TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-2117
miRNA Sequence: UGUUCUCUUUGCCAAGGACAG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000084chrX125739 5497 4595 4450 2774 2696 2413 1010 650 462 339 186 25511 4978 34967 2478 977 25081 2403
NM_000092chr261515 1100 1000 605 538 35 11172 13862 24276 722
NM_000192chr1251461 74 62 43 37 --191 11419
NM_000208chr19124444 4094 3703 3692 3648 3192 2949 1684 1667 1502 458 189 64801 4058 3533 1546 1483 1001 ----
NM_000217chr12115278 4218 4151 3904 3572 3415 1829 1344 1316 1281 241 22147 1071 11319 1842
NM_000325chr44154 129 116 110 --1157 --
NM_000332chr6186875 6794 6783 6724 5416 5251 4924 4454 2505 2047 1789 1766 1466 1453 1443 1411 782 340 25440 948 54798 4717 2414 2342 845 35973 4834 1473
NM_000368chr9124338 4232 4161 4138 4002 3748 3044 2938 1860 1509 1200 815 1465 21512 1292 13264
NM_000452chr1341814 1695 615 305 11496 --21707 297
NM_000461chr394385 3758 2920 1086 997 706 461 121 114 12925 --1809
NM_000555chrX137716 7383 6762 6396 5992 5473 2881 2252 1799 1132 892 569 469 --17697 1638
NM_000599chr2194011 3749 3726 3704 3689 3680 3268 2881 1778 1716 1709 719 520 322 294 288 264 143 108 11539 ----
NM_000618chr12106475 6253 5723 5008 4130 4113 1673 1652 1124 1072 14003 --15727
NM_000618chr12106475 6253 5723 5008 4130 4113 1673 1652 1124 1072 14003 --15727
NM_000719chr12206614 6585 6389 5843 5791 5724 5698 5691 5572 5525 5456 5076 4380 2431 1490 1158 1141 464 436 207 36141 2465 296 14995 24898 1791
NM_000793chr14144998 4743 4124 4106 3670 1824 1347 895 764 713 673 602 364 251 24954 2048 --1854
NM_000831chr1165173 4664 2414 2316 2156 1854 1665 1600 1368 1267 1123 853 783 645 625 45 --45192 4719 791 651 11513
NM_000912chr883098 2917 2906 2580 2524 1093 453 42 22776 1183 --22434 268
NM_000926chr11179317 8918 8557 8537 8030 7617 7286 7218 6611 6566 6533 6405 6111 2345 1745 936 342 36815 6778 5755 46614 6385 3502 717 23579 2201
NM_000959chr143901 1581 1264 752 11019 33444 2664 1440 2915 335
NM_001001419chr594946 4153 3990 3568 3332 1830 1705 1113 56 13490 13530 13624
NM_001001420chr594946 4153 3990 3568 3332 1830 1705 1113 56 13490 13530 13624
NM_001001481chr873435 3071 2999 2873 2286 2276 667 --12901 12510
NM_001001484chr1061972 1807 888 820 474 128 11574 --149
NM_001001557chr891890 1796 637 577 442 201 154 141 79 11410 11713 21469 125
NM_001001938chr9153842 3390 3281 3014 2850 2843 2811 2765 2546 2504 1358 1045 700 387 249 --21048 469 1416
NM_001003407chr10104993 4685 4251 1922 1397 1388 692 128 89 28 13157 14219 1552
NM_001003408chr10104993 4685 4251 1922 1397 1388 692 128 89 28 13157 14219 1552
NM_001003652chr1897851 7222 2960 2468 1414 860 223 217 106 36824 6757 1910 --37039 2489 2041
NM_001003674chr18126510 6493 5685 5543 5223 4298 2073 1700 850 527 47 30 --32684 616 269 11477
NM_001003675chr18126510 6493 5685 5543 5223 4298 2073 1700 850 527 47 30 --32684 616 269 11477
NM_001004065chr9103189 3020 2678 2576 1419 1110 1104 1088 687 211 2765 585 12663 1379
NM_001004317chr673835 3152 1774 1342 1100 792 119 169 31234 983 246 1201
NM_001004328chr12102386 1910 929 844 737 681 650 322 110 24 --2464 385 11547
NM_001005404chr17144465 4104 3414 3269 1404 1398 1363 1270 990 929 512 382 326 74 43205 1373 866 354 ----
NM_001005473chr5186476 6333 6070 5817 4955 1704 1443 1205 1074 1054 1034 977 965 706 682 665 108 37 --11916 --
NM_001005609chrX193704 3416 3249 3193 3163 3006 2906 2856 2710 2551 2515 2501 1452 1343 680 520 482 351 115 12869 32838 2785 2518 --
NM_001005743chr143534 287 192 21201 456 11249 21051 966
NM_001005744chr143534 287 192 21201 456 11249 21051 966
NM_001005745chr143534 287 192 21201 456 11249 21051 966
NM_001007023chr14144998 4743 4124 4106 3670 1824 1347 895 764 713 673 602 364 251 24954 2048 --1854
NM_001007094chr10194310 4298 3522 3066 2829 2799 2770 1747 1579 1489 1117 960 900 630 522 379 144 122 42 23036 70 42950 1725 274 110 --
NM_001007278chr1385265 5068 4696 4213 1890 1666 826 727 23835 1749 13934 150
NM_001008220chr5103687 3364 3176 3137 2683 2391 1577 1118 934 327 53620 2792 2750 835 224 43029 2814 2446 1495 13376
NM_001008801chr19111320 834 766 682 596 582 431 329 245 160 76 11410 ----
NM_001009993chr2114028 3957 3302 1413 1361 990 908 825 620 613 22 13492 24241 3960 23814 1110
NM_001010888chrX94040 3665 3537 3158 2872 1306 1144 359 178 33791 1550 317 --1775
NM_001011513chr463889 3865 1444 716 40 25 --1479 21454 1127
NM_001011666chr7166373 6101 6058 6037 5944 5786 4924 4576 4381 2488 2212 1994 1946 1220 1210 938 16072 --16105
NM_001012393chr11144803 4625 4358 4288 4038 3781 3696 3403 3179 1922 1913 1682 1418 747 173 13750 --
NM_001013659chr19135354 5204 5057 4574 4426 4174 3946 3712 1828 1502 364 348 32 14318 ----
NM_001013746chr782275 1646 1589 716 463 383 297 48 11511 21800 217 --
NM_001014797chr10257425 7162 6935 6901 6775 6664 6645 6631 6550 6271 6144 6113 6068 6007 5925 5496 5295 3298 2072 1547 912 811 564 527 112 26299 3137 --15796
NM_001017440chr7197678 7300 7154 6951 6582 6493 6154 5446 5098 3186 3004 2810 2593 2566 2404 1108 766 359 295 36450 5633 2361 31292 727 628 27315 353
NM_001018065chr995811 5594 5151 4681 4467 4406 2015 1976 77 --11548 24410 454
NM_001018066chr995811 5594 5151 4681 4467 4406 2015 1976 77 --11548 24410 454
NM_001024455chrX92507 2263 1820 1778 1083 1046 903 894 876 21833 271 2587 173 1450
NM_001024647chr12115884 5662 5481 5324 5236 2198 1663 1642 927 902 839 16564 25842 5550 --
NM_001025068chr341319 1240 607 258 1716 11313 31514 1427 707
NM_001025069chr341319 1240 607 258 1716 11313 31514 1427 707
NM_001025077chr10186803 5943 5786 5462 4962 4584 2988 2294 2116 985 523 513 430 351 319 118 88 79 1418 ----
NM_001031695chr22115461 5162 4417 3541 2157 2119 1910 1013 579 101 78 23490 1160 24825 4314 11996
NM_001034841chr16114944 1784 1297 1107 963 742 668 656 530 341 306 13717 11652 --
NM_001037132chr72602 96 22012 131 --21966 814
NM_001037133chr72602 96 22012 131 --21966 814
NM_001037535chrX41291 1204 1070 352 --2414 335 21035 500
NM_001037536chrX41291 1204 1070 352 --2414 335 21035 500
NM_001037540chrX41291 1204 1070 352 --2414 335 21035 500
NM_001039577chr1114362 4089 4004 3618 3495 2962 1433 1422 1416 1383 314 24401 1601 14446 --
NM_001039585chr144158 1521 1009 241 11276 33701 2921 1697 21172 592
NM_001039615chr8101909 1454 928 736 680 649 612 322 110 24 --2464 385 11546
NM_001039618chr1184745 3689 2274 942 863 609 410 103 1916 --15430
NM_001039844chr1042457 2391 1922 395 1380 --22858 402
NM_001040001chr651565 1414 314 86 78 21748 1653 31369 1317 320 1427
NM_001040152chr7124898 4861 4494 4468 4457 4227 4113 3604 3575 3257 1643 1532 21595 1355 34801 4497 4116 14423
NM_001040284chr16105089 5005 4997 4473 2377 859 658 381 331 217 34304 3900 1140 13868 12030
NM_001040429chr1393289 2595 2266 2228 873 342 296 259 244 12667 --12964
NM_001042555chr1234438 1515 150 11706 --21906 1507
NM_001042599chr2187654 7645 6965 5457 4772 3018 2732 2541 2425 1882 1871 1013 946 524 260 244 189 175 56749 6085 2266 2001 1667 --25711 3045
NM_001042601chr393091 3057 2579 2421 2394 2155 2101 1012 926 12569 --22583 2352
NM_001042603chr1294827 4750 3739 1067 822 777 703 612 121 14611 --15255
NM_001100108chr1207747 7529 7459 7333 7223 6664 6561 6396 5601 5316 2824 2456 2051 2043 1789 1582 1366 1054 461 50 --22827 2170 21135 261
NM_001106chr3258942 8903 8469 8401 8220 6815 6624 6587 6445 6240 6068 3813 3747 3724 3493 3358 1820 1578 1073 1032 800 644 615 471 425 26368 3531 17000 --
NM_001201chr432669 739 338 ----2392 294
NM_001204chr2127715 7307 6527 6116 5904 5012 4763 4719 3050 1690 850 655 1701 16680 1854
NM_001259chr7106273 5887 5055 4198 4147 4003 1961 1916 684 265 139 12434 11696
NM_001399chrX193704 3416 3249 3193 3163 3006 2906 2856 2710 2551 2515 2501 1452 1343 680 520 482 351 115 12869 32838 2785 2518 --
NM_001419chr1984021 3315 1851 1497 1413 1258 693 631 11958 34591 1854 1500 13540
NM_001609chr10104495 3795 3748 3643 2891 2861 1521 1239 825 697 11594 23976 3461 --
NM_001759chr12114493 4337 4148 3920 3683 3365 537 342 220 154 25 34323 3804 332 --1309
NM_001918chr1169172 9121 7865 7489 7433 7424 7413 3411 3152 3012 2546 1982 1812 1175 861 485 38209 7597 7553 17380 1812
NM_001939chrX93543 3116 3099 2337 1322 907 382 314 185 53787 3019 2987 853 654 --12844
NM_002025chrX188855 8704 8572 8540 6623 5739 5618 3641 3582 2918 2358 2268 1996 1354 873 499 388 92 38599 5631 1002 1622 --
NM_002158chr263053 2804 2357 908 810 91 --23038 870 1591
NM_002214chr754577 4215 357 339 191 25522 1128 22138 1488 1343
NM_002223chr1293956 3534 3243 3197 3166 2486 503 492 313 1152 --33391 2971 1170
NM_002313chr10104993 4685 4251 1922 1397 1388 692 128 89 28 13157 14219 1552
NM_002387chr564426 4316 3719 3458 1083 102 13925 11330 1679
NM_002501chr19103620 3599 3571 2758 1656 1330 1072 463 108 94 33269 1359 649 1237 1321
NM_002522chr1783975 3621 3452 2867 1392 928 370 295 2757 700 23745 596 23606 1459
NM_002545chr11144803 4625 4358 4288 4038 3781 3696 3403 3179 1922 1913 1682 1418 747 173 13750 --
NM_002547chrX84074 3759 2791 1633 1533 1216 497 470 14031 33762 2665 35 13659
NM_002556chr1161945 1812 768 586 38 23 1779 --145
NM_002577chr373837 1274 1189 1080 706 608 153 --11172 13822
NM_002581chr9135033 4684 4530 4185 3437 1685 1634 1304 1267 986 720 465 403 14547 1612 --
NM_002613chr16134568 4165 3568 2039 1734 1593 1379 1268 929 900 882 838 108 24348 1224 34720 1271 998 --
NM_002760chrY105853 4411 4236 2413 2310 1236 964 815 189 51 24049 292 --14351
NM_002886chr351659 810 525 499 379 15105 34737 3799 1782 34404 4373 1775
NM_003030chr361763 749 481 432 424 286 --1439 --
NM_003034chr12198121 7843 7445 7260 7176 6953 6154 6138 5841 5787 5547 5422 5248 2025 1988 1606 1595 1239 70 1172 --27454 6197
NM_003043chr3134290 3982 3972 3553 3125 2819 2685 1550 1439 929 814 632 548 13343 33696 3111 551 --
NM_003099chr15115513 5187 5121 4835 4498 4192 4041 3993 1986 651 618 35550 4622 1912 24847 1995 1201
NM_003108chr2177291 6937 6523 6080 6035 5232 5044 4631 2708 2683 2305 2298 2243 2233 2183 661 143 --56066 5799 1703 557 493 27161 994
NM_003262chr384755 4282 4203 3866 3584 840 650 627 11291 11121 24207 3880
NM_003320chr11104272 3174 2901 1634 1540 1095 1069 563 351 196 24318 225 23251 944 13035
NM_003410chrX52709 2401 1034 778 209 22993 1917 --11008
NM_003421chr10194310 4298 3522 3066 2829 2799 2770 1747 1579 1489 1117 960 900 630 522 379 144 122 42 23036 70 42950 1725 274 110 --
NM_003441chr471052 987 890 421 341 173 88 --1158 --
NM_003607chr193760 3396 2921 2746 1514 720 708 622 412 --34398 4234 713 --
NM_003671chr952828 2220 695 198 136 12646 13443 21041 662
NM_003744chr143534 287 192 21201 456 11249 21051 966
NM_003759chr484074 3244 3027 2633 2625 1151 705 447 11178 23359 3181 1127
NM_003872chr272962 2954 2863 1090 1084 997 379 11072 --11943
NM_003966chr5137749 7306 6501 6444 6281 6126 5735 5728 5448 4979 4943 3028 2104 47738 6005 5950 4936 ----
NM_004171chr1199049 8580 8530 3728 3630 3403 3145 537 141 58486 6106 2644 1578 673 29074 6165 1780
NM_004200chr11153135 2985 2974 2678 2499 2022 1277 1264 749 667 616 605 374 284 108 12485 12491 12270
NM_004338chr18126510 6493 5685 5543 5223 4298 2073 1700 850 527 47 30 --32684 616 269 11477
NM_004349chr82452 139 --2238 142 2258 251
NM_004397chr11134155 4124 3997 3636 3091 2874 2706 1630 1286 322 307 299 158 --14069 21290 1180
NM_004501chr173212 2767 1314 1123 1020 624 101 --33496 229 203 1367
NM_004504chr273056 2598 2461 2314 2026 2000 109 22351 701 --12780
NM_004586chrX115005 4665 4424 3504 3298 2095 1967 1897 1673 1118 760 13561 22162 745 --
NM_004703chr1782052 1872 590 560 383 144 122 96 22310 494 1386 --
NM_004726chrX105404 5286 5262 5006 4604 4112 1542 1465 1134 758 25599 4636 --14277
NM_004798chr20132887 2828 2452 2227 1412 1334 1070 951 705 509 114 76 51 11363 43332 2685 1119 268 11010
NM_004834chr263125 2977 2384 2300 2133 54 12325 --22395 455
NM_004863chr1494873 4603 4150 3390 2011 1927 1706 1464 25 24739 1476 34997 1402 1315 --
NM_004904chr7166373 6101 6058 6037 5944 5786 4924 4576 4381 2488 2212 1994 1946 1220 1210 938 16072 --16105
NM_004992chrX178109 7575 7297 6562 6450 6234 5612 3225 2849 2696 2596 2579 1578 1092 920 715 512 35225 2925 1031 --36325 1473 387
NM_004992chrX178109 7575 7297 6562 6450 6234 5612 3225 2849 2696 2596 2579 1578 1092 920 715 512 35225 2925 1031 --36325 1473 387
NM_004999chr694209 4019 3787 3556 3329 3010 1474 1401 1324 13281 1326 12746
NM_005010chr72602 96 22012 131 --21966 814
NM_005056chr1295071 4994 3983 1311 1066 1021 947 856 365 14855 --15499
NM_005065chr1464458 3979 3836 3701 834 817 24240 57 44398 1690 1614 1049 --
NM_005156chr965217 4810 4045 1434 691 304 25063 3821 --14356
NM_005188chr11117758 7395 6680 5902 5281 1990 1538 1019 447 333 244 46355 5233 2485 283 47974 6863 1518 32 28172 5605
NM_005197chr14175970 5957 5368 4463 4295 4156 3919 2422 2253 2213 2105 1910 1612 1399 1285 868 705 --22474 1817 24958 2318
NM_005235chr2187654 7645 6965 5457 4772 3018 2732 2541 2425 1882 1871 1013 946 524 260 244 189 175 56749 6085 2266 2001 1667 --25711 3045
NM_005339chr454229 3271 1147 930 510 --14049 23234 2866
NM_005359chr18166564 6530 6399 6373 6243 6094 4881 4589 4139 2615 1642 842 816 663 390 229 14739 11212 --
NM_005497chr17135413 4412 2349 2307 2060 1999 1304 1187 547 337 254 175 169 ------
NM_005504chr12135316 5298 5277 5249 4955 2142 1940 1717 1523 1328 1196 162 34 12346 --12227
NM_005578chr394902 4318 3836 3613 3584 3574 959 520 476 14490 --14155
NM_005587chr151317 ----2942 653
NM_005798chr1385265 5068 4696 4213 1890 1666 826 727 23835 1749 13934 150
NM_005819chr173247 2698 740 499 265 193 57 1517 22517 2449 22438 2257
NM_005840chrX197644 7369 7236 6998 6942 6931 6748 6533 6379 6365 6337 6030 2678 1993 1983 1649 772 448 290 --21732 1703 --
NM_005901chr1897851 7222 2960 2468 1414 860 223 217 106 36824 6757 1910 --37039 2489 2041
NM_005903chr594946 4153 3990 3568 3332 1830 1705 1113 56 13490 13530 13624
NM_005909chr5163946 3888 3021 2664 1639 1387 493 469 459 437 417 379 348 340 320 185 33980 1348 358 1329 1473
NM_005910chr17132905 2640 1312 1181 852 780 758 647 599 572 337 49 36 13178 21500 42 --
NM_005935chr4145291 5034 4986 4431 4372 4335 3453 1606 1164 1070 781 488 347 33 --35143 1836 901 14425
NM_006047chr2042804 1243 1176 246 --12313 22715 216
NM_006095chr453373 1809 590 101 46 23679 287 --31752 1231 758
NM_006197chr862155 2133 1715 765 413 385 32014 1591 1403 12158 --
NM_006203chr5125286 5266 5199 5180 4464 3948 2184 1721 1696 1456 834 291 15463 --13936
NM_006252chr1117548 6123 6000 2879 2479 2372 2206 2014 1522 1137 890 15844 ----
NM_006282chr2094158 3685 3469 2939 1640 1165 808 695 654 --11308 21772 498
NM_006315chr442964 1102 184 139 --1142 32893 1219 116
NM_006371chr3184501 4479 4014 3482 1839 1761 1627 1538 1515 1387 1357 1324 1225 1159 1119 1091 892 123 21474 971 14184 25085 4832
NM_006457chr463889 3865 1444 716 40 25 --1479 21454 1127
NM_006544chr14156131 5726 5609 4623 2387 2217 1815 1609 1583 1370 1215 988 828 780 45 ----14346
NM_006546chr17175402 4724 4476 4322 4253 4070 2558 2357 2242 1949 1773 1209 986 647 558 357 81 35679 5043 1888 26336 1968 --
NM_006646chr1352609 2451 2397 512 491 --1695 22073 976
NM_006650chr5103687 3364 3176 3137 2683 2391 1577 1118 934 327 53620 2792 2750 835 224 43029 2814 2446 1495 13376
NM_006654chr1234438 1515 150 11706 --21906 1507
NM_006720chr10104993 4685 4251 1922 1397 1388 692 128 89 28 13157 14219 1552
NM_006731chr9135201 4780 4707 4047 3832 1910 1571 1535 601 592 210 95 23 1728 23949 287 35462 1495 571
NM_006746chrX41291 1204 1070 352 --2414 335 21035 500
NM_006827chr1473248 2944 2444 2427 2348 2325 2163 1148 12119 12951
NM_006884chr361763 749 481 432 424 286 --1439 --
NM_006902chr163238 1014 1006 319 306 133 11332 12617 12650
NM_007011chr1586334 5571 5308 4382 2517 2238 1294 480 42569 2324 2086 365 14497 11080
NM_007038chr2165735 5546 2424 2391 2038 163 35116 4402 3881 32284 2028 1629 --
NM_007050chr20217846 6990 6932 6518 6397 6344 6258 5859 5511 5445 5147 4967 3043 2920 2286 2142 2029 1764 1556 555 122 17292 51890 1388 1294 1238 739 17244
NM_007137chrX105184 4737 4143 2144 2093 1825 1513 1362 193 29 14121 53580 2190 1410 843 196 --
NM_007153chr19114405 3305 1041 822 751 659 493 409 325 240 224 --34243 3193 56 --
NM_007203chr9103189 3020 2678 2576 1419 1110 1104 1088 687 211 2765 585 12663 1379
NM_007249chr13159181 8827 8338 7690 7258 3060 2834 2290 1918 1497 1489 1365 1049 1001 191 18406 27349 1316 22589 2283
NM_007350chr1273665 1714 1308 1124 967 828 37 23264 434 --1926
NM_012164chr9107414 6877 5894 4978 1862 1615 1381 1231 1012 261 11779 17125 16745
NM_012193chr11104286 3863 3789 3735 3529 2062 1709 1383 844 378 34276 3755 1231 24747 1223 24460 3388
NM_012252chr765298 1996 1469 1387 1093 569 33589 1593 1501 14637 --
NM_012262chr195071 4765 3864 3773 3764 3658 1671 1466 246 14854 13512 23581 1843
NM_012316chr1135601 5358 5124 4801 4571 4094 3450 1814 1214 1025 990 492 308 13835 21145 919 --
NM_012465chr10103415 3051 2762 2756 2412 2299 1161 1151 190 33 --23427 2599 --
NM_013231chr14113927 3516 3111 1651 1566 1517 923 885 675 417 282 33670 3451 50 ----
NM_013238chr1351545 654 600 591 410 21858 455 --21523 1188
NM_013255chr7188855 8427 7917 7671 7322 7295 6644 6561 5625 5602 5434 3453 3422 3215 1039 949 863 101 17351 12316 --
NM_013286chr353761 3068 752 314 204 11515 33595 3518 2900 23535 1494
NM_013372chr15133093 2692 2349 2069 2059 1294 1276 1248 1165 1098 963 801 198 --12274 1221
NM_013374chr342317 631 368 41 33116 1074 916 12387 12970
NM_013382chr14142214 2093 1995 1940 1828 1715 1704 1696 1536 1482 940 899 889 48 --2186 175 3685 493 219
NM_013989chr14144998 4743 4124 4106 3670 1824 1347 895 764 713 673 602 364 251 24954 2048 --1854
NM_014112chr8124689 4639 4608 4175 4084 4050 3653 3422 1242 1215 474 468 25208 1462 ----
NM_014155chr11137489 6825 6808 6386 5753 2620 2580 2292 1721 951 591 514 178 21967 61 15263 --
NM_014309chr22115451 5152 4407 3531 2147 2109 1900 1003 569 91 68 23480 1150 24815 4304 11986
NM_014331chr4147427 7177 6390 6097 5457 5343 2322 1534 1446 1282 902 670 461 267 --25199 86 --
NM_014388chr164961 4764 4322 4106 3858 399 24063 1850 --25480 5414
NM_014636chr984032 3767 3743 3659 1738 638 376 42 13368 --22823 294
NM_014700chr1671387 1036 353 233 206 200 191 --1123 --
NM_014721chr697018 5269 4663 4567 4517 930 494 445 414 35260 2913 558 26365 807 --
NM_014730chr12175005 4790 4707 4523 3573 3487 3393 3340 3217 2095 1800 1536 956 851 371 329 109 ----1162
NM_014730chr12175005 4790 4707 4523 3573 3487 3393 3340 3217 2095 1800 1536 956 851 371 329 109 ----1162
NM_014739chr673623 3360 3322 3083 1580 987 779 ----13808
NM_014774chr173203 2699 2657 2477 2107 756 335 --1996 1341
NM_014826chr193760 3396 2921 2746 1514 720 708 622 412 --34398 4234 713 --
NM_014873chr183974 3795 3510 3179 3099 813 306 265 13642 21928 1596 --
NM_014899chr582729 2618 2514 1129 974 892 868 617 --11147 2899 180
NM_014909chr14153770 3320 2845 2587 1249 1148 1078 801 686 674 658 611 507 501 335 --23323 3135 --
NM_014935chr1112691 1401 1387 1331 1268 1085 938 744 726 428 413 1387 23451 175 2678 655
NM_015000chr1233049 354 124 --2795 33 2955 817
NM_015020chr16102915 2892 2787 1440 1196 1117 969 727 628 466 31350 877 799 21152 974 --
NM_015035chr20126010 5907 5456 5078 4955 4683 4598 2272 1572 882 498 125 26652 4101 45618 4773 4571 1642 11943
NM_015049chr282824 2731 2135 927 396 368 225 89 --1371 23180 1180
NM_015051chr9113190 3163 2900 2594 2552 2259 2160 1038 829 815 330 12482 33093 1058 950 11096
NM_015064chr12113584 2356 2265 877 864 765 725 693 644 247 199 --3787 679 420 11234
NM_015068chr7143750 3713 3346 3320 3309 3079 2965 2456 2427 1323 1204 1137 495 384 2447 207 33653 3349 2968 13275
NM_015071chr5245933 5917 5414 5346 5338 5300 5216 4592 4482 4355 4079 3947 2528 2521 2480 2351 1865 1825 1804 1363 1261 893 336 245 3634 364 228 11609 15520
NM_015077chr17134374 4280 4261 4066 4056 3569 3488 3467 3442 3105 2967 1333 189 13578 --34477 4080 3251
NM_015090chr1286119 5833 5588 5487 4891 4793 4779 4770 4759 4701 4541 4499 4209 4016 3954 2497 2374 2150 2140 1638 1608 1315 928 687 471 219 142 51 11429 14252 26251 4020
NM_015200chr472357 2195 2113 1895 1856 210 22 --12323 11710
NM_015234chr681476 570 468 451 445 435 139 83 ------
NM_015299chr14143576 3457 3227 2726 2691 2573 2545 2455 1331 1150 734 641 625 129 1634 12681 1403
NM_015310chr8217617 7146 7115 6686 6274 6076 5956 5675 3337 3247 3182 2056 1748 1618 1377 1371 687 681 631 623 593 12482 36963 6887 6777 --
NM_015345chr662647 2572 1899 436 423 50 1512 --32191 2045 565
NM_015393chr483382 3099 2851 2514 904 860 845 805 32759 2597 357 12854 1465
NM_015394chr1291826 1618 1561 868 732 362 306 149 52 3959 912 236 1133 --
NM_015520chr3132784 1814 1074 747 657 599 572 453 378 334 327 283 122 --22301 546 1576
NM_015553chr684834 4496 2030 1915 1873 1470 699 583 --21461 321 11919
NM_015852chr7172737 2725 1217 1136 1052 968 884 800 716 632 548 464 380 296 212 128 44 --12287 --
NM_015879chr18148417 8145 7330 7314 7195 5957 5278 3385 3350 2461 2336 2175 314 221 27463 1194 35292 1941 86 --
NM_015886chr8115600 5477 5470 5375 4500 2013 1536 1140 1081 450 71 31946 1543 42 174 --
NM_015995chr15135015 4884 4856 4628 4484 3760 3376 2128 2016 1362 1153 1127 79 44723 3518 351 284 32165 1374 84 --
NM_016075chr1341161 338 310 96 13082 32619 760 664 1329
NM_016089chr3162037 1969 1949 1836 859 818 802 734 650 480 398 382 314 230 81 46 3720 300 216 --1468
NM_016206chr3168521 8120 7164 6656 6442 5913 5859 2911 2411 2245 1555 1440 1087 861 512 112 18028 48502 7167 6799 2851 --
NM_016220chr782275 1646 1589 716 463 383 297 48 11511 21800 217 --
NM_016248chr1343408 2920 1546 981 23344 49 23390 3060 11213
NM_016260chr2147543 6667 6376 6076 5439 5146 3007 2675 2040 1809 1293 1014 531 196 22616 1672 11826 --
NM_016507chr1773024 2480 2356 1198 513 330 267 --13027 2467 258
NM_016834chr17132905 2640 1312 1181 852 780 758 647 599 572 337 49 36 13178 21500 42 --
NM_016835chr17132905 2640 1312 1181 852 780 758 647 599 572 337 49 36 13178 21500 42 --
NM_016841chr17132905 2640 1312 1181 852 780 758 647 599 572 337 49 36 13178 21500 42 --
NM_017628chr495055 4892 4593 4478 4158 3975 3419 1859 372 --195 14451
NM_017633chr692929 2906 937 786 488 400 294 252 54 11345 22909 1235 23892 3075
NM_017637chr9198597 8578 8542 7898 7892 7677 7642 7602 7126 6582 6429 6155 5868 3714 3060 2277 1639 1592 423 18885 38497 7853 1921 17239
NM_017650chr7124639 4554 4443 4355 3850 1298 1102 1077 584 312 77 40 1941 11580 35679 4735 427
NM_017709chr1103987 3770 3561 1407 1305 607 569 333 104 32 13473 13690 12708
NM_017754chr674951 4253 4046 2001 1652 513 35 24194 181 34760 4256 1130 14806
NM_017847chr172137 1925 1729 1696 1686 1651 849 --1837 21742 38
NM_017848chrX104593 3056 1843 1571 1542 1413 1116 197 77 38 12939 33843 1678 1545 --
NM_017902chr10165271 4999 4251 4149 4098 3741 2282 2117 1911 1711 1585 1418 643 619 598 445 169 15349 13761
NM_017952chr2104357 4264 3752 3478 1567 1429 1248 1204 703 61 ----13960
NM_018003chr1552371 2284 1723 976 355 32060 2017 737 32332 1899 940 --
NM_018257chr2072587 2353 1642 1042 319 269 261 --3688 249 112 --
NM_018299chr873435 3071 2999 2873 2286 2276 667 --12901 12510
NM_018373chr14216334 5911 5895 5092 4767 4535 4448 4071 3909 2475 2412 2368 2148 2134 1770 1684 1467 1211 557 367 282 --34486 2227 688 --
NM_020122chr285753 4524 4433 3949 3680 1513 284 140 --25091 4886 12069
NM_020141chr181851 1806 1778 1762 658 553 404 368 1543 1409 1581
NM_020182chr20123427 3211 3156 3010 2939 2204 753 692 506 424 80 71 12590 1183 --
NM_020205chr183103 3063 2164 1280 1120 766 636 307 32401 899 782 --12565
NM_020341chr201534 41740 60 47 39 1578 --
NM_020443chr1206830 6171 5752 5501 5253 5214 5024 4886 4768 2564 2371 1231 1094 992 751 623 391 210 174 141 21131 116 36833 4952 649 --
NM_020466chr694984 4524 3879 1375 1332 1321 640 488 270 34600 4464 3297 21481 1272 21980 123
NM_020699chr1115373 4880 4616 4231 3577 1777 1626 1614 1507 1016 302 25166 880 11399 --
NM_020714chr19103493 3456 3446 3163 3068 2903 1755 1556 311 75 44332 3201 1587 297 ----
NM_020718chr16146587 5418 5180 5127 5115 5084 4956 4824 4099 1400 1277 1039 626 494 --1308 --
NM_020734chr1263118 2695 2207 202 136 111 13059 12698 12577
NM_020772chr17137378 7334 6002 5829 5591 2712 2551 2193 1544 1251 533 457 101 18044 13215 --
NM_020774chr18116091 5533 5047 4444 4422 4385 4376 730 596 501 258 13898 11956 --
NM_020781chr7122750 2708 2677 2529 2482 2143 1154 1079 815 474 418 62 1676 --1329
NM_020810chr14123554 3503 2817 2809 2794 2712 2655 2553 2208 1322 782 269 ----12435
NM_020850chr1653253 2272 988 782 742 --53256 2965 1290 1105 759 --
NM_020921chr1453116 2774 2625 773 379 ----23475 907
NM_021061chr8144384 3936 3826 3721 3434 3321 3253 3203 3045 2923 2873 2771 300 74 23609 3444 1246 --
NM_021079chr17102975 2965 2273 588 530 521 491 436 257 96 33227 3164 445 12653 12388
NM_021116chr7239104 7892 7711 7502 7299 7091 6936 6433 6022 5854 5800 3207 2845 2787 2670 2273 1808 1506 1368 1301 1087 859 612 1212 26025 3105 --
NM_021120chrX123157 2863 2487 2434 2001 1168 885 791 761 640 332 325 32889 1195 90 33085 2463 888 12898
NM_021202chr2073083 2466 2430 1030 791 686 675 11078 32387 696 650 --
NM_021255chr1493814 3253 3206 3087 3031 2509 1195 127 99 ----32974 1161 587
NM_021813chr661898 1809 1740 1641 1169 1124 1101 25273 3840 33761 1744 1481
NM_021961chr1176485 5063 2218 2129 1894 1045 229 12941 17241 22334 1574
NM_022048chr15196030 6011 5561 5451 5322 5091 4930 4486 4139 4104 2387 2093 1806 1535 1504 1138 934 873 481 --11854 45152 1288 892 877
NM_022114chr1144695 4683 4568 3294 2898 1763 1251 1010 869 648 602 395 367 79 33680 1233 222 ----
NM_022166chr16165192 4912 4322 4168 3977 2168 2149 2066 2037 1565 1557 1422 1312 908 674 143 14671 ----
NM_022456chr12115884 5662 5481 5324 5236 2198 1663 1642 927 902 839 16564 25842 5550 --
NM_022497chr383727 3619 3424 2406 2392 265 165 79 1398 23103 3054 12818
NM_022648chr2154169 3164 3089 3077 2971 2923 1581 1218 430 332 216 175 144 119 94 24374 4310 13948 --
NM_022716chr153082 858 850 163 150 11176 12461 12494
NM_022719chr2283410 2440 2372 1467 1175 1169 503 135 33013 1138 1111 21122 70 13573
NM_022898chr1494307 4183 4119 3911 3901 3698 3140 1771 758 --44127 3148 2949 58 13157
NM_023016chr222459 1865 1281 --2768 550
NM_024408chr1133571 2812 2803 2797 2784 2541 2416 2410 732 722 154 125 81 32995 2464 283 --13335
NM_024513chr3113376 3268 3212 2962 2548 2336 1513 1403 1395 1164 148 12990 --11374
NM_024569chr172898 2248 1960 1909 941 847 213 12324 22515 1022 22194 84
NM_024639chr6122692 2527 2516 2113 1821 918 855 791 562 501 445 262 2361 70 92740 2647 858 670 346 308 157 118 53 12520
NM_024665chr393980 3969 3877 3581 3410 3325 896 428 281 --13497 21871 1597
NM_024770chr2106575 6052 5549 5531 5425 5379 4520 2104 445 421 --54230 2490 1868 102 35 --
NM_024884chr1484480 4043 1694 1299 1271 505 266 230 43192 3170 1731 410 --13596
NM_024947chr3109308 8720 7881 6975 6947 6170 3243 3203 2152 622 12440 22937 1753 12788
NM_024949chr4104675 4506 4087 3968 3072 1191 1106 919 722 447 2894 550 1902 --
NM_024989chr2137847 7332 7051 5965 3082 1810 1803 1753 1699 1521 261 161 102 23096 1689 11815 27731 62
NM_025138chr1361005 463 213 124 106 52 --1495 11139
NM_025160chr1123873 3416 3167 2724 1713 1705 1694 1688 1630 1508 1474 1357 ----13059
NM_025179chr1214429 4311 4113 4023 3662 3405 3159 3046 1823 1740 1563 804 689 601 595 546 516 382 353 248 140 54933 3754 3181 1700 224 33377 3130 233 --
NM_030647chr7106066 4716 4214 3958 3934 1726 1572 766 412 202 16151 13922 1913
NM_030648chr4145510 4766 4659 4179 4042 2086 2069 2017 1814 1523 1247 844 600 321 21550 1407 14297 --
NM_030664chr1061972 1807 888 820 474 128 11574 --149
NM_030674chr12125392 5171 4787 4661 3844 2279 1818 1753 1433 1051 917 421 11355 25463 984 --
NM_030761chr192471 2270 2203 2185 1674 889 692 392 46 1631 --32236 2177 525
NM_030806chr1159087 7788 7645 7585 7342 6921 6826 6199 6031 6019 2739 2208 1668 1311 556 12727 36786 2976 1239 25776 3032
NM_030918chr1145337 5270 4949 4937 4333 3486 1763 1596 1548 1388 912 802 728 296 ----13425
NM_030952chr141247 237 231 219 --1313 1876
NM_031268chr16134568 4165 3568 2039 1734 1593 1379 1268 929 900 882 838 108 24348 1224 34720 1271 998 --
NM_031417chr19132689 2670 2616 2413 2337 2139 2112 1984 918 692 662 639 574 12164 12130 12419
NM_031453chr1072177 1750 1592 892 818 542 485 2280 89 1107 1298
NM_031468chr7197678 7300 7154 6951 6582 6493 6154 5446 5098 3186 3004 2810 2593 2566 2404 1108 766 359 295 36450 5633 2361 31292 727 628 27315 353
NM_031844chr173212 2767 1314 1123 1020 624 101 --33496 229 203 1367
NM_031911chr4122807 2556 2108 2063 1939 1928 1894 932 889 799 725 464 22046 1129 12789 --
NM_032105chr1197927 7633 7487 7428 7413 6868 6360 5958 5734 5391 2838 2696 2649 2587 2370 1629 1377 594 390 24953 1334 12854 --
NM_032199chr1073405 2696 2586 2522 1242 1217 508 --33303 1036 308 11096
NM_032440chr1062368 1111 999 991 809 375 --22553 240 1261
NM_032873chr11104476 3990 3785 3422 1197 503 359 234 183 166 --21085 273 11558
NM_032900chr1083804 3189 3171 2697 1069 925 681 199 --23347 1136 22961 1340
NM_033133chr17113431 3311 3227 3169 3082 2957 2857 763 476 47 35 13483 23466 449 --
NM_033224chr7127987 7868 7516 5771 5264 2689 965 514 320 227 147 119 12220 37297 6449 57 1164
NM_033331chr952828 2220 695 198 136 12646 13443 21041 662
NM_033430chr483694 3378 3183 2988 2726 1293 920 492 13418 21131 170 32789 1030 619
NM_033437chr483694 3378 3183 2988 2726 1293 920 492 13418 21131 170 32789 1030 619
NM_033505chr2146529 6436 5912 5583 5443 5202 4113 2279 1790 992 660 652 636 436 --55824 4567 2704 1696 556 --
NM_033656chr2195677 5299 5014 4457 3881 2311 865 97 31 --21735 1583 15684
NM_052811chr1385265 5068 4696 4213 1890 1666 826 727 23835 1749 13934 150
NM_052851chr13112241 2230 2074 1914 1581 1482 230 94 88 64 32 ------
NM_052875chr1141865 663 300 159 31638 309 259 --1316
NM_052879chr1242840 386 378 109 --13668 23459 2801
NM_052885chr1294090 3507 1955 1905 1607 1216 1120 1020 48 23140 1709 13754 --
NM_053016chr9107415 7259 5922 5845 3180 3086 2132 1940 1870 1390 16011 21623 1099 --
NM_053042chr452311 2199 1276 509 355 12879 3728 242 105 1843
NM_078470chr1082259 2209 1712 1660 943 788 244 45 ----21664 1649
NM_080717chr1251461 74 62 43 37 --191 11419
NM_133170chr20217846 6990 6932 6518 6397 6344 6258 5859 5511 5445 5147 4967 3043 2920 2286 2142 2029 1764 1556 555 122 17292 51890 1388 1294 1238 739 17244
NM_133468chr782326 2070 2063 2052 1927 1792 952 441 12503 --12330
NM_133474chr471568 1493 1454 1129 666 607 151 --41571 1047 651 54 1536
NM_133477chr443107 3075 2669 2239 1925 --22794 981
NM_138288chr1482156 2098 2065 1877 1868 777 500 483 11660 11817 --
NM_138348chr5106595 5712 5603 5136 2158 947 598 309 290 168 14675 36246 5514 740 --
NM_138473chr12104274 4171 4023 3773 1487 1406 1400 1096 148 89 --43812 1657 1554 92 --
NM_138576chr1494307 4183 4119 3911 3901 3698 3140 1771 758 --44127 3148 2949 58 13157
NM_138731chr1494065 3081 1686 1561 1455 1179 1111 669 474 --11523 --
NM_138959chr1166273 6242 5837 5158 4657 4372 2194 1735 1720 1344 1186 843 806 614 540 51 12365 16235 15978
NM_139321chr20123818 3611 3162 3136 3076 2742 1434 1296 1101 983 541 66 23628 1152 24162 288 11177
NM_144571chr4136605 6165 6000 5854 4463 4417 4404 4381 2380 2332 1059 748 436 ----11063
NM_144578chr1464228 4023 3605 2106 1656 134 1420 25202 1043 13589
NM_144973chr12105035 4950 4875 4785 4333 3997 3386 1809 1163 1074 13950 24420 1079 1674
NM_145117chr1183115 1112 584 519 433 329 321 208 2868 122 1346 13277
NM_145284chrX62142 1653 803 657 261 63 --172 11682
NM_145686chr263125 2977 2384 2300 2133 54 12325 --22395 455
NM_145687chr263125 2977 2384 2300 2133 54 12325 --22395 455
NM_147150chr9103189 3020 2678 2576 1419 1110 1104 1088 687 211 2765 585 12663 1379
NM_148955chr15115513 5187 5121 4835 4498 4192 4041 3993 1986 651 618 35550 4622 1912 24847 1995 1201
NM_152263chr1155057 5023 4511 4423 4354 4326 4198 3919 3904 3836 1960 1740 1225 1150 53 11549 15951 16037
NM_152406chr571640 1151 678 310 194 187 88 1204 --2567 175
NM_152470chr18153334 3128 3069 2937 1623 1520 1424 783 584 288 233 180 164 135 103 13267 --21634 1428
NM_152624chr5116881 6161 4916 4820 4707 2816 2519 1553 1504 1002 144 25495 1185 ----
NM_152744chr783569 2954 2615 2509 2176 725 291 241 33394 1023 808 22957 434 12681
NM_152793chr7105160 4807 4337 4218 3716 3660 563 402 388 303 14878 21107 333 --
NM_152826chr15115513 5187 5121 4835 4498 4192 4041 3993 1986 651 618 35550 4622 1912 24847 1995 1201
NM_152838chr2042804 1243 1176 246 --12313 22715 216
NM_152924chr1586334 5571 5308 4382 2517 2238 1294 480 42569 2324 2086 365 14497 11080
NM_153350chr16101610 1380 1366 1358 1348 1340 1314 601 145 29 --11333 --
NM_153367chr10123951 3885 3468 3241 3210 2881 2767 1344 1269 1081 323 206 ----22809 984
NM_153426chr44154 129 116 110 --1157 --
NM_153427chr44154 129 116 110 --1157 --
NM_153442chr10246416 6391 6363 6330 6319 6121 6097 6021 5786 5699 5684 5370 5259 5113 5048 4646 4505 4047 4003 2512 2060 1563 1292 578 25385 2242 21889 323 16323
NM_153456chr13245875 5751 5193 5118 4932 4832 4788 4618 4591 4518 4333 3874 2277 1718 1642 1376 1353 935 835 749 451 441 264 75 2422 95 35653 3999 678 --
NM_153810chr10144555 4462 4422 4258 4163 2041 1891 1742 1535 1245 1089 939 657 127 --11341 21942 40
NM_170686chr7122750 2708 2677 2529 2482 2143 1154 1079 815 474 418 62 1676 --1329
NM_170719chr1361005 463 213 124 106 52 --1495 11139
NM_173463chr494418 1768 1108 1060 1005 989 938 328 98 34039 3461 1050 44318 903 849 601 --
NM_173468chr465686 5438 4889 3837 2023 880 25641 5624 25770 3881 24811 2027
NM_173510chr2272917 2558 772 613 470 462 202 1337 12213 1477
NM_173531chr1993115 2883 2787 748 665 622 462 312 151 --2829 70 13070
NM_173582chr11106252 5284 5196 4552 2180 1749 1573 1425 196 57 14839 24711 1899 15781
NM_173654chr332202 2152 29 22273 2169 --12206
NM_173808chr1124224 3753 3272 3242 3143 2929 2900 2851 2813 2805 794 253 24342 1399 ----
NM_175623chr12115884 5662 5481 5324 5236 2198 1663 1642 927 902 839 16564 25842 5550 --
NM_175624chr12125979 5757 5576 5419 5331 2293 1758 1737 1022 997 934 88 16659 25937 5645 --
NM_175625chr12125979 5757 5576 5419 5331 2293 1758 1737 1022 997 934 88 16659 25937 5645 --
NM_175634chr82452 139 --2238 142 2258 251
NM_175635chr82452 139 --2238 142 2258 251
NM_175636chr82452 139 --2238 142 2258 251
NM_175736chr12227481 7278 6776 6770 6687 6494 5754 5091 4908 2902 2815 2678 2669 2286 2164 1842 1059 1026 784 646 519 334 25440 2917 15761 45567 3127 1612 341
NM_175861chr12134805 4561 4319 4054 3983 1100 1037 868 820 616 419 232 226 11090 13631 14931
NM_175910chr19121922 1656 1641 944 862 781 699 615 531 279 195 111 --1264 --
NM_177972chr11104272 3174 2901 1634 1540 1095 1069 563 351 196 24318 225 23251 944 13035
NM_177990chr201534 41740 60 47 39 1578 --
NM_178006chr13112241 2230 2074 1914 1581 1482 230 94 88 64 32 ------
NM_178007chr13112241 2230 2074 1914 1581 1482 230 94 88 64 32 ------
NM_178037chr12113584 2356 2265 877 864 765 725 693 644 247 199 --3787 679 420 11234
NM_178038chr12113584 2356 2265 877 864 765 725 693 644 247 199 --3787 679 420 11234
NM_178151chrX137716 7383 6762 6396 5992 5473 2881 2252 1799 1132 892 569 469 --17697 1638
NM_178152chrX137716 7383 6762 6396 5992 5473 2881 2252 1799 1132 892 569 469 --17697 1638
NM_178153chrX137716 7383 6762 6396 5992 5473 2881 2252 1799 1132 892 569 469 --17697 1638
NM_181481chr18126510 6493 5685 5543 5223 4298 2073 1700 850 527 47 30 --32684 616 269 11477
NM_181482chr18126510 6493 5685 5543 5223 4298 2073 1700 850 527 47 30 --32684 616 269 11477
NM_181483chr18126510 6493 5685 5543 5223 4298 2073 1700 850 527 47 30 --32684 616 269 11477
NM_181486chr1251461 74 62 43 37 --191 11419
NM_181705chr5125309 5290 4348 4202 4005 3916 2030 1072 661 548 324 167 --11117 --
NM_182503chr6115573 5561 4992 4638 4180 3630 3578 2058 1903 1849 857 31398 788 387 34641 1310 327 1152
NM_182762chr7145543 5438 4713 4628 4590 4174 2383 2168 1847 1558 1028 730 584 31 --34928 2493 603 23873 2309
NM_182898chr7166373 6101 6058 6037 5944 5786 4924 4576 4381 2488 2212 1994 1946 1220 1210 938 16072 --16105
NM_182899chr7166373 6101 6058 6037 5944 5786 4924 4576 4381 2488 2212 1994 1946 1220 1210 938 16072 --16105
NM_182964chr1183115 1112 584 519 433 329 321 208 2868 122 1346 13277
NM_183376chr1582267 2028 1639 823 810 685 442 308 ----12176
NM_194071chr754634 4353 4014 3879 1057 15057 12166 25144 168
NM_194247chr243470 3240 103 39 14137 142 21116 621
NM_194283chr5114067 3756 3636 3488 3309 3265 2598 1251 954 860 297 13600 23104 3035 --
NM_194285chr1153158 3004 2895 496 115 11012 --33382 3143 1289
NM_194318chr1392010 1977 1590 927 504 300 180 159 36 --1647 21981 1664
NM_197941chr592649 2311 1936 1914 798 220 81 75 21 22356 1119 32640 1917 64 --
NM_198270chrX41387 960 860 272 22252 1290 33157 950 74 13066
NM_198392chr6112244 1979 1853 1778 1613 812 569 273 232 128 29 11745 --1710
NM_198399chr341319 1240 607 258 1716 11313 31514 1427 707
NM_198560chr3193520 3503 3497 3393 3345 3274 3114 3035 2797 2649 2412 2343 2334 1523 590 321 179 151 88 --12600 13614
NM_198859chr3144720 4606 4276 3999 3562 1978 1429 1223 1203 1148 805 116 109 27 --11738 11252
NM_198900chr12227481 7278 6776 6770 6687 6494 5754 5091 4908 2902 2815 2678 2669 2286 2164 1842 1059 1026 784 646 519 334 25440 2917 15761 45567 3127 1612 341
NM_199005chr94913 850 791 262 2361 70 7853 670 346 308 157 118 53 --
NM_199132chr19111320 834 766 682 596 582 431 329 245 160 76 11410 ----
NM_199169chr20123427 3211 3156 3010 2939 2204 753 692 506 424 80 71 12590 1183 --
NM_199170chr20123427 3211 3156 3010 2939 2204 753 692 506 424 80 71 12590 1183 --
NM_199171chr20123427 3211 3156 3010 2939 2204 753 692 506 424 80 71 12590 1183 --
NM_199188chr1242840 386 378 109 --13668 23459 2801
NM_199190chr1242840 386 378 109 --13668 23459 2801
NM_199320chr482698 2391 1951 1049 955 570 76 55 12880 2576 374 --
NM_199320chr482698 2391 1951 1049 955 570 76 55 12880 2576 374 --
NM_199454chr1144695 4683 4568 3294 2898 1763 1251 1010 869 648 602 395 367 79 33680 1233 222 ----
NM_201266chr272962 2954 2863 1090 1084 997 379 11072 --11943
NM_201279chr272962 2954 2863 1090 1084 997 379 11072 --11943
NM_203406chr561070 475 346 279 130 119 21994 794 1297 --
NM_203458chr1103568 3342 3325 3257 2558 1446 1381 1351 453 407 1533 23345 243 --
NM_203463chr2104385 4333 4318 3911 3672 3049 1540 1395 1098 602 --13465 2872 223
NM_206909chr8217617 7146 7115 6686 6274 6076 5956 5675 3337 3247 3182 2056 1748 1618 1377 1371 687 681 631 623 593 12482 36963 6887 6777 --
NM_207043chr152162 1770 1664 1577 1562 --31565 492 316 21798 1594
NM_207044chr152162 1770 1664 1577 1562 --31565 492 316 21798 1594
NM_207047chr152162 1770 1664 1577 1562 --31565 492 316 21798 1594
NM_207380chr1582810 2622 2386 1075 871 691 47 39 ----22729 331
NM_207406chr486173 5865 5835 5722 5325 4684 1681 370 26004 2138 --1549
NM_212558chr9113776 3734 3052 2765 2739 2733 1658 567 385 183 83 33078 1414 321 --12775
NM_213589chr2135406 4762 4660 4600 4401 4212 4011 1778 1450 1221 1107 893 218 23490 3471 1223 35221 1530 1123
NM_213590chr1385265 5068 4696 4213 1890 1666 826 727 23835 1749 13934 150