --22786 2054 12279
NM_014702chr633241 525 163 22395 2287 ----
NM_014705chr721919 420 11906 ----
NM_014707chr732285 2173 1707 ------
NM_014711chr1661773 574 372 214 138 38 ------
NM_014717chr19----1710 --
NM_014721chr655567 5462 5439 5207 311 22795 62 25298 1870 --
NM_014723chr2083211 2623 1279 1126 1108 997 747 424 13085 22139 330 --
NM_014726chr1741240 492 188 156 11390 195 --
NM_014729chr841970 1754 1567 772 1219 ----
NM_014730chr12195062 4827 4770 4678 4324 4199 4183 3734 3592 3243 2028 1476 1319 1060 929 878 629 341 277 21445 938 13715 --
NM_014730chr12195062 4827 4770 4678 4324 4199 4183 3734 3592 3243 2028 1476 1319 1060 929 878 629 341 277 21445 938 13715 --
NM_014731chr204503 394 341 142 --21146 636 11558
NM_014733chr5--42272 1934 1480 638 12255 --
NM_014735chrX72108 1808 1709 1489 731 604 440 --1323 --
NM_014736chr152843 35 ------
NM_014741chr1182086 1423 774 513 482 372 321 146 ------
NM_014742chr2031447 475 398 1275 1128 --
NM_014743chr453057 2829 2286 1117 1064 ------
NM_014746chr271702 1669 1550 339 289 239 29 22817 718 --13486
NM_014747chr1134320 3960 3782 3646 1944 1784 1236 1228 945 803 638 591 273 25356 4398 54999 1459 1122 761 442 24955 4695
NM_014752chr1161944 1519 1379 1349 1247 621 2406 211 1115 --
NM_014754chr83949 604 220 ------
NM_014755chr243830 3369 1301 210 22683 1454 1656 --
NM_014757chr532365 1795 954 1853 ----
NM_014761chr167990 749 304 260 185 152 73 ------
NM_014764chr1221227 276 ------
NM_014765chr142498 1863 768 616 2492 260 ----
NM_014766chr7113810 3713 3129 3029 2590 1256 1205 1174 825 523 197 13304 ----
NM_014767chr1092863 2733 2646 2563 2372 955 947 668 301 22660 1170 22411 2378 21219 248
NM_014772chr1893355 3309 3008 2999 2638 1393 924 734 249 43477 3014 2233 171 ----
NM_014776chr12143092 3050 2988 2963 2484 2451 2428 2231 2115 1110 541 449 419 326 2952 908 11251 --
NM_014779chr3149 1163 ----
NM_014783chr1531192 341 322 ------
NM_014784chr12746 98 1979 1825 1906
NM_014791chr91299 ------
NM_014795chr21252 11348 ----
NM_014800chr72199 94 11142 ----
NM_014802chr1221102 49 ------
NM_014807chr113660 592 69 ----1299
NM_014810chr173458 3440 2603 1414 1046 660 433 ----12947
NM_014812chr121591 118 1392 ----
NM_014819chr531944 778 453 ------
NM_014824chr1131330 629 331 ----11765
NM_014826chr183884 3789 3440 3409 1646 1101 1085 39 11589 1422 --
NM_014827chr121559 159 1319 ----
NM_014830chr1233714 2582 74 12434 11392 --
NM_014832chr1322092 607 11752 ----
NM_014835chr202837 196 1134 --12094
NM_014839chr12604 531 2961 318 ----
NM_014840chr1252731 2591 2542 818 421 1840 ----
NM_014846chr8137 ------
NM_014848chr153391 376 69 --12464 --
NM_014850chr3114435 4291 3928 3899 3888 3550 3393 3380 1916 1087 893 34525 4406 3660 11260 --
NM_014859chr1761340 396 325 198 109 95 11472 ----
NM_014868chr122232 188 --1580 --
NM_014870chr1104177 4109 3945 3581 3354 1067 959 830 81 29 24608 503 23504 1138 --
NM_014872chr952194 2172 1748 386 225 22018 208 12131 --
NM_014873chr134155 562 476 24631 3555 21283 826 --
NM_014874chr13751 409 286 11856 ----
NM_014875chr131183 742 261 ------
NM_014876chr2242052 1801 1746 470 --1185 --
NM_014877chr17107695 6836 6775 6319 5488 4961 2954 2363 1867 1321 47370 2020 1442 1331 25833 1762 16383
NM_014883chr441916 464 389 359 1787 1682 --
NM_014887chr131721 ------
NM_014891chr741348 551 541 531 11080 1491 --
NM_014892chr62551 50 --1518 --
NM_014893chrY41733 1573 884 748 --12324 --
NM_014897chr1742313 2258 2161 881 13103 ----
NM_014901chr561997 1815 712 347 293 283 2500 472 21628 159 1250
NM_014902chr2041371 530 407 169 --11552 --
NM_014903chr1262393 2162 2114 1933 1845 361 ------
NM_014904chr1063454 3186 1490 777 326 244 ------
NM_014905chr232062 1625 487 11377 ----
NM_014906chr1763939 3640 2913 2877 631 451 33387 3140 1532 1221 13096
NM_014909chr1493929 3453 3142 2901 2413 916 775 524 377 12677 13518 --
NM_014912chr1022884 2789 ------
NM_014914chr231004 847 109 1444 ----
NM_014918chr1531610 1065 320 ------
NM_014921chr19142968 2895 2887 2848 2804 2495 2481 1199 1183 818 529 522 503 367 1604 1633 --
NM_014924chr1442192 765 603 529 --1359 1380
NM_014932chr3165 11578 ----
NM_014934chr13103841 3543 3376 3082 2977 2941 2759 1301 696 145 13642 ----
NM_014935chr163715 2836 2789 2751 2721 1436 1361 13057 --
NM_014939chr1861226 522 463 443 390 113 11569 21266 1054 --
NM_014944chr14908 528 521 225 --11337 --
NM_014945chr571853 1335 1242 666 334 324 228 21892 1255 ----
NM_014946chr221902 1081 32392 1929 822 ----
NM_014947chr162959 2810 2595 2048 446 207 ------
NM_014949chr13849 758 152 ------
NM_014961chr43766 480 219 --11462 1354
NM_014969chr12410 323 1840 ----
NM_014974chr1021752 419 --11252 --
NM_014978chr1031128 731 289 ------
NM_014982chr1464074 3721 2128 2083 1170 448 34850 1362 526 ----
NM_014988chr422520 172 1505 --12474
NM_014989chr6--1398 31636 1333 608 --
NM_014990chr142277 149 ------
NM_014991chr432504 799 224 1258 --13214
NM_014992chr141704 1878 ----
NM_014994chr1582325 2155 2096 840 785 662 364 200 1181 ----
NM_014996chr351049 1002 316 149 74 ------
NM_014997chr782895 2860 2583 2337 2173 2154 1060 207 12538 --11100
NM_014999chr1211576 ----11376
NM_015000chr1222222 1144 12590 13069 --
NM_015008chr383219 2975 2834 2553 2387 523 265 240 --11289 --
NM_015009chr32588 59 ------
NM_015020chr1643675 2604 1383 717 --22867 194 --
NM_015023chr151697 1677 1550 1448 1142 --21257 278 --
NM_015025chr222547 2033 ------
NM_015032chr1352858 2556 513 427 26 ------
NM_015033chr9102889 2821 1299 813 538 310 154 131 118 36 --23255 2098 1820
NM_015035chr20186190 6137 5837 5737 5226 5035 4673 4292 4243 4065 1776 1624 1296 1123 582 551 448 78 24623 2574 25744 1215 14520
NM_015039chr1144045 3516 3462 3329 3257 3235 3135 1631 1527 1220 1063 951 513 73 23432 904 43122 1644 1533 258 11681
NM_015042chr15113971 3917 3720 3682 3654 3471 2977 2844 1336 1243 841 13434 14374 --
NM_015044chr1673257 2993 2918 2755 2632 656 283 13148 32422 696 326 12912
NM_015045chr101458 1555 --184
NM_015046chr952389 1944 1825 1109 452 --1539 1222
NM_015051chr92615 346 23123 973 11012 --
NM_015052chr741124 509 52 30 1926 ----
NM_015053chr162234 1864 1783 1774 388 222 1711 1540 --
NM_015059chr15143386 3265 3079 2893 2862 2853 2628 2555 2436 1379 658 598 335 148 --13214 167
NM_015063chr19101374 1226 1188 1060 959 447 349 342 270 215 ------
NM_015064chr1272257 2234 1212 1096 1049 908 562 32336 1447 612 12817 --
NM_015068chr751587 1490 1315 47 28 1126 --12495
NM_015074chr1184664 4588 4492 3953 3541 3511 3210 3137 1927 1800 1670 1184 894 876 591 570 458 127 ------
NM_015075chrX32249 1958 100 21903 1451 ----
NM_015076chr694451 4288 4173 3663 3609 3485 3422 305 216 1242 ----
NM_015079chr1563032 2432 1242 1235 1082 32 --33080 2369 2139 --
NM_015086chr1231380 97 43 21444 128 --1624
NM_015087chr1332274 2000 611 12545 ----
NM_015090chr1135709 5394 5162 5094 4845 4709 3998 2436 1902 1786 774 715 705 24744 4201 44279 1358 435 405 12134
NM_015092chr1654471 4007 3481 1842 733 14586 ----
NM_015094chr2284551 3310 2959 1525 864 817 607 306 21592 490 --1825
NM_015097chr331729 686 29 ----1898
NM_015100chr131642 793 156 --21885 1850 --
NM_015102chr1289 21 ------
NM_015107chrX62374 2172 1649 1538 1523 580 --22389 522 --
NM_015113chr1742245 735 667 555 2586 110 11549 --
NM_015115chr431047 1018 362 ------
NM_015129chrX31122 659 55 ------
NM_015130chr411289 11089 ----
NM_015132chr711769 21786 498 ----
NM_015138chr1522670 1012 ------
NM_015144chr16103343 3257 3234 3227 3066 1558 529 478 455 226 12567 ----
NM_015149chr142108 1768 1433 470 --1129 --
NM_015150chr33929 130 85 --1618 1167
NM_015151chr2141034 731 309 105 1163 --1357
NM_015155chr1053036 2388 2326 1189 906 12931 22303 1006 --
NM_015156chr1483864 3507 3303 1471 1113 355 174 98 1775 1376 13500
NM_015158chr9----3247 230 56 --
NM_015161chr1621317 1127 11046 ----
NM_015170chr831898 1542 617 --1227 --
NM_015171chr162440 102 ------
NM_015172chr121322 600 1639 ----
NM_015176chr161657 1641 1468 1418 158 92 ------
NM_015191chr1162532 1871 890 829 290 51 --11675 --
NM_015192chr201651 12574 ----
NM_015194chr1741473 350 181 146 --21535 198 --
NM_015199chr352314 2068 2041 1100 1068 11987 ----
NM_015200chr462134 2091 1987 1862 594 124 --1306 186
NM_015205chr13123956 3934 3880 3352 2027 1469 706 662 596 535 243 37 --34595 1897 1406 --
NM_015206chr1562888 2444 1222 619 506 487 22617 834 1906 --
NM_015208chr1823913 1256 11212 --13285
NM_015209chr142151 1718 474 249 --1897 --
NM_015215chr112936 --1445 12996
NM_015216chr511078 ------
NM_015225chr922072 295 42869 2718 729 663 ----
NM_015226chr1693455 3275 3034 2879 2272 1339 1239 696 133 23288 593 22731 2110 33150 288 172
NM_015234chr631145 1023 273 ------
NM_015236chr41225 1330 ----
NM_015245chr662330 2323 1117 1007 768 581 1963 12549 --
NM_015247chr16124928 4818 4550 4237 4221 3924 3705 2148 2142 879 820 676 44760 1873 1195 1163 24782 3438 1169
NM_015250chr941651 1586 308 255 ------
NM_015252chr22739 620 1230 ----
NM_015254chr882934 2867 2786 2471 850 701 663 152 12250 12601 12025
NM_015256chr51130 1571 ----
NM_015260chr1961549 1393 1236 1004 469 310 ------
NM_015263chr153985 362 106 11132 ----
NM_015265chr231964 322 268 12121 --1638
NM_015270chr12102240 2049 1896 1722 1674 1645 1586 532 406 352 11686 22151 686 --
NM_015271chr433086 3009 857 24091 874 ----
NM_015272chr1641854 1680 1606 58 ------
NM_015278chr662964 2211 1053 689 83 24 --1310 13026
NM_015282chr2112689 2480 2412 2342 2203 1950 1225 889 845 690 138 22042 1110 12404 --
NM_015285chr1862460 2227 1607 646 250 69 --32548 2365 283 --
NM_015288chr543201 3002 2686 253 --183 32669 1085 590
NM_015291chr143054 2278 1072 979 22159 876 22459 289 --
NM_015292chr123568 243 38 ------
NM_015296chr131404 ------
NM_015299chr14163962 3817 3811 3731 3698 3084 1555 1481 1361 987 970 901 746 376 369 75 13935 13680 --
NM_015305chr1461894 1794 1750 1676 389 176 --1189 --
NM_015308chr111120 2594 324 ----
NM_015310chr8147958 7568 7560 7445 7137 6720 5466 5458 3042 2639 1839 1329 1262 1030 57343 6940 2494 2114 1198 28269 3207 --
NM_015313chr11104411 4077 4052 3658 3447 3088 1625 1471 712 581 33386 3191 605 1937 --
NM_015315chr593435 2947 2784 2156 2110 1120 1036 998 551 32349 754 739 13141 --
NM_015317chr272408 2380 2341 2124 2087 1116 446 --1667 --
NM_015326chr1112557 2371 2306 1989 1154 1008 935 908 863 731 560 11912 2607 524 1877
NM_015327chr161246 962 468 259 182 56 2934 341 ----
NM_015332chr783355 2922 2776 2388 1038 505 337 74 1691 --23417 3340
NM_015335chr125997 328 43 35 24 1187 ----
NM_015336chr1212447 ------
NM_015338chr2061946 1574 1352 770 405 193 ------
NM_015339chr20--2731 195 ----
NM_015344chr841923 1917 281 37 ----12085
NM_015345chr632760 2387 658 --1380 11115
NM_015346chr1441607 601 392 101 21724 1571 21403 291 --
NM_015349chr642694 2150 1962 222 12707 177 --
NM_015353chr1792447 2403 1931 1829 1006 835 602 454 337 --22765 1919 11101
NM_015355chr172587 521 11518 ----
NM_015361chr21753 ------
NM_015365chrX73742 3486 2616 385 346 322 35 ------
NM_015375chr1114552 4227 4123 3401 3366 3279 1588 1424 802 618 575 23534 1549 1497 --
NM_015378chr182991 2675 2657 2620 2461 1830 1173 1159 ----12555
NM_015385chr1062668 2206 1291 1028 786 495 12008 --12119
NM_015396chr321280 41 11082 ----
NM_015397chr961516 1469 1401 1277 688 54 11351 1300 --
NM_015401chr124783 354 171 80 1694 ----
NM_015404chr9282 53 ------
NM_015415chr11170 ------
NM_015426chr31586 ------
NM_015428chr1931220 583 296 11697 ----
NM_015429chr331062 1024 1001 ------
NM_015443chr1741385 1031 518 62 ------
NM_015455chr554032 2788 1356 923 607 --11132 --
NM_015457chr113985 802 242 1236 ----
NM_015460chr351871 1544 585 293 204 --1504 --
NM_015466chr3294 24 ------
NM_015477chr152666 115 1744 ----
NM_015483chr72975 325 ------
NM_015488chr251734 1276 623 552 537 ------
NM_015493chr1962046 1492 149 76 65 46 --1597 --
NM_015497chr152807 467 1121 --1291
NM_015503chr16--2575 459 ----
NM_015508chr331547 1012 451 ------
NM_015509chr1241356 1325 633 536 11597 1544 --
NM_015511chr2051136 1102 981 959 948 --11047 --
NM_015520chr382743 2737 2531 1889 1880 1797 1716 359 --2554 431 --
NM_015527chr164717 599 513 101 --2786 229 --
NM_015530chr23986 729 326 --1274 --
NM_015534chr13217 198 89 1129 ----
NM_015541chr331158 1147 578 ------
NM_015542chr102986 889 ----1418
NM_015545chr7--1710 1290 --
NM_015548chr62759 364 3335 308 31 ----
NM_015550chr7103169 2848 2836 2726 2291 2254 862 843 814 641 12674 12545 1792
NM_015554chr1542780 2676 1967 1912 ------
NM_015557chr183083 2735 2374 2352 1220 703 665 413 --23123 1077 --
NM_015564chr522956 2597 11054 ----
NM_015565chr2131529 738 121 128 ----
NM_015568chr2073890 3206 2760 2744 1643 1469 193 --24274 759 --
NM_015569chr144670 3903 1493 1138 --23109 2930 11064
NM_015570chr731760 1306 734 21150 699 ----
NM_015576chr322223 1822 12281 32334 1146 869 22067 767
NM_015578chr1912009 --1723 --
NM_015601chr10--1841 ----
NM_015604chr143636 275 213 ------
NM_015605chr1011527 1181 ----
NM_015607chr12199 157 ------
NM_015635chr932200 1940 1428 2623 56 --11442
NM_015652chr104624 490 223 179 1185 ----
NM_015657chr22863 211 ------
NM_015678chr132538 71 ------
NM_015681chr17------127
NM_015686chrX32505 2333 1760 --22455 2412 --
NM_015691chrX42455 2372 1084 195 2369 216 1631 --
NM_015694chr71139 1254 ----
NM_015695chr631886 1850 220 32156 1892 1872 21969 652 --
NM_015726chr171785 1395 1310 595 539 529 66 11747 ----
NM_015833chr2182253 1733 928 749 607 574 552 236 1613 21954 1702 --
NM_015840chr182679 2316 2100 1943 1799 947 687 480 22492 2268 ----
NM_015841chr182679 2316 2100 1943 1799 947 687 480 22492 2268 ----
NM_015850chr892267 2134 1820 1799 1729 875 273 136 100 1342 42411 2358 1690 88 --
NM_015853chr112150 48 ------
NM_015872chr161394 1185 1169 472 464 452 --21549 263 --
NM_015878chr8----11848 --
NM_015879chr18148184 6648 6507 6384 5613 2538 2467 2447 2299 1925 1395 823 744 519 27181 1547 --12024
NM_015886chr845704 3932 3601 305 25195 4101 ----
NM_015888chr133248 1191 54 1198 ----
NM_015889chr223911 597 114 ------
NM_015891chr631623 1560 1441 1639 ----
NM_015898chr1962173 2149 2120 1742 1650 240 ------
NM_015902chr81143 ------
NM_015906chr174479 4324 4053 4031 3308 1860 1062 33666 281 124 14669 --
NM_015912chr882491 2337 2228 2035 2029 1969 1684 432 11886 ----
NM_015948chr61400 ------
NM_015955chr21156 ------
NM_015981chr562522 2495 1077 1039 692 406 1971 11969 --
NM_015982chr171427 1143 ----
NM_015995chr15145381 5243 5128 4999 4757 4428 2219 2105 2066 1713 1279 910 497 294 24286 2097 43698 607 520 48 --
NM_016009chr144535 4248 3467 962 34225 3955 664 ----
NM_016019chr7127 1163 ----
NM_016022chr16777 768 713 163 145 94 ------
NM_016038chr7------1486
NM_016061chr231448 1359 556 ------
NM_016072chr1221997 432 12346 ----
NM_016073chr153424 327 153 --2988 101 --
NM_016075chr1342843 2594 911 727 ----12787
NM_016076chr162415 1244 1197 1149 833 584 1700 135 --
NM_016083chr643049 1219 962 79 1851 ----
NM_016096chr871936 1498 1409 590 450 433 225 ------
NM_016120chrX1146 11042 ----
NM_016125chr171573 ------
NM_016131chr282327 2269 1496 771 761 746 727 412 ------
NM_016132chr1543352 2476 521 511 12318 ----
NM_016133chr211133 --1350 --
NM_016141chr31811 ------
NM_016147chr113980 272 242 1384 1828 --
NM_016156chr1122119 1744 12253 12048 --
NM_016162chr123319 306 259 ------
NM_016169chr1093268 2793 2483 1288 1128 1108 645 428 262 1617 43182 3061 2608 1010 --
NM_016173chr393781 3715 3477 3402 2949 1746 1634 878 522 21773 1738 33750 761 627 --
NM_016201chr341439 500 457 100 12307 2911 783 --
NM_016206chr3138073 7929 7195 7181 7148 3274 2973 2863 2079 1945 1748 1208 1130 11046 12114 --
NM_016210chr33980 620 101 170 11204 --
NM_016213chr15168 ------
NM_016221chr542302 835 336 290 12327 ----
NM_016227chr131371 338 288 1997 11059 --
NM_016230chr62142 21 --1436 --
NM_016233chr15928 879 423 153 134 ------
NM_016235chr1651356 1268 1064 1039 52 ------
NM_016240chr861521 1334 1316 1039 659 522 11066 1621 --
NM_016252chr22885 804 ------
NM_016255chr653213 3158 2486 430 67 ------
NM_016257chr1103275 3169 2412 2334 2328 1198 499 434 110 68 33431 3259 406 22888 25 --
NM_016260chr245670 5580 5181 1145 24672 2952 36786 1987 1455 --
NM_016261chr173566 121 70 ------
NM_016272chr2291911 1743 961 914 850 687 441 348 311 ------
NM_016281chr123943 892 229 1861 ----
NM_016284chr162939 397 192 1914 --
NM_016287chr152049 1804 268 260 198 ------
NM_016302chr32515 328 1539 ----
NM_016303chrX--165 1180 --
NM_016315chr21219 11894 ----
NM_016316chr21597 129 ----
NM_016320chr1151146 804 123 92 58 --1724 --
NM_016328chr71126 ------
NM_016329chr32452 390 ------
NM_016333chr163418 196 57 --2166 89 --
NM_016338chr52862 281 ------
NM_016339chr1791597 1569 1558 1230 644 572 409 109 35 --21470 222 --
NM_016353chr822253 107 ------
NM_016373chr164290 223 178 89 ------
NM_016374chr131629 1305 1114 ------
NM_016374chr131629 1305 1114 ------
NM_016376chr1733636 867 106 --32975 1194 33 22964 1051
NM_016395chr1511630 2194 148 ----
NM_016396chr1562887 2304 2052 606 462 367 22386 2143 ----
NM_016418chr22123744 3593 3320 3136 2401 2377 1363 1298 1150 1122 899 877 32674 336 279 12804 --
NM_016424chr17--11969 11997 --
NM_016431chr223760 300 235 1481 2729 290 --
NM_016436chr2052260 2056 1002 420 409 22589 935 ----
NM_016441chr222088 716 12300 12265 --
NM_016467chr22911 134 ------
NM_016470chr20------1451
NM_016475chr1441246 1124 866 358 21165 786 ----
NM_016478chr73100 71 21 ------
NM_016480chr51726 ------
NM_016505chr12713 218 --1701 --
NM_016507chr1773220 2125 970 828 750 687 140 23069 62 --13082
NM_016519chr4----1211 --
NM_016522chr1131671 1089 336 11422 --11642
NM_016525chr93856 258 43 1785 1146 --
NM_016526chr1182275 2112 1943 1804 1783 1573 301 220 22387 2305 41822 1708 609 573 --
NM_016530chr1593855 3428 3230 3101 1506 979 721 247 47 156 ----
NM_016531chr443630 1119 915 54 23106 126 33963 828 394 --
NM_016547chr12638 257 1557 ----
NM_016553chr192520 31 11361 11140 --
NM_016569chr1241108 621 549 539 --1309 11351
NM_016574chr113710 286 43 1314 ----
NM_016577chr3144300 4277 4215 3988 3809 3399 3304 2962 2764 1477 758 402 123 37 32736 1300 712 --11336
NM_016578chr11----1232 --
NM_016588chr62621 102 ------
NM_016592chr202443 27 ------
NM_016596chr124783 354 171 80 1694 ----
NM_016603chr51484 2749 48 ----
NM_016605chr552496 1948 1900 1784 261 --12604 --
NM_016621chr11114467 4041 3866 3622 3605 3409 3020 1479 724 674 458 34297 2881 1503 33628 3551 1182 --
NM_016623chr82258 125 ------
NM_016626chr182676 185 ------
NM_016631chr212746 138 ------
NM_016653chr211046 ------
NM_016733chr2271553 1432 563 523 310 94 66 11080 ----
NM_016829chr32305 42 ------
NM_016830chr123204 191 77 ------
NM_016929chr664322 3730 1653 1612 955 179 11680 1666 --
NM_016936chr1642069 1938 1764 429 --1522 12088
NM_016940chr211624 1448 ----
NM_016946chr183490 2515 1441 1313 1223 503 494 404 12754 13002 --
NM_016952chr1173908 3774 3524 2995 2846 2794 274 31373 1363 742 ----
NM_017413chrX82464 1772 683 635 425 241 230 74 --1310 --
NM_017420chr1453194 3014 2871 2712 927 12842 --11522
NM_017423chr412047 ------
NM_017447chr2134215 3835 1328 11757 ----
NM_017450chr1721434 1065 1438 2973 544 --
NM_017455chr15------130
NM_017488chr221481 400 1300 21487 406 --
NM_017522chr11992 ------
NM_017544chrX2865 228 1988 ----
NM_017548chr341904 592 562 80 ------
NM_017553chr1521175 361 --21011 998 1497
NM_017563chr396140 6127 5805 4394 1799 1634 1530 1184 70 35126 4346 1867 2598 265 --
NM_017575chr1741185 646 631 567 21396 517 --21240 42
NM_017580chr1072360 2216 2042 787 544 403 135 ------
NM_017582chr121148 110 ------
NM_017590chr2282649 2538 2261 1975 1646 974 396 387 21785 608 --1854
NM_017593chr41428 ------
NM_017596chr1154651 4243 4204 4156 4117 3437 2918 2852 1799 1781 1150 1142 187 169 133 ------
NM_017602chrX3374 253 197 --1937 --
NM_017610chr152251 48 1750 ----
NM_017628chr443928 2032 1872 937 13445 ----
NM_017629chr141956 1948 1208 582 ----11892
NM_017633chr623720 2861 11485 --12568
NM_017635chr1141489 1441 1365 105 ------
NM_017637chr9139099 8817 8512 8464 7717 7400 6669 6533 6227 6017 3768 2609 2120 26195 163 28749 7912 --
NM_017640chr6297 26 1600 ----
NM_017643chr1773023 2536 2483 1237 1161 840 782 --12815 --
NM_017657chr21298 ------
NM_017658chr1454161 3772 3692 967 566 33506 1542 364 11583 11127
NM_017664chr1341067 793 217 37 --1679 --
NM_017666chrX4602 397 258 54 ------
NM_017667chr72492 186 ------
NM_017670chr112830 109 --2745 176 --
NM_017672chr1521159 181 ------
NM_017680chr92886 691 ------
NM_017686chr11122 1292 --11150
NM_017693chr133652 548 213 ------
NM_017709chr163531 2752 2645 1630 847 553 ----23116 3032
NM_017719chr361872 822 644 416 366 34 ------
NM_017724chr32684 34 ------
NM_017730chr3--1225 ----
NM_017737chr142198 699 398 204 12004 ----
NM_017738chr93944 913 815 1962 1795 1137
NM_017739chr11207 ----1179
NM_017741chr472726 2715 2564 961 824 335 283 129 --11107
NM_017742chr18--11972 ----
NM_017744chr151891 1666 1600 911 762 ------
NM_017745chrX146 ------
NM_017754chr664975 4559 3615 3533 1459 895 --34537 3166 904 13754
NM_017757chr182984 818 21089 74 ----
NM_017763chr173835 449 180 ------
NM_017766chr16552 508 391 144 118 83 ------
NM_017772chr651520 1322 1120 443 320 141 21497 167 --
NM_017778chr861165 1001 995 551 535 134 --11520 --
NM_017780chr82865 598 ------
NM_017784chr341154 919 887 473 ------
NM_017786chr82110 89 ------
NM_017787chr1062859 2754 2450 963 955 113 ----1633
NM_017799chr1431542 1287 424 ------
NM_017807chr142128 32 ------
NM_017810chr163654 272 31 ----2646 86
NM_017811chr932466 2376 295 ----12453
NM_017813chr855799 5551 5457 737 151 25839 3564 14329 --
NM_017824chr102773 764 ------
NM_017831chr1863253 1588 1415 1398 1209 651 1195 1636 --
NM_017848chrX84477 4384 3672 3519 1818 1771 705 154 24333 1533 ----
NM_017849chr2113196 3092 2942 1198 969 937 909 897 609 323 168 12209 ----
NM_017873chr932302 908 789 1710 21029 563 --
NM_017890chr851687 1598 444 312 25 1667 --11757
NM_017902chr10165494 4607 4547 4501 4016 3782 3620 2226 2158 1577 1208 1196 1172 635 370 232 65629 5205 4618 4404 2181 1794 43989 2061 1605 1511 --
NM_017919chr9115045 4806 4122 3924 2334 1681 1464 966 841 740 265 --33833 1568 1046 --
NM_017921chr1781791 1772 1693 1680 646 395 168 80 2141 50 ----
NM_017934chr6182 ------
NM_017943chr141836 ------
NM_017944chr113936 884 25 12348 ----
NM_017946chr721302 1074 --1474 --
NM_017949chr172274 23 ------
NM_017964chr22837 40 ------
NM_017987chr1021464 554 1697 ----
NM_017993chr13123 1404 ----
NM_017994chr782875 2858 2746 1207 798 296 281 50 ------
NM_017998chr92944 48 ------
NM_018011chr13----2575 483 1510
NM_018014chr221380 144 ------
NM_018026chr1141097 1008 331 101 11142 ----
NM_018027chr1042650 2018 426 27 1593 12771 --
NM_018045chr192800 2408 2279 2227 2197 2091 790 449 31 12717 --12014
NM_018047chr54855 722 633 589 ------
NM_018048chr1262044 1691 1439 781 424 305 ------
NM_018061chr12651 107 ------
NM_018062chr22409 156 ------
NM_018063chr103467 401 56 ------
NM_018071chr142322 118 2786 753 ----
NM_018078chr4--1215 --182
NM_018084chr22151 51 1193 ----
NM_018086chr221802 1638 ------
NM_018107chr145981 812 745 377 28 ----2273 125
NM_018117chr102709 534 --1273 --
NM_018120chr811407 ------
NM_018121chr1033062 2032 1142 11164 ----
NM_018133chr321566 200 ------
NM_018150chr12900 792 ------
NM_018155chr333220 2126 1128 2735 462 --12406
NM_018156chr182991 2675 2657 2620 2461 1830 1173 1159 ----12555
NM_018157chr1263169 2765 2240 1151 345 51 1822 ----
NM_018164chr121245 ------
NM_018171chr122866 838 --1743 170
NM_018172chr1191253 601 585 533 481 445 429 377 341 ------
NM_018178chr151897 1835 1765 700 427 --1521 --
NM_018181chr1831717 1387 29 21287 1220 --21522 347
NM_018182chr1792134 2064 2038 1928 1638 1611 532 313 258 11844 11732 --
NM_018184chr361893 763 748 89 61 27 ------
NM_018195chr1141568 614 426 57 --22045 1608 --
NM_018201chr9102376 2310 1985 728 718 643 629 595 304 252 22495 2210 1336 --
NM_018206chr161251 ------
NM_018208chr141131 914 883 438 --1222 --
NM_018211chr131850 48 37 2354 276 ----
NM_018214chr62852 87 --156 --
NM_018227chr453155 3102 3079 2512 284 22826 2283 ----
NM_018237chr10--1207 ----
NM_018240chr13862 233 28 165 ----
NM_018243chr483803 3447 3373 3057 2875 2684 1100 61 2718 447 13534 --
NM_018247chr623015 2001 --12078 --
NM_018254chr131884 1674 339 1820 1710 --
NM_018263chr282252 2104 1710 1616 774 708 541 72 ------
NM_018275chr72426 63 --2524 220 --
NM_018293chr332859 1070 933 189 13001 --
NM_018299chr8103198 3087 2619 2547 2430 1239 1090 896 722 329 1732 ----
NM_018307chr172667 22 ------
NM_018312chr1111591 21645 1357 11659 --
NM_018315chr421063 49 ------
NM_018325chr91192 --3627 621 577 --
NM_018330chr1021133 248 ------
NM_018360chrX4274 267 257 53 1353 ----
NM_018361chr844022 3644 1434 1022 181 ----
NM_018362chr1142759 876 124 55 13732 ----
NM_018364chr1134146 4107 3845 3713 3598 2967 1635 1313 1277 785 551 353 291 --1673 --
NM_018370chr1232114 663 144 12139 ----
NM_018371chr82593 146 --11441 --
NM_018374chr734280 1674 440 34988 1770 1748 ----
NM_018375chr1451919 1888 743 380 87 21837 659 ----
NM_018386chr13------1116
NM_018387chr9------1401
NM_018388chrX11276 11358 ----
NM_018394chr311436 ----1213
NM_018403chr383573 3145 3139 2617 1553 1384 907 203 23928 915 ----
NM_018413chr12----1200 --
NM_018416chr1292539 2051 1924 569 284 203 178 129 81 1908 12509 --
NM_018424chr941925 1843 493 366 1601 --1291
NM_018429chr542354 2021 278 180 --1326 --
NM_018440chr8158206 7704 7347 7156 6856 6249 5488 2139 2025 1913 670 655 464 414 244 37661 7134 2127 28154 647 --
NM_018452chr6_random33526 2642 1478 1723 12380 --
NM_018482chr82366 233 ------
NM_018489chr13530 443 70 12358 ----
NM_018490chr11--1543 ----
NM_018509chr1751626 1319 534 480 391 1180 ----
NM_018553chr1741700 1652 1329 1213 ------
NM_018557chr241353 1177 360 119 ------
NM_018566chr164832 3253 1493 1252 252 150 44717 906 793 692 24030 3786 --
NM_018571chr22170 47 ------
NM_018584chr11976 --11251 --
NM_018590chr1021488 186 1457 11648 --
NM_018622chr3----137 --
NM_018638chr1265368 4741 3872 2254 647 331 14188 1570 --
NM_018639chr1241302 539 418 175 --1937 --
NM_018644chr1142085 425 417 75 11646 1431 --
NM_018646chr73500 46 25 ------
NM_018650chr142233 1942 578 359 ------
NM_018660chr882846 2285 2267 2239 996 829 552 360 --21080 29 --
NM_018667chr1671871 1020 998 733 510 320 54 --22469 1746 --
NM_018683chr2051633 420 356 347 262 11523 --11314
NM_018684chrX31285 1127 407 ------
NM_018689chr15112590 2490 2206 1935 1900 1809 1775 1027 975 531 243 --11665 --
NM_018712chr112598 62 ------
NM_018717chr442640 916 756 81 11989 ----
NM_018718chr7101968 1929 1870 928 668 547 346 237 153 135 --2398 141 --
NM_018719chr7--11270 11294 --
NM_018837chr201333 --1725 --
NM_018841chr1113471 3407 2634 1259 1029 1020 980 740 515 162 144 21298 61 ----
NM_018890chr731306 1003 33 11515 ----
NM_018897chr2121 ------
NM_018912chr541720 1376 1273 383 --11167 11588
NM_018913chr541720 1376 1273 383 --11167 11588
NM_018914chr541720 1376 1273 383 --11167 11588
NM_018915chr541720 1376 1273 383 --11167 11588
NM_018916chr541720 1376 1273 383 --11167 11588
NM_018917chr541720 1376 1273 383 --11167 11588
NM_018918chr541720 1376 1273 383 --11167 11588
NM_018919chr541720 1376 1273 383 --11167 11588
NM_018920chr541720 1376 1273 383 --11167 11588
NM_018921chr541720 1376 1273 383 --11167 11588
NM_018922chr541720 1376 1273 383 --11167 11588
NM_018923chr541720 1376 1273 383 --11167 11588
NM_018924chr541720 1376 1273 383 --11167 11588
NM_018925chr541720 1376 1273 383 --11167 11588
NM_018926chr541720 1376 1273 383 --11167 11588
NM_018927chr541720 1376 1273 383 --11167 11588
NM_018928chr541720 1376 1273 383 --11167 11588
NM_018929chr541720 1376 1273 383 --11167 11588
NM_018948chr131015 1000 119 ------
NM_018953chr122702 149 1826 3756 51 45 --
NM_018959chr191577 ------
NM_018963chr2121443 144 ------
NM_018970chr732736 2093 46 ------
NM_018976chr1222460 778 ----12203
NM_018977chrX21043 720 1296 ----
NM_018979chr1252107 1709 771 640 253 11792 ----
NM_018991chr72589 165 ------
NM_018999chr1094925 4789 4742 4550 4530 4333 4327 1296 1120 13216 24255 340 --
NM_019000chr511519 11600 ----
NM_019002chr2182 ------
NM_019004chr742168 2087 1674 518 ------
NM_019005chr7156 ------
NM_019008chr22113767 3722 3295 3279 3149 2795 1407 1295 646 360 216 13733 3585 422 94 13558
NM_019022chr1862745 2529 2445 2056 704 147 --1754 --
NM_019027chr422372 876 ----11950
NM_019030chr51177 ------
NM_019035chr431362 827 788 21405 672 11719 --
NM_019042chr731130 58 50 ------
NM_019053chr1011090 --1799 --
NM_019063chr252279 1903 777 654 154 1433 ----
NM_019064chr172784 696 1805 1702 --
NM_019069chr332133 1962 1864 12625 22051 951 --
NM_019087chr561722 1357 642 381 255 223 11678 ----
NM_019096chr641042 859 136 35 --1355 --
NM_019102chr72457 90 --1401 --
NM_019102chr72457 90 --1401 --
NM_019106chr2273202 2172 1269 530 293 244 234 --1724 1802
NM_019114chr952419 2100 2054 1858 594 ------
NM_019116chr16133622 3376 3336 2704 2446 1497 1343 1304 1242 1100 1071 637 75 12824 ----
NM_019555chr361237 729 540 343 150 129 ------
NM_019557chr12836 290 ------
NM_019590chr1031379 1319 505 --11444 --
NM_019592chr9--181 ----
NM_019593chr20103080 2745 2732 2713 2632 2437 2149 2094 916 200 --22069 803 --
NM_019594chr941487 1260 463 278 --11350 --
NM_019595chr22546 141 1526 ----
NM_019597chrX1718 ------
NM_019600chr152582 325 1143 ----
NM_019610chr152119 589 282 136 126 ------
NM_019859chr1041473 1169 1033 100 21500 1450 1577 --
NM_019860chr1041521 1217 1081 148 21548 1498 1625 --
NM_019885chr292492 2343 2326 2180 1096 1010 654 346 137 11824 22233 892 --
NM_019895chr32980 964 ------
NM_020039chr1241828 1251 392 166 ------
NM_020066chr13876 861 789 ------
NM_020116chr431705 1393 365 ------
NM_020122chr2115587 5525 4860 4507 4203 2307 1441 1211 674 231 224 23911 1391 15113 --
NM_020123chr102397 125 21273 181 ----
NM_020127chr151872 711 688 437 280 21456 94 ----
NM_020130chr831192 1138 1046 --1267 --
NM_020134chr271141 1026 1015 937 793 219 204 ------
NM_020139chr43758 413 92 ------
NM_020141chr131940 1863 1530 12412 1232 --
NM_020144chr771719 1677 1623 769 196 181 172 1672 ----
NM_020148chr1863010 2563 2493 2453 1100 303 ------
NM_020150chr1031931 1860 38 1569 1132 --
NM_020159chr421710 1521 ------
NM_020177chr522378 1270 ----12447
NM_020178chr171900 1373 11126 --
NM_020182chr2073189 3171 2980 2760 2602 2315 131 --43417 2727 1124 799 --
NM_020184chr231960 1798 1454 11826 12075 1441
NM_020193chr114535 445 319 266 ------
NM_020205chr143376 3364 3256 1372 11362 12372 --
NM_020225chr4--1397 ----
NM_020226chr43718 519 90 ------
NM_020228chr1142329 1976 927 131 ------
NM_020229chr113369 272 157 1362 1100 --
NM_020239chr172155 841 822 590 573 460 442 189 21462 315 --
NM_020240chr5--11886 11095 --
NM_020309chr193893 93 55 --21065 1059 --
NM_020310chr1782412 2383 2184 1968 1739 779 716 696 42583 932 601 328 22575 2040 --
NM_020317chr11303 ------
NM_020336chr2071466 1453 1206 1111 897 704 620 23284 3198 ----
NM_020337chr452992 1196 678 373 119 3907 810 277 --13060
NM_020338chr10103194 2394 2367 2330 1028 698 578 414 407 329 12648 11189 1754
NM_020340chr622148 869 21502 250 ----
NM_020341chr201771 ------
NM_020342chr242612 296 170 61 ------
NM_020346chr1121344 1103 ------
NM_020348chr1042811 1081 1010 610 ------
NM_020357chr311548 11275 ----
NM_020362chr11846 ------
NM_020381chr62353 298 --21279 523 --
NM_020384chrX21872 397 11701 ----
NM_020390chr364341 1732 1321 613 304 227 13960 ----
NM_020403chr1331820 1752 628 ------
NM_020405chr17154466 4182 4074 4016 3510 3098 3032 2990 1551 1071 717 704 697 333 79 11759 23959 957 --
NM_020416chr482425 2283 2190 2183 2157 798 307 161 12512 12275 --
NM_020420chrY21827 1785 ------
NM_020429chr762931 2328 2272 723 641 129 --12165 --
NM_020433chr2041213 1178 342 269 1281 31161 522 29 --
NM_020443chr1126613 6431 6162 5326 5144 4262 4228 2707 2617 1862 1511 361 --25639 2316 --
NM_020445chr72785 53 ------
NM_020452chr171915 1604 1504 1433 826 473 98 1479 --1398
NM_020455chr621050 26 1670 11062 --
NM_020456chr1331582 933 424 ------
NM_020465chr1671666 656 599 545 535 313 52 ------
NM_020467chr12131 180 ----
NM_020474chr1832060 684 183 31444 1339 408 ----
NM_020482chr61220 ------
NM_020530chr222924 353 1699 1777 --
NM_020638chr12101600 1520 1295 807 578 311 289 136 128 70 1569 --1387
NM_020640chr321875 538 11779 ----
NM_020644chr112827 281 ------
NM_020647chr832263 1605 58 --11840 --
NM_020648chr1812856 1274 ----
NM_020651chr211561 ------
NM_020654chr321564 374 ------
NM_020655chr1641403 1156 958 454 11086 ----
NM_020661chr1271641 1591 1571 786 83 70 41 ------
NM_020666chr51749 ------
NM_020673chr2071957 1684 1297 1184 1094 532 399 --56425 5667 3110 1446 73 --
NM_020686chr1653102 1255 1142 750 195 11176 1356 12536
NM_020689chr2081750 1509 1455 1212 1161 210 185 104 ------
NM_020698chr1263007 2754 1971 890 330 249 11109 2344 178 --
NM_020699chr153839 3338 1873 1565 1222 25143 32 ----
NM_020703chr11389 1607 ----
NM_020711chr242510 1872 535 397 ------
NM_020713chr2062263 1959 659 394 368 362 1154 12106 --
NM_020714chr1994443 4342 4292 4048 3480 3359 3178 3029 41 --11254 --
NM_020718chr1674989 4427 1358 947 894 425 276 32613 2183 1422 35488 2440 1136 --
NM_020734chr1232965 830 321 ------
NM_020740chr17--1289 --1115
NM_020742chrX42646 2236 2057 1799 --12397 --
NM_020749chr851861 1771 1490 1314 684 129 1669 --
NM_020752chr1062932 2506 2154 1000 701 210 --12539 --
NM_020755chr61259 11232 ----
NM_020760chr221928 25 1438 ----
NM_020766chrX94583 4556 4184 3209 2930 2890 1772 815 161 23116 1083 14341 --
NM_020772chr17148271 8200 7242 7070 7061 6790 6578 5988 5775 2577 1968 959 845 414 22661 2056 1352 --
NM_020773chr482282 2227 2096 1969 1927 982 933 684 21805 531 12071 --
NM_020774chr1864550 2332 1558 1522 1001 266 22305 408 ----
NM_020776chr1882668 1992 1903 1199 1181 646 497 92 --12878 --
NM_020778chr15124985 4846 4629 4615 4549 4295 3385 3043 1688 1019 779 698 63157 1777 1361 562 282 134 41621 1416 1095 607 13320
NM_020786chr1631619 1452 807 --1192 --
NM_020792chr362241 2041 1952 1892 744 232 11945 ----
NM_020794chr121266 1049 ------
NM_020795chr1781739 1701 1357 675 190 184 146 38 1752 ----
NM_020796chr532132 1023 142 12477 21854 981 --
NM_020801chr512637 32433 2381 1695 12573 --
NM_020804chr662125 2063 1996 1810 544 383 12532 ----
NM_020806chr14--1852 ----
NM_020810chr1463482 1233 739 713 339 180 33407 3127 3044 ----
NM_020825chr16143692 3232 2860 2787 2773 2485 1333 1154 1128 1004 959 799 792 403 22604 888 13512 --
NM_020830chr233316 2231 58 22427 217 ----
NM_020836chr143727 243 126 ----1759
NM_020841chr122786 291 11258 ----
NM_020845chr1282423 2333 2113 2005 972 832 743 154 --12465 --
NM_020850chr16133132 2985 2467 2449 2145 1231 1185 1088 1067 581 342 187 165 --1828 --
NM_020854chr1851355 1144 1057 231 57 11512 ----
NM_020858chr1562308 2197 2134 1912 1557 938 1903 ----
NM_020859chr473960 3828 3651 3206 2894 652 360 1173 23378 2914 1117
NM_020861chr61350 163 1108 --
NM_020866chr1321048 113 ------
NM_020868chr241678 1520 1294 235 ----1390
NM_020870chr422038 487 11441 11762 --
NM_020871chrX--12040 --11840
NM_020872chr321768 1649 ----11122
NM_020888chr141798 1498 1449 661 1818 --1556
NM_020899chr1782377 1709 918 630 617 549 79 70 31664 932 45 1558 --
NM_020918chr104956 814 588 47 ------
NM_020922chrX31348 1162 610 ------
NM_020925chr12972 139 ------
NM_020927chr1682274 2198 1454 958 914 867 742 197 1806 ----
NM_020935chr254583 4363 3827 3473 981 23225 483 ----
NM_020940chr102377 347 11903 ----
NM_020946chr941436 578 127 87 21088 163 11337 1219
NM_020948chr133005 2722 719 2436 93 ----
NM_020952chr91635 181 ----
NM_020956chr19104734 4455 3730 3661 1137 530 421 371 289 87 --13787 --
NM_020962chr1542495 1620 882 648 ------
NM_020975chr1022021 472 31858 1832 1817 ----
NM_020977chr441798 1697 739 226 11358 ----
NM_020983chr12102240 2049 1896 1722 1674 1645 1586 532 406 352 11686 22151 686 --
NM_020993chr1282366 2130 2020 1902 1815 893 739 542 12208 1222 --
NM_021003chr144817 720 617 589 --1297 --
NM_021007chr231657 949 917 ------
NM_021020chr8133231 2844 2770 2715 2699 2615 2265 2245 2177 1368 1312 908 109 1167 ----
NM_021033chr1323203 1175 2626 160 ----
NM_021035chr2061286 1273 1242 1139 972 215 ------
NM_021038chr32247 118 12267 ----
NM_021069chr421979 226 ------
NM_021072chr562454 2408 2117 1816 1699 311 --21008 442 --
NM_021079chr1793012 2526 2112 2039 907 768 741 665 101 --42870 2345 994 205 --
NM_021083chrX93666 3597 2942 1368 812 628 590 471 117 1394 --13183
NM_021096chr2252476 2259 1251 697 457 --33081 2560 1058 12767
NM_021097chr232174 845 790 ------
NM_021101chr341922 801 778 658 11729 ----
NM_021106chr93695 285 67 1498 1115 --
NM_021116chr7198722 8578 8417 7550 7235 6995 6350 5843 3379 3344 3238 2400 2071 1852 1570 1527 889 529 242 47486 5538 1474 985 57823 2359 2106 1595 1070 12565
NM_021120chrX62254 1218 969 241 73 48 11947 ----
NM_021133chr111102 11681 2133 52 --
NM_021136chr143683 675 157 ------
NM_021137chr1751996 1812 660 262 236 21979 626 21889 97 --
NM_021140chrX1363 ------
NM_021145chr73936 240 121 1765 ----
NM_021159chr431464 1307 233 ------
NM_021165chr14839 725 695 607 ------
NM_021183chrX42042 1834 252 122 11746 ----
NM_021188chr143517 393 143 ------
NM_021189chr131007 833 237 --1702 --
NM_021190chr11149 ------
NM_021192chr22107 101 --184 --
NM_021194chr1----1102 --
NM_021198chr271466 1074 1049 945 590 345 302 --2360 280 --
NM_021200chr1151118 1073 764 440 357 ------
NM_021201chr1141813 774 601 78 2456 70 1564 --
NM_021202chr2072917 2606 1225 282 269 125 46 1156 --1360
NM_021215chr2052197 2075 790 717 354 1535 --11967
NM_021220chr201125 ------
NM_021222chr141477 1050 1028 976 ------
NM_021227chr41213 1507 ----
NM_021229chr122988 506 11192 ----
NM_021239chr1431209 586 193 ------
NM_021240chr91470 ------
NM_021249chr1431484 1413 1283 11304 ----
NM_021252chr1011289 11622 ----
NM_021255chr1433929 1219 1147 ------
NM_021260chr1471429 1332 1288 1139 533 527 24 --21087 480 --
NM_021267chr1921145 250 --2295 67 --
NM_021629chr353572 1870 1322 1280 612 --1874 --
NM_021633chr131237 1126 279 11342 --1181
NM_021637chrX41360 1232 1112 981 ------
NM_021643chr241298 666 560 343 1645 --11319
NM_021647chr4114576 4032 2908 1765 1373 1283 1064 955 525 266 51 13281 ----
NM_021648chr6102687 2656 2483 2339 1790 1730 1086 910 677 556 ----12196
NM_021705chr621512 572 21136 528 ----
NM_021728chr142983 386 --1793 --
NM_021729chr11----1309 --
NM_021808chr122619 485 ------
NM_021813chr665683 5606 4092 1649 1393 822 11512 --1576
NM_021908chr74859 727 309 302 2831 55 1256 --
NM_021911chr5105485 5295 5010 4640 4624 4329 1848 1089 591 408 --45275 5078 1075 193 --
NM_021912chr1563192 3173 2649 1676 1361 561 43873 3384 3108 1314 12798 --
NM_021913chr1951234 520 360 162 151 ------
NM_021914chr144939 876 603 226 --11865 --
NM_021940chr631575 1393 47 ------
NM_021942chr41870 ------
NM_021945chr6123395 2810 2644 1359 1270 1260 1090 1077 825 543 370 309 23453 2308 --13402
NM_021946chrX111378 1331 1303 1084 1011 959 590 313 297 194 61 1392 1926 --
NM_021949chrX42589 2486 1147 291 12346 12354 --
NM_021954chr1373665 2767 2573 2528 2484 1243 352 --1304 --
NM_021956chr63311 232 70 --21237 971 --
NM_021959chr62928 25 --1763 --
NM_021960chr141780 1772 1121 310 12790 ----
NM_021961chr11176991 6930 6100 6049 5901 5872 5371 2686 2621 2575 2490 2111 1816 1754 1363 1094 309 26629 1421 47380 5670 5390 2909 26528 1996
NM_021964chr355217 4943 4128 2315 1841 ------
NM_021965chr911194 ------
NM_021973chr41110 ------
NM_021977chr6133153 2864 2772 2497 2479 1562 1436 1426 599 548 280 258 52 23462 3293 22891 2838 23504 290
NM_021988chr2031139 1076 409 --2999 372 --
NM_021998chrX--11348 ----
NM_022037chr22719 244 1360 ----
NM_022048chr15116400 6345 6004 5963 4951 4843 2515 1688 1028 580 232 --22249 650 15464
NM_022049chr121180 177 11874 150 --
NM_022051chr11605 ------
NM_022060chr1481161 1113 864 521 326 262 80 54 --11026 --
NM_022062chr113731 208 163 21571 295 1614 --
NM_022073chr1451532 1064 233 134 107 1349 --149
NM_022075chr16973 666 291 135 120 61 1362 1625 --
NM_022079chr10--1841 ----
NM_022080chr2042766 947 381 323 ------
NM_022107chr62147 28 1484 ----
NM_022114chr184129 3867 3845 3228 3081 1202 662 174 11389 53810 3195 1628 987 90 --
NM_022116chr731105 935 29 ------
NM_022118chr132611 574 ------
NM_022124chr102644 478 ------
NM_022131chr371515 1032 571 307 159 127 35 --1510 --
NM_022166chr16165722 5531 5044 4745 4524 4121 2411 2367 2081 1747 1722 1298 1270 700 268 116 36084 1938 898 22484 216 --
NM_022169chr1181442 1430 1364 1280 1269 1116 519 300 --199 --
NM_022170chr751500 593 297 271 255 ------
NM_022173chr22719 244 1360 ----
NM_022337chr11--1637 1540 --
NM_022343chr91332 --3980 133 90 11186
NM_022351chr833521 2882 1200 ------
NM_022356chr11178 135 156 --
NM_022436chr21189 1397 1481 --
NM_022442chr2031139 1076 409 --2999 372 --
NM_022454chr8155 1302 ----
NM_022458chr772864 2651 2429 2095 1965 421 63 12110 12294 --
NM_022459chr1356316 4402 4037 1973 733 12197 15901 11469
NM_022463chr1741597 1475 472 124 ------
NM_022465chr12122867 2714 2390 2215 2144 2025 1949 850 809 774 531 62 32117 1955 782 --1910
NM_022473chr15103971 3950 3411 2790 1648 1389 1102 692 665 235 ------
NM_022474chr1452777 2397 2296 1765 322 1734 11103 --
NM_022476chr162170 35 ------
NM_022497chr341074 843 472 200 --198 --
NM_022552chr221219 1042 ------
NM_022572chr251734 1276 623 552 537 ------
NM_022574chr7102097 2061 2033 2013 1833 1631 864 758 700 290 ----11656
NM_022652chr12121 ------
NM_022658chr1271206 378 370 349 298 256 244 --21327 277 --
NM_022716chr122941 194 12308 --11243
NM_022719chr2273882 3747 3620 3245 3137 2484 485 --33292 3022 2362 13316
NM_022726chr641749 1198 1120 573 ------
NM_022733chr14397 309 178 98 --11170 --
NM_022735chr131606 1555 706 1158 21796 1714 --
NM_022737chr1941254 930 474 358 --1899 --
NM_022739chr172749 370 ----1954
NM_022745chr132954 2833 2802 22935 1161 ----
NM_022755chr972642 2062 1677 944 889 513 174 1829 1578 --
NM_022756chr12521 353 155 11228 11369
NM_022758chr6113098 2529 2388 2368 2064 1230 1050 1027 792 719 74 22171 703 22582 2132 1565
NM_022763chr393062 2962 2840 2741 2722 2308 1250 1199 1102 ------
NM_022776chr3141 196 11615 --
NM_022780chr21413 ------
NM_022781chr963294 2833 2332 1312 261 37 ------
NM_022818chr1611537 --11378 1581
NM_022824chr51785 21435 508 11317 --
NM_022831chr151531 1440 565 301 196 ------
NM_022832chr442360 1895 928 430 1559 1399 --
NM_022836chr131398 637 561 --1567 --
NM_022841chr1522285 515 21117 440 ----
NM_022845chr1611837 --11959 --
NM_022893chr283179 2899 2648 2580 2572 618 401 88 ------
NM_022894chr211318 1211 ----
NM_022898chr14114716 4706 4432 4021 3861 3617 3608 3568 3427 3003 1631 23448 2973 14106 13256
NM_022910chr1671666 656 599 545 535 313 52 ------
NM_022912chr242960 841 680 107 11007 ----
NM_022918chr1132187 1739 1427 ------
NM_022970chr1041313 1038 497 309 1994 ----
NM_022977chrX21941 1755 32438 2284 1657 12275 --
NM_023000chr14----11103 --
NM_023001chr14----11103 --
NM_023009chr15755 545 280 215 94 --2262 53 --
NM_023010chrX1784 --1689 --
NM_023012chr12----161 --
NM_023015chr1--1711 ----
NM_023016chr272842 1786 1082 329 311 231 216 12453 ----
NM_023039chr5148 1136 ----
NM_023067chr351360 1113 288 263 140 1220 ----
NM_023068chr2061225 1219 1192 1175 1037 251 ------
NM_023071chr12--21043 198 ----
NM_023074chr1941101 885 243 78 1901 ----
NM_023076chr162181 123 1698 --1279
NM_023079chr1741742 1588 504 187 --11423 --
NM_023105chr892267 2134 1820 1799 1729 875 273 136 100 1342 42411 2358 1690 88 --
NM_023106chr892267 2134 1820 1799 1729 875 273 136 100 1342 42411 2358 1690 88 --
NM_023110chr892267 2134 1820 1799 1729 875 273 136 100 1342 42411 2358 1690 88 --
NM_023111chr892267 2134 1820 1799 1729 875 273 136 100 1342 42411 2358 1690 88 --
NM_023923chr173737 3579 2353 1278 1136 483 434 63720 3476 3233 2893 2577 690 ----
NM_023925chr122127 110 ------
NM_023929chr842804 1049 565 306 ------
NM_023943chr3142 ------
NM_024007chr513184 ------
NM_024017chr1771447 1436 1210 242 179 131 118 ------
NM_024019chr42690 50 --1409 --
NM_024034chr202984 880 1685 3945 901 41 --
NM_024046chr351239 866 830 277 235 11128 ----
NM_024050chr19197 1167 ----
NM_024052chr1751926 814 695 650 272 32437 2060 1125 2543 100 12392
NM_024061chr71479 1467 --1493
NM_024082chrX1107 --1475 --
NM_024095chr1231097 519 66 11059 296 54 --
NM_024107chr173618 186 61 ------
NM_024117chr951302 1110 1093 999 335 ------
NM_024293chr24640 284 259 44 ------
NM_024294chr6113098 2529 2388 2368 2064 1230 1050 1027 792 719 74 22171 703 22582 2132 1565
NM_024328chr142166 87 2569 156 ----
NM_024345chr994748 4284 4155 2062 1216 757 613 332 295 56064 5939 4296 3832 1002 ----
NM_024416chr91367 21526 606 11267 --
NM_024422chr1831748 725 324 21714 436 --122
NM_024423chr1874024 2851 2700 2675 1386 1148 449 --1973 --
NM_024424chr112827 784 --1183 --
NM_024425chr112827 784 --1183 --
NM_024426chr112827 784 --1183 --
NM_024430chr1851816 1795 1743 1325 735 1623 ----
NM_024494chr12164 64 1217 ----
NM_024511chr463405 2733 2627 815 784 753 ------
NM_024512chr362873 2555 1137 1122 1061 36 1760 ----
NM_024523chr72454 21 1381 ----
NM_024525chr11460 --1492 --
NM_024528chrX1139 ------
NM_024529chr1--1332 1414 --
NM_024545chr22674 111 ------
NM_024563chr511495 --11873 --
NM_024567chr8170 ------
NM_024572chr22298 46 --2432 323 --
NM_024574chr41368 ------
NM_024582chr42422 209 ------
NM_024586chr12487 116 ------
NM_024594chr521626 21 11281 ----
NM_024612chr1711053 ------
NM_024613chr821595 85 ------
NM_024617chr92789 44 --1586 --
NM_024626chr121583 1170 ----1373
NM_024631chr112675 410 ------
NM_024639chr632602 2490 2393 22102 1971 ----
NM_024645chr831200 1024 47 2614 240 ----
NM_024646chr173088 2844 1500 466 337 204 160 178 1720 --
NM_024657chrX3671 142 72 ------
NM_024665chr323066 1313 24299 4270 --164
NM_024666chr1541517 534 401 329 ----147
NM_024670chr1021627 443 ------
NM_024674chr133223 2541 773 23069 3049 ----
NM_024692chr211677 11493 ----
NM_024698chr1151149 1127 546 506 459 --1303 --
NM_024700chr121142 103 1733 ----
NM_024701chr1041624 558 124 75 ------
NM_024705chr135807 388 323 250 224 ------
NM_024713chr1531622 1326 1315 147 ----
NM_024721chr812332 1578 ----
NM_024726chr2164 --1535 --
NM_024740chr11104167 4119 3696 2586 2553 2538 1558 529 185 67 34113 3791 3298 1197 --
NM_024742chr164729 524 399 219 11750 21683 479 --
NM_024749chr141650 567 231 47 12157 ----
NM_024753chr22740 66 ------
NM_024759chr82631 196 ------
NM_024761chr9175177 4989 4749 4573 4380 3992 3876 3846 3546 3233 1581 929 813 785 597 496 410 24551 1293 31972 1560 667 --
NM_024762chr192140 106 ------
NM_024766chr22437 307 ------
NM_024770chr265117 4870 2023 755 560 114 25310 259 16632 --
NM_024771chr1172076 1978 1561 1513 951 329 58 11900 42052 1845 1838 1542 11852
NM_024785chr271322 1251 1163 554 539 506 191 1202 1126 --
NM_024786chr52204 164 ------
NM_024798chr1582545 2404 2119 2015 1842 1170 999 364 ------
NM_024811chr11--11858 1591 --
NM_024817chr15175932 5069 4951 4853 4828 4718 3731 2307 2227 2212 1244 1078 1051 913 528 238 204 15332 45654 2016 1189 368 --
NM_024828chr9------11283
NM_024830chr531961 261 160 11931 1323 --
NM_024834chr1041882 1819 770 414 2755 122 ----
NM_024850chr53634 369 319 ------
NM_024875chr105324 250 242 174 47 21543 304 1228 --
NM_024884chr1474137 3892 3058 1683 1604 1372 1251 53964 1800 1230 1148 914 --1818
NM_024887chr142082 1600 864 290 192 11614 --
NM_024896chr951960 1869 1668 957 578 1667 ----
NM_024899chr181209 --1510 --
NM_024909chr671532 1439 1400 1325 1193 564 446 31524 1242 603 ----
NM_024911chr13330 188 31 --1545 --
NM_024920chr411190 11430 --1125
NM_024921chrX21452 677 1382 160 --
NM_024923chr331299 139 69 --2904 528 --
NM_024930chr542801 2489 2260 789 22614 47 ----
NM_024939chr1641369 1146 457 53 ------
NM_024944chr2121274 906 1881 11291 --
NM_024946chr1661591 1449 699 503 187 78 --11605 1521
NM_024947chr3109182 8965 7946 7910 7904 3377 3260 2840 2472 1321 13099 12913 --
NM_024949chr443820 1713 1466 585 14160 24298 386 13331
NM_024953chr1211967 11820 --1417
NM_024958chr203824 458 327 --11141 --
NM_024969chr22692 66 --1186 --
NM_024971chr91635 181 ----
NM_024989chr296861 6305 6225 6178 5936 3188 1981 1397 771 11603 18133 17453
NM_024991chr1062668 2206 1291 1028 786 495 12008 --12119
NM_024997chr1641337 1076 408 188 21131 911 ----
NM_025054chr862993 2932 2919 1377 1194 717 11064 11288 --
NM_025073chr154667 3480 1729 1710 517 2480 302 ----
NM_025076chr22571 242 ------
NM_025079chr12718 249 ------
NM_025080chr1111069 2860 695 ----
NM_025133chr23943 853 433 ------
NM_025134chr1621736 1710 1374 ----
NM_025137chr151125 ------
NM_025146chr36886 831 696 534 495 110 1145 ----
NM_025151chr831826 1450 1431 --21953 795 --
NM_025160chr123579 306 24121 898 13346 --
NM_025179chr194706 4203 3386 3056 1986 1847 1436 1000 22 24221 569 23519 1133 --
NM_025187chr164889 551 527 261 --11166 --
NM_025191chr141044 848 664 289 --1313 --
NM_025195chr861853 616 609 484 243 147 2651 471 ----
NM_025201chr1551857 1558 1490 351 162 22039 381 1770 --
NM_025222chr373006 2567 1904 1224 930 733 467 --12201 --
NM_025235chr1031581 815 195 ------
NM_025236chr62724 204 1257 1182 --
NM_025248chr17103198 3176 3155 2934 2720 2181 2092 712 556 468 32747 877 269 12307 11169
NM_025251chr83390 341 322 1796 ----
NM_025263chr681251 1234 699 567 543 420 64 38 1363 ----
NM_030579chr1643675 2301 1461 1362 22668 615 12644 --
NM_030594chr1531289 403 274 ------
NM_030621chr1433369 1675 388 1701 12626 --
NM_030625chr1032537 940 721 12509 ----
NM_030627chr574029 3987 2553 1446 498 273 96 --13186 --
NM_030629chr161762 11880 ----
NM_030630chr173683 554 221 ----154
NM_030634chr151802 1697 879 855 334 2530 494 22350 2119 --
NM_030645chr131418 1185 123 ------
NM_030647chr745939 4088 2282 252 14459 --16319
NM_030648chr485346 4796 4715 4331 1777 1446 1366 645 22139 922 ----
NM_030650chr253914 3244 3050 2882 2843 22976 2786 ----
NM_030660chr14--2555 462 --11318
NM_030661chr751584 1554 471 243 94 11611 ----
NM_030664chr1021523 873 22476 150 ----
NM_030665chr1711197 1129 11100 --
NM_030667chr1241314 1042 870 184 11236 ----
NM_030668chr1241314 1042 870 184 11236 ----
NM_030669chr1241314 1042 870 184 11236 ----
NM_030670chr1242346 2074 1902 1769 12268 ----
NM_030671chr1242346 2074 1902 1769 12268 ----
NM_030674chr12145282 5032 4641 4486 2136 1948 1835 1567 1385 661 592 308 180 28 11717 13980 --
NM_030751chr1031865 103 62 --11817 --
NM_030751chr1031865 103 62 --11817 --
NM_030755chr1432775 508 385 21163 919 ----
NM_030761chr172314 2298 1943 952 807 604 502 ------
NM_030767chr972732 2659 2036 1929 1151 281 105 1371 32798 939 153 --
NM_030777chr2042390 444 352 257 11747 1833 1210
NM_030786chr1--21931 1735 ----
NM_030796chr772070 2022 858 718 266 112 47 --1556 11596
NM_030797chr21267 ------
NM_030799chr51283 --1257 11407
NM_030806chr1179177 9094 8705 7386 7163 7101 6478 6313 5922 5711 5701 3470 3156 2640 1458 776 538 28850 6750 ----
NM_030809chr1221605 631 22447 605 21948 503 --
NM_030820chr611003 ------
NM_030881chr2222438 2345 --11944 --
NM_030884chr392057 1750 1623 1608 1516 774 542 370 184 --1214 --
NM_030885chr31110 21473 512 11752 --
NM_030912chr103878 844 290 1359 1817 --
NM_030918chr1135383 5010 4612 4443 4261 4025 2121 1807 1798 1696 1126 1093 603 --34361 4194 986 1203
NM_030920chr142059 1776 1765 400 ------
NM_030926chr25196 157 126 61 35 --11059 --
NM_030927chr1041564 1325 144 57 ------
NM_030934chr12385 352 ------
NM_030937chr141391 1353 950 40 ----11011
NM_030949chr63508 308 91 ------
NM_030952chr151331 1315 885 442 399 ------
NM_030953chr5----1189 1197
NM_030962chr1141183 497 323 209 2359 79 ----
NM_030963chr6----1160 --
NM_030964chr583073 2772 2545 2318 1499 748 634 572 13033 1905 1535
NM_030981chr1181049 1037 995 937 899 361 315 186 11023 31097 855 54 --
NM_031203chr19------1257
NM_031216chr1822262 1565 --11594 1281
NM_031262chr921023 147 --21092 357 --
NM_031263chr921080 204 --21149 414 --
NM_031266chr51395 ------
NM_031268chr16154896 4449 4056 3675 3666 3622 3421 1907 1527 1521 1420 1353 591 549 232 --31704 1435 754 --
NM_031309chr811728 11877 11774 1303
NM_031314chr1441982 1927 647 128 11385 ----
NM_031369chr41154 ----1130
NM_031370chr41154 ----1130
NM_031371chr131629 1305 1114 ------
NM_031371chr131629 1305 1114 ------
NM_031372chr451659 1421 475 396 184 11667 2650 644 --
NM_031412chr1271153 996 943 768 506 363 275 ------
NM_031417chr19102329 1952 1755 1133 960 814 778 741 488 428 22159 386 198 --
NM_031419chr321238 539 --1434 --
NM_031424chr203556 394 382 --2482 58 --
NM_031426chr9122699 2598 2475 2212 2107 1900 1782 1125 702 652 461 235 --22528 2278 --
NM_031427chr14115071 3852 3805 2343 2275 2216 1978 1635 1297 794 479 45138 4713 4129 406 1419 --
NM_031433chr119568 550 532 433 187 177 112 97 29 1448 2473 466 --
NM_031434chr71357 1347 ----
NM_031435chr1263186 3063 2611 2441 1188 335 13041 ----
NM_031438chr541339 772 534 463 1225 --1381
NM_031439chr841700 1624 1343 350 ------
NM_031442chrX72249 2100 1100 705 696 598 376 12123 ----
NM_031443chr72402 342 ------
NM_031445chr2102950 2853 2691 2444 2391 1275 1072 699 566 81 23316 353 22969 2794 --
NM_031459chr121504 50 21358 343 1358 --
NM_031461chr842279 2267 1707 611 --12011 --
NM_031468chr7247795 7592 7451 7337 6740 6555 6372 6253 6188 5564 3178 2820 2148 2072 1867 1852 1615 1607 1554 1012 900 686 426 183 32159 1764 1342 11045 11595
NM_031469chr654032 3028 2934 1277 623 24015 3342 ----
NM_031476chr1692706 2446 2117 1970 497 359 311 282 209 --42809 2543 2016 607 --
NM_031483chr20113597 3527 3256 3023 2863 2411 1399 1191 548 364 55 11226 1949 --
NM_031844chr153892 3458 1624 491 118 12896 ----
NM_031845chr253410 2915 2718 1030 796 ------
NM_031847chr253410 2915 2718 1030 796 ------
NM_031890chr22112861 2592 2469 2407 2272 2078 1112 1045 985 949 438 12393 32621 479 22 --
NM_031892chrX1940 --1115 --
NM_031899chr331515 318 93 --1418 --
NM_031904chr1152081 853 632 583 434 11950 21606 340 --
NM_031922chr62492 364 ------
NM_031935chr14787 209 142 79 1323 ----
NM_031936chr13694 677 138 1276 1111 --
NM_031990chr1931109 353 329 ------
NM_031991chr1931109 353 329 ------
NM_031992chr751500 593 297 271 255 ------
NM_032012chr955129 4356 1212 1023 394 ------
NM_032017chr192096 1957 1833 1437 733 617 479 442 272 22120 802 2709 290 --
NM_032027chr11222 136 ----
NM_032041chr842172 2065 2041 1877 --22287 286 --
NM_032042chr562868 2431 979 925 612 208 22120 477 --1732
NM_032047chr341997 976 756 501 --11913 --
NM_032051chr221122 --2272 98 --
NM_032052chr222297 285 ------
NM_032088chr541720 1376 1273 383 --11167 11588
NM_032092chr541720 1376 1273 383 --11167 11588
NM_032102chr1133057 2128 660 12928 183 --
NM_032132chr11156 ------
NM_032139chr19--1365 --1134
NM_032144chr22595 234 ------
NM_032153chr342582 2061 1888 1109 12373 ----
NM_032156chr122127 110 ------
NM_032160chr1863282 3228 1539 1269 759 432 34121 1293 639 ----
NM_032181chr21326 ------
NM_032189chr13113758 3736 3682 3154 1829 1271 508 464 398 337 45 --34397 1699 1208 --
NM_032195chr212487 149 ------
NM_032199chr1043582 897 865 614 ------
NM_032208chr262718 2641 1407 606 410 387 --1513 --
NM_032213chr251102 844 353 255 114 --181 --
NM_032221chr2042000 1727 1255 128 ------
NM_032229chr131222 ------
NM_032233chr145855 846 684 298 77 1693 ----
NM_032236chr13964 888 350 ------
NM_032239chr421412 424 ------
NM_032242chr3103157 3060 2796 2577 2207 2165 2120 2081 935 171 --32192 2087 941 --
NM_032268chr1642683 2266 2201 467 1162 33245 2716 2072 --
NM_032271chr1651504 1417 616 518 205 --1187 --
NM_032281chr1952814 2567 2513 1229 1194 --22888 137 --
NM_032283chr121593 701 1147 31847 669 281 --
NM_032288chr382162 1888 1672 1607 1495 915 401 265 ------
NM_032289chr531680 214 176 21810 792 1184 --
NM_032298chr193383 311 58 184 ----
NM_032312chr21613 ------
NM_032316chr3102226 2201 1546 799 641 572 510 453 313 84 1276 12217 --
NM_032329chr2103461 3265 3062 2853 1673 1537 736 563 364 45 12813 11627 11237
NM_032352chr1421255 1117 1907 ----
NM_032373chr1065416 5354 4399 4318 1645 548 ------
NM_032375chr193225 158 108 1587 2686 618 --
NM_032403chr541720 1376 1273 383 --11167 11588
NM_032410chr81195 ------
NM_032434chr251175 504 323 314 199 ------
NM_032440chr1062948 2823 2255 1894 909 284 ------
NM_032445chr1532112 688 67 ------
NM_032446chr542376 1395 1210 718 ------
NM_032452chr1451430 1231 512 167 83 2626 302 1208 --
NM_032457chr453495 989 544 527 199 --13921 --
NM_032458chrX32656 1142 1035 --33358 2965 886 --
NM_032488chr19126 ------
NM_032491chr123917 516 349 ------
NM_032492chr31180 --1276 --
NM_032499chr1541639 418 303 65 1618 1244 --
NM_032505chr361947 1739 1095 675 226 164 ------
NM_032509chr82727 329 ----11714
NM_032511chr6245 28 ------
NM_032514chr201414 ----176
NM_032538chr671988 1821 1091 946 835 407 295 11000 ----
NM_032550chr1041059 975 467 163 ----21107 879
NM_032562chr102305 21 ------
NM_032580chr172200 180 --1187 --
NM_032581chr721463 1285 2691 95 11510 --
NM_032582chr172368 52 1440 ----
NM_032588chr12560 140 1434 ----
NM_032590chr122358 260 11058 ----
NM_032595chr1751508 562 555 401 51 --2493 346 --
NM_032632chr1421986 542 1442 ----
NM_032682chr343488 3252 3090 2407 13281 ----
NM_032711chr17163758 3711 3515 3005 2947 2898 2888 2761 1634 1603 1491 1142 1131 739 126 71 22845 1686 33981 3312 2781 13851
NM_032717chr43892 688 125 ------
NM_032727chr1021607 1433 174 11478 --
NM_032741chr64924 904 331 96 1883 ----
NM_032778chr353203 2967 2667 2417 131 --11293 --
NM_032804chr1051783 701 544 207 66 ------
NM_032808chr153884 308 81 ------
NM_032813chr1321023 989 --1943 --
NM_032824chr23713 310 162 1640 ----
NM_032827chr211094 ------
NM_032829chr123938 870 811 11101 ----
NM_032830chr16123 129 ----
NM_032832chr61581 1419 --1250
NM_032833chr142225 2079 260 84 ------
NM_032836chr1941028 930 809 209 1410 2948 264 --
NM_032837chr1721804 603 ------
NM_032840chr126891 812 768 451 156 32 1425 2214 200 167
NM_032842chr711328 170 1411 --
NM_032846chr1441283 1209 440 28 21467 1039 ----
NM_032859chr13162 23164 468 ----
NM_032866chr1593181 3153 3047 2844 2368 2301 606 161 37 --33098 2161 309 --
NM_032870chr6173 ------
NM_032873chr11104467 3453 3393 3285 2895 2868 2799 1232 665 202 ------
NM_032875chr173697 257 68 ------
NM_032876chr141853 12096 1649 1618
NM_032900chr10103463 3357 3244 2931 2651 2514 858 425 217 66 13786 ----
NM_032905chr1021058 216 ------
NM_032932chr17146029 5766 5679 5484 5194 5077 4963 4789 4229 2002 1767 1709 946 108 14194 35896 5865 5403 --
NM_032947chr56955 929 909 400 371 251 1358 ----
NM_032960chr131075 420 332 --2397 298 --
NM_032968chrX24025 571 12741 ----
NM_032969chrX24025 571 12741 ----
NM_032973chrY24017 571 ------
NM_032975chr1863308 2673 1455 998 977 333 --2678 644 1604
NM_032980chr1863308 2673 1455 998 977 333 --2678 644 1604
NM_033014chr91367 21526 606 11267 --
NM_033016chr2231344 1133 565 1426 174 --
NM_033018chrX3440 93 82 --21073 242 11182
NM_033020chr174479 4324 4053 4031 3308 1860 1062 33666 281 124 14669 --
NM_033023chr72222 23 157 1938 --
NM_033027chr341076 755 339 148 ----11042
NM_033030chr22331 54 11572 ----
NM_033044chr11932 11208 ----
NM_033081chr2021391 971 ------
NM_033089chr2041452 1114 1078 307 ------
NM_033129chr2031381 690 102 21323 393 --1611
NM_033132chr1331786 1624 502 12101 147 --
NM_033133chr17113648 3502 3176 2837 2599 2303 1266 844 502 163 70 13117 21099 714 --
NM_033136chr541571 601 462 172 ------
NM_033137chr541571 601 462 172 ------
NM_033138chr732291 2133 2107 ------
NM_033139chr732291 2133 2107 ------
NM_033140chr732291 2133 2107 ------
NM_033143chr434511 3359 1336 --14465 1228
NM_033157chr732291 2133 2107 ------
NM_033161chr951684 1628 1607 1256 473 --21797 714 --
NM_033181chr643049 1219 962 79 1851 ----
NM_033211chr532088 1405 400 --1121 --
NM_033222chr911366 --11220 --
NM_033224chr7138008 7478 7430 6583 6566 6214 6064 5835 5444 5186 330 313 68 57783 7357 6899 3223 506 ----
NM_033225chr872313 2287 2014 1993 1979 537 372 32613 2302 993 ----
NM_033274chr5123601 3178 3110 2913 1379 1300 780 767 614 176 148 39 131 ----
NM_033285chr894499 3408 3178 3050 1322 1091 891 441 86 13281 13033 --
NM_033290chrX63774 3693 3467 2753 1204 871 ------
NM_033300chr11992 ------
NM_033315chr1742071 1457 873 209 1753 42093 1735 1721 729 11411
NM_033326chr1131694 1644 859 21868 158 ----
NM_033331chr993077 2798 2584 2273 2227 1202 920 745 733 13470 22246 316 --
NM_033360chr1253509 3086 974 832 227 2632 587 12872 --
NM_033375chr1751418 1343 611 514 448 31203 383 300 ----
NM_033387chr972514 2482 2196 785 629 458 249 22236 298 32600 1789 973 --
NM_033389chr17114763 4699 4690 4155 3314 3283 3244 3221 1467 1140 809 ----1523
NM_033393chr462713 2585 1075 1066 687 503 11170 12939 --
NM_033394chr231047 584 298 --21466 1402 --
NM_033401chr161515 --1371 --
NM_033402chr81101 ------
NM_033420chr193956 335 242 ----1862
NM_033421chr2021761 426 31547 714 542 11559 --
NM_033425chr1183399 2773 2286 720 677 363 224 45 1806 ----
NM_033430chr444089 2900 1574 942 ----13362
NM_033437chr444089 2900 1574 942 ----13362
NM_033449chr581905 1833 1441 863 729 296 268 41 ----21917 1357
NM_033480chr633035 2459 235 --12130 --
NM_033481chr633035 2459 235 --12130 --
NM_033503chr15113649 3613 3588 2627 1430 1258 1048 1011 600 338 180 1140 ----
NM_033505chr265618 5572 4489 4136 927 250 26201 1599 --1741
NM_033512chr8103100 2578 2035 1882 1179 787 673 496 255 67 --22425 1896 --
NM_033515chr621254 503 ------
NM_033540chr32321 187 11096 --1459
NM_033551chr593435 2947 2784 2156 2110 1120 1036 998 551 32349 754 739 13141 --
NM_033626chrX51767 1370 565 450 416 ------
NM_033631chr1133881 3820 3712 3520 2944 2667 1442 1392 1193 982 700 342 243 23399 753 23365 249 --
NM_033632chr421063 49 ------
NM_033637chr10113559 3419 2922 2674 2516 963 692 649 481 406 119 11010 ----
NM_033642chrX2929 74 ------
NM_033644chr552082 1713 923 684 553 ------
NM_033645chr552082 1713 923 684 553 ------
NM_033656chr2134148 3858 1599 --14652 25210 1824
NM_044472chr12692 37 ------
NM_052818chr1351962 1945 1845 560 226 ------
NM_052834chr1862460 2227 1607 646 250 69 --32548 2365 283 --
NM_052845chr1242650 2015 1285 718 22581 2111 1940 2198 87
NM_052847chr1953295 2772 1157 715 54 12556 266 60 --
NM_052849chr154818 794 780 589 --1306 --
NM_052875chr1161712 607 326 252 190 154 41462 859 351 342 21415 374 --
NM_052876chr1992623 2516 2118 2098 1761 1688 500 481 88 ------
NM_052879chr1264059 3905 3782 3310 883 816 22713 473 23985 3372 12923
NM_052885chr1224082 1685 53120 1872 1212 478 257 11253 --
NM_052886chr812164 --1500 --
NM_052896chr142068 1909 976 122 12559 12513 1906
NM_052898chr831876 1662 108 ----1197
NM_052904chr621365 88 ------
NM_052905chr241293 1285 1243 381 1343 ----
NM_052906chr22125061 5011 4981 4282 3575 3419 1882 1432 1071 979 687 438 24536 1754 14754 --
NM_052907chr1273806 3024 1679 879 624 597 504 22793 562 ----
NM_052910chr1321501 427 1187 ----
NM_052918chr1073512 2821 1295 1040 853 745 653 ------
NM_052925chr1941028 970 775 134 ------
NM_052936chrX1655 ------
NM_052937chr822023 1851 ------
NM_052940chr12227 28 ------
NM_052966chr133943 2457 1190 131 11141 --
NM_052968chr112525 35 1595 --181
NM_052978chr1461874 1688 1586 614 548 95 148 ----
NM_053016chr9148001 7649 7044 6702 6332 5830 5530 5321 2827 2806 2375 689 262 232 47068 7037 2360 2056 37790 400 371 17004
NM_053023chr11102621 2587 2168 2068 1307 1299 1263 734 483 303 12840 ----
NM_053024chr331467 445 214 ------
NM_053025chr311350 --2633 396 --
NM_053026chr311350 --2633 396 --
NM_053027chr311350 --2633 396 --
NM_053028chr311350 --2633 396 --
NM_053031chr311350 --2633 396 --
NM_053032chr311350 --2633 396 --
NM_053056chr1182388 2375 1243 703 555 344 125 77 2519 170 ----
NM_053279chr872602 2491 2259 1924 1871 894 315 12046 52484 593 308 195 112 --
NM_054013chr53933 820 569 --1307 --
NM_054016chr131801 598 121 11438 1225 --
NM_054016chr131801 598 121 11438 1225 --
NM_054016chr131801 598 121 11438 1225 --
NM_054025chr1142085 425 417 75 11646 1431 --
NM_054027chr532120 1724 1656 2866 838 11770 --
NM_057089chr74476 180 102 68 ------
NM_057157chr102397 217 ------
NM_057159chr911362 --1148 --
NM_057161chr62185 137 1497 ----
NM_057169chr12143092 3050 2988 2963 2484 2451 2428 2231 2115 1110 541 449 419 326 2952 908 11251 --
NM_057170chr12143092 3050 2988 2963 2484 2451 2428 2231 2115 1110 541 449 419 326 2952 908 11251 --
NM_057178chr1782512 2185 2091 1003 768 552 481 442 1313 11027 --
NM_057749chr81919 ------
NM_058164chr196333 311 297 143 93 76 --2287 99 --
NM_058170chr1--1515 1220 --
NM_058175chr218788 774 748 691 601 252 75 64 --181 --
NM_058240chr1431224 399 380 2681 283 11290 --
NM_078487chr93991 904 165 1625 ----
NM_080552chr204268 206 125 119 ------
NM_080591chr993016 2275 1998 1923 1252 935 886 498 199 1556 32786 2242 416 --
NM_080599chr102986 889 ----1418
NM_080625chr2041204 89 36 28 ------
NM_080629chr121499 547 ----1443
NM_080630chr121499 547 ----1443
NM_080632chrX1784 --1689 --
NM_080645chr641959 1840 676 651 ------
NM_080654chr1151116 1012 332 274 75 ------
NM_080655chr91244 ------
NM_080667chr2164 ------
NM_080670chr57943 886 705 577 321 306 154 ------
NM_080671chr232145 1410 429 1777 ----
NM_080672chr201535 175 ----
NM_080676chr2062895 2160 1019 784 672 251 --12038 --
NM_080682chr12604 146 4232 107 73 53 ----
NM_080683chr41482 ------
NM_080684chr41482 ------
NM_080685chr41482 ------
NM_080717chr1231506 1490 472 1549 1389 --
NM_080723chr63896 413 231 1469 --1520
NM_080738chr141576 1363 606 177 1317 ----
NM_080743chr662347 2048 1986 1041 470 435 22336 1995 ----
NM_080759chr1342258 1738 1646 90 1107 ----
NM_080760chr1342258 1738 1646 90 1107 ----
NM_080764chr2243217 3103 2638 1156 12000 ----
NM_080840chr203490 427 179 1536 ----
NM_080841chr203490 427 179 1536 ----
NM_080867chr1464456 3995 3487 791 392 118 23242 731 --13494
NM_080872chr833646 566 220 44041 3459 1218 660 23719 3354 11164
NM_080881chr55712 541 505 305 276 ------
NM_080921chr11487 ------
NM_080927chr373006 2979 2498 2052 1015 771 652 12169 ----
NM_080928chr74730 604 560 281 --1619 --
NM_130391chr963254 3208 3180 2660 90 58 12532 --1496
NM_130392chr963254 3208 3180 2660 90 58 12532 --1496
NM_130393chr963254 3208 3180 2660 90 58 12532 --1496
NM_130434chr1521148 24 1219 ----
NM_130436chr2121099 915 1