TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-218-2-3p
miRNA Sequence: CAUGGUUCUGUCAAGCACCGCG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000084chrX186860 6564 6517 6212 5580 5545 4529 4385 2377 1783 1627 1609 1530 1393 979 350 330 46 25653 4750 11246 --
NM_000138chr1552655 2634 2236 1826 769 --22016 80 159
NM_000165chr611161 ----11460
NM_000176chr563901 2967 987 661 549 64 12635 13227 --
NM_000189chr282382 2368 2209 1694 1545 770 600 232 --12294 --
NM_000214chr2021182 447 ----11260
NM_000217chr12125125 4235 3763 3567 3521 1349 1321 1016 752 285 210 177 1308 ----
NM_000259chr1595723 5087 4575 4428 4311 4080 3943 2301 1276 11721 15732 --
NM_000267chr1742779 1395 712 353 43413 1402 843 513 --1532
NM_000332chr686789 6388 5504 4586 2239 1413 1342 588 15362 16650 --
NM_000337chr566074 6044 4561 1221 348 339 34188 2478 2038 1240 --
NM_000362chr2282827 2662 2583 2440 2295 1138 605 462 12475 1170 --
NM_000367chr682078 1846 1554 1496 873 835 654 150 1110 11705 1706
NM_000368chr9104792 4563 4502 4470 4297 3544 3132 2976 1389 1029 --14574 --
NM_000393chr232061 1492 399 42113 2032 1590 552 11475 --
NM_000430chr1763795 3150 2454 1436 287 278 --1517 --
NM_000441chr772278 1715 1609 898 715 621 109 1365 ----
NM_000461chr394531 4387 4316 3379 1452 1277 1172 258 180 24310 1508 ----
NM_000489chrX43374 2606 1071 65 32385 326 37 21381 980 --
NM_000555chrX157255 7119 6092 5792 5476 5271 5204 2921 2375 2247 1986 1225 1169 731 227 11441 ----
NM_000618chr1265657 5574 2429 987 709 304 34800 4537 2546 36519 6247 373 --
NM_000618chr1265657 5574 2429 987 709 304 34800 4537 2546 36519 6247 373 --
NM_000629chr21134257 4039 3897 3648 3422 2893 2582 1637 1437 1192 1088 526 168 ------
NM_000633chr1874512 4496 4100 3798 1681 1202 195 1705 14470 11609
NM_000663chr1692877 2758 2492 2225 2050 1978 826 612 203 23070 2952 21043 892 --
NM_000719chr12125342 5189 4945 4627 2600 1716 1570 1362 964 415 373 132 ------
NM_000793chr1474358 3750 1841 1826 1619 1373 543 32039 1675 196 1982 --
NM_000809chr4127241 6635 6255 5916 5828 5812 3469 2633 1813 1779 1130 638 17970 57193 2076 1139 739 178 1830
NM_000813chr575622 5156 3892 2141 944 612 555 13938 13642 11251
NM_000875chr15116522 5642 4974 4952 4562 4502 2130 1967 1176 838 288 16376 15207 --
NM_000877chr262578 997 575 431 158 136 1104 22923 1100 --
NM_000891chr1763651 3572 3156 2786 832 186 13329 11153 23050 1476
NM_000899chr1283704 3582 2900 1060 882 685 621 209 33455 3255 1483 ----
NM_000902chr363050 2925 2201 842 784 212 1900 ----
NM_000926chr11128372 7377 2950 2933 2742 2588 2338 2276 1015 602 329 266 23208 2646 49404 8242 8033 6388 11246
NM_001001323chr1232993 2326 34 ----12213
NM_001001419chr574956 4593 1780 1748 1488 1256 784 35187 4847 508 11117 --
NM_001001420chr574956 4593 1780 1748 1488 1256 784 35187 4847 508 11117 --
NM_001001928chr22138363 8089 7127 7050 6271 6143 5714 5588 2322 1680 1352 791 672 22926 559 27404 2989 --
NM_001002860chr1464334 2898 1763 1741 1735 1061 11872 ----
NM_001003407chr1084745 4691 4381 4230 4221 3804 1390 990 ------
NM_001003408chr1084745 4691 4381 4230 4221 3804 1390 990 ------
NM_001003652chr1898712 7910 7226 6777 5431 5349 2962 2010 1310 21604 712 ----
NM_001003674chr18137076 6666 5657 5397 5374 4884 4505 2730 2641 2050 1329 489 429 27064 6206 ----
NM_001003675chr18137076 6666 5657 5397 5374 4884 4505 2730 2641 2050 1329 489 429 27064 6206 ----
NM_001003712chr12103732 3580 3542 3309 3033 1502 509 55 29 21 13225 11580 23254 2832
NM_001003760chr673473 3275 2482 2426 937 714 53 12592 2952 744 --
NM_001003945chr931919 1198 27 ----1551
NM_001004065chr993672 3022 2756 2630 2582 1223 986 821 203 32536 802 497 ----
NM_001004303chr13738 312 43 ----1294
NM_001004303chr13738 312 43 ----1294
NM_001004419chr1274244 4007 3952 1194 651 454 366 23492 226 1633 --
NM_001005473chr544898 4811 2569 412 31798 521 167 16195 --
NM_001005502chr1295249 4745 3812 3373 3348 1744 1191 342 41 11905 ----
NM_001007023chr1474358 3750 1841 1826 1619 1373 543 32039 1675 196 1982 --
NM_001007024chr1774327 3977 3889 3762 2964 2773 2680 14210 ----
NM_001007025chr1774327 3977 3889 3762 2964 2773 2680 14210 ----
NM_001007097chr9125092 5018 4983 4895 4689 4429 4374 3992 3583 2039 2002 1381 --14927 --
NM_001008239chr1863836 3627 3554 3537 2437 1043 12539 ----
NM_001008408chr734597 2553 2374 ----16393
NM_001008756chr362105 2027 1730 559 227 189 --22449 2210 --
NM_001009554chr464722 4518 3229 1527 1519 1353 ----11000
NM_001009554chr464722 4518 3229 1527 1519 1353 ----11000
NM_001009555chr481300 1195 1175 1151 675 668 411 347 --148 --
NM_001009899chr395964 5869 5587 4802 4599 4281 1856 1610 148 15063 36431 5939 5400 --
NM_001009959chr242597 2100 2023 1880 --21998 1809 --
NM_001009993chr264438 2936 1002 963 916 355 --13038 1278
NM_001010000chr1863420 3394 3047 2775 2624 493 31004 972 878 21101 152 --
NM_001010861chr112230 22398 2133 1315 1914
NM_001010867chr1156696 6464 5754 5420 5273 5078 4592 4558 4111 2213 1833 1233 863 694 571 15065 25748 1877 --
NM_001010888chrX74664 4019 3119 1611 1562 1380 695 1912 13631 1940
NM_001010891chr5106410 6324 6291 5748 5365 4817 2783 1657 477 277 1512 25557 1214 26376 1954
NM_001011666chr7185696 5612 4930 4610 4541 4384 4016 2172 1731 1704 1606 1562 1481 1464 1166 1111 761 290 25132 2428 12453 --
NM_001011708chr21588 21993 765 22377 1825 1262
NM_001012751chr1051855 1772 1664 1481 692 --1304 --
NM_001012755chrX94511 4140 4037 1964 1468 761 591 238 97 34225 966 800 3975 894 408 --
NM_001012756chr1993136 2745 2618 2095 1078 1047 1011 819 527 1953 1395 --
NM_001012968chrX52286 1844 1042 635 258 ------
NM_001013031chr1043195 2956 2247 787 23520 3290 12704 --
NM_001013399chr661005 878 459 375 45 29 1750 ----
NM_001013659chr19125098 4901 4803 4780 4699 4463 4429 3715 1330 755 715 323 14746 --1922
NM_001014797chr1086896 2936 1816 1612 1398 1187 914 214 25733 2461 46525 5620 3086 151 12194
NM_001017371chr261066 992 892 868 540 384 1968 ----
NM_001017440chr7127654 6938 6506 5499 3043 2170 2022 1534 983 553 330 276 11796 1125 --
NM_001018065chr9156046 5764 5283 4748 4291 4152 2378 2372 1943 1924 1848 1309 1151 528 44 1230 14872 --
NM_001018066chr9156046 5764 5283 4748 4291 4152 2378 2372 1943 1924 1848 1309 1151 528 44 1230 14872 --
NM_001018067chr145222 4193 4159 3670 1521 11775 13379
NM_001018068chr145222 4193 4159 3670 1521 11775 13379
NM_001018069chr145222 4193 4159 3670 1521 11775 13379
NM_001018074chr563901 2967 987 661 549 64 12635 13227 --
NM_001018075chr563901 2967 987 661 549 64 12635 13227 --
NM_001018076chr563901 2967 987 661 549 64 12635 13227 --
NM_001018077chr563901 2967 987 661 549 64 12635 13227 --
NM_001024094chr563901 2967 987 661 549 64 12635 13227 --
NM_001024647chr1297471 7353 7017 6806 6766 2709 2484 1476 794 45912 2027 2014 1896 26605 2953 --
NM_001024660chr361703 1602 1223 1127 421 47 11084 1591 --
NM_001024680chr251392 1130 523 496 206 --1130 --
NM_001024948chr113367 12991 1974 12872
NM_001025076chr1065971 5637 3937 3853 1931 604 ----16069
NM_001025077chr10107329 6995 5295 5211 4752 4692 4608 1962 94 61 ----17427
NM_001025252chr883144 3073 2441 2037 1138 778 690 490 --32712 901 809 --
NM_001025253chr883144 3073 2441 2037 1138 778 690 490 --32712 901 809 --
NM_001029858chr683289 3171 2899 1012 933 865 370 268 1611 ----
NM_001029863chr653070 3040 2535 966 766 32516 2246 132 12807 --
NM_001030055chr14104648 3832 3510 3488 1891 1781 1546 1528 175 133 --14688 --
NM_001031695chr2285103 4276 3970 3820 1323 992 840 638 25243 1204 14959 15219
NM_001031804chr1634390 4356 2947 44146 2961 2831 1135 24256 86 1928
NM_001032394chr662727 2307 1931 560 402 21 1413 --1726
NM_001032395chr652594 2174 1798 427 269 1280 --1593
NM_001033045chr263924 3284 1442 960 840 716 23507 2817 --133
NM_001033117chr394529 4150 3850 3788 3337 1802 1122 1068 177 11038 --13766
NM_001033659chr1741555 1280 538 513 --1238 1436
NM_001034841chr16104686 4300 4253 4238 4152 3372 1152 896 330 218 23684 1705 25497 1622 --
NM_001035260chr1051648 1422 1234 596 55 ------
NM_001037165chr7127264 6463 5955 2997 2879 2797 2723 1439 1300 1181 486 479 --11036 18759
NM_001037317chr112230 22398 2133 1315 1914
NM_001037535chrX31405 337 178 2624 506 31121 146 70 --
NM_001037536chrX31405 337 178 2624 506 31121 146 70 --
NM_001037540chrX31405 337 178 2624 506 31121 146 70 --
NM_001037954chr11133522 3501 3363 2602 2578 2542 1358 1220 1046 914 544 205 71 --21109 744 --
NM_001039585chr154111 3765 2957 1187 67 --21154 547 13351
NM_001039618chr1175911 5464 4929 4417 1686 1388 944 25952 2200 --13757
NM_001039840chrX85518 5217 5200 3882 1519 902 833 272 --11099 --
NM_001039937chr1334002 3019 567 13629 ----
NM_001040152chr744118 3310 844 198 24629 3229 34471 3382 124 --
NM_001040202chr432490 1787 674 1238 21850 1807 12368
NM_001040284chr16105797 5186 4824 4468 4146 3599 2160 1673 1568 1182 31373 1167 517 15655 --
NM_001040402chr452484 2241 1176 619 378 32080 670 61 ----
NM_001040441chr1105387 5235 4807 4537 4000 3378 1516 584 438 213 14091 11392 --
NM_001040712chr972721 2667 2305 853 700 303 169 --12749 169
NM_001042355chr1674804 4108 2050 993 759 392 377 11081 --11124
NM_001042404chr16688 620 429 318 181 26 11531 11583 --
NM_001042412chr1674804 4108 2050 993 759 392 377 11081 --11124
NM_001042413chr943857 2721 2677 695 13702 1178 --
NM_001042492chr1742779 1395 712 353 43413 1402 843 513 --1532
NM_001042543chr471347 1307 1154 1007 428 265 113 1379 ----
NM_001042555chr1244318 757 714 496 1388 --11682
NM_001042599chr297116 5423 3158 2718 1821 1810 1140 266 204 46522 6364 5573 456 25690 1614 --
NM_001042601chr352423 1291 443 183 49 32284 2085 1025 1369 --
NM_001042603chr1285274 5207 4740 4562 4497 1527 864 41 14544 ----
NM_001042604chr384572 4055 3985 3861 3732 1257 723 319 --23105 349 1671
NM_001043351chr172231 2213 1882 1679 833 464 319 11864 --11842
NM_001044385chr273698 3680 1371 1357 1035 288 227 1322 --22647 925
NM_001048183chr193819 3346 2873 2739 2468 929 419 276 24 13667 ----
NM_001071775chr1331945 1513 634 21666 141 2733 182 --
NM_001100108chr1106606 5493 2861 2771 2444 1929 1241 1175 736 654 1777 12667 --
NM_001106chr378814 8035 7353 6660 3826 3345 278 --59762 3652 3131 2737 930 --
NM_001121chr1031841 1584 1540 2612 378 21788 1705 --
NM_001160chr1252404 1918 1019 852 411 22243 936 --12068
NM_001167chrX136605 6238 5887 5752 5136 4955 4619 2137 1598 1102 688 607 320 1229 --12700
NM_001173chr14104648 3832 3510 3488 1891 1781 1546 1528 175 133 --14688 --
NM_001186chr2193248 3171 3000 2004 1279 1174 147 77 26 13040 --12699
NM_001201chr483437 2701 2402 1391 1167 918 812 38 11032 ----
NM_001204chr2126847 6757 5696 5619 5517 4766 2234 2183 1217 886 739 346 36630 2994 1443 17173 --
NM_001206chr962601 2569 2494 1004 919 548 ------
NM_001233chr772283 1942 1828 1508 1501 696 112 21975 513 ----
NM_001256chr1742641 854 592 353 --22660 327 --
NM_001364chr1194202 3722 3523 3056 1533 1461 1269 436 156 --21766 1171 --
NM_001390chr1883602 3338 3285 3128 2496 697 575 152 33215 2283 778 1898 --
NM_001438chr1113443 3020 2802 2505 2348 2275 1436 1081 821 674 660 13071 --1636
NM_001490chr9103733 3710 3578 3421 2440 1480 681 395 371 276 13360 13614 --
NM_001527chr684336 3884 3504 3456 2999 1499 464 32 --14654 --
NM_001616chr223035 368 --12291 12937
NM_001621chr782584 2519 2378 2198 2056 1162 669 426 ------
NM_001621chr782584 2519 2378 2198 2056 1162 669 426 ------
NM_001682chr1222707 2040 ----11927
NM_001690chr342432 2212 902 576 ----1587
NM_001695chr8104049 4040 3401 2831 2764 2684 790 684 647 444 --33954 817 422 --
NM_001718chr651022 951 870 264 112 11119 --11356
NM_001830chrX83865 3477 3233 3167 2933 2463 665 625 --23701 709 1468
NM_001859chr9113790 2636 1452 1301 1207 1065 738 704 285 178 81 ------
NM_001874chr1295249 4745 3812 3373 3348 1744 1191 342 41 11905 ----
NM_001918chr1118848 8233 8079 7439 7184 6817 6024 5874 2725 2593 2582 1619 59124 7744 6824 5855 2854 --
NM_001941chr1873870 3729 3695 3448 2657 1274 1093 13564 ----
NM_001966chr321249 122 ----1408
NM_001981chr142435 1966 855 59 --1591 11633
NM_001987chr1254224 1485 825 776 739 13102 1899 12699
NM_002006chr455615 4183 3829 820 150 1330 --12142
NM_002009chr1562140 882 558 469 262 24 --11849 --
NM_002015chr1352995 2831 998 866 582 13262 11151 --
NM_002025chrX138875 7986 7353 6497 6428 6027 3585 3501 3286 2491 2187 1831 1661 49275 9087 8222 6515 58714 8208 1357 1228 406 --
NM_002035chr1884013 3361 3185 3078 2723 863 214 121 13461 --12993
NM_002040chr2153219 2862 2579 431 371 12128 ----
NM_002069chr721835 646 31766 1581 1574 11787 --
NM_002128chr1342360 2235 763 542 ------
NM_002158chr263689 3540 3136 2718 1229 395 2383 62 ----
NM_002182chr342792 2452 1912 1747 12565 12170 --
NM_002203chr584157 3831 3752 3718 2745 1485 944 29 ------
NM_002247chr1051990 1515 724 656 212 62162 2066 2054 2032 2008 864 ----
NM_002264chr394458 4415 3697 3467 3100 1628 1222 1154 606 1850 ----
NM_002270chr553564 3476 2026 1961 531 25715 1900 --1357
NM_002310chr586199 5773 4155 2107 1568 984 821 30 36252 1737 677 35232 4492 1789 14843
NM_002313chr1084745 4691 4381 4230 4221 3804 1390 990 ------
NM_002336chr1263967 3327 1961 1081 1016 108 1425 ----
NM_002356chr652843 2106 2099 718 203 1663 ----
NM_002397chr541761 1394 863 562 11978 --1577
NM_002399chr155503 474 367 203 186 ----11112
NM_002427chr112376 172 --11158 1428
NM_002480chr1251440 1377 1262 1170 223 11068 --157
NM_002514chr82196 89 1429 --1395
NM_002515chr1422003 617 ----11658
NM_002519chr1151467 1381 1309 441 139 2999 952 ----
NM_002581chr993972 3494 2185 1906 892 828 614 275 174 12164 11166 --
NM_002613chr1674709 3853 3613 3515 3465 2130 96 25298 5235 1361 --
NM_002645chr1143032 511 214 174 ----11148
NM_002655chr8104386 4098 3836 3474 1950 1294 1163 940 268 59 13453 34333 923 175 --
NM_002709chr283002 2551 2464 1090 498 87 79 26 22990 640 ----
NM_002715chr541277 395 196 128 1982 --138
NM_002716chr1183674 2476 1376 1092 822 303 205 138 ------
NM_002737chr17156540 6428 6268 5310 5291 4959 4541 4091 4085 2228 2000 1161 842 754 595 --12324 --
NM_002740chr392405 938 931 918 819 386 205 145 85 11984 ----
NM_002837chr12114439 4286 3764 3477 3326 2808 1728 1541 592 573 474 33677 3044 1645 ----
NM_002839chr972721 2667 2305 853 700 303 169 --12749 169
NM_002858chr121097 315 21257 463 --1875
NM_002886chr3124724 4585 4241 3801 3499 3486 2082 1822 1665 1492 1429 1164 14102 --1504
NM_002892chr1431552 1324 1259 ----11070
NM_002941chr371446 1155 1012 642 555 235 40 11599 ----
NM_003034chr12137629 7302 7077 5705 2508 2328 1862 1242 1183 714 571 330 29 27762 588 26227 3099 1443
NM_003099chr15106486 6343 4501 4242 4057 2133 1903 937 445 157 --14862 --
NM_003108chr297125 6730 6512 5398 4640 4429 2807 2476 1456 14803 1599 --
NM_003111chr261066 992 892 868 540 384 1968 ----
NM_003144chr652170 1428 277 210 84 --1267 --
NM_003161chr1763453 3288 2850 2259 786 323 13120 1667 --
NM_003199chr1895695 5205 3542 3451 2064 1605 1413 1272 582 --14106 --
NM_003236chr283166 2717 1204 1104 798 575 336 217 --22437 2205 11070
NM_003262chr3114692 3847 3510 3370 1503 1227 1147 818 519 403 196 --33828 3204 1124 --
NM_003342chr1763202 2737 2449 2400 2352 785 ------
NM_003359chr48884 440 428 403 382 338 306 91 ------
NM_003463chr672626 2414 2167 2093 551 451 267 32512 1151 888 1414 12546
NM_003507chr221820 1549 21706 497 31616 1444 1313 --
NM_003574chr1885790 4405 3632 2015 1762 1273 1163 102 14273 ----
NM_003583chr1263195 3150 2999 1059 915 503 12959 ----
NM_003597chr292061 1983 828 766 745 688 666 647 261 ----12309
NM_003615chr363989 3529 3231 2634 2548 210 21525 538 13946 --
NM_003617chr1133405 3365 3172 1900 1822 1577 1361 1350 852 603 561 266 25 ------
NM_003626chr1171171 1092 1016 507 463 422 291 --11343 --
NM_003630chr63772 701 564 --1574 --
NM_003663chr372806 2667 2289 1124 561 526 99 12389 --1733
NM_003671chr973618 3384 3015 2947 1240 487 329 23423 809 ----
NM_003713chr131447 408 395 31744 1325 601 ----
NM_003816chr861335 940 566 491 274 98 ------
NM_003831chr1841712 1441 1410 680 1662 ----
NM_003913chr643831 1302 941 545 23903 1348 22989 1229 --
NM_003953chr162828 2785 2654 1099 947 195 11976 12282 11071
NM_003972chr1031233 988 251 11334 --1440
NM_003994chr1283704 3582 2900 1060 882 685 621 209 33455 3255 1483 ----
NM_004035chr17135178 4826 4587 3895 1940 1790 1402 1243 1122 906 808 583 214 1993 1642 --
NM_004086chr145282 220 128 109 96 ------
NM_004113chr341737 549 519 177 --1583 11759
NM_004124chr1482394 2250 1242 959 558 417 164 56 22766 47 23093 465 --
NM_004136chr1583149 2586 2105 1994 888 589 279 140 13088 21016 636 12793
NM_004171chr11139055 7649 7006 6331 3533 3410 3358 3246 3128 2222 1159 257 206 --68235 7245 3214 3135 1517 605 17703
NM_004172chr571972 1925 1784 1469 1394 213 47 11877 ----
NM_004232chr1883120 3071 3032 2760 2481 2407 809 104 11205 ----
NM_004338chr18137076 6666 5657 5397 5374 4884 4505 2730 2641 2050 1329 489 429 27064 6206 ----
NM_004397chr1164096 3527 3310 2876 513 476 --23591 108 1830
NM_004412chr1085910 5836 5000 4062 3661 1903 1746 79 45397 1990 1667 1030 22365 200 15827
NM_004432chr91861 31591 1548 40 --11791
NM_004440chr661867 1738 1405 1399 423 351 11287 12003 --
NM_004457chr23482 476 110 11357 --1263
NM_004459chr1751941 820 604 489 73 --156 --
NM_004464chr4103410 3375 3128 2784 1597 1546 1525 1365 499 28 1609 ----
NM_004501chr193580 3429 2725 1595 1575 1427 950 829 614 22932 529 13081 --
NM_004504chr272568 2206 2110 1864 970 438 429 ------
NM_004505chr1751979 1801 1776 1450 263 1335 ----
NM_004540chr21172 1920 --1324
NM_004575chr41407 ----11297
NM_004703chr1762519 2457 2232 1859 1776 1610 ----1594
NM_004726chrX85357 5288 4577 4083 3909 2112 1639 1254 1485 25374 1653 --
NM_004734chr1343137 3075 2872 2136 22980 2322 ----
NM_004736chr132237 2163 2138 31942 1456 645 12051 --
NM_004744chr463701 3055 2522 2404 1349 137 11366 12649 --
NM_004745chr8106734 6476 6337 5900 5099 4582 2780 2657 2421 1323 36405 6058 396 11703 --
NM_004755chr141782 ----11061
NM_004795chr1351784 1483 422 284 64 11564 ----
NM_004798chr2083257 2820 2671 2229 738 732 421 400 23311 2961 ----
NM_004815chr183806 3396 3280 3078 1960 1340 881 113 23270 1516 34570 1906 916 --
NM_004824chr611034 11214 --11402
NM_004859chr1783021 2570 2447 2274 2106 1218 1116 461 32556 2066 142 32281 2235 707 --
NM_004863chr14124999 4974 4885 4558 4153 3978 2087 1383 500 271 79 66 1730 14188 --
NM_004866chr584802 4613 4573 4178 3321 1274 680 391 --14446 --
NM_004871chr1774327 3977 3889 3762 2964 2773 2680 14210 ----
NM_004904chr7185696 5612 4930 4610 4541 4384 4016 2172 1731 1704 1606 1562 1481 1464 1166 1111 761 290 25132 2428 12453 --
NM_004921chr152316 1822 917 197 41 2996 441 ----
NM_004947chr392380 2072 974 821 710 588 333 124 97 --31857 1002 297 1481
NM_004956chr7104575 3885 3513 2862 1570 1368 1221 1160 939 849 3757 614 318 ----
NM_004985chr1274272 3755 3035 1635 755 648 214 --1351 --
NM_004992chrX128012 7922 7816 7534 7193 6452 2356 2252 1775 1094 705 681 26407 5596 26107 2796 12319
NM_004992chrX128012 7922 7816 7534 7193 6452 2356 2252 1775 1094 705 681 26407 5596 26107 2796 12319
NM_004999chr674022 3083 2936 1356 240 88 77 13066 ----
NM_005014chr92740 701 1804 --1231
NM_005023chr551126 1065 201 152 64 1479 21221 982 --
NM_005036chr22138363 8089 7127 7050 6271 6143 5714 5588 2322 1680 1352 791 672 22926 559 27404 2989 --
NM_005056chr1285518 5451 4984 4806 4741 1771 1108 285 14788 ----
NM_005065chr1444764 1542 1051 363 --13705 11694
NM_005079chr883144 3073 2441 2037 1138 778 690 490 --32712 901 809 --
NM_005116chr20104528 3504 3199 2785 1817 1193 1089 1022 299 136 ------
NM_005121chr1752931 2748 2433 2336 980 12729 11323 1296
NM_005126chr34700 299 173 138 21823 720 12094 --
NM_005156chr974756 4188 4057 3555 3394 764 454 24541 4215 --136
NM_005188chr11138119 7781 6865 5994 5819 5131 3207 2339 2118 1776 1765 1699 34 --37513 1852 1542 --
NM_005190chr661005 878 459 375 45 29 1750 ----
NM_005197chr14136126 5253 4158 3925 3891 3868 2424 1844 1810 1002 741 407 36 36108 787 218 11913 15962
NM_005233chr372458 2261 873 472 368 289 277 --1790 --
NM_005235chr297116 5423 3158 2718 1821 1810 1140 266 204 46522 6364 5573 456 25690 1614 --
NM_005238chr1172681 2441 2378 555 317 304 207 --1495 13132
NM_005313chr154997 352 191 58 21244 502 11341 --
NM_005338chr7103992 3909 3670 3636 3329 3211 1497 1397 571 311 --23769 2858 --
NM_005339chr4113816 3747 3397 3244 2947 2787 2738 1371 1341 1265 262 --11553 11490
NM_005358chr132649 169 ----1454
NM_005359chr1896405 5118 5050 4030 2471 2420 2361 1745 1077 12060 25834 274 12508
NM_005399chr183537 2947 2879 2760 1737 1306 1266 65 1318 ----
NM_005433chr1862044 1996 1972 427 302 73 --12243 --
NM_005436chr1074121 3916 3351 2943 1415 1145 517 --33392 1465 640 --
NM_005476chr931412 895 51 ----11001
NM_005497chr17136034 5787 5081 4414 4282 3852 2392 2205 1943 1902 1715 867 275 --24611 3788 --
NM_005502chr993179 2865 2784 2771 811 430 372 87 43 --32844 2296 744 --
NM_005504chr1266230 5610 4642 1315 744 178 21826 250 26495 4575 --
NM_005566chr111520 ----1458
NM_005578chr3104617 4047 3694 3658 1891 1730 980 934 607 452 11337 1191 --
NM_005596chr955011 3956 1041 564 491 --2911 558 14068
NM_005665chr143231 1970 779 333 33013 1462 297 43494 3425 3206 315 --
NM_005668chr584384 3701 3351 3049 1162 1039 939 394 ------
NM_005746chr751998 1987 1699 626 184 22159 1693 ----
NM_005779chr5103494 3216 3031 2410 2395 1220 962 301 136 85 2679 471 22519 2385 --
NM_005813chr242597 2173 1864 200 21723 524 12568 --
NM_005840chrX77306 6711 5887 5553 1465 1382 1172 36065 5632 5475 26945 1410 --
NM_005898chr1153066 2689 2558 2093 188 22312 928 --12241
NM_005901chr1898712 7910 7226 6777 5431 5349 2962 2010 1310 21604 712 ----
NM_005902chr1594272 4055 4039 3718 3643 3202 3180 2874 1726 11328 14322 --
NM_005903chr574956 4593 1780 1748 1488 1256 784 35187 4847 508 11117 --
NM_005909chr553815 3492 2989 1723 267 12649 13940 --
NM_005955chr165223 4547 4120 2206 2125 1690 11566 44328 4228 1637 175 --
NM_006007chr953928 3042 1482 1433 633 34492 1526 965 13310 --
NM_006011chr1574131 3290 3211 1477 704 383 254 --21732 763 --
NM_006036chr242116 1910 991 225 2948 530 --12561
NM_006038chr2041939 1464 589 111 21481 1470 ----
NM_006080chr752935 1052 556 372 360 1646 12474 --
NM_006089chrX61751 1658 1638 1528 1514 370 1560 11195 --
NM_006095chr474281 3404 2995 2962 1456 806 366 14115 ----
NM_006154chr1572920 2831 1943 1874 874 769 80 1126 22360 2101 --
NM_006203chr595548 5504 5324 3881 3712 1999 1698 638 469 13402 25314 4224 11569
NM_006237chr1342168 1750 1523 404 11681 1413 1527
NM_006241chr352264 2135 1965 951 334 --12152 --
NM_006251chr542370 1129 774 628 22724 1007 12069 --
NM_006252chr1127292 7104 6535 5560 5284 4837 3004 2379 2209 1960 1589 462 47443 7127 6221 1283 1313 --
NM_006256chr172504 837 829 759 627 504 380 1934 --1918
NM_006282chr2074773 4452 3537 3316 1624 1385 537 1908 54206 3990 1554 1513 1249 --
NM_006283chr864913 4543 3596 1784 1179 919 14219 ----
NM_006306chrX165680 5614 5537 5445 5428 5412 5379 5361 4758 4489 4332 3581 2117 1301 1193 622 25314 3793 45861 5646 5555 3817 --
NM_006323chr41770 1589 --1522
NM_006379chr752322 1821 1590 1530 898 ------
NM_006380chr1794324 3928 961 756 726 706 599 332 70 14333 11679 --
NM_006482chr1263195 3150 2999 1059 915 503 12959 ----
NM_006489chr1422003 617 ----11658
NM_006504chr1082914 2811 2526 2331 1880 1182 726 58 ------
NM_006520chrX31089 536 28 ----11342
NM_006526chr2041984 1822 653 346 ----21756 1615
NM_006534chr2063418 2240 1294 932 383 108 --2821 75 --
NM_006544chr1495172 4872 4416 4273 4106 4070 2294 1585 612 1150 22058 626 1798
NM_006546chr1796488 6263 6091 5187 4954 4552 4255 1857 1392 --11244 --
NM_006561chr1065971 5637 3937 3853 1931 604 ----16069
NM_006599chr16127721 6954 6826 6362 6233 5887 5825 3316 2956 2547 2062 325 38257 7518 698 22367 900 --
NM_006628chr1574403 4180 3792 3271 3001 1407 838 13091 ----
NM_006654chr1244318 757 714 496 1388 --11682
NM_006699chr172240 2002 602 477 379 123 50 --2708 21 --
NM_006706chr55842 669 634 102 51 1764 ----
NM_006717chr942631 2220 1315 299 2831 695 136 1618
NM_006720chr1084745 4691 4381 4230 4221 3804 1390 990 ------
NM_006746chrX31405 337 178 2624 506 31121 146 70 --
NM_006750chr16107142 6680 2938 2704 2493 2424 2310 1031 831 782 15616 --1139
NM_006766chr832381 916 711 1922 22720 2135 --
NM_006777chrX72907 2507 2078 2058 1799 1035 563 12816 ----
NM_006827chr1463417 3306 3055 2767 1117 408 ----1874
NM_006873chr273449 3360 3212 3148 2882 2722 410 13553 ----
NM_006895chr221698 52 11538 11530 1167
NM_006908chr751183 1133 330 167 156 ----11521
NM_006924chr1724352 428 32980 2814 1469 12757 --
NM_006948chr211806 32093 301 271 --1430
NM_006963chr105892 860 493 331 298 11219 ----
NM_006965chr1851019 432 422 281 25 11115 ----
NM_007006chr165909 740 605 557 166 22394 464 --13162
NM_007010chr172663 156 ----11161
NM_007011chr1596336 4298 2393 2121 1778 1638 1507 1008 573 15196 11518 --
NM_007038chr2185914 5741 4421 4143 4105 1631 620 347 15553 14696 --
NM_007039chr1441960 1441 496 341 1569 22290 2022 --
NM_007043chr12102059 1983 1972 1946 1767 1559 1370 847 537 224 21346 786 129 --
NM_007050chr20137496 7344 4994 4912 3149 2440 2208 1755 1296 1240 775 603 519 47576 7298 7237 5968 11949 --
NM_007064chr361703 1602 1223 1127 421 47 11084 1591 --
NM_007124chr641967 1589 1363 357 4702 514 499 198 ----
NM_007137chrX165401 5186 4774 3411 2192 2183 1744 1679 1638 1523 1416 1234 1065 976 953 845 163 --25263 1086
NM_007153chr1984022 3647 3229 2926 1768 1508 414 189 --13196 --
NM_007173chr1132217 2099 801 31643 893 612 ----
NM_007175chr863424 3279 2525 2277 237 61 13133 ----
NM_007203chr993672 3022 2756 2630 2582 1223 986 821 203 32536 802 497 ----
NM_007249chr13159447 7692 7042 6911 6815 6404 5875 3702 2539 2413 2306 2220 1367 1303 878 29435 7928 55815 5789 3078 1921 194 --
NM_007270chr741471 494 336 267 ----21130 351
NM_007282chr34924 868 806 367 ------
NM_007287chr363050 2925 2201 842 784 212 1900 ----
NM_007288chr363050 2925 2201 842 784 212 1900 ----
NM_007289chr363050 2925 2201 842 784 212 1900 ----
NM_007292chr17135178 4826 4587 3895 1940 1790 1402 1243 1122 906 808 583 214 1993 1642 --
NM_007347chr1563059 2511 1254 1044 866 504 --21002 713 --
NM_007373chr1041727 1536 1274 1140 ----1145
NM_007375chr152809 2736 758 363 351 ------
NM_012089chr141382 1225 1088 511 190 1608 --
NM_012096chr383584 3562 3199 3052 2528 1031 342 75 ----23400 2831
NM_012120chr622217 648 22687 413 11111 --
NM_012124chr11--2846 276 --1230
NM_012141chr1334002 3019 567 13629 ----
NM_012156chr2083092 2994 2590 2365 2147 2129 2120 554 1334 23458 52 --
NM_012164chr9207506 7062 6967 6450 5550 5254 3030 2619 2557 2539 2489 2128 2122 1920 1507 1203 1083 476 129 88 15248 ----
NM_012192chr1172209 2158 771 565 559 394 142 11768 1603 1894
NM_012193chr1164867 4306 4206 3737 1582 1092 11399 54772 3872 3418 2081 1060 --
NM_012214chr276417 5810 5115 5020 2201 1756 1340 15175 14399 --
NM_012234chr373224 3115 2811 2296 235 33 27 1475 ----
NM_012249chr273376 3252 3026 2360 2310 1027 833 21120 336 21328 1273 --
NM_012250chr111293 --1495 1365
NM_012252chr7134385 4147 4107 3636 3416 1939 1713 1180 1066 846 744 427 330 1169 ----
NM_012262chr1115073 4362 3595 1922 1565 1049 988 609 359 118 32 1507 ----
NM_012281chr771850 1731 887 827 775 470 391 32039 1710 549 ----
NM_012297chr441000 676 661 251 1240 12239 --
NM_012300chr541627 865 696 45 22232 2206 --1624
NM_012316chr1145161 4838 4804 4502 4029 4006 3944 3921 3786 2266 2081 1348 1335 613 --1187 --
NM_012382chr564242 3490 3302 2918 2891 2869 --33275 2898 1182 12991
NM_012395chr743291 1231 358 231 12348 1100 1902
NM_012397chr1841709 1577 330 169 ----11146
NM_012479chr742543 1815 1690 629 1613 22690 2618 --
NM_013229chr1252404 1918 1019 852 411 22243 936 --12068
NM_013231chr1472896 2881 1763 1149 830 761 612 1815 --14250
NM_013261chr463496 2755 2716 733 658 415 --13622 --
NM_013269chr1274171 3934 3879 1121 578 381 293 33419 1803 153 1560 --
NM_013302chr1684433 4282 3461 3414 1784 1774 572 253 ----11409
NM_013341chr21588 21993 765 22377 1825 1262
NM_013386chr151379 1187 1171 456 329 1189 1442 --
NM_013989chr1474358 3750 1841 1826 1619 1373 543 32039 1675 196 1982 --
NM_014034chr62350 176 31471 1206 496 2301 53 --
NM_014048chr1675097 4644 4393 1298 959 892 475 13496 ----
NM_014112chr875073 4135 3391 1660 1203 830 253 25094 3383 24087 405 --
NM_014141chr7124491 4128 4115 3781 3716 3370 3287 1888 1769 883 775 692 --14169 --
NM_014155chr1187201 6229 5568 4664 2703 2295 499 265 22043 1645 22535 905 17123
NM_014294chr841410 1142 295 232 ----11449
NM_014309chr2285093 4266 3960 3810 1313 982 830 628 25233 1194 14949 15209
NM_014331chr477791 7780 7390 7028 5253 1571 153 37381 5012 953 --15347
NM_014372chr152010 1935 1408 78 33 --12074 --
NM_014388chr1115873 5821 5722 5199 5176 4642 4400 2424 2381 1688 1424 --1829 --
NM_014423chr595196 4817 4660 4375 3603 1485 1281 1211 876 25615 853 ----
NM_014521chr271727 1676 1614 1592 1149 654 529 --11415 1317
NM_014586chr2153365 3192 1334 1219 555 --11573 14253
NM_014612chr921309 556 ----1318
NM_014613chr592575 2501 1134 1115 1057 1048 926 604 175 ------
NM_014616chr373314 2993 2796 2676 701 584 27 2931 662 1574 --
NM_014674chr363945 2789 886 655 57 31 1977 11081 12845
NM_014721chr6137127 5708 5546 4935 4719 4683 2890 2863 2420 2044 1639 1254 948 31912 1396 916 25087 1714 --
NM_014732chr1684726 4496 2258 1698 1118 372 135 115 --35587 4311 4293 11595
NM_014737chr2083646 3576 3216 1076 639 391 126 38 ----14175
NM_014746chr273395 3081 2742 1655 1197 1104 541 11069 --14290
NM_014774chr173262 2688 2181 959 751 642 177 32460 2098 1027 ----
NM_014781chr83814 499 257 11021 1460 1315
NM_014787chr181896 1829 1087 921 548 241 118 83 ------
NM_014803chr1012399 32930 2345 2106 1810 12178
NM_014810chr173266 2456 2252 1294 799 714 533 --1816 --
NM_014812chr16688 620 429 318 181 26 11531 11583 --
NM_014850chr394529 4150 3850 3788 3337 1802 1122 1068 177 11038 --13766
NM_014873chr184189 4110 4103 3809 3770 1598 1484 284 23790 277 11108 --
NM_014877chr17107433 7045 6732 6185 5775 5453 5373 2586 1203 826 1302 25011 2655 --
NM_014897chr1762829 2743 698 217 209 136 12915 ----
NM_014904chr1064024 3577 2740 1573 1100 192 ------
NM_014920chr653495 3254 2651 2605 133 13384 --11394
NM_014923chr1312142 1755 --1812
NM_014924chr1462457 2146 969 713 497 410 12849 --12793
NM_014932chr331676 351 22 1435 1313 --
NM_014936chr652293 618 241 213 79 2943 192 12245 --
NM_014946chr292740 2367 2259 1911 1896 991 924 868 148 22202 293 22977 2427 --
NM_014947chr173049 2828 2410 2358 1998 1982 1195 --1905 --
NM_014982chr14104799 4674 4650 4517 3357 1940 1460 1434 813 337 33994 3838 1553 25029 2120 --
NM_014991chr452749 2457 511 414 27 12267 22162 1099 --
NM_015020chr16123873 3786 3536 3450 3252 3176 2987 2405 925 838 452 206 1426 22523 469 --
NM_015035chr20105647 5459 4437 2369 2168 1791 1743 1433 307 64 --1766 1774
NM_015039chr183636 3205 3026 1479 1247 1093 933 896 --22876 154 11600
NM_015040chr263152 3071 3015 2580 802 59 23251 2775 --12365
NM_015045chr1051836 1711 559 370 202 1677 21574 651 --
NM_015049chr273063 3005 2836 2466 2324 2193 585 ------
NM_015051chr973400 2944 2831 2825 2236 821 765 --12819 13011
NM_015064chr1282963 2547 2437 781 422 408 314 25 --23298 682 --
NM_015071chr5135745 5684 5603 5248 5051 4906 4780 4228 4023 3984 2546 2516 2244 11208 15357 14406
NM_015076chr663074 3019 1561 1279 90 74 13752 2968 694 --
NM_015093chr621839 436 21668 1271 1447 --
NM_015097chr382357 1913 1904 720 680 616 508 22 ------
NM_015115chr452484 2241 1176 619 378 32080 670 61 ----
NM_015137chr862568 2296 1984 1794 1010 675 ------
NM_015147chr283234 3152 2796 1278 1131 917 906 322 --22746 90 --
NM_015149chr171897 1593 1377 833 818 716 446 11386 1696 --
NM_015156chr1494042 3931 3334 2886 1331 1308 871 277 80 ------
NM_015199chr362869 2636 2521 635 442 118 --1682 --
NM_015206chr1583264 3171 2988 2967 960 780 457 108 13111 12501 --
NM_015230chr421610 372 21399 1237 --180
NM_015247chr1674804 4108 2050 993 759 392 377 11081 --11124
NM_015267chr1282139 1982 1897 1822 756 545 498 101 11593 ----
NM_015271chr464328 4135 3698 3075 2983 72 --2248 108 1947
NM_015291chr143541 2985 2321 1101 12679 22628 125 1855
NM_015299chr14103662 3027 2703 2477 1469 1211 1187 1168 1032 671 --13766 --
NM_015310chr8237799 7058 6852 6544 6383 6243 6205 6044 6019 5987 5936 5920 5788 5487 5417 3170 2815 2425 2069 1636 1577 1486 501 12915 ----
NM_015313chr1164305 3956 3745 3674 1059 120 --23718 1076 --
NM_015314chr762055 898 645 615 602 168 ------
NM_015317chr282731 2097 912 733 555 117 85 36 ------
NM_015328chr772997 2853 2576 2301 2229 2213 488 11995 ----
NM_015349chr663083 2620 1237 902 556 61 33027 2962 369 22597 849 --
NM_015358chr2111014 1111 --11032
NM_015359chr861829 1022 922 610 367 318 22250 2131 ----
NM_015455chr543194 1283 757 504 13612 ----
NM_015458chr8125202 5158 4592 4465 3986 3589 1889 1345 1320 812 515 180 34616 3328 424 14579 --
NM_015525chr61762 1145 --1293
NM_015535chr273936 2627 1433 1400 1159 978 131 13985 24069 2780 --
NM_015564chr5123608 3013 2935 2926 2728 2495 2242 1162 1075 996 413 192 1171 11139 12443
NM_015569chr163949 1785 1550 1285 79 66 23018 386 ----
NM_015571chr642254 1730 718 478 ----11697
NM_015575chr273508 3222 3005 2386 2336 432 118 --1837 --
NM_015602chr151442 1126 148 95 24 --1185 --
NM_015640chr145222 4193 4159 3670 1521 11775 13379
NM_015713chr883541 2921 2847 2481 2375 1344 806 774 --21162 1098 --
NM_015852chr722333 84 43512 1372 862 386 ----
NM_015879chr18168635 8530 7445 7282 7269 6892 6162 5850 5819 3318 3283 2526 1384 1275 1052 962 27498 1365 36574 2706 1176 --
NM_015888chr132288 1143 190 23185 2459 22569 455 11151
NM_015906chr184089 3266 2958 1703 1593 1315 990 772 14622 1524 --
NM_016009chr1144701 4522 4501 4188 4174 4097 3803 3582 3548 1848 1184 1044 511 120 13968 ----
NM_016132chr1563206 2440 1097 809 684 253 23001 869 ----
NM_016206chr398829 8504 8250 7668 5549 3213 948 906 339 18943 17765 12885
NM_016255chr662689 2620 2238 2069 814 622 1821 ----
NM_016260chr2107074 6274 6168 2979 2385 2075 1945 1705 1597 1231 --12966 --
NM_016297chr2103583 3208 3194 2341 1367 1309 947 300 266 88 22918 391 23693 3418 --
NM_016322chr942376 1158 783 678 ----12132
NM_016442chr552132 1968 1637 683 649 11776 ----
NM_016485chr641856 1391 610 44 ----12057
NM_016513chr653495 3254 2651 2605 133 13384 --11394
NM_016530chr1583932 3893 2963 1641 1367 1199 649 84 --1518 --
NM_016531chr463929 3767 3479 3297 2829 894 34009 3422 867 1853 12997
NM_016577chr3123996 3889 3659 3626 1790 1538 1428 1058 996 284 206 87 --44171 3218 1274 417 --
NM_016613chr451901 1843 1111 1071 670 32746 528 365 --1621
NM_016824chr1031841 1584 1540 2612 378 21788 1705 --
NM_017420chr1453361 2597 1324 1245 375 13148 1272 --
NM_017423chr441844 1688 1483 84 11746 ----
NM_017628chr4105276 5230 4949 4786 4379 3980 1832 1697 1516 1296 1289 ----
NM_017633chr673877 3743 1571 1237 727 440 33 --23394 2912 11323
NM_017637chr9159190 9123 8856 8285 7311 6912 6823 6681 5733 3653 2559 1792 1130 880 856 23249 2358 15856 --
NM_017644chr365189 4275 4267 3933 1435 1187 21799 161 1579 --
NM_017645chr962763 1049 875 395 254 25 1700 --1429
NM_017650chr765420 4784 4457 2353 777 315 14904 11127 --
NM_017658chr1473471 3182 1806 1796 1663 1091 371 23666 1817 ----
NM_017737chr112076 21700 184 --11581
NM_017754chr685042 4966 4694 4135 1894 1302 587 408 35075 4128 1444 ----
NM_017761chr171248 1052 597 302 254 116 92 1989 ----
NM_017770chr6112958 2678 2658 2469 2333 1888 1098 904 726 455 120 ------
NM_017779chr142065 2026 1952 1087 3684 318 55 1872 --
NM_017824chr1062713 2082 1971 385 167 155 12140 1235 --
NM_017831chr1873983 3278 3233 3162 1010 732 29 13907 14792 --
NM_017847chr172018 1917 1603 1502 1479 321 250 11610 ----
NM_017848chrX103941 3653 3271 3225 1832 1586 1223 794 679 644 ----23091 2832
NM_017915chr1241074 849 353 43 --11186 1935
NM_017919chr9105293 5075 4858 4452 4068 3969 3690 3572 2227 1389 1528 15534 --
NM_017925chr941669 1556 1454 1395 1775 --1306
NM_017944chr1163140 2645 2512 2493 785 529 --22594 184 --
NM_017988chr124721 644 624 44 1899 ----
NM_018030chr18--1859 --1339
NM_018036chr1463190 2978 1139 925 377 42 --11508 --
NM_018046chr571280 715 528 314 189 157 79 1293 197 --
NM_018084chr242476 431 306 197 1107 22385 115 --
NM_018085chr1158013 7942 7089 6753 6625 6327 6158 5784 2869 2825 1465 1398 1157 472 49 47644 6032 2793 758 ----
NM_018155chr352787 2643 351 321 115 22375 1142 22689 57 --
NM_018184chr362120 1763 704 291 243 176 --21939 1713 --
NM_018225chr975098 4709 4596 3840 1718 1007 672 13427 --1355
NM_018227chr492619 2406 2302 2209 1960 1268 747 359 31 33236 3016 1217 11075 --
NM_018243chr493487 2799 2513 1167 1049 687 393 376 131 11586 1936 --
NM_018247chr642680 2361 737 24 22301 458 22903 2226 --
NM_018293chr352390 1018 1004 497 401 22572 1061 12918 --
NM_018313chr342192 1016 314 57 12241 22126 1766 --
NM_018318chr126851 752 695 685 257 102 2394 41 1153 --
NM_018351chr1284598 1683 1331 1210 1149 480 309 282 11256 ----
NM_018364chr153332 2521 1564 911 838 ------
NM_018374chr7104889 4851 4610 4214 3556 3377 1975 1719 1646 541 24896 1477 ----
NM_018403chr3123656 3547 3356 3213 2975 2941 2793 1397 897 882 874 496 11424 ----
NM_018409chr483252 2572 1139 1083 911 899 378 267 23040 250 ----
NM_018429chr562807 2474 2342 2222 572 502 --12574 --
NM_018440chr8198253 7175 7059 7041 6950 6744 6486 6333 6127 5904 2529 2420 2238 2059 1629 1351 920 543 345 17571 37354 6982 5712 12586
NM_018448chr1241286 504 412 349 267 38 124 --
NM_018490chr1121665 1600 21725 1485 --1558
NM_018566chr164616 4397 3690 3591 1307 1215 11861 1111 --
NM_018638chr1264563 4311 3951 3787 2025 1776 11729 22050 473 15197
NM_018650chr122080 1888 ----1177
NM_018689chr1582429 2416 2267 2039 1917 1724 753 489 12095 --1302
NM_018698chrX41921 1638 731 187 11570 ----
NM_018841chr183977 3673 2978 2872 2729 1532 668 227 23796 1443 ----
NM_018890chr751183 1133 330 167 156 ----11521
NM_018898chr562208 1590 1493 726 556 460 --22135 1692 --
NM_018899chr562208 1590 1493 726 556 460 --22135 1692 --
NM_018900chr562208 1590 1493 726 556 460 --22135 1692 --
NM_018901chr562208 1590 1493 726 556 460 --22135 1692 --
NM_018902chr562208 1590 1493 726 556 460 --22135 1692 --
NM_018903chr562208 1590 1493 726 556 460 --22135 1692 --
NM_018904chr562208 1590 1493 726 556 460 --22135 1692 --
NM_018905chr562208 1590 1493 726 556 460 --22135 1692 --
NM_018906chr562208 1590 1493 726 556 460 --22135 1692 --
NM_018907chr562208 1590 1493 726 556 460 --22135 1692 --
NM_018908chr562208 1590 1493 726 556 460 --22135 1692 --
NM_018909chr562208 1590 1493 726 556 460 --22135 1692 --
NM_018910chr562208 1590 1493 726 556 460 --22135 1692 --
NM_018911chr562208 1590 1493 726 556 460 --22135 1692 --
NM_018945chr683682 3643 3498 3188 2856 1355 1209 181 11142 13134 --
NM_018970chr762547 2106 1984 1950 227 101 22586 72 ----
NM_018999chr10104680 3837 3557 1757 1607 984 736 639 356 82 --1398 --
NM_019001chr384572 4055 3985 3861 3732 1257 723 319 --23105 349 1671
NM_019027chr432388 2105 1849 22465 394 1430 --
NM_019041chr642149 502 446 436 2642 180 ----
NM_019072chr5104274 4153 4026 3950 3554 3415 2893 863 539 235 13783 --23592 3148
NM_019080chr1351462 1286 584 408 165 1260 ----
NM_019590chr101358 ----11120
NM_019610chr192054 2031 1652 1598 1469 694 634 63 22 --1381 --
NM_019903chr1031841 1584 1540 2612 378 21788 1705 --
NM_020116chr43608 286 241 1534 --11720
NM_020122chr285633 5167 4778 1878 1364 533 160 66 1923 11106 --
NM_020133chr696153 5929 5751 5698 5073 4006 3998 1220 980 --26310 4170 --
NM_020177chr553152 2601 2574 432 305 23352 3010 ----
NM_020297chr1233021 2793 2701 33495 3178 639 13391 --
NM_020336chr2063360 3327 2442 1388 1003 910 23614 240 --145
NM_020337chr453064 2519 1935 839 544 11125 ----
NM_020338chr10113507 3471 2874 2785 2524 2362 1494 993 742 287 109 --12465 12676
NM_020341chr2072028 1877 1468 1428 754 580 499 ------
NM_020342chr271866 971 863 513 354 343 238 1280 12526 --
NM_020390chr3103695 3586 1617 1228 1203 863 538 494 299 40 --24695 1351 11461
NM_020443chr1136901 6822 6231 6017 5503 4933 4511 2625 1888 1739 1560 1226 631 ------
NM_020455chr662727 2307 1931 560 402 21 1413 --1726
NM_020466chr675031 3646 3595 3169 805 491 263 --11607 13393
NM_020474chr1861714 1362 465 265 174 133 1513 2549 478 --
NM_020640chr32854 685 11656 1263 1156
NM_020673chr2096385 6267 5499 5319 4844 2944 1870 1854 139 37547 1731 1144 ----
NM_020686chr1692877 2758 2492 2225 2050 1978 826 612 203 23070 2952 21043 892 --
NM_020711chr242597 2100 2023 1880 --21998 1809 --
NM_020717chrX154764 4506 4140 3911 3659 3629 3200 1355 1320 1284 585 429 286 234 39 ------
NM_020727chr2153666 1621 1169 407 305 1908 ----
NM_020766chrX54448 4144 3128 1102 1014 --14418 13826
NM_020772chr1797850 7442 7326 6133 5832 5227 1694 211 117 28599 1135 26612 46 1107
NM_020774chr1855970 3834 1753 1273 657 26258 4095 ----
NM_020776chr1873087 2924 2712 575 550 287 149 --11023 12724
NM_020782chr1284414 3917 3908 3017 1775 1632 1536 153 11191 11341 14838
NM_020792chr362273 2171 2125 1845 1770 475 1256 12790 --
NM_020802chr1172343 1319 1242 1210 1169 978 660 181 ----
NM_020809chr1182326 1975 1921 1620 919 628 578 403 --1567 --
NM_020810chr1482705 2407 2393 1265 1244 1088 372 158 --1725 --
NM_020841chr12103732 3580 3542 3309 3033 1502 509 55 29 21 13225 11580 23254 2832
NM_020844chr8106326 5764 4987 2878 2335 2286 1389 1174 1110 38 26786 5795 56235 6102 5312 889 477 --
NM_020886chr1131327 377 129 21197 187 11300 --
NM_020921chr1493586 3512 3305 2783 2628 1192 972 933 836 11010 --1768
NM_020935chr2124443 4191 3941 2908 2817 1787 1691 1565 1429 1117 1042 352 23335 1328 ----
NM_020940chr1062599 2476 2124 672 515 35 --1133 --
NM_021032chr341737 549 519 177 --1583 11759
NM_021033chr1363397 2884 1092 891 606 311 1334 ----
NM_021038chr352784 2075 725 366 23 22965 81 --12860
NM_021061chr894045 3851 3573 3353 2989 1758 1077 294 50 3401 266 232 21765 319 --
NM_021072chr552036 1939 461 397 249 22619 2262 ----
NM_021090chr22114794 4672 4111 3262 3112 1011 984 551 431 372 109 ----11906
NM_021097chr282829 2455 2151 2046 631 451 414 159 12237 ----
NM_021116chr7178592 8424 8278 6981 6832 5721 3455 3107 2915 2483 1014 741 685 506 375 110 85 27397 3371 58145 7642 5803 3487 3225 --
NM_021163chr743254 3039 2692 2489 33605 814 365 23789 3171 1294
NM_021165chr14816 579 325 300 --1335 --
NM_021191chr1272368 2309 954 892 804 379 232 21925 1692 --2757 744
NM_021255chr1474118 4090 3512 3446 3093 1377 1072 2337 230 ----
NM_021647chr464722 4518 3229 1527 1519 1353 ----11000
NM_021813chr6105732 5305 4922 4219 3818 3812 1819 1665 1440 587 12049 35233 5076 4479 --
NM_021911chr575622 5156 3892 2141 944 612 555 13938 13642 11251
NM_021954chr1363046 2835 2815 2627 1181 1089 12270 ----
NM_021956chr661556 1547 1302 403 224 132 ----11327
NM_021960chr142729 2002 1801 919 --1447 12132
NM_021964chr376047 6017 5842 5310 5149 1757 1007 16067 ----
NM_022037chr22286 141 ----1782
NM_022048chr15105128 4668 4549 4401 3871 1861 1207 1105 1096 865 --25454 5308 24271 1910
NM_022114chr184601 4313 4161 3840 3795 1542 1535 287 21651 453 1740 --
NM_022166chr16146066 5861 5594 5155 4509 4263 2225 1424 1402 1104 926 920 879 548 --26033 711 --
NM_022173chr22286 141 ----1782
NM_022351chr853648 3390 1245 1130 986 32938 2908 1164 33013 2992 1002 --
NM_022456chr1297471 7353 7017 6806 6766 2709 2484 1476 794 45912 2027 2014 1896 26605 2953 --
NM_022459chr1395531 4863 4748 2253 1488 1222 1154 883 558 22036 806 ----
NM_022473chr1543962 3171 1662 939 23285 333 142 22975 227
NM_022716chr152744 2566 1219 767 126 32503 362 46 22983 141 --
NM_022726chr631525 1076 246 ----11286
NM_022745chr142750 2337 2050 697 42817 2627 1969 634 --12986
NM_022763chr333053 523 411 22607 1973 ----
NM_023000chr1431552 1324 1259 ----11070
NM_023001chr1431552 1324 1259 ----11070
NM_023923chr193819 3346 2873 2739 2468 929 419 276 24 13667 ----
NM_023929chr842172 648 282 198 1947 ----
NM_024090chr43582 455 78 2611 25 --11433
NM_024345chr9135654 5558 5452 5084 4562 4373 3772 2311 1733 1359 1006 962 919 24643 2215 24932 1959 --
NM_024525chr12174 140 --2592 477 1163
NM_024569chr162905 2862 2731 1176 1024 272 12053 12359 11148
NM_024646chr183930 3344 3327 2959 2661 2423 1207 28 12597 ----
NM_024665chr384704 3852 3737 3525 3472 2936 524 364 1935 24555 96 --
NM_024674chr1103179 2512 2385 2367 2069 907 882 395 240 187 ------
NM_024692chr241748 413 160 125 186 31399 183 173 --
NM_024713chr1571167 637 615 393 379 299 115 ------
NM_024740chr11133674 3648 3558 3536 3366 3210 3166 1315 616 405 322 43 31 1691 ----
NM_024749chr141947 909 154 84 21878 257 21841 653 --
NM_024761chr9105376 4852 4817 4533 3976 3916 3280 1784 234 73 24441 1480 11524 --
NM_024770chr2126149 5475 5226 4182 4085 2521 2454 2107 1705 1393 989 243 --34695 4249 2561 --
NM_024854chr1241488 1409 1367 509 --1346 125
NM_024884chr14103105 3088 2959 2889 2851 2828 2787 1260 242 233 13035 11207 --
NM_024947chr3169422 8748 8334 7932 7759 7583 6922 6860 6812 6560 6041 2593 2356 2050 1984 1181 23737 1023 37885 3401 1355 17038
NM_024949chr454489 4089 1864 1372 979 33696 1330 213 24060 3230 --
NM_024989chr2117767 7444 6471 5854 5643 5471 5215 2655 2459 1988 212 22067 1893 16933 16344
NM_025054chr852715 920 666 454 402 12555 --13643
NM_025073chr184306 4220 4142 1562 1550 1330 462 268 --23759 881 --
NM_025160chr134301 4266 1062 23776 3622 2578 126 --
NM_025181chr24659 300 292 250 ----140
NM_025191chr183452 2641 1378 949 908 868 688 296 12595 21126 1011 --
NM_025235chr1071914 1856 1575 735 329 92 42 ------
NM_030579chr16103716 3536 3380 3305 2809 2604 2345 2273 966 122 --11495 --
NM_030621chr1464163 3883 3820 2840 611 188 11462 ----
NM_030623chr231699 658 365 31414 1285 329 --1115
NM_030625chr1082473 1756 924 767 712 566 481 275 --12334 --
NM_030627chr563531 3072 2676 1648 1228 398 1122 ----
NM_030647chr765421 2416 1815 602 179 21 15578 15245 --
NM_030648chr4115369 5362 4475 4412 4012 3782 3525 3448 1217 1205 873 14023 ----
NM_030674chr12115901 4768 4609 3935 3846 1755 1704 1228 555 521 265 21932 241 25514 987 11878
NM_030791chr1451520 1315 616 423 363 --21484 481 --
NM_030806chr187315 7287 6954 6618 6160 2257 1009 709 36645 6131 2460 19149 --
NM_030816chr1103395 3213 3189 3049 2348 1148 593 581 547 494 11448 1380 13637
NM_030918chr1135130 4241 3578 3543 3392 3336 2159 2111 894 580 406 276 28 --11152 --
NM_031268chr1674709 3853 3613 3515 3465 2130 96 25298 5235 1361 --
NM_031296chr4102550 2085 2050 1994 1895 1834 739 610 297 289 21866 91 ----
NM_031411chr562208 1590 1493 726 556 460 --22135 1692 --
NM_031427chr14135820 5400 5293 5115 5032 4867 4728 4650 3941 3649 2062 1484 506 24987 4933 21717 1378 11954
NM_031453chr1062590 2314 1724 826 307 258 --22629 1980 --
NM_031461chr852200 2173 820 370 100 ----126
NM_031468chr7127654 6938 6506 5499 3043 2170 2022 1534 983 553 330 276 11796 1125 --
NM_031844chr193580 3429 2725 1595 1575 1427 950 829 614 22932 529 13081 --
NM_031849chr562208 1590 1493 726 556 460 --22135 1692 --
NM_031857chr562208 1590 1493 726 556 460 --22135 1692 --
NM_031860chr562208 1590 1493 726 556 460 --22135 1692 --
NM_032042chr582755 2712 2320 2226 2126 1810 629 397 ------
NM_032160chr1844003 3891 920 65 ----1555
NM_032199chr1043754 2802 2673 1150 13760 13306 11040
NM_032208chr253145 1024 318 230 149 13341 1850 12992
NM_032221chr2041646 1587 1476 439 1255 1140 --
NM_032373chr1065614 5089 2338 1052 710 485 24234 1807 21087 205 --
NM_032446chr583282 3199 2877 1525 1068 935 436 129 23408 3161 --1235
NM_032457chr493844 3804 3717 3414 3305 2836 2380 905 194 23152 3068 ----
NM_032458chrX63142 3049 2492 2452 2201 2161 1192 ----
NM_032505chr362641 2513 1845 302 292 242 --12225 --
NM_032509chr852388 2011 1870 1736 1642 12621 12219 --
NM_032521chr2073120 2888 2353 1182 1145 759 260 --1287 1623
NM_032582chr1751813 1788 1473 275 174 1346 ----
NM_032826chr7105081 4959 4907 4208 3945 3897 1985 1432 938 108 --11133 --
NM_032859chr1343905 2749 850 389 13820 13639 --
NM_032866chr1593022 2921 2548 1991 812 798 391 226 219 --12802 --
NM_032873chr11124172 3424 3268 2905 1812 1726 1284 1199 1087 844 808 455 31029 985 763 ----
NM_032968chrX94144 3843 3674 3664 2838 1283 746 349 102 11060 ----
NM_032969chrX94144 3843 3674 3664 2838 1283 746 349 102 11060 ----
NM_032973chrY73835 3666 3656 1283 746 349 102 ------
NM_032975chr1883602 3338 3285 3128 2496 697 575 152 33215 2283 778 1898 --
NM_032980chr1883602 3338 3285 3128 2496 697 575 152 33215 2283 778 1898 --
NM_033020chr184089 3266 2958 1703 1593 1315 990 772 14622 1524 --
NM_033143chr483741 3706 3459 3115 1856 1696 830 359 1940 ----
NM_033224chr7147790 5301 2711 2435 2363 2280 1951 987 967 679 630 613 580 371 27229 1044 16878 --
NM_033331chr973618 3384 3015 2947 1240 487 329 23423 809 ----
NM_033360chr1274393 3876 3156 1756 876 769 335 --1472 --
NM_033425chr11133522 3501 3363 2602 2578 2542 1358 1220 1046 914 544 205 71 --21109 744 --
NM_033429chr1562861 2768 2707 2486 322 168 22358 125 1457 --
NM_033505chr2126307 6292 6211 5205 4541 1920 1721 1497 1390 1374 201 73 11165 25749 4570 --
NM_033644chr541627 865 696 45 22232 2206 --1624
NM_033645chr541627 865 696 45 22232 2206 --1624
NM_033656chr21105545 5529 5416 5267 4645 4555 720 479 464 143 25938 4665 22087 1755 --
NM_052832chr853048 2918 2603 2096 378 11918 ----
NM_052885chr1264116 4029 3009 970 319 159 13104 --11458
NM_052918chr1053394 3155 2446 986 162 23719 3489 12903 --
NM_052938chr151189 1078 229 190 32 ------
NM_053016chr9127555 7417 6688 6529 6470 6410 2927 2906 2445 2388 2334 251 37685 5292 943 27386 5950 --
NM_053042chr492923 2754 2709 2471 2324 1142 1032 954 782 ------
NM_053043chr734597 2553 2374 ----16393
NM_057175chr44784 719 679 506 21982 485 12190 139
NM_080597chr18--1859 --1339
NM_080743chr652399 2180 1767 384 286 32290 1587 788 1227 --
NM_080867chr1494520 3843 3456 3449 3429 3105 1335 767 661 --14832 --
NM_130391chr972721 2667 2305 853 700 303 169 --12749 169
NM_130392chr972721 2667 2305 853 700 303 169 --12749 169
NM_130393chr972721 2667 2305 853 700 303 169 --12749 169
NM_130435chr1082914 2811 2526 2331 1880 1182 726 58 ------
NM_133170chr20137496 7344 4994 4912 3149 2440 2208 1755 1296 1240 775 603 519 47576 7298 7237 5968 11949 --
NM_133334chr465337 4581 2102 931 640 77 --52324 2072 1915 1850 610 15144
NM_133367chr663478 2942 2573 2129 1194 766 22831 557 1275 --
NM_133445chr963567 3519 2532 1034 570 81 12645 1582 --
NM_133468chr762162 728 701 655 247 62 --12365 1176
NM_133478chr262156 2090 1980 1585 723 617 1489 21893 1029 --
NM_133493chr684648 4543 4015 3314 1792 936 854 605 --34242 3928 3392 --
NM_133496chr163450 3184 956 577 538 35 1584 14225 13577
NM_133631chr371446 1155 1012 642 555 235 40 11599 ----
NM_133646chr253979 2109 1387 357 220 11523 1626 --
NM_138270chrX43374 2606 1071 65 32385 326 37 21381 980 --
NM_138286chr1963491 2982 1500 769 405 190 33968 3061 1585 14351 14186
NM_138288chr1482161 1819 1625 1507 502 361 150 67 --11880 --
NM_138444chr1384835 4680 4510 4407 4274 4015 3723 220 23536 1709 24934 3398 13577
NM_138459chr653405 2722 1309 969 50 43616 3220 2420 1379 ----
NM_138473chr1283814 3422 2053 1492 1081 487 350 129 11614 195 --
NM_138694chr673281 3094 3078 2975 2623 797 578 43587 3442 3404 2358 ----
NM_138713chr16127721 6954 6826 6362 6233 5887 5825 3316 2956 2547 2062 325 38257 7518 698 22367 900 --
NM_138714chr16127721 6954 6826 6362 6233 5887 5825 3316 2956 2547 2062 325 38257 7518 698 22367 900 --
NM_138731chr1463408 2599 1449 811 366 259 1210 14068 11385
NM_138959chr1156608 6237 6123 5996 5751 5059 4526 1776 1757 1504 1134 1044 973 240 144 15112 21814 1349 --
NM_139182chr421610 372 21399 1237 --180
NM_139321chr2084164 4058 3923 3720 2999 2987 290 278 --156 --
NM_144571chr4126578 6264 5881 4939 4434 2505 2325 2031 667 532 359 187 36095 979 393 15346 --
NM_144578chr1475556 3377 1909 1675 1090 296 209 12218 ----
NM_144599chr1595294 5266 4496 3951 1749 1619 1514 1074 1051 --34749 4730 1596 --
NM_144778chr1342553 2373 2111 2014 32613 1882 336 1661 --
NM_144973chr1254722 1430 1047 912 452 12097 15112 34955 3672 3535
NM_145055chr1863836 3627 3554 3537 2437 1043 12539 ----
NM_145117chr1183103 2418 1266 986 962 804 606 89 12134 11139 --
NM_145176chr652880 1318 1189 461 62 1599 --2743 592
NM_145244chr421111 48 ----1418
NM_145259chr286542 6527 6485 6231 5322 2558 627 330 11896 --2895 866
NM_145307chr1054053 3983 3481 3463 1329 23316 1020 1984 1372
NM_145808chr752366 2305 2094 1156 722 22965 834 1194 1828
NM_145893chr1651851 1228 1211 659 107 21172 136 141 --
NM_147150chr993672 3022 2756 2630 2582 1223 986 821 203 32536 802 497 ----
NM_147223chr292147 1903 1857 1778 519 447 284 129 89 12003 ----
NM_148955chr15106486 6343 4501 4242 4057 2133 1903 937 445 157 --14862 --
NM_152261chr1241625 1569 591 553 22162 450 1654 --
NM_152263chr1125953 5836 5338 5238 5125 4914 4333 4090 2418 830 541 473 --13975 --
NM_152277chr572111 2069 1664 812 281 256 193 2565 413 ----
NM_152300chr172663 156 ----11161
NM_152332chr1432461 1840 507 52806 2433 1006 907 292 1498 --
NM_152388chr273698 3680 1371 1357 1035 288 227 1322 --22647 925
NM_152409chr593523 1382 1221 1123 730 606 426 334 235 13617 ----
NM_152422chr941331 438 346 155 31791 1229 323 11208 --
NM_152523chr21554 --1303 1709
NM_152529chr263924 3284 1442 960 840 716 23507 2817 --133
NM_152542chr472115 2087 1485 1340 796 557 536 11393 ----
NM_152594chr1552179 1849 457 364 230 11791 ----
NM_152622chr563256 2981 2594 1277 1215 214 1855 1193 1136
NM_152624chr5126348 6267 6176 6017 4795 2684 2433 2235 2058 2023 1842 1293 14582 16183 11730
NM_152629chr943857 2721 2677 695 13702 1178 --
NM_152641chr1262929 2088 1816 971 559 426 22795 98 --12507
NM_152678chr362642 2477 1774 968 358 247 12444 ----
NM_152682chr441394 1130 358 284 --11591 1470
NM_152754chr743718 1442 428 180 1861 1510 11058
NM_152756chr573436 2659 1500 739 694 439 267 ----1963
NM_152774chr742526 2435 1929 1916 ----12560
NM_152785chr362105 2027 1730 559 227 189 --22449 2210 --
NM_152787chrX43866 3691 2881 627 ----1357
NM_152826chr15106486 6343 4501 4242 4057 2133 1903 937 445 157 --14862 --
NM_152903chr1352861 2717 2416 1998 1052 21776 851 ----
NM_152924chr1596336 4298 2393 2121 1778 1638 1507 1008 573 15196 11518 --
NM_153050chr22114794 4672 4111 3262 3112 1011 984 551 431 372 109 ----11906
NM_153051chr22114794 4672 4111 3262 3112 1011 984 551 431 372 109 ----11906
NM_153184chr351469 1322 754 655 280 11995 1636 --
NM_153188chr553564 3476 2026 1961 531 25715 1900 --1357
NM_153207chr1233310 1623 850 1993 --13347
NM_153235chr632361 2155 1657 32427 1719 438 ----
NM_153371chr1342179 2053 1803 487 --22389 2279 1349
NM_153607chr562875 2329 432 343 195 133 1233 ----
NM_153634chr1241476 1415 1038 81 11523 ----
NM_153649chr172231 2213 1882 1679 833 464 319 11864 --11842
NM_153686chr442029 1761 133 120 ------
NM_153687chr1221197 191 --11519 129
NM_170674chr155503 474 367 203 186 ----11112
NM_170675chr154268 179 150 43 ----1788
NM_170676chr154268 179 150 43 ----1788
NM_170677chr155503 474 367 203 186 ----11112
NM_170706chr183636 3205 3026 1479 1247 1093 933 896 --22876 154 11600
NM_170751chr611034 11214 --11402
NM_170752chr611034 11214 --11402
NM_170774chr2083646 3576 3216 1076 639 391 126 38 ----14175
NM_172071chr166989 5994 5875 5139 1000 953 --11089 --
NM_172315chr155503 474 367 203 186 ----11112
NM_172316chr155503 474 367 203 186 ----11112
NM_173214chr16127721 6954 6826 6362 6233 5887 5825 3316 2956 2547 2062 325 38257 7518 698 22367 900 --
NM_173468chr495828 5772 5664 4943 4409 3830 3783 3750 1054 2510 161 21873 190 --
NM_173470chrX62674 1802 966 814 164 132 ------
NM_173510chr2241945 1100 319 158 1299 --12783
NM_173545chr262112 2085 1531 458 437 68 1305 11298 11926
NM_173582chr11126009 5519 5321 5287 4851 4666 4463 2410 2382 2030 1958 1544 14527 11678 --
NM_173642chr1178920 8605 8158 7673 7550 6802 6618 6503 5592 3479 3471 2911 2787 2486 2357 1537 1385 37783 5740 507 23613 994 --
NM_173808chr194106 3938 3504 3354 2939 1566 1329 1295 910 24250 720 ----
NM_173825chr342065 1924 964 101 --12312 --
NM_173851chr873906 3773 3052 919 432 280 89 1908 --11090
NM_175623chr1297471 7353 7017 6806 6766 2709 2484 1476 794 45912 2027 2014 1896 26605 2953 --
NM_175624chr1297566 7448 7112 6901 6861 2804 2579 1571 889 46007 2122 2109 1991 36700 3048 113 --
NM_175625chr1297566 7448 7112 6901 6861 2804 2579 1571 889 46007 2122 2109 1991 36700 3048 113 --
NM_175921chr573805 3129 3053 2973 1423 1324 1183 14329 1534 --
NM_176081chr1085910 5836 5000 4062 3661 1903 1746 79 45397 1990 1667 1030 22365 200 15827
NM_176083chr1085910 5836 5000 4062 3661 1903 1746 79 45397 1990 1667 1030 22365 200 15827
NM_177414chr131447 408 395 31744 1325 601 ----
NM_177438chr1464163 3883 3820 2840 611 188 11462 ----
NM_177966chr341610 1525 609 69 21930 1187 21263 734 --
NM_177990chr2072028 1877 1468 1428 754 580 499 ------
NM_177995chr941331 438 346 155 31791 1229 323 11208 --
NM_177996chr2083092 2994 2590 2365 2147 2129 2120 554 1334 23458 52 --
NM_178037chr1282963 2547 2437 781 422 408 314 25 --23298 682 --
NM_178038chr1282963 2547 2437 781 422 408 314 25 --23298 682 --
NM_178123chr21977 ----1225
NM_178151chrX157255 7119 6092 5792 5476 5271 5204 2921 2375 2247 1986 1225 1169 731 227 11441 ----
NM_178152chrX157255 7119 6092 5792 5476 5271 5204 2921 2375 2247 1986 1225 1169 731 227 11441 ----
NM_178153chrX157255 7119 6092 5792 5476 5271 5204 2921 2375 2247 1986 1225 1169 731 227 11441 ----
NM_178496chr321522 472 1276 --1457
NM_178498chr1173683 3544 2914 2524 2492 1156 355 23097 876 ----
NM_178509chr1794111 3774 3518 3381 3217 2632 1433 1381 1183 21294 568 24154 1170 --
NM_178539chr1241970 1751 1692 1326 21891 638 ----
NM_178585chr452749 2457 511 414 27 12267 22162 1099 --
NM_178815chr1072225 795 653 468 410 223 131 1814 ----
NM_178818chr1672477 2376 2095 1599 962 905 373 --11907 --
NM_181358chr164134 4092 2695 1687 1464 863 --128 --
NM_181481chr18137076 6666 5657 5397 5374 4884 4505 2730 2641 2050 1329 489 429 27064 6206 ----
NM_181482chr18137076 6666 5657 5397 5374 4884 4505 2730 2641 2050 1329 489 429 27064 6206 ----
NM_181483chr18137076 6666 5657 5397 5374 4884 4505 2730 2641 2050 1329 489 429 27064 6206 ----
NM_181504chr583401 3370 2963 1576 1003 734 331 111 ------
NM_181523chr583401 3370 2963 1576 1003 734 331 111 ------
NM_181524chr583401 3370 2963 1576 1003 734 331 111 ------
NM_181659chr2063418 2240 1294 932 383 108 --2821 75 --
NM_181659chr2063418 2240 1294 932 383 108 --2821 75 --
NM_181705chr544614 4255 685 169 55753 5421 4406 3527 3513 ----
NM_181787chr883924 3385 2750 2625 1100 867 739 722 21557 1030 ----
NM_181789chr1573234 2776 2705 1281 1046 558 50 --2976 816 13145
NM_181861chr1252404 1918 1019 852 411 22243 936 --12068
NM_181868chr1252404 1918 1019 852 411 22243 936 --12068
NM_181869chr1252489 2003 1104 937 496 22328 1021 --12153
NM_182515chr19116516 6086 5818 5310 4349 2519 1997 1261 985 691 69 1472 136 26334 5687
NM_182641chr1751941 820 604 489 73 --156 --
NM_182763chr142718 1991 1790 908 --1436 12121
NM_182848chr1381603 1513 1407 1320 998 316 178 100 ------
NM_182898chr7185696 5612 4930 4610 4541 4384 4016 2172 1731 1704 1606 1562 1481 1464 1166 1111 761 290 25132 2428 12453 --
NM_182899chr7185696 5612 4930 4610 4541 4384 4016 2172 1731 1704 1606 1562 1481 1464 1166 1111 761 290 25132 2428 12453 --
NM_182964chr1183103 2418 1266 986 962 804 606 89 12134 11139 --
NM_182975chr12942 436 2209 38 1115 --
NM_183075chr453029 1888 1175 1026 190 42951 2362 2210 927 ----
NM_183381chr34924 868 806 367 ------
NM_183383chr34924 868 806 367 ------
NM_183384chr34924 868 806 367 ------
NM_183416chr141772 1295 800 28 11444 1787 --
NM_194247chr263482 3041 1370 1124 960 588 22932 779 1990 --
NM_194286chr12116135 5667 5633 5166 5059 4984 4919 4816 4614 4225 1960 --32047 900 239 --
NM_194291chr832179 817 664 --22949 2150 12395
NM_194314chr145624 1048 308 141 24282 1954 1390 --
NM_194434chr1885790 4405 3632 2015 1762 1273 1163 102 14273 ----
NM_197941chr573005 2408 1997 1940 856 416 66 1651 1323 2639 527
NM_198181chr1562847 2438 2243 2041 2029 91 12765 ----
NM_198196chr3102548 2278 2272 2172 2136 1880 766 624 560 93 22394 1721 12185 --
NM_198212chr772245 1904 1790 1470 1463 658 74 21937 475 ----
NM_198268chr164134 4092 2695 1687 1464 863 --128 --
NM_198269chr164134 4092 2695 1687 1464 863 --128 --
NM_198270chrX113223 3207 3184 3159 2617 2337 2190 1038 740 674 441 ------
NM_198281chr443497 3113 2953 2463 --1837 2926 497
NM_198320chr1295249 4745 3812 3373 3348 1744 1191 342 41 11905 ----
NM_198400chr1572920 2831 1943 1874 874 769 80 1126 22360 2101 --
NM_198465chrX82692 2662 2167 1964 1858 976 527 443 21937 185 12976 --
NM_198484chr3136259 6216 5997 5944 4852 4278 2502 2454 2378 2077 1276 879 338 ----11582
NM_198503chr111872 1340 --1515
NM_198569chr652594 2174 1798 427 269 1280 --1593
NM_198581chr2136765 6693 5945 5749 5421 5335 5271 5121 4812 2837 2317 263 132 16292 ----
NM_198829chr751183 1133 330 167 156 --11520 --
NM_198859chr344357 4089 3748 3611 --23191 709 14477
NM_199072chr72815 312 12886 12987 1977
NM_199168chr1041066 333 110 102 ----11312
NM_199320chr452212 931 813 376 160 32040 461 224 22903 2460 --
NM_199320chr452212 931 813 376 160 32040 461 224 22903 2460 --
NM_199421chr1494520 3843 3456 3449 3429 3105 1335 767 661 --14832 --
NM_199436chr292740 2367 2259 1911 1896 991 924 868 148 22202 293 22977 2427 --
NM_199454chr184601 4313 4161 3840 3795 1542 1535 287 21651 453 1740 --
NM_203327chr20104528 3504 3199 2785 1817 1193 1089 1022 299 136 ------
NM_203349chr1561681 1428 585 161 137 128 --1431 --
NM_203372chr23482 476 110 11357 --1263
NM_203446chr2162785 2464 2128 360 346 42 22942 1055 ----
NM_203458chr143524 3356 3347 553 --13370 --
NM_203463chr254860 4053 1486 536 519 31880 1349 948 21562 37 --
NM_203504chr441000 676 661 251 1240 12239 --
NM_203505chr441000 676 661 251 1240 12239 --
NM_206594chr1113443 3020 2802 2505 2348 2275 1436 1081 821 674 660 13071 --1636
NM_206595chr1113443 3020 2802 2505 2348 2275 1436 1081 821 674 660 13071 --1636
NM_206853chr663660 3571 3100 3050 2748 1310 ------
NM_206854chr684921 4832 4361 4311 4009 757 391 294 ------
NM_206855chr6105886 5797 5326 5276 4974 1722 1356 1259 634 616 1846 ----
NM_206866chr2193248 3171 3000 2004 1279 1174 147 77 26 13040 --12699
NM_206876chr283002 2551 2464 1090 498 87 79 26 22990 640 ----
NM_206907chr542370 1129 774 628 22724 1007 12069 --
NM_206909chr8237799 7058 6852 6544 6383 6243 6205 6044 6019 5987 5936 5920 5788 5487 5417 3170 2815 2425 2069 1636 1577 1486 501 12915 ----
NM_206933chr192722 2572 2416 2287 2080 1075 1051 765 96 --12113 --
NM_207292chr352784 2075 725 366 23 22965 81 --12860
NM_207293chr352784 2075 725 366 23 22965 81 --12860
NM_207294chr352784 2075 725 366 23 22965 81 --12860
NM_207295chr352784 2075 725 366 23 22965 81 --12860
NM_207296chr352784 2075 725 366 23 22965 81 --12860
NM_207297chr352809 2100 750 391 48 22990 106 --12885
NM_207303chr1094056 3963 3884 3622 3561 3197 2707 1675 407 1536 21233 856 --
NM_207304chr1342440 2260 1998 1901 32500 1769 223 1548 --
NM_213651chr151379 1187 1171 456 329 1189 1442 --