TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-218-5p
miRNA Sequence: UUGUGCUUGAUCUAACCAUGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000067chr81267 --162 --
NM_000084chrX26971 2458 15669 17001 --
NM_000088chr1711385 ----11275
NM_000089chr71815 ------
NM_000090chr21876 ------
NM_000109chrX1510 --12679 22465 2384
NM_000110chr131227 391 376 ------
NM_000114chr2021274 189 ------
NM_000115chr133694 229 110 --12057 --
NM_000126chr15193 ------
NM_000138chr1562254 2176 2061 1034 389 129 ------
NM_000141chr102348 143 1364 ----
NM_000161chr1431606 320 243 --31513 604 341 --
NM_000163chr551647 858 568 397 293 ------
NM_000165chr611434 ------
NM_000168chr752961 2557 2086 1191 569 1514 ----
NM_000208chr1943887 3652 3152 318 --13542 21459 1140
NM_000214chr2011303 --11124 --
NM_000216chrX3578 329 219 ----13449
NM_000217chr12104975 4956 4282 4171 1745 1095 1036 865 599 449 1845 23872 1379 --
NM_000227chr182342 43 ------
NM_000237chr841637 299 222 174 11353 ----
NM_000248chr323073 799 --12710 12812
NM_000252chrX11051 ------
NM_000253chr44710 403 85 68 ------
NM_000259chr1586174 4645 1496 1228 676 450 392 101 12449 ----
NM_000264chr943350 2750 1040 345 --23167 556 --
NM_000276chrX51731 1430 1420 732 373 1668 ----
NM_000313chr3------1865
NM_000325chr41427 ------
NM_000329chr15831 579 316 189 148 1733 1699 --
NM_000332chr6136778 5870 5465 5123 5106 1388 1371 1177 1153 1119 1100 299 219 27167 1621 14853 --
NM_000337chr595546 5198 5036 2490 2163 1934 1785 1160 403 4989 755 230 35 11439 --
NM_000338chr1521183 839 ------
NM_000346chr1731767 1560 795 --1214 --
NM_000353chr1631045 984 284 ----1154
NM_000368chr994712 4422 4184 3598 3521 3305 1706 850 43 ------
NM_000376chr1253179 2956 771 581 574 --11946 --
NM_000378chr1121177 41 ------
NM_000388chr341280 1270 1249 228 ------
NM_000399chr101768 ------
NM_000408chr243209 2244 2134 969 --22114 1085 12359
NM_000448chr1132816 2065 1132 12215 ----
NM_000449chr1----11492 --
NM_000452chr1331754 1601 1486 ------
NM_000461chr363705 3398 3387 1239 419 279 34173 1592 534 ----
NM_000462chr15--2685 116 --11245
NM_000478chr11268 ------
NM_000489chrX32535 2453 223 --1818 --
NM_000503chr83649 243 25 --1629 --
NM_000516chr20------139
NM_000522chr731197 1139 1107 ------
NM_000551chr341967 657 324 126 11792 ----
NM_000555chrX45906 2675 2399 1264 45590 5396 4966 33 21565 688 --
NM_000610chr1133020 2992 2935 1121 12380 1645
NM_000612chr11433858 3426 3323 1529 1509 1494 1470 1451 1432 1413 1398 1381 1362 1355 1338 1323 1306 1289 1280 1265 1246 1227 1208 1201 1189 1164 1149 1141 1130 1113 1096 1077 1048 1033 1004 985 977 966 957 932 921 904 856 --1198 --
NM_000618chr1295434 4904 2499 2490 2241 1585 1450 847 830 --36548 6412 563 --
NM_000618chr1295434 4904 2499 2490 2241 1585 1450 847 830 --36548 6412 563 --
NM_000624chr141866 ------
NM_000627chr22849 597 ------
NM_000633chr1874655 3342 1932 1428 1335 748 320 --15266 --
NM_000663chr1652817 2104 1956 1075 493 12330 1842 --
NM_000681chr1031339 502 331 ------
NM_000684chr101390 ----11338
NM_000689chr92365 43 ------
NM_000702chr132093 1811 1702 12037 --11800
NM_000724chr1021766 353 ------
NM_000726chr22238 91 1897 1299 --
NM_000792chr11821 --21007 350 1795
NM_000801chr20--1342 1320 --
NM_000808chrX61066 813 756 57 49 30 ------
NM_000809chr479108 8898 6957 6640 5945 1159 1033 1968 13435 23124 2029
NM_000813chr585531 4155 3919 2036 1589 906 799 603 22244 1030 ----
NM_000814chr1533391 735 155 --54127 4025 3491 1226 901 --
NM_000817chr21900 ------
NM_000826chr431753 393 59 --1482 --
NM_000829chr1162306 1999 1991 1692 1485 330 ----11534
NM_000831chr175974 5501 5178 4655 2200 1993 337 --35801 3874 255 --
NM_000834chr122464 442 1390 ----
NM_000838chr61617 --12349 1268
NM_000840chr71474 1462 ----
NM_000844chr33988 959 767 ------
NM_000868chrX32212 2177 2131 --1371 --
NM_000875chr1587051 6238 6200 6138 5228 2083 1105 278 12241 1748 --
NM_000877chr223036 378 12869 12084 --
NM_000891chr1733280 964 210 1174 --1134
NM_000902chr363089 3003 2469 1990 584 386 12224 --1923
NM_000909chr41334 ----152
NM_000912chr853266 1268 847 714 225 --12912 --
NM_000926chr1198589 7962 7593 6409 6396 2757 2475 2289 244 56733 6032 1907 1715 1653 28996 6379 18125
NM_000935chr32907 357 ------
NM_000944chr452121 1895 1501 1471 894 --1882 --
NM_000945chr231472 562 233 1418 ----
NM_001001132chr2111206 ----11237
NM_001001323chr121558 --12251 --
NM_001001331chr352590 2083 1741 1666 80 12188 ----
NM_001001389chr1133020 2992 2935 1121 12380 1645
NM_001001390chr1133020 2992 2935 1121 12380 1645
NM_001001391chr1133020 2992 2935 1121 12380 1645
NM_001001392chr1133066 3038 2981 1167 12426 1691
NM_001001395chr1232506 690 35 1389 --1319
NM_001001396chr164117 4065 3625 1774 1679 443 ------
NM_001001419chr584415 3405 3323 2002 1664 1303 739 68 1878 14633 1461
NM_001001420chr584415 3405 3323 2002 1664 1303 739 68 1878 14633 1461
NM_001001664chr22709 440 12813 1131 --
NM_001001685chr1752438 2268 955 904 780 ------
NM_001001787chr11464 ------
NM_001001790chr91414 --1438 --
NM_001001890chr2144121 4108 2892 849 --14325 --
NM_001001924chr84539 262 99 35 183 1309 --
NM_001001925chr84539 262 99 35 183 1309 --
NM_001001931chr84539 262 99 35 183 1309 --
NM_001001933chr11110 ------
NM_001001938chr953499 3198 2949 2692 952 --13416 1695
NM_001001974chr1042107 1490 331 241 ------
NM_001001995chrX172 --11385 --
NM_001002243chr2----168 --
NM_001002258chr231521 1479 1368 --11939 --
NM_001002295chr10------11148
NM_001002296chr82341 260 --11011 --
NM_001002762chr1062197 1091 781 650 386 369 11831 ----
NM_001002860chr1454665 4576 1673 1474 502 ------
NM_001002909chr1731949 1508 402 ----12194
NM_001003406chr2272807 2545 2486 816 663 410 121 ----12710
NM_001003652chr18108398 8224 7510 7462 6870 6088 5358 2607 2024 140 1777 17592 28531 7905
NM_001003674chr1884468 2088 1718 1646 1505 1362 704 401 17070 --26777 1521
NM_001003675chr1884468 2088 1718 1646 1505 1362 704 401 17070 --26777 1521
NM_001003688chr41977 ------
NM_001003712chr1243966 3828 747 520 --23886 1332 1426
NM_001003760chr653454 2670 1157 359 281 23317 760 1135 --
NM_001003792chr31934 ------
NM_001003793chr31934 ------
NM_001003800chr9103790 3359 2750 2548 2464 1500 635 455 291 207 ------
NM_001003810chr41688 ------
NM_001003895chrY--162 ----
NM_001004065chr963758 3244 2762 1450 413 73 --12433 --
NM_001004127chr131340 ------
NM_001004317chr684417 4007 3855 3171 2926 2806 1537 399 --23088 344 --
NM_001004342chr155696 5363 1509 1127 1062 35240 5132 2329 ----
NM_001004360chr221642 126 11334 --11278
NM_001004419chr1244511 4077 1116 25 --23234 111 --
NM_001004441chr511629 1165 ----
NM_001005158chr31334 ----138
NM_001005159chr31334 ----138
NM_001005242chr1221571 89 ------
NM_001005266chr15193 ------
NM_001005267chr15193 ------
NM_001005268chr15193 ------
NM_001005269chr15193 ------
NM_001005375chrY41561 1145 487 467 1502 ----
NM_001005386chr23927 500 333 1360 ----
NM_001005404chr1753578 3397 3206 1374 1348 2874 598 11176 --
NM_001005463chr1022508 2119 --1669 11818
NM_001005473chr595293 5017 4816 4552 2057 1961 1748 1714 781 22103 1536 ----
NM_001005609chrX33378 3283 1359 43586 2962 956 926 --13493
NM_001005746chr22238 91 1897 1299 --
NM_001005747chr22238 91 1897 1299 --
NM_001005849chr17----1188 --
NM_001006634chr161263 ------
NM_001006657chr242155 2047 371 43 --12642 --
NM_001007067chr84734 419 389 100 ------
NM_001007068chr84734 419 389 100 ------
NM_001007069chr84734 419 389 100 ------
NM_001007070chr84734 419 389 100 ------
NM_001007102chr6----11212 164
NM_001007232chr11195 --138 --
NM_001007246chr2151817 1233 432 132 63 ------
NM_001007257chr121096 69 ------
NM_001007466chr664647 4421 4086 3890 1652 350 13616 13524 --
NM_001007559chr1821760 1296 --1582 11334
NM_001007595chr15----1273 --
NM_001007794chr11230 ------
NM_001008215chr21335 1242 1274 --
NM_001008239chr1843484 1494 885 601 23824 2707 11076 --
NM_001008405chr721496 696 ------
NM_001008407chr751700 353 175 157 28 ------
NM_001008495chr832297 1954 1609 1103 11938 11411
NM_001008660chr1111261 ------
NM_001008707chr1411595 --11457 --
NM_001008738chr542730 2064 878 245 ------
NM_001008895chr1311076 --162 --
NM_001008925chr483312 3135 2497 2376 1395 1384 1057 327 23490 310 12909 --
NM_001009552chr81201 1179 ----
NM_001009555chr431569 477 263 2334 31 1552 --
NM_001009881chr11620 ------
NM_001009882chr11620 ------
NM_001009909chr1133130 1452 93 --11168 1856
NM_001009958chr71605 ------
NM_001009993chr243724 3374 3006 1792 11339 24523 1349 --
NM_001010852chr6--1120 ----
NM_001010853chr643138 2401 2085 866 1568 ----
NM_001010861chr1--1233 11008 --
NM_001010867chr1105680 5510 4130 1845 1493 1485 994 781 680 185 25812 2041 56732 4174 2368 2124 558 --
NM_001010888chrX94252 3919 3330 3300 3242 2995 1184 782 129 --11336 --
NM_001010891chr585728 5223 5031 2557 1717 1507 750 592 12448 22158 1835 --
NM_001010895chr92745 478 ------
NM_001010898chr133294 3149 2690 3936 915 895 33571 1122 948 --
NM_001010927chr6----1402 --
NM_001010971chr131012 894 812 ------
NM_001010983chr3127 ------
NM_001010986chrX1133 --1434 --
NM_001011513chr433392 2920 710 ----12690
NM_001011553chr71217 ------
NM_001011663chr10------1156
NM_001011666chr786601 6320 4935 4864 2023 1278 906 559 ------
NM_001011724chr131233 --190 --
NM_001011725chr131233 --190 --
NM_001012267chr961882 1865 1657 1604 1264 132 ------
NM_001012270chr171698 1537 --1560
NM_001012271chr171801 1640 --1663
NM_001012393chr1164219 3441 3351 2004 1779 1648 14047 24597 1369 --
NM_001012423chr152957 374 1465 ----
NM_001012659chr321516 997 21385 1354 --12645
NM_001012751chr1031430 1343 457 ----1153
NM_001012755chrX64680 3701 3436 3126 1887 338 ----14283
NM_001012761chr542231 753 324 268 12003 ----
NM_001012989chrX2551 188 ------
NM_001013031chr1032214 992 629 --11190 --
NM_001013399chr61171 --1114 1340
NM_001013415chr41429 ------
NM_001013437chr18------1358
NM_001013439chr31345 ------
NM_001014336chr12----197 --
NM_001014434chr11570 ------
NM_001014797chr10107519 7251 6735 6579 5997 3126 2510 1758 1551 889 27850 5935 37976 6308 5341 26989 3265
NM_001015048chr1483129 3031 2348 1237 918 428 310 178 ------
NM_001015049chr1483129 3031 2348 1237 918 428 310 178 ------
NM_001015508chr81186 ------
NM_001015877chrX52906 2347 651 505 417 --22759 1158 1372
NM_001015881chrX2114 82 ------
NM_001017371chr221112 558 ------
NM_001017396chr261843 783 606 577 495 145 11579 ----
NM_001017405chr42817 241 ------
NM_001017415chr11678 ------
NM_001017416chr11678 ------
NM_001017440chr735695 5417 1654 37042 5979 1773 37864 7804 7551 23151 780
NM_001017523chr1221200 241 ------
NM_001017535chr1253179 2956 771 581 574 --11946 --
NM_001017923chr1421215 222 ------
NM_001017926chr821542 260 ------
NM_001017969chr9----191 --
NM_001018065chr994685 2215 2195 1632 1592 1191 1061 360 212 11531 21903 973 --
NM_001018066chr994685 2215 2195 1632 1592 1191 1061 360 212 11531 21903 973 --
NM_001018067chr115077 13909 34318 823 653 --
NM_001018068chr115077 13909 34318 823 653 --
NM_001018069chr115077 13909 34318 823 653 --
NM_001018072chr1221200 241 ------
NM_001018108chr1542253 2240 2100 443 --12072 --
NM_001018111chr743759 3034 2825 665 --23925 1306 --
NM_001020818chr1931179 664 526 ------
NM_001020819chr1931179 664 526 ------
NM_001020820chr1931179 664 526 ------
NM_001020821chr1931179 664 526 ------
NM_001023587chr3----11171 --
NM_001024647chr1231847 1647 136 27172 5615 17438 --
NM_001024649chr522218 78 --21087 1060 --
NM_001024660chr311562 ----1614
NM_001024668chr122944 150 ----1646
NM_001024847chr332427 2038 1984 12194 1634 --
NM_001024934chr62251 161 --1448 --
NM_001024935chr62251 161 --1448 --
NM_001024936chr62251 161 --1448 --
NM_001025076chr1035529 2375 985 15412 15390 --
NM_001025077chr1066887 5100 2343 854 527 419 16770 26748 324 --
NM_001025079chr333521 848 71 --34035 1299 529 --
NM_001025100chr1863464 2802 2529 1474 1393 745 --11149 --
NM_001025105chr521214 564 ----11125
NM_001025107chr162035 1966 1883 865 812 284 --22618 268 --
NM_001025107chr162035 1966 1883 865 812 284 --22618 268 --
NM_001025108chr253898 2860 2585 2574 440 11579 1293 --
NM_001025233chr1252668 1892 646 552 35 12188 12800 12613
NM_001025266chr353622 1853 1113 688 414 --11507 24823 4197
NM_001025356chr1262575 2388 2254 2094 695 23 --1652 --
NM_001025366chr661893 1835 1510 238 215 180 --11160 --
NM_001025366chr661893 1835 1510 238 215 180 --11160 --
NM_001025367chr661893 1835 1510 238 215 180 --11160 --
NM_001025367chr661893 1835 1510 238 215 180 --11160 --
NM_001025368chr661893 1835 1510 238 215 180 --11160 --
NM_001025368chr661893 1835 1510 238 215 180 --11160 --
NM_001025369chr661909 1851 1526 254 231 196 --11176 --
NM_001025369chr661909 1851 1526 254 231 196 --11176 --
NM_001025370chr661893 1835 1510 238 215 180 --11160 --
NM_001025370chr661893 1835 1510 238 215 180 --11160 --
NM_001025579chr171384 ------
NM_001025580chrX43598 3326 3304 234 23962 2948 ----
NM_001025595chr421403 101 ------
NM_001025596chr112408 75 --196 --
NM_001025603chr1----11492 --
NM_001025616chr4----1262 --
NM_001029875chr562991 2469 2128 854 834 629 ------
NM_001029884chr641790 922 900 189 1143 --12764
NM_001030006chr1731912 1805 462 1154 11892 1977
NM_001030055chr1453925 3880 1883 1295 186 --31675 1656 1564 1234
NM_001031677chr51535 ------
NM_001031679chr1243041 2235 666 276 21425 1283 12615 --
NM_001031695chr2285441 5409 5166 3614 3520 1805 1315 1181 --11593 33708 1069 977
NM_001031710chr72822 239 --1327 --
NM_001031716chr221154 91 ------
NM_001031732chr462806 2744 1421 1375 847 152 --33465 3021 897 --
NM_001031804chr1643855 3729 3272 3186 --12930 --
NM_001031812chr541624 722 697 328 1392 ----
NM_001032221chr941809 1762 1549 1217 ----11772
NM_001032280chr611121 ------
NM_001032282chr83915 373 287 --11142 --
NM_001032288chr202303 109 --21045 602 --
NM_001032293chr171440 ------
NM_001032380chr1021331 67 ----1169
NM_001032394chr622331 828 1125 --11096
NM_001032730chr11131 ----1711
NM_001033030chr3184 ------
NM_001033031chr3184 ------
NM_001033032chr3184 ------
NM_001033045chr244164 2685 1755 1528 ----11645
NM_001033047chr412570 --11051 --
NM_001033057chr331817 829 94 1610 32135 727 681 --
NM_001033112chr53351 264 242 2759 35 ----
NM_001033518chr731154 1125 317 --1857 --
NM_001033519chr731154 1125 317 --1857 --
NM_001033520chr731154 1125 317 --1857 --
NM_001033557chr221453 1103 ------
NM_001033564chr621792 230 --1163 --
NM_001033566chr171176 ------
NM_001033568chr171176 ------
NM_001033756chr661827 1769 1444 172 149 114 ------
NM_001033756chr661827 1769 1444 172 149 114 ------
NM_001033925chr102823 133 ------
NM_001034837chr52558 251 1652 ----
NM_001034838chr52558 251 1652 ----
NM_001034850chr54644 574 353 214 129 ----
NM_001034954chr1062526 2076 1083 838 589 46 12881 1302 --
NM_001034955chr1062526 2076 1083 838 589 46 12881 1302 --
NM_001034956chr1062526 2076 1083 838 589 46 12881 1302 --
NM_001034957chr1062526 2076 1083 838 589 46 12881 1302 --
NM_001035003chr421047 82 11370 1109 --
NM_001035004chr421047 82 11370 1109 --
NM_001035260chr1041027 654 356 228 --1632 --
NM_001037132chr751793 1664 853 668 53 11969 --11840
NM_001037133chr751793 1664 853 668 53 11969 --11840
NM_001037164chr741986 1621 783 668 ------
NM_001037172chr341079 562 347 47 --1161 --
NM_001037174chr252036 1976 1478 688 388 ----21699 279
NM_001037317chr1--1233 11008 --
NM_001037332chr53887 617 119 1204 ----
NM_001037333chr53887 617 119 1204 ----
NM_001037334chr1832110 1708 872 21609 527 11499 --
NM_001037872chr22490 204 ------
NM_001037954chr1183251 3204 2816 2281 1202 961 947 132 11036 ----
NM_001038640chr1511030 ------
NM_001039111chr3------1158
NM_001039350chr71365 ----122
NM_001039372chr72183 23 ------
NM_001039395chr941871 1584 266 64 --2942 863 12201
NM_001039538chr263341 3309 2632 2388 607 166 ------
NM_001039547chr331318 367 133 --1438 --
NM_001039570chr2284263 3916 3726 3264 1726 1130 329 157 --13513 --
NM_001039571chr2284263 3916 3726 3264 1726 1130 329 157 --13513 --
NM_001039590chrX34026 2831 2741 1955 ----
NM_001039591chrX34026 2831 2741 1955 ----
NM_001039618chr1164785 4424 4395 3703 1672 149 --15873 --
NM_001039619chr14274 60 ------
NM_001039649chr132327 35 ------
NM_001039715chr11821 --21007 350 1795
NM_001039716chr11885 --21071 414 1859
NM_001039762chr1032057 486 110 ----1508
NM_001039840chrX34307 1246 678 11944 ----
NM_001039937chr1364042 3743 3371 1446 923 492 12944 1395 --
NM_001040020chr7----2282 31 2583 236
NM_001040092chr8122 ------
NM_001040100chr32822 106 ------
NM_001040108chr1453050 3020 813 234 85 ----12682
NM_001040110chr721440 171 ------
NM_001040142chr221678 735 ------
NM_001040143chr221678 735 ------
NM_001040152chr784634 1978 1326 1313 639 584 400 373 --21264 886 --
NM_001040153chr131648 1633 ----
NM_001040157chr422842 1843 1745 21879 329 --
NM_001040272chr932335 2148 810 --3632 415 329 1157
NM_001040284chr1645017 2368 2220 1611 --13728 --
NM_001040402chr443173 2723 2491 1107 --32143 988 85 --
NM_001040409chr22866 294 ------
NM_001040429chr1353578 3065 2965 1282 1273 --13153 --
NM_001040437chr6187 ------
NM_001040438chr6187 ------
NM_001040441chr184253 4127 3785 3769 3498 1987 1143 449 --24982 4226 --
NM_001040450chr15--1402 32206 963 814 --
NM_001040453chr15--1402 32206 963 814 --
NM_001040458chr531164 296 260 --11212 --
NM_001040665chr734978 1517 947 13339 ----
NM_001040666chr71680 ------
NM_001040708chr81887 ------
NM_001040709chr112576 ------
NM_001040712chr942489 2197 2184 798 1369 ----
NM_001042355chr1634936 1326 188 --21440 301 --
NM_001042404chr12497 63 ------
NM_001042412chr1634936 1326 188 --21440 301 --
NM_001042413chr933466 3381 3288 22809 2655 33599 3123 484 1458
NM_001042425chr611121 ------
NM_001042453chrX21146 601 --11736 --
NM_001042473chr1022043 1532 ------
NM_001042486chr2011031 ------
NM_001042493chr631895 1327 295 ----11841
NM_001042494chr1572648 2422 1244 1035 1012 348 150 12566 1949 --
NM_001042495chr1572648 2422 1244 1035 1012 348 150 12566 1949 --
NM_001042496chr1572648 2422 1244 1035 1012 348 150 12566 1949 --
NM_001042497chr1572648 2422 1244 1035 1012 348 150 12566 1949 --
NM_001042510chr811658 21894 1858 ----
NM_001042511chr811658 21894 1858 ----
NM_001042533chr333314 513 170 ----22624 265
NM_001042537chrX1622 --32121 729 602 --
NM_001042555chr1264712 3653 3185 3056 1360 523 14646 ----
NM_001042599chr246824 6750 1983 1283 26881 6637 11182 --
NM_001042603chr1233892 3640 1258 25261 1350 14442 --
NM_001042604chr373479 1944 1845 1236 380 339 146 13303 1976 --
NM_001042669chr4----1262 --
NM_001042749chrX11487 ------
NM_001042750chrX11487 ------
NM_001042751chrX11487 ------
NM_001042762chr74996 128 58 36 --1823 --
NM_001043318chr1433865 3814 1177 --23373 2748 1856
NM_001044722chr541624 722 697 328 1392 ----
NM_001044723chr541624 722 697 328 1392 ----
NM_001046chr5----32394 1070 136 1311
NM_001048183chr163640 3074 1022 578 532 92 12995 ----
NM_001083620chr42392 59 --1481 --
NM_001096chr173285 277 136 --1209 --
NM_001099678chr365478 4340 2340 1511 1317 1192 21604 1351 1880 --
NM_001100108chr1157389 7203 6198 6058 5914 5866 3338 3319 2712 2641 2123 1741 1658 1348 123 15808 26911 783 12736
NM_001106chr399173 8171 7779 3458 3062 2775 2219 692 207 --26598 2040 --
NM_001111chr162035 1966 1883 865 812 284 --22618 268 --
NM_001113490chrX51120 920 744 467 354 --11059 --
NM_001116chr1662435 1067 903 621 235 83 --22691 492 --
NM_001117chr1832282 1606 174 ----11732
NM_001123chr101311 ------
NM_001144chr1651407 943 469 366 123 ------
NM_001146chr822097 646 ------
NM_001148chr441975 719 86 64 ------
NM_001167chrX44368 2708 1301 248 25568 4671 ----
NM_001173chr1453925 3880 1883 1295 186 --31675 1656 1564 1234
NM_001186chr2132143 1244 320 --13188 --
NM_001198chr622117 507 --1967 --
NM_001204chr286584 5946 2742 2417 2217 2096 1526 568 1433 12939 --
NM_001206chr962937 2293 613 588 109 52 --3740 174 97 --
NM_001219chr722081 206 --1678 --
NM_001233chr741955 774 669 68 1273 1493 --
NM_001237chr4----1461 1121
NM_001237chr4----1461 1121
NM_001238chr191211 ------
NM_001241chr24820 408 315 35 123 ----
NM_001241chr24820 408 315 35 123 ----
NM_001256chr17------11841
NM_001259chr765921 5558 5331 4572 4481 1377 15720 1342 12506
NM_001268chr134901 428 406 184 ------
NM_001271chr1532451 1178 140 --1522 --
NM_001273chr12------1538
NM_001278chr101270 ------
NM_001280chr191244 ------
NM_001282chr1731912 1805 462 1154 11892 1977
NM_001283chr71703 ------
NM_001289chrX51392 1056 635 465 250 --11242 --
NM_001292chr155825 770 434 231 26 1355 21090 925 --
NM_001304chr1743395 1051 826 183 130 ----
NM_001310chr1242361 2294 1157 809 1555 12820 --
NM_001326chr111353 ------
NM_001331chr1132601 1808 552 ----12415
NM_001332chr521409 535 ----1348
NM_001351chr341728 1535 402 388 ------
NM_001356chrX52214 1567 715 429 101 11883 1562 --
NM_001364chr1144502 3992 965 687 --14628 --
NM_001386chr812112 --1967 --
NM_001399chrX33378 3283 1359 43586 2962 956 926 --13493
NM_001401chr91548 ------
NM_001407chr3----1473 --
NM_001412chrX53189 2662 2387 1475 699 ------
NM_001419chr1984751 3325 1675 1332 1015 733 662 302 ------
NM_001427chr711549 ------
NM_001430chr231503 1480 99 --21617 198 --
NM_001438chr132779 2576 1280 --1691 --
NM_001460chr163535 2460 2197 1376 1260 315 1201 ----
NM_001482chr152879 865 ------
NM_001494chr101491 ------
NM_001530chr1411024 ------
NM_001546chr6147 --2941 905 --
NM_001584chr11--21071 815 ----
NM_001587chrX51731 1430 1420 732 373 1668 ----
NM_001608chr22958 371 ----2931 296
NM_001616chr253377 1357 939 563 182 ------
NM_001650chr1843416 3367 3152 1530 12712 ----
NM_001663chr1422756 1950 --12711 12155
NM_001677chr111102 ------
NM_001682chr121272 --21965 1113 --
NM_001683chr352590 2083 1741 1666 80 12188 ----
NM_001684chr163834 3782 3342 1491 1396 160 ------
NM_001689chr231521 1479 1368 --11939 --
NM_001690chr3--11763 11042 --
NM_001695chr853944 3874 3619 3055 492 ------
NM_001698chr92138 83 ------
NM_001699chr1951801 1517 1353 1314 46 ------
NM_001701chr93585 282 134 ------
NM_001704chr61216 ------
NM_001709chr112988 137 --12923 --
NM_001713chr52387 235 ----1206
NM_001714chr12----1165 1506
NM_001720chr171879 1673 853 812 539 377 299 --21598 1415 --
NM_001721chrX----2372 242 --
NM_001729chr41359 ------
NM_001744chr5178 ------
NM_001746chr522218 78 --21087 1060 --
NM_001754chr2144121 4108 2892 849 --14325 --
NM_001755chr1652114 1745 602 248 57 --11553 --
NM_001759chr1283893 3805 1897 1229 971 541 374 188 2497 215 1209 24572 3637
NM_001762chr7----1279 --
NM_001777chr333521 848 71 --34035 1299 529 --
NM_001788chr71217 ------
NM_001792chr184227 220 103 65 1955 --135
NM_001806chr1952878 2420 2217 2076 1960 12444 1699 1562
NM_001819chr201199 ------
NM_001829chr42728 345 2960 60 ----
NM_001830chrX63318 3125 1165 1138 932 718 --14054 --
NM_001839chr1--2736 214 ----
NM_001844chr122441 54 ------
NM_001858chr684910 4569 3963 3576 1748 1297 717 639 --24883 3594 13937
NM_001866chrX----1111 --
NM_001873chr41494 ------
NM_001884chr5------1365
NM_001892chr521214 564 ----11125
NM_001901chr63973 770 232 190 ----
NM_001920chr121619 --1725 1719
NM_001935chr21723 ------
NM_001936chr71365 ----122
NM_001938chr121669 498 1675 ----
NM_001939chrX2691 258 ------
NM_001941chr1843856 3419 1150 242 --24027 3314 --
NM_001949chr642459 2417 1988 837 ------
NM_001967chr31441 ------
NM_001968chr41233 ------
NM_001969chr1463056 2604 1213 871 754 499 --11139 --
NM_001977chr42122 56 --11323 181
NM_001980chr1211527 --1186 22209 150
NM_001987chr12113976 3878 3327 3172 3063 2883 1575 982 770 186 164 11537 ----
NM_001995chr441295 1001 415 32 1610 --11315
NM_001999chr541232 280 57 39 1196 11312 --
NM_002006chr434236 3785 657 --24368 3929 24212 1900
NM_002009chr1532496 1919 1091 --1597 --
NM_002015chr1343074 2759 2150 31 --22619 2112 --
NM_002017chr1111110 ----11046
NM_002023chr151672 1617 1469 1288 1145 ------
NM_002024chrX3334 269 104 --11451 --
NM_002025chrX129158 8950 8239 7759 6400 3645 3397 3078 2412 577 329 55 15637 47921 2834 2781 2277 --
NM_002026chr23421 163 30 1818 1300 --
NM_002031chr61871 --1235 --
NM_002040chr212458 177 12884 --12509
NM_002048chr92436 317 ------
NM_002051chr10------11148
NM_002063chrX11278 1223 ----
NM_002069chr711480 --21822 466 --
NM_002072chr91216 --1205 --
NM_002074chr141190 1174 477 71 1173 1676 --
NM_002092chr464713 4125 3351 1749 906 42 --11954 --
NM_002107chr1----1456 --
NM_002126chr1753994 3329 2962 2568 924 1448 ----
NM_002137chr722017 312 1791 ----
NM_002138chr41688 ------
NM_002148chr21247 --1524 1642
NM_002158chr221518 840 23633 3022 13391 1216
NM_002160chr9166 ----1613
NM_002182chr321898 879 --12320 --
NM_002190chr641211 952 831 465 ------
NM_002202chr541054 695 322 260 ------
NM_002203chr583011 2586 1584 1458 1346 1290 437 320 ----2842 731
NM_002210chr21869 --23601 822 --
NM_002214chr765157 2213 2081 963 293 269 ----11116
NM_002221chr141962 1153 853 334 1507 2769 407 --
NM_002222chr31258 --11363 --
NM_002227chr151006 420 257 249 138 --1157 --
NM_002232chr12303 277 --2389 128 --
NM_002233chr112443 113 ------
NM_002234chr122715 207 ------
NM_002239chr22770 229 --1119 --
NM_002242chr221753 604 --1579 --
NM_002247chr1072213 1794 1752 1446 548 466 310 1190 ----
NM_002265chr171210 11036 --1951
NM_002267chr13144 ----1501
NM_002268chr3--11634 --1395
NM_002269chr62343 137 ------
NM_002270chr584203 3593 1426 1326 1079 661 402 315 1133 ----
NM_002271chr1362101 1905 1793 1712 816 498 ------
NM_002285chr253898 2860 2585 2574 440 11579 1293 --
NM_002336chr1284441 4345 4021 3992 2025 1062 802 280 23217 311 23512 3165 --
NM_002351chrX31504 507 132 11442 11186 --
NM_002356chr631837 1826 147 --22402 845 --
NM_002372chr51154 --176 --
NM_002374chr263341 3309 2632 2388 607 166 ------
NM_002381chr21641 ----1682
NM_002395chr6----11486 --
NM_002397chr551717 1470 850 734 142 ------
NM_002398chr221158 1043 ------
NM_002408chr14----1344 --
NM_002444chrX21628 126 --11522 --
NM_002448chr41663 ------
NM_002467chr8----1392 --
NM_002480chr1221405 297 --11323 11312
NM_002486chr921954 1645 1371 --1281
NM_002500chr211110 ------
NM_002504chr921152 140 1454 ----
NM_002515chr1461368 736 598 530 452 418 ------
NM_002519chr112476 92 ------
NM_002524chr1--2272 155 1873 --
NM_002526chr611461 --1371 --
NM_002527chr12161 ------
NM_002538chr52469 152 ------
NM_002544chr172289 32 ------
NM_002545chr1164219 3441 3351 2004 1779 1648 14047 24597 1369 --
NM_002552chr241199 1128 1030 372 ------
NM_002556chr1121476 28 ------
NM_002568chr81303 ----1290
NM_002581chr974718 3938 2022 1781 1328 655 340 ------
NM_002583chr122488 182 172 ----
NM_002595chr121611 --1593 --
NM_002612chr72596 558 ------
NM_002613chr16125411 4605 4496 4463 4188 3695 2075 1824 1650 1329 1229 773 ------
NM_002645chr1152475 1998 1945 687 29 12190 1352 1485
NM_002655chr853519 1705 1589 716 637 --54232 3904 2127 1108 1021 --
NM_002657chr2042940 1477 299 141 --1957 23726 3280
NM_002706chr21736 ------
NM_002709chr252727 2244 978 326 284 ------
NM_002710chr12--1326 --1705
NM_002711chr71819 --1226 1853
NM_002715chr511224 ------
NM_002718chr31478 12525 22225 299 --
NM_002731chr153175 3015 606 194 180 12408 12310 --
NM_002736chr722006 88 --31907 722 584 --
NM_002737chr17106508 6366 5559 4804 4505 2159 1965 1958 1871 998 ------
NM_002740chr322653 741 1957 21137 331 --
NM_002745chr22114568 4550 4363 3547 3332 2961 1779 1151 1133 697 588 ----1858
NM_002748chr1511122 ------
NM_002755chr151790 ------
NM_002767chr17----1443 --
NM_002806chr141298 ------
NM_002822chr1221187 56 --11260 --
NM_002823chr21245 ------
NM_002825chr73599 564 236 --1111 --
NM_002827chr2031589 1500 1223 ----1516
NM_002837chr1233373 1176 796 13106 13366 11640
NM_002839chr942489 2197 2184 798 1369 ----
NM_002844chr631349 1028 206 ------
NM_002847chr761260 443 435 320 270 133 --21557 1142 --
NM_002848chr1221156 147 --1276 --
NM_002855chr1142945 2791 2368 1120 ----12299
NM_002868chr1242394 654 99 77 139 ----
NM_002869chr1152174 1814 1652 574 229 ----1172
NM_002886chr333740 3719 1963 1993 14764 --
NM_002890chr52328 97 ------
NM_002892chr1431634 481 81 1632 ----
NM_002897chr21719 ------
NM_002906chr1152261 1927 939 517 102 12336 ----
NM_002942chr3----1187 1463
NM_002943chr15------140
NM_002957chr943467 2928 2703 123 --33266 2884 927 --
NM_002959chr163805 3694 3651 688 483 186 ------
NM_002971chr33338 281 216 ------
NM_002994chr431333 1306 225 ------
NM_003011chr931457 1142 411 ------
NM_003014chr721175 572 ------
NM_003016chr1731945 1816 1806 ------
NM_003034chr1287597 7550 7533 7335 5022 1753 667 212 11328 35414 889 264 --
NM_003042chr332220 1409 492 21907 883 11452 1778
NM_003043chr373796 3487 3435 3344 3307 2752 1070 23967 3258 21274 890 13662
NM_003051chr1------1597
NM_003069chrX--1630 ----
NM_003071chr341584 1334 534 300 ------
NM_003081chr20--1999 ----
NM_003106chr31688 ------
NM_003108chr257254 7108 6912 4822 1030 34828 899 509 21450 1401 15882
NM_003111chr221112 558 ------
NM_003112chr763142 3002 2712 2536 421 365 ------
NM_003113chr2139 1275 ----
NM_003133chr13980 907 81 1409 ----
NM_003136chr141329 ------
NM_003137chr63604 307 62 1404 ----
NM_003142chr2--1268 ----
NM_003144chr642285 1945 856 708 1457 12072 --
NM_003150chr1741943 1704 931 562 ----1713
NM_003155chr832642 1796 239 22782 1912 ----
NM_003156chr1111393 ------
NM_003161chr1722321 2222 13376 32549 2499 219 1379
NM_003178chr312230 12043 ----
NM_003182chr71428 ------
NM_003182chr71428 ------
NM_003199chr1855702 5410 3960 1558 1452 23554 1597 14752 13564
NM_003211chr1211489 ------
NM_003220chr611121 ------
NM_003234chr332241 1716 1599 --1742 --
NM_003242chr332427 2038 1984 12194 1634 --
NM_003246chr154614 459 361 262 11635 21449 227 --
NM_003255chr1752531 1999 1631 886 223 --12357 --
NM_003262chr344140 3972 3335 1753 44955 4874 1881 1223 24551 1624 23366 35
NM_003269chr62368 148 --196 --
NM_003274chr2122988 2478 ------
NM_003288chr2021579 31 ----1362
NM_003291chr132791 334 2573 548 ----
NM_003298chr354806 4737 1291 675 429 15786 --12253
NM_003304chr331607 1309 1103 1141 ----
NM_003305chr41369 136 ----
NM_003314chr5197 ------
NM_003320chr1143928 1350 669 436 33290 1150 860 23180 357 13510
NM_003338chr1031581 619 77 ----11629
NM_003340chr411267 ------
NM_003341chr31241 ------
NM_003342chr1743240 1306 892 438 1270 ----
NM_003344chr71200 --1618 21735 1700
NM_003348chr122293 188 ------
NM_003349chr202303 109 --21045 602 --
NM_003350chr831064 312 219 1197 ----
NM_003368chr11678 ------
NM_003369chr112491 378 ------
NM_003373chr1051618 1421 580 118 26 ------
NM_003376chr661893 1835 1510 238 215 180 --11160 --
NM_003376chr661893 1835 1510 238 215 180 --11160 --
NM_003385chr2----1203 --
NM_003390chr111333 ------
NM_003392chr323845 3824 11630 33854 2853 58 --
NM_003410chrX11973 ----12633
NM_003411chrY1622 --11306 --
NM_003412chr32690 167 ------
NM_003413chrX42013 1894 462 214 ------
NM_003418chr3--1677 ----
NM_003423chr1942181 1699 1037 667 1577 1829 --
NM_003431chr12169 85 1550 ----
NM_003439chr783221 2586 1427 1111 937 899 744 308 --1258 --
NM_003455chr1121427 1407 --1454 1215
NM_003457chr171440 ------
NM_003458chr372898 1331 1039 751 560 434 215 11092 1304 --
NM_003463chr61221 1366 1670 --
NM_003468chr233437 3265 1583 1578 13877 --
NM_003469chr21410 ------
NM_003471chr321840 57 ----1930
NM_003472chr611024 ------
NM_003473chr101809 ------
NM_003477chr112663 134 ------
NM_003480chr121657 --21973 1875 --
NM_003481chr12------1547
NM_003482chr1232638 2370 317 --12243 --
NM_003483chr12----11124 --
NM_003498chr1672592 2552 2349 2042 813 400 211 --1356 --
NM_003551chr51399 --1315 --
NM_003566chr1243394 2433 1355 432 --22397 1000 --
NM_003574chr1855440 4035 3561 1719 1466 11314 --13949
NM_003583chr1263269 2982 2652 1570 1502 1423 ----1233
NM_003589chr1311076 --162 --
NM_003590chr243455 2828 2736 113 1868 3913 613 527 --
NM_003607chr163938 3311 2933 1354 558 526 13753 11503 --
NM_003615chr343566 1198 682 148 --12772 --
NM_003618chr21180 ------
NM_003622chr1231060 524 430 12299 ----
NM_003626chr1131393 1385 909 --1522 --
NM_003629chr112225 ------
NM_003633chr522261 218 1827 ----
NM_003644chr1746205 5916 2329 1420 21977 1736 --11544
NM_003659chr221197 450 1259 ----
NM_003663chr31750 --23476 2901 --
NM_003664chr53567 211 33 --1462 --
NM_003671chr932840 2683 537 167 12453 --
NM_003676chr12940 303 2817 108 1264 --
NM_003679chr132923 2136 55 --32513 1170 889 --
NM_003692chr921011 346 ------
NM_003702chr82602 64 --1769 1831
NM_003704chr41699 ------
NM_003713chr151713 1543 1087 685 370 1662 ----
NM_003714chr542577 2511 2145 987 ------
NM_003722chr362252 2051 2029 851 306 57 --12337 --
NM_003750chr104897 756 673 128 ------
NM_003758chr1531185 1001 538 162 ----
NM_003758chr1531185 1001 538 162 ----
NM_003759chr463407 2898 1720 1605 1092 796 ------
NM_003762chr1----11478 1897
NM_003764chr62685 667 ------
NM_003772chr112821 330 ----1116
NM_003774chr1262744 2703 2565 2491 464 123 13262 ----
NM_003783chr12253 51 ----1896
NM_003787chr1841235 593 387 191 ------
NM_003794chr31956 1160 --152
NM_003822chr152585 2532 2246 2031 87 ------
NM_003825chr151309 --11187 --
NM_003828chrX1237 --1531 1205
NM_003861chr1452551 2095 2046 834 566 --1102 --
NM_003873chr1032038 1723 529 12488 ----
NM_003884chr341702 1601 686 639 11328 ----
NM_003887chr221575 21 12212 ----
NM_003895chr2131524 858 253 --32149 1477 885 --
NM_003909chr862852 2565 2307 1131 594 143 --1616 --
NM_003913chr694004 3637 3610 3048 2825 1618 525 280 115 1371 13394 --
NM_003916chrX41207 1101 420 296 --11392 --
NM_003919chr71189 ------
NM_003921chr111585 --2161 125 --
NM_003930chr741985 890 659 324 11963 1565 172
NM_003931chr62251 161 --1448 --
NM_003939chr1064039 3724 2619 1458 1085 504 21569 202 ----
NM_003941chr7--12551 11647 12046
NM_003955chr1731623 1041 65 173 --179
NM_003958chr662871 2775 2732 1406 950 197 --13674 --
NM_003968chr31187 --1268 --
NM_003972chr10--1127 --1875
NM_004006chrX1510 --12679 22465 2384
NM_004007chrX1510 --12679 22465 2384
NM_004009chrX1510 --12679 22465 2384
NM_004010chrX1510 --12679 22465 2384
NM_004011chrX1510 --12679 22465 2384
NM_004012chrX1510 --12679 22465 2384
NM_004013chrX1510 --12679 22465 2384
NM_004014chrX1510 --12679 22465 2384
NM_004015chrX1510 --12679 22465 2384
NM_004016chrX1424 --12593 22379 2298
NM_004017chrX1510 --12679 22465 2384
NM_004018chrX1424 --12593 22379 2298
NM_004020chrX1510 --12679 22465 2384
NM_004021chrX1424 --12593 22379 2298
NM_004022chrX1424 --12593 22379 2298
NM_004023chrX1424 --12593 22379 2298
NM_004028chr1843416 3367 3152 1530 12712 ----
NM_004035chr17105229 5036 4956 3651 3267 1862 1739 882 532 39 ------
NM_004050chr1442578 2018 286 223 --22209 388 1885
NM_004061chr51429 ------
NM_004071chr21259 ------
NM_004080chr71390 139 11077 --
NM_004081chrY41561 1145 487 467 1502 ----
NM_004087chr3--21959 357 ----
NM_004089chrX2114 82 ------
NM_004093chr1352344 1167 906 876 824 --1104 --
NM_004094chr1442993 2923 2427 458 ------
NM_004096chr1021753 585 21710 1409 ----
NM_004100chr621997 996 12464 144 --
NM_004117chr612155 ------
NM_004124chr1423562 746 --1498 --
NM_004133chr822484 794 ------
NM_004156chr81201 1179 ----
NM_004162chr3----1964 --
NM_004170chr92651 537 --1272 --
NM_004171chr11129387 9371 8787 8001 7610 6409 2843 2123 1987 1365 781 169 17137 89489 9141 8797 8741 7984 2084 1533 1122 --
NM_004172chr572017 1832 1741 685 528 289 30 1734 ----
NM_004185chr11294 ----156
NM_004197chr61385 ------
NM_004202chrY2669 43 ------
NM_004219chr5147 ------
NM_004225chr861228 960 943 364 344 186 11070 ----
NM_004232chr1812878 12499 1340 --
NM_004241chr101160 ------
NM_004253chr91810 ------
NM_004268chr11------175
NM_004272chr521902 1352 ----11491
NM_004274chr1452774 2410 573 523 22 ----1871
NM_004291chr51394 ------
NM_004313chr171459 1431 ----
NM_004319chr141211 1158 454 360 --22412 1976 --
NM_004321chr253449 2395 2174 575 260 --33281 2285 305 13115
NM_004330chr1511147 ------
NM_004331chr842132 1030 970 90 ----1539
NM_004337chr81324 ------
NM_004338chr1884468 2088 1718 1646 1505 1362 704 401 17070 --26777 1521
NM_004342chr732372 428 195 ----11811
NM_004365chr51122 ------
NM_004371chr121503 1325 --21197 952 --
NM_004380chr1642031 1621 1032 788 --12141 --
NM_004383chr151393 ------
NM_004384chr541624 722 697 328 1392 ----
NM_004385chr51221 ------
NM_004386chr19----1482 2268 24
NM_004392chr133998 652 372 11860 11824 --
NM_004393chr32287 121 11993 ----
NM_004397chr1122776 1156 23283 3144 11475 --
NM_004411chr71531 ------
NM_004415chr63749 731 203 1252 ----
NM_004419chr101215 ----2401 308
NM_004426chr1271596 1363 1264 1238 782 769 625 ------
NM_004432chr952429 2275 1954 656 446 ------
NM_004434chr1411595 --11457 --
NM_004438chr222974 233 ------
NM_004440chr63779 238 137 11937 ----
NM_004441chr321329 184 ------
NM_004449chr211267 ------
NM_004458chrX22445 406 --1744 --
NM_004459chr17--1708 --1526
NM_004464chr453065 1643 454 438 205 --2961 840 12649
NM_004480chr14--1221 ----
NM_004482chr22705 646 ----1188
NM_004487chr31913 ------
NM_004492chr15----163 --
NM_004496chr14--1102 ----
NM_004500chr1431430 328 104 ------
NM_004501chr164140 4131 4014 3984 2855 2556 23789 2546 ----
NM_004504chr222919 811 --12862 --
NM_004505chr1711419 11713 ----
NM_004516chr191333 ------
NM_004520chr51216 --1514 1191
NM_004529chr921388 469 ------
NM_004538chrX2550 254 ------
NM_004540chr211278 ------
NM_004575chr411107 --1395 --
NM_004586chrX74623 4447 3570 1400 482 392 70 21886 49 2305 95 --
NM_004593chr3----1815 --
NM_004612chr954632 3600 3223 1009 409 ------
NM_004622chr241757 1655 495 59 --22082 1813 --
NM_004627chr212692 665 ------
NM_004642chr122490 236 ------
NM_004654chrY21044 126 1917 ----
NM_004655chr1711143 ------
NM_004660chrY4636 562 427 100 11813 2741 571 --
NM_004663chr1541417 1262 1035 572 ------
NM_004680chrY--162 ----
NM_004685chr131930 42297 2071 1145 36 31040 796 652 2327 72
NM_004690chr62700 264 ------
NM_004703chr1752408 1812 717 273 158 12044 12589 1701
NM_004709chrX41719 1484 1123 310 --11611 --
NM_004719chr12--12495 42787 2023 1975 524 --
NM_004726chrX105591 3832 3760 2229 1971 1880 1264 513 393 248 35336 4501 1762 25469 4782 --
NM_004733chr31619 ------
NM_004734chr1352490 2432 2178 2075 869 22022 1127 11174 12649
NM_004744chr473266 3175 1260 1252 998 211 78 --13857 --
NM_004748chr1544206 3433 3159 1299 --13669 1486
NM_004755chr1461179 1136 808 196 165 51 --11113 --
NM_004770chr81163 ------
NM_004772chr511558 ------
NM_004776chr2042260 2239 1261 154 --12606 --
NM_004795chr1331729 269 238 ------
NM_004800chr131190 ------
NM_004808chr1072910 2633 2343 2132 684 577 240 ----193
NM_004824chr64993 583 266 170 ------
NM_004827chr4148 --1528 --
NM_004830chr61828 ------
NM_004834chr223232 2596 1406 23340 2314 11100
NM_004840chrX22135 1911 ------
NM_004841chr131144 418 335 --1436 --
NM_004845chrX44058 3986 3702 3517 23242 3023 --14042
NM_004849chr631467 1378 651 ------
NM_004857chr14124486 4474 3827 3616 3496 3379 1859 1429 624 308 212 132 --11371 --
NM_004859chr1742820 1196 729 503 --22119 2097 --
NM_004866chr563334 3047 1231 1150 762 95 ----13682
NM_004873chr1483129 3031 2348 1237 918 428 310 178 ------
NM_004887chr55875 756 458 359 162 ------
NM_004898chr452714 2221 1072 643 327 1740 --12478
NM_004904chr786601 6320 4935 4864 2023 1278 906 559 ------
NM_004906chr61461 ------
NM_004921chr152246 967 804 507 164 --127 12100
NM_004932chr531742 1280 162 ------
NM_004938chr911117 ------
NM_004956chr733425 1751 895 1672 14310 --
NM_004966chr104961 832 817 626 ------
NM_004976chr1174938 4622 4246 3812 1434 1047 809 --11785 --
NM_004985chr12--21689 39 ----
NM_004992chrX128401 8210 7626 7256 5856 5601 2699 2439 2101 1143 840 317 --21624 203 --
NM_004992chrX128401 8210 7626 7256 5856 5601 2699 2439 2101 1143 840 317 --21624 203 --
NM_004993chr14163 ------
NM_004999chr673648 3529 3418 1774 644 440 364 33799 1738 669 14214 --
NM_005010chr751793 1664 853 668 53 11969 --11840
NM_005011chr721440 171 ------
NM_005012chr11118 ------
NM_005025chr31231 --142 --
NM_005045chr71349 ----1308
NM_005056chr1234136 3884 1502 25505 1594 14686 --
NM_005063chr1033530 3511 124 ------
NM_005065chr1484679 4591 4075 3528 910 565 124 109 1116 ----
NM_005069chr2111692 ------
NM_005087chr31345 ------
NM_005095chr121873 430 ------
NM_005097chr102134 44 ------
NM_005119chr121037 525 ------
NM_005121chr1743075 2969 742 330 ------
NM_005126chr32806 616 11812 1593 --
NM_005135chr1572648 2422 1244 1035 1012 348 150 12566 1949 --
NM_005147chr1611156 --1969 --
NM_005151chr1832110 1708 872 21609 527 11499 --
NM_005154chr151267 ------
NM_005156chr974900 4717 4612 3779 3625 1550 1133 --23689 498 --
NM_005160chr22106737 6316 6246 5893 5831 4437 4203 1422 816 362 25568 5517 24416 2180 --
NM_005165chr172375 348 ------
NM_005168chr221479 1263 ------
NM_005171chr1221220 463 1194 ----
NM_005180chr1031285 316 296 ----11477
NM_005188chr11148317 7715 7399 7157 7066 6392 5794 5186 2601 2216 2045 1877 828 766 1456 15375 --
NM_005190chr61171 --1114 1340
NM_005194chr201558 ------
NM_005197chr1465531 4959 2065 1365 594 390 --35701 5024 478 --
NM_005204chr102817 797 ------
NM_005207chr2221132 70 --1255 --
NM_005215chr185726 461 164 72 50 1519 ----
NM_005230chr12----1524 --
NM_005233chr332042 560 282 1133 2633 529 --
NM_005235chr246824 6750 1983 1283 26881 6637 11182 --
NM_005238chr1153503 1061 987 924 859 ------
NM_005239chr2151517 1448 604 244 193 --31750 1415 1288 --
NM_005244chr202470 189 ------
NM_005245chr41521 ------
NM_005252chr142752 167 ------
NM_005256chr114790 675 628 378 ------
NM_005259chr241043 544 508 80 ----21053 124
NM_005277chr411204 1141 ----
NM_005295chr71206 ------
NM_005302chr71425 ------
NM_005324chr1721994 177 --31819 1734 1481 --
NM_005339chr463775 3034 2938 502 127 50 11502 ----
NM_005349chr41457 ------
NM_005358chr1341798 1769 150 23 1255 --11388
NM_005359chr18--25985 1289 --24453 787
NM_005375chr62887 435 ------
NM_005385chr331919 782 365 --31090 906 381 --
NM_005387chr112595 473 192 ----
NM_005397chr743759 3034 2825 665 --23925 1306 --
NM_005398chr1011353 ------
NM_005399chr143878 3570 718 39 1510 ----
NM_005400chr2--22154 986 12159 --
NM_005402chr741248 707 128 58 ------
NM_005406chr1811358 21089 153 1229 --
NM_005410chr51784 ------
NM_005433chr1822575 633 --12267 --
NM_005436chr1053921 3213 2819 2720 1041 23515 1136 13168 13774
NM_005437chr10----2928 331 11496
NM_005445chr101114 ------
NM_005455chr131843 372 141 --1155 --
NM_005458chr972073 1892 1781 1763 987 558 342 --22181 568 --
NM_005460chr5--138 144 --
NM_005497chr1765905 5880 2419 2003 1237 724 14755 1195 --
NM_005499chr191134 ------
NM_005502chr943082 2286 699 528 12655 ----
NM_005504chr1255575 5381 4762 4400 569 11140 24165 902 16458
NM_005513chr321503 1056 ------
NM_005522chr741198 1148 979 219 1908 166 --
NM_005530chr1521008 110 2472 440 ----
NM_005544chr21403 ------
NM_005563chr11260 ----1741
NM_005577chr6125 ------
NM_005578chr344697 4527 3994 1048 13316 ----
NM_005584chr13----1263 --
NM_005593chr12------1541
NM_005596chr955295 4708 4335 641 580 15968 46110 4218 1909 1698 --
NM_005604chr64894 568 429 323 11684 ----
NM_005625chr84734 419 389 100 ------
NM_005637chr1821760 1296 --1582 11334
NM_005638chrX11494 11500 21756 588 --
NM_005639chr1241886 1683 487 480 11584 1662 --
NM_005644chr11291 --1110 --
NM_005650chr221921 --143 11231
NM_005655chr83915 373 287 --11142 --
NM_005665chr164056 4002 3703 3458 3345 1323 --11708 --
NM_005668chr521323 708 23991 3145 23178 343 14408
NM_005669chr552314 1842 1814 1465 183 --11772 --
NM_005715chr642623 1852 875 852 12126 11934 --
NM_005722chr23927 500 333 1360 ----
NM_005724chr151222 --1102 --
NM_005738chr741986 1621 783 668 ------
NM_005746chr762267 2237 2060 1844 671 451 --11097 --
NM_005748chr1222579 794 --22843 2449 --
NM_005749chr17------1169
NM_005751chr73481 178 145 ------
NM_005756chrX125 --11322 1125
NM_005759chr214221 21020 268 13125 --
NM_005763chr7------1102
NM_005776chr141329 ----1633
NM_005779chr543384 2794 1325 507 --22256 1144 --
NM_005795chr221906 321 1603 --1283
NM_005828chr1775049 4390 1778 1209 916 794 659 --1905 --
NM_005832chr321288 986 ------
NM_005840chrX56959 5131 4849 2008 863 14908 44880 1726 151 58 --
NM_005841chr41464 --11164 --
NM_005843chr25748 651 566 550 478 ----1126
NM_005857chr1----1107 --
NM_005868chr742222 2043 1902 723 12514 ----
NM_005880chr1621562 221 ------
NM_005882chr42817 241 ------
NM_005895chr1241509 1411 1228 607 11576 24118 868 11184
NM_005900chr41977 ------
NM_005901chr18108398 8224 7510 7462 6870 6088 5358 2607 2024 140 1777 17592 28531 7905
NM_005902chr15124548 4536 4479 4303 4124 3831 3232 3100 2949 1793 1352 1031 ------
NM_005903chr584415 3405 3323 2002 1664 1303 739 68 1878 14633 1461
NM_005904chr1841313 1169 554 284 ------
NM_005908chr4255 44 ------
NM_005909chr524076 922 1361 11678 --
NM_005911chr22386 232 --11130 --
NM_005917chr2166 ------
NM_005933chr1162943 2875 2394 859 386 104 --12037 --
NM_005941chr833395 2743 1559 ------
NM_005943chr651574 1526 1170 570 53 ----11212
NM_005955chr123715 3583 24740 618 14528 --
NM_005966chr231599 927 286 ----12097
NM_005977chr133336 278 54 ------
NM_006007chr983769 3161 1694 1641 1341 1285 732 327 --23523 3415 14368
NM_006011chr1544302 2925 2662 559 3610 527 79 11638 --
NM_006016chr621971 623 ----11991
NM_006036chr231825 780 747 --12318 --
NM_006037chr254283 3172 1571 1039 110 --41051 837 360 270 --
NM_006047chr2013010 11159 --12883
NM_006048chr11261 --11185 --
NM_006054chr1111204 ----1175
NM_006079chr61742 ------
NM_006080chr752870 2758 1907 1096 938 ------
NM_006089chrX1231 ------
NM_006090chr11230 ------
NM_006094chr842421 1675 918 522 --32096 1961 662 --
NM_006095chr441171 1054 497 166 ------
NM_006106chr1143205 2902 2870 2572 --12472 --
NM_006109chr14274 60 ------
NM_006136chr751368 1323 1025 900 511 1143 ----
NM_006141chr1652296 2226 1978 566 85 --21892 254 --
NM_006148chr1722395 31 --1692 12087
NM_006154chr1552368 2006 1839 247 136 --12661 --
NM_006164chr21155 ------
NM_006190chr22869 109 ------
NM_006194chr1421245 237 --1968 --
NM_006195chr91209 ----1339
NM_006203chr554804 4577 4072 3650 2102 45045 4369 703 439 11680 --
NM_006206chr432216 2041 849 --12747 1729
NM_006209chr8122 ------
NM_006212chr155270 5198 4578 2087 1124 ------
NM_006224chr1722129 1998 ------
NM_006226chr241253 1178 473 402 --21098 510 --
NM_006238chr651647 730 568 380 92 --11569 --
NM_006241chr331863 1645 95 ------
NM_006245chr63804 222 212 --1311 --
NM_006251chr522057 39 22257 223 11228 --
NM_006252chr167242 7188 5806 5046 4729 127 45488 5127 4833 2314 ----
NM_006256chr162710 2475 2204 2090 206 148 --12600 --
NM_006258chr1021409 1056 ----1634
NM_006265chr81148 ------
NM_006282chr2094350 4256 3805 3386 1841 1823 1506 1448 783 ------
NM_006283chr853520 3477 3402 1415 1040 --33139 563 124 --
NM_006298chr663248 2954 2601 2496 2392 1267 ------
NM_006303chr71132 ------
NM_006306chrX85778 5636 4528 4090 4010 791 140 126 24996 2221 14068 --
NM_006310chr17--1252 ----
NM_006317chr51322 ------
NM_006320chr421160 1144 ------
NM_006323chr44594 513 264 67 ----151
NM_006330chr8----130 --
NM_006334chr91268 ------
NM_006350chr51128 ------
NM_006359chrX1622 --32121 729 602 --
NM_006364chr1411107 ------
NM_006366chr621053 515 11127 11132 --
NM_006371chr364557 4196 4083 3947 3497 3448 14270 ----
NM_006373chr17----21191 1078 1541
NM_006375chrX31874 1588 550 --31265 661 56 --
NM_006377chr921224 488 ------
NM_006380chr1731617 1576 489 12893 23102 175 13354
NM_006382chr17--193 --1206
NM_006386chr2232054 1922 1802 11600 32392 1730 918 --
NM_006415chr941254 1054 956 380 ------
NM_006416chr6--184 ----
NM_006421chr811092 ----1359
NM_006434chr1062526 2076 1083 838 589 46 12881 1302 --
NM_006457chr433392 2920 710 ----12690
NM_006464chr244160 3743 3647 144 1750 13725 --
NM_006465chr1532227 305 101 11648 11966 --
NM_006467chr53413 405 93 1621 1521 --
NM_006482chr1263269 2982 2652 1570 1502 1423 ----1233
NM_006489chr1461368 736 598 530 452 418 ------
NM_006496chr12630 86 1141 ----
NM_006517chrX32227 1435 85 ------
NM_006534chr2031299 841 436 --13172 --
NM_006538chr233858 1123 882 12739 ----
NM_006544chr1454114 2434 2125 1590 1068 --45577 1863 533 86 --
NM_006546chr1744766 4484 935 690 2735 240 16144 --
NM_006547chr721994 455 ------
NM_006549chr1242248 1864 893 98 --12913 12416
NM_006560chr112408 75 --196 --
NM_006561chr1035529 2375 985 15412 15390 --
NM_006565chr161103 ------
NM_006584chr17146 ------
NM_006587chr431100 1089 95 2529 277 ----
NM_006595chr11122 --31819 1744 737 --
NM_006599chr16108123 8025 7452 6025 5375 2016 1827 978 575 150 --1479 13180
NM_006601chr1211047 ------
NM_006603chrX11487 ------
NM_006609chr252542 1871 1088 277 268 1298 --12136
NM_006614chr333295 674 182 23183 2294 ----
NM_006620chr634394 4045 3539 1648 --23241 338
NM_006625chr11169 ------
NM_006625chr11169 ------
NM_006625chr11169 ------
NM_006628chr1534204 3910 2950 --11228 1809
NM_006629chr1872558 2428 2201 2076 2025 1941 125 --11026 12804
NM_006636chr22866 294 ------
NM_006646chr1361211 1171 1153 977 875 93 12668 22469 1128 --
NM_006648chr91115 ------
NM_006654chr1264712 3653 3185 3056 1360 523 14646 ----
NM_006667chrX3890 262 107 ------
NM_006682chr721141 920 1902 1683 --
NM_006690chr2052258 2048 1762 1557 775 --11854 --
NM_006699chr132340 1842 347 22655 1986 ----
NM_006706chr51125 ------
NM_006708chr621257 76 1924 --1448
NM_006717chr96942 899 667 609 175 153 --1348 --
NM_006721chr101311 ------
NM_006722chr323073 799 --12710 12812
NM_006729chrX94629 4287 3793 3455 2069 1955 655 531 428 --11457 15395
NM_006734chr631496 551 277 --11014 --
NM_006735chr7124 ------
NM_006738chr15104259 4192 4014 3887 1477 1462 1158 990 732 601 23255 506 1285 --
NM_006750chr16118012 7279 7129 7101 6688 6261 6239 1425 1215 352 100 --36422 5286 1592 25274 71
NM_006754chr7171 --21196 824 --
NM_006756chr841275 1254 1194 1083 --11452 --
NM_006766chr832667 1686 490 ------
NM_006778chr671590 1378 782 727 567 266 55 --133 --
NM_006805chr5----1477 --
NM_006826chr21512 --21007 809 --
NM_006827chr1433213 2370 101 1918 11013 12148
NM_006839chr21117 ------
NM_006852chr1742261 1098 654 533 1469 ----
NM_006856chr12----1998 --
NM_006885chr1643285 3033 723 372 ----23907 3786
NM_006888chr1453092 3016 1203 338 141 1790 ----
NM_006912chr132356 1709 193 1605 1628 1676
NM_006914chr91458 --11488 --
NM_006922chr222320 314 ------
NM_006937chr17----1188 --
NM_006943chr2072600 2468 2382 1115 1043 934 708 13266 ----
NM_006951chr101670 --1540 --
NM_006956chr732316 2122 559 ------
NM_006981chr942752 1029 954 287 ------
NM_006988chr21--3859 468 238 ----
NM_006996chr12672 291 ------
NM_007005chr911577 --1238 --
NM_007006chr1673411 2729 2566 1385 545 404 49 13027 ----
NM_007011chr15126542 6394 6217 5906 4987 2570 2342 1940 1428 1205 1123 613 --34950 4944 292 --
NM_007013chr82949 717 ------
NM_007017chr51598 ------
NM_007023chr2--1741 11014 --
NM_007030chr5114723 4561 4541 4365 3241 3185 1461 1419 1231 956 573 ------
NM_007038chr2166048 5923 4878 4274 3790 1294 25024 4310 25055 1426 15463
NM_007045chr61586 ------
NM_007050chr2087587 7446 6999 5450 5160 2241 2176 1117 27094 2182 67833 7466 6839 5948 1642 260 12066
NM_007064chr311562 ----1614
NM_007067chr1731581 1418 629 --1100 --
NM_007073chr664040 3605 3164 1097 708 625 --12600 --
NM_007106chr1331131 639 569 1730 ----
NM_007107chr312343 --12233 1384
NM_007111chr131869 ------
NM_007114chr363317 2209 901 259 234 40 --22762 1039 --
NM_007118chr51783 ------
NM_007145chr192119 91 21449 917 1235 --
NM_007146chr1732596 910 676 21946 875 22052 597 --
NM_007159chr331715 1139 1099 ----21697 115
NM_007166chr1111261 ------
NM_007172chr2233077 1319 1173 ----22947 761
NM_007174chr1241588 852 262 88 --12312 --
NM_007178chr12161 ------
NM_007191chr121175 ------
NM_007200chr15104259 4192 4014 3887 1477 1462 1158 990 732 601 23255 506 1285 --
NM_007203chr963758 3244 2762 1450 413 73 --12433 --
NM_007214chr6186 11111 ----
NM_007218chr8------198
NM_007222chr821542 260 ------
NM_007236chr1521850 107 11953 ----
NM_007246chr42177 23 ------
NM_007249chr13109385 8240 7321 6944 6375 5842 3471 2998 2533 755 16044 22928 146 12714
NM_007275chr341096 959 267 26 ------
NM_007287chr363089 3003 2469 1990 584 386 12224 --1923
NM_007288chr363089 3003 2469 1990 584 386 12224 --1923
NM_007289chr363089 3003 2469 1990 584 386 12224 --1923
NM_007292chr17105229 5036 4956 3651 3267 1862 1739 882 532 39 ------
NM_007345chr1822346 63 --2847 407 1760
NM_007350chr1254291 4216 3849 905 58 --11025 21053 721
NM_007361chr141586 ------
NM_007363chrX--1898 ----
NM_007375chr122727 572 --11850 1511
NM_012081chr542377 2269 1394 935 11218 1720 --
NM_012082chr83383 360 303 --1804 --
NM_012084chrX----1547 --
NM_012089chr131368 1284 1230 ------
NM_012092chr241641 1615 1291 532 11309 132 --
NM_012095chr1062238 2177 717 570 529 104 --12359 1811
NM_012096chr321024 417 ------
NM_012097chr252036 1976 1478 688 388 ----21699 279
NM_012098chr92496 302 171 ----
NM_012104chr1163023 1536 1261 358 216 101 1609 --23255 1105
NM_012104chr1163023 1536 1261 358 216 101 1609 --23255 1105
NM_012110chr4--1303 ----
NM_012120chr632869 1949 848 ------
NM_012141chr1364042 3743 3371 1446 923 492 12944 1395 --
NM_012154chr8--1819 ----
NM_012156chr2053295 3194 2950 2604 2428 --23230 148 --
NM_012158chr1341705 749 319 99 ------
NM_012164chr986732 6151 6101 5724 5215 2785 2348 1914 --11817 --
NM_012193chr1164820 3879 2181 1989 1810 633 --11048 11160
NM_012210chr951192 1021 977 266 75 ------
NM_012214chr286128 5608 4943 4121 2459 1233 647 60 11829 1474 --
NM_012216chrX1111 ------
NM_012218chr1982921 2684 2484 2208 2071 2043 2035 491 --21194 858 --
NM_012224chr43752 409 40 --1259 --
NM_012233chr2------11135
NM_012234chr332836 909 412 --12865 --
NM_012238chr1031299 604 456 ------
NM_012249chr223157 2603 1568 ----
NM_012252chr745046 4605 1170 669 24137 271 11246 21676 1444
NM_012257chr7----1297 --
NM_012262chr1115158 4821 4606 3662 2077 1798 1389 1370 930 636 343 ------
NM_012279chr531556 1511 1343 --1106 --
NM_012281chr711883 32401 1918 242 ----
NM_012287chr353718 3495 3408 1376 377 --24481 3147 --
NM_012294chr753296 3107 3089 1008 236 22838 2764 2832 67 --
NM_012296chr1162819 1126 894 277 186 130 --31048 1031 932 13319
NM_012297chr462534 1596 1053 888 776 126 --12092 --
NM_012300chr522276 156 --11671 --
NM_012301chr722012 112 ----11718
NM_012304chr572304 1028 1021 771 756 642 79 ------
NM_012307chr181664 ------
NM_012309chr1164081 3153 1494 1069 1021 878 21218 724 13992 21720 771
NM_012320chr1631387 966 130 ------
NM_012325chr201121 ------
NM_012329chr1721105 628 ------
NM_012333chr121681 1161 ------
NM_012334chr5104730 4631 4595 4506 4436 3573 3233 1613 1527 1189 23241 2925 23823 3032 --
NM_012338chr72386 63 --1125 --
NM_012345chr1341803 1309 614 34 1536 ----
NM_012347chr682926 2772 2624 2548 999 839 422 62 154 1277 --
NM_012382chr523817 1769 21210 1087 13657 11052
NM_012388chr1522599 1925 --12009 12496
NM_012399chr221315 21728 301 2227 74 --
NM_012412chr72603 177 --1109 --
NM_012419chr61526 ------
NM_012428chr151127 --1391 --
NM_012454chr6----1402 --
NM_013231chr1453477 3324 2869 561 258 14024 12676 --
NM_013233chr2--1226 ----
NM_013261chr453754 3154 3098 2369 1389 --1235 --
NM_013267chr122185 38 ------
NM_013269chr1234438 4004 1043 --23161 38 --
NM_013281chr2011491 --21427 398 --
NM_013293chr71717 ------
NM_013372chr1522791 222 12391 12330 --
NM_013374chr352834 2088 1973 1054 442 1603 ----
NM_013381chr1211665 ----1453
NM_013390chr941737 1528 1371 1141 ------
NM_013437chr831320 1295 912 ------
NM_013438chr931267 349 145 ----11625
NM_013447chr1953756 3706 995 859 220 --11520 1265
NM_013943chr143038 2378 722 631 1933 11027 --
NM_013995chrX------22211 48
NM_013996chr71428 ------
NM_013996chr71428 ------
NM_013997chr71428 ------
NM_013997chr71428 ------
NM_013998chr71428 ------
NM_013998chr71428 ------
NM_014000chr1051618 1421 580 118 26 ------
NM_014011chr252392 2255 2066 839 59 --174 --
NM_014016chr311289 --1119 11468
NM_014021chr183385 3267 2999 2988 2727 832 265 213 --13063 12417
NM_014023chr106966 729 572 488 259 39 --12116 --
NM_014028chr622897 2385 ----12619
NM_014033chr1212305 ------
NM_014034chr621543 280 124 2242 76 --
NM_014043chr341015 613 352 265 --157 --
NM_014048chr16135016 4678 4596 4564 3586 3449 3353 1686 1643 1064 321 282 208 ------
NM_014056chr331694 1559 704 ----11917
NM_014057chr951601 1399 1303 391 326 21590 1549 133 11221
NM_014071chr201344 ------
NM_014106chr1522306 404 ----1451
NM_014109chr831090 856 339 ------
NM_014112chr8104920 4895 4784 4709 4453 4373 3697 3615 1831 883 11230 1919 14170
NM_014117chr1622682 721 ------
NM_014141chr7164915 4894 3964 3379 3359 3275 3230 1850 1746 1740 1727 1677 1472 862 91 69 2668 112 24753 3395 13265
NM_014155chr1175422 5336 2670 2300 1968 1871 136 16891 35601 4637 470 26392 2710
NM_014157chr1643965 3154 1613 958 13956 1260 33550 3213 478
NM_014181chr21844 2495 392 ----
NM_014191chr1231018 381 318 ------
NM_014240chr352986 1666 1070 762 260 23559 3186 13652 --
NM_014243chr422139 800 11678 11759 --
NM_014268chr1821228 1094 11038 ----
NM_014289chrX11360 ------
NM_014294chr811106 ------
NM_014309chr2285431 5399 5156 3604 3510 1795 1305 1171 --11583 33698 1059 967
NM_014319chr122330 269 ------
NM_014323chr2211079 ------
NM_014325chr1232129 349 98 1619 11408 --
NM_014331chr487488 6941 5976 2109 1493 560 317 144 --36754 5752 438 25872 5006
NM_014333chr1132800 2001 529 --1179 --
NM_014368chr962065 1682 1660 800 724 197 --11582 --
NM_014372chr152041 1575 462 265 155 --11763 --
NM_014376chr53887 617 119 1204 ----
NM_014381chr1453050 3020 813 234 85 ----12682
NM_014382chr3--21102 314 1244 --
NM_014391chr101584 --1143 --
NM_014393chr81245 ----11536
NM_014394chr1021013 784 --1207 --
NM_014395chr411943 ------
NM_014399chr71111 --1902 --
NM_014415chr331724 593 476 ----11338
NM_014418chr1421927 797 21631 1396 ----
NM_014423chr554909 3453 1331 791 225 1395 14945 --
NM_014432chr62153 75 --2563 332 --
NM_014445chr332246 424 98 --32064 954 452 22192 2119
NM_014447chr421402 101 ------
NM_014456chr1031797 673 96 169 1736 --
NM_014458chr12996 145 1555 ----
NM_014469chr111668 192 ----
NM_014488chr114669 522 239 135 --1453 --
NM_014491chr72716 108 1910 ----
NM_014517chr341285 216 207 189 ----11548
NM_014548chr1511512 1505 --11089
NM_014554chr1242093 1496 780 431 1839 2648 152 --
NM_014562chr22817 333 ------
NM_014572chr132266 251 21808 1518 ----
NM_014584chr142431 363 --11650 --
NM_014586chr2154832 3420 1357 251 79 22967 992 14371 --
NM_014592chr52558 251 1652 ----
NM_014606chr411382 ------
NM_014607chr211737 --11979 --
NM_014612chr9----1263 1482
NM_014613chr532514 2439 1943 22356 2148 32205 1174 468 --
NM_014616chr332561 795 158 21182 166 ----
NM_014633chr11----1480 --
NM_014634chr2262894 2622 2578 1430 538 394 --11363 --
NM_014646chr1853184 2783 2381 973 895 --1952 --
NM_014647chr161317 1392 11957 --
NM_014660chr7198 ----1890
NM_014661chr1073720 3646 2848 1457 1067 1024 855 11162 ----
NM_014670chr21104 ------
NM_014677chr831242 1206 444 ------
NM_014679chr112961 180 ------
NM_014680chr17127 ------
NM_014702chr612518 23214 503 23465 2985 1709
NM_014707chr722053 365 ------
NM_014720chr1011302 ----11589
NM_014721chr695733 5181 5014 4992 4752 2626 1585 1227 701 12233 34573 2670 1362 1458
NM_014729chr821433 116 --12194 1690
NM_014730chr1295117 5012 4998 4733 4571 4000 3634 3299 1097 ----15255
NM_014730chr1295117 5012 4998 4733 4571 4000 3634 3299 1097 ----15255
NM_014732chr1644009 2199 1027 395 --24584 850 --
NM_014733chr522026 228 2448 164 11754 --
NM_014735chrX2701 83 --1179 2695 659
NM_014739chr653533 2996 2596 997 88 --24103 304 1599
NM_014743chr442634 2271 2199 1944 --12246 --
NM_014746chr274210 3697 3473 3254 3007 431 217 13164 22676 1474 --
NM_014747chr164965 4582 4169 3880 1578 1278 13600 15604 1739
NM_014755chr223323 863 --1784 1303
NM_014758chr1151901 1773 1633 887 376 11891 ----
NM_014760chr331644 665 595 11682 1398 11819
NM_014761chr165842 756 391 379 335 1128 ----
NM_014766chr761442 1167 1095 1086 893 806 13463 33826 3373 2416 --
NM_014781chr8--11252 ----
NM_014783chr1521171 678 11488 ----
NM_014787chr142682 2521 2367 205 1517 ----
NM_014795chr2------1282
NM_014803chr1072725 1908 1099 1022 899 227 220 --1538 --
NM_014810chr143601 3434 3105 615 11347 12800 --
NM_014812chr12497 63 ------
NM_014820chr311954 1264 ----
NM_014826chr163938 3311 2933 1354 558 526 13753 11503 --
NM_014827chr121622 1117 ------
NM_014829chr522292 165 --21819 324 --
NM_014830chr1233770 1233 157 13904 1617 --
NM_014835chr2051575 1419 710 679 309 ------
NM_014836chr1021331 67 ----1169
NM_014838chr2242015 527 402 111 11882 ----
NM_014839chr142425 2310 2008 472 --12505 1188
NM_014840chr1222940 2884 32994 935 864 1309 12831
NM_014841chr63918 851 508 --11187 --
NM_014849chr12958 943 --134 11058
NM_014862chr1584064 3822 2975 2621 1572 1039 973 918 --43842 1195 800 502 --
NM_014864chr134014 828 511 155 14042 --
NM_014872chr93869 522 279 ----11988
NM_014873chr154843 3549 1343 1164 789 ------
NM_014874chr131778 421 122 21827 1286 ----
NM_014877chr1767418 5954 5815 2738 2695 1675 11817 36720 4856 1507 14850
NM_014888chr7----2282 31 2583 236
NM_014892chr61607 1469 ----
NM_014893chrY42380 2029 466 334 ------
NM_014897chr1742615 2221 2113 498 13029 ----
NM_014898chr1952339 2229 2207 1856 43 --2114 52 --
NM_014899chr543056 2212 854 663 1404 ----
NM_014902chr2011031 ------
NM_014903chr1232339 208 93 12149 11662 1531
NM_014904chr1073976 3878 3679 3636 3521 2589 313 ------
NM_014906chr1731494 1273 902 --1158 --
NM_014912chr1032437 1154 27 12501 ----
NM_014920chr613618 --13685 --
NM_014923chr1341454 688 630 118 11780 ----
NM_014935chr173474 3388 3302 2734 2413 953 278 23669 3380 ----
NM_014936chr632309 502 121 --22520 871 --
NM_014937chr1041349 1276 463 230 ------
NM_014939chr1821552 244 11014 1156 --
NM_014946chr212663 1254 ----
NM_014947chr11189 --1898 --
NM_014950chr1411728 --21161 63 --
NM_014952chr1542056 1309 485 203 --172 11913
NM_014953chr1374304 3535 3023 1324 1094 974 330 --1108 --
NM_014961chr412102 ------
NM_014962chr2042822 2049 1922 1814 --22634 1958 21932 1880
NM_014964chr1762234 1781 621 423 223 29 1568 ----
NM_014988chr472210 1720 1095 953 923 867 154 12340 1997 --
NM_014989chr651922 1878 756 581 82 ------
NM_014991chr41167 1203 12475 --
NM_014997chr71284 ------
NM_015000chr1242707 2375 2274 670 --12935 --
NM_015009chr32664 100 --1307 --
NM_015017chr12829 364 ----11200
NM_015020chr1663592 2829 2813 1364 878 247 ------
NM_015024chr821462 170 ------
NM_015025chr212187 12743 --12321
NM_015026chr1243811 3732 1810 1160 23407 1254 --1406
NM_015032chr13--11978 ----
NM_015035chr20136411 5861 5171 5027 4838 4565 4165 4102 2092 1688 1599 1523 1506 26176 1100 12403 26329 511
NM_015039chr164023 3778 2811 2701 996 327 24323 2997 ----
NM_015040chr233299 2209 399 ------
NM_015042chr1561032 730 624 437 413 285 --11131 11658
NM_015049chr233014 339 39 23201 2143 42347 2306 1059 831 1359
NM_015051chr932459 2342 994 --12785 --
NM_015057chr132496 274 ------
NM_015068chr763486 1029 930 830 178 165 --1116 --
NM_015069chr161641 ------
NM_015071chr5136229 6112 5822 5533 5283 4758 4573 4432 1950 1419 942 452 365 --21230 839 --
NM_015074chr1104767 4639 3874 3546 3294 1220 1106 1080 626 416 --13035 --
NM_015076chr654194 1120 534 463 39 11699 --13876
NM_015077chr1754742 4669 4478 3252 1485 11769 14718 11110
NM_015082chr522558 882 --12134 --
NM_015087chr1352701 2529 1888 754 278 ------
NM_015091chr143813 598 143 ------
NM_015092chr1663719 3644 2903 1833 1519 333 --13444 --
NM_015093chr611340 ------
NM_015110chr982292 2098 1856 1832 1671 925 820 612 ------
NM_015113chr1772218 1961 799 655 529 521 453 --2395 184 --
NM_015115chr443173 2723 2491 1107 --32143 988 85 --
NM_015116chr1331706 1498 377 ----1165
NM_015129chrX11529 11495 1255 1494
NM_015132chr751996 1974 1843 1647 755 ----1350
NM_015144chr1683511 3194 3121 3086 2895 2873 2551 670 ------
NM_015147chr253127 995 926 881 551 --33212 1044 811 --
NM_015149chr151746 1613 1415 156 144 ----1868
NM_015155chr1053377 2354 924 578 273 --1713 --
NM_015156chr1453888 2922 1572 1169 554 --12448 13545
NM_015161chr1631381 569 317 ------
NM_015163chr142777 468 ----1587
NM_015170chr84691 550 235 80 --12269 --
NM_015172chr1----1573 --
NM_015176chr131519 1238 1099 ----11540
NM_015184chr31581 ----1114
NM_015185chrX52257 2073 1871 125 79 ------
NM_015192chr202516 102 ------
NM_015199chr352734 2613 1087 956 65 --12661 --
NM_015205chr1354203 3244 1535 1047 29 --13396 --
NM_015208chr1843383 3030 3009 50 23676 439 12804 33694 3118 3103
NM_015215chr143071 2708 1243 600 12659 12770 --
NM_015226chr1673381 3230 2741 2515 2141 689 85 --13112 --
NM_015231chr111789 ------
NM_015236chr421408 1283 --11092 --
NM_015238chr51445 ------
NM_015247chr1634936 1326 188 --21440 301 --
NM_015252chr21891 ------
NM_015265chr22764 352 ----12491
NM_015268chr32523 186 --1247 --
NM_015269chr11620 ------
NM_015271chr483225 2930 1649 1259 1052 909 694 319 --22637 737 --
NM_015272chr16------1357
NM_015277chr182585 513 ------
NM_015278chr631248 235 148 13388 --12790
NM_015282chr232389 1881 916 196 22566 801 --
NM_015284chr161701 1480 1410 1303 738 487 ------
NM_015285chr181197 --21651 829 1319
NM_015288chr553374 3117 1510 1401 537 ----23404 516
NM_015291chr143491 2391 1305 769 --23182 335 --
NM_015293chr61572 139 --1552
NM_015294chr1731012 184 158 ------
NM_015296chr132792 212 ----2783 84
NM_015299chr1473506 1605 1354 1225 460 238 102 13204 11112 14046
NM_015310chr8148232 7313 6922 6807 6729 6714 5318 5215 5098 3257 2856 2723 2469 477 26694 1475 25154 636 --
NM_015313chr1184581 3961 3520 1328 767 702 548 442 --34394 1256 372 11831
NM_015314chr721992 314 --1155 1737
NM_015317chr232548 2395 969 21950 410 2354 247 --
NM_015326chr122756 2085 --1801 12980
NM_015330chr2232339 1589 235 --21746 883 12504
NM_015335chr1232559 2455 927 11745 2480 147 --
NM_015336chr1231690 997 681 --2990 24 1791
NM_015338chr2041929 1724 460 112 ------
NM_015349chr652700 2676 1039 1030 624 --2888 820 --
NM_015355chr1731919 229 105 ------
NM_015359chr842603 2410 1067 881 11102 1871 --
NM_015360chr51172 --1146 --
NM_015365chrX43598 3326 3304 234 23962 2948 ----
NM_015374chr223546 488 264 1103 ----
NM_015385chr1062526 2076 1083 838 589 46 12881 1302 --
NM_015388chr61133 ------
NM_015393chr453404 2760 2464 1056 75 11395 ----
NM_015394chr1232425 2181 176 22324 540 1589 --
NM_015396chr341366 1297 1091 471 --155 --
NM_015407chr3----1161 --
NM_015409chr1282750 2524 2301 1963 1711 905 622 384 ------
NM_015416chr122944 150 ----1646
NM_015423chr1111642 --11662 --
NM_015435chr81239 --21046 277 11070
NM_015436chr493131 2954 2316 2195 1302 1214 1203 876 146 23309 129 12728 --
NM_015439chr61422 ------
NM_015446chr1--11471 11155 --
NM_015455chr573530 3468 3306 2777 1158 1091 967 --22809 429 --
NM_015460chr32514 466 --11920 --
NM_015475chr22681 130 ------
NM_015483chr731072 862 93 ------
NM_015503chr16------1714
NM_015508chr321355 461 11095 ----
NM_015513chr32777 114 ------
NM_015520chr362515 792 537 492 468 94 11904 12833 1340
NM_015531chr111145 ------
NM_015534chr12408 280 1831 1147 --
NM_015550chr772962 2794 2653 2268 1295 1019 627 164 ----
NM_015553chr664726 3597 3525 3460 1545 112 --14370 --
NM_015554chr1532572 2073 72 --178 32815 2604 650
NM_015564chr552733 2519 2297 2201 1318 --23398 943 --
NM_015565chr21----21464 34 --
NM_015567chr1341302 465 351 209 ------
NM_015569chr113217 --24179 655 1569
NM_015571chr63981 819 483 ------
NM_015576chr352951 1891 1085 849 781 --11197 --
NM_015610chr731154 1125 317 --1857 --
NM_015635chr9----1665 --
NM_015640chr115077 13909 34318 823 653 --
NM_015652chr10----1269 --
NM_015676chr141272 ------
NM_015713chr833082 2467 951 --1942 --
NM_015840chr162035 1966 1883 865 812 284 --22618 268 --
NM_015841chr162035 1966 1883 865 812 284 --22618 268 --
NM_015852chr742844 2551 2351 2311 ------
NM_015866chr121096 69 ------
NM_015874chr41457 ------
NM_015878chr81789 ------
NM_015879chr18117928 7607 7399 6366 6327 6004 5961 5861 3412 2028 1257 17150 11506 27542 7215
NM_015885chr111698 ------
NM_015886chr885045 4727 4571 4332 2104 1895 1172 733 15020 11587 --
NM_015888chr142722 2609 2545 206 13219 --33179 870 712
NM_015891chr642077 1950 1759 282 ------
NM_015912chr831913 1868 409 --12265 --
NM_015915chr141271 ------
NM_015932chr132179 87 ------
NM_015975chrX21587 203 1346 ----
NM_015980chr531423 397 353 1637 ----
NM_015986chr171211 ------
NM_015994chr14----1294 --
NM_015999chr1----1721 --
NM_016003chr731154 1125 317 --1857 --
NM_016021chr632440 2337 2134 ------
NM_016023chr841978 1475 872 770 11360 ----
NM_016025chr16------22017 1515
NM_016041chr171125 --1267 --
NM_016066chr1128 ------
NM_016072chr1252155 1959 771 681 141 173 ----
NM_016073chr151779 ------
NM_016076chr142012 615 547 75 --1417 --
NM_016083chr633775 1424 24 --1824 --
NM_016089chr31552 ------
NM_016096chr811658 21894 1858 ----
NM_016098chr61343 ------
NM_016099chr82341 260 --11011 --
NM_016100chr20----1393 --
NM_016120chrX1764 11198 --1833
NM_016121chr121030 70 --1208 --
NM_016123chr123472 246 135 ------
NM_016129chr4174 ------
NM_016131chr22870 564 ------
NM_016132chr1533322 3052 2848 13457 1897 1826
NM_016133chr211609 --1440 --
NM_016169chr1063109 2446 2434 2192 2060 931 ------
NM_016206chr3108567 8157 6887 6481 3532 3342 2634 2484 516 191 32931 2038 35 15898 18404
NM_016213chr15128 ------
NM_016224chr631742 1686 244 ------
NM_016231chr1721674 1572 --11712 --
NM_016252chr21901 ----146
NM_016255chr642780 1052 954 306 ------
NM_016258chr11580 1278 ----
NM_016260chr296626 5531 2456 2141 1928 1918 1907 904 691 --37560 5238 2538 14722
NM_016269chr41439 --21102 277 1245
NM_016275chr32853 106 ------
NM_016279chr5137 ------
NM_016281chr121244 1768 ----
NM_016287chr11370 --11846 2680 417
NM_016302chr31194 ------
NM_016308chr111490 --1125 --
NM_016315chr211787 ------
NM_016316chr22490 204 ------
NM_016322chr952481 2333 2232 2084 291 22741 2646 ----
NM_016329chr31334 ----138
NM_016338chr531073 997 768 --2252 240 --
NM_016351chr71603 ------
NM_016373chr164601 299 155 25 ------
NM_016374chr131392 96 21 177 2494 302 1173
NM_016374chr131392 96 21 177 2494 302 1173
NM_016376chr1763938 3928 3389 3295 1330 1251 --13683 --
NM_016396chr1563012 2732 2196 1107 979 844 ----12327
NM_016413chr13----1396 --
NM_016418chr22103706 3353 2971 2660 2605 2474 1187 630 557 355 11396 ----
NM_016424chr1721427 1277 --31376 1366 453 --
NM_016451chr11--1254 ----
NM_016454chr152247 80 ------
NM_016472chr1421030 363 --11142 --
NM_016480chr53351 264 242 2759 35 ----
NM_016507chr1711120 12897 ----
NM_016513chr613618 --13685 --
NM_016530chr1573448 3361 3060 2975 1140 110 28 33545 3082 327 163 --
NM_016531chr432922 1477 1181 --21258 486 --
NM_016542chrX21146 601 --11736 --
NM_016545chr11732 ------
NM_016577chr374419 4038 3224 2793 2756 1768 903 ------
NM_016578chr111615 ------
NM_016586chr141408 ------
NM_016603chr531628 1457 99 --11495 --
NM_016612chr8--1427 ----
NM_016620chr121286 257 ------
NM_016626chr1831707 1450 1160 ------
NM_016628chr102786 648 1722 1816 --
NM_016652chr2011710 11119 11226 --
NM_016836chr21719 ------
NM_016839chr21719 ------
NM_016929chr673862 3834 3648 3438 3128 2793 1605 --13062 13770
NM_016937chrX1182 --1695 --
NM_016946chr11631 12956 ----
NM_016953chr285652 4073 1938 1386 841 207 150 126 14384 --14247
NM_017412chr821157 263 --21328 113 --
NM_017415chr533459 2762 1416 --23637 1827 --
NM_017416chrX----139 165
NM_017420chr1443690 3288 3031 1042 12495 ----
NM_017423chr431465 461 303 ------
NM_017440chr12--1211 ----
NM_017455chr151127 --1391 --
NM_017519chr631372 1131 21 1849 1208 --
NM_017520chr132239 83 ------
NM_017545chr201596 ------
NM_017548chr31862 ------
NM_017563chr3106250 6018 5480 5302 4518 4182 1912 714 416 22 --11386 --
NM_017580chr1021908 1863 --1381 --
NM_017610chr1521762 101 --12009 --
NM_017628chr484683 4540 4286 4199 3733 1946 1535 1490 11771 24009 3356 --
NM_017629chr121786 748 11245 1606 --
NM_017632chr41181 ------
NM_017633chr633559 2475 1362 ----13642
NM_017634chr821984 205 ----1381
NM_017635chr1151281 1155 403 144 120 ------
NM_017637chr9118033 7986 7903 7336 7116 3232 2168 1903 801 767 509 22347 955 26880 6318 16875
NM_017643chr1733070 2806 2019 ----12026
NM_017644chr345099 4873 4607 4257 11443 ----
NM_017657chr2----168 --
NM_017658chr1444036 3161 1230 787 --1756 --
NM_017676chr52249 199 11164 ----
NM_017692chr93791 323 168 ------
NM_017693chr132414 336 --1200 --
NM_017694chr241344 515 169 100 ------
NM_017706chr561180 1131 1066 1050 431 356 ------
NM_017709chr162899 2709 1490 1258 294 235 ------
NM_017738chr91462 2994 322 1177 --
NM_017744chr12886 120 ------
NM_017752chrX41869 1825 1756 588 1331 1336 1136
NM_017761chr121463 532 ----11540
NM_017762chr151620 ------
NM_017769chr1431146 633 421 --1189 12135
NM_017770chr652981 2081 1846 940 839 --22574 23 22174 1181
NM_017778chr82521 313 ------
NM_017787chr1062764 2523 1788 203 99 69 --11015 12257
NM_017810chr16--1151 --1585
NM_017813chr885616 5567 5538 5449 4268 1812 876 132 13577 --24697 470
NM_017824chr1042101 1017 933 136 ------
NM_017848chrX44171 1263 749 688 13603 ----
NM_017860chr14671 636 291 87 ------
NM_017887chr1149 ------
NM_017902chr1095752 5737 5487 4839 3575 1915 1054 1033 84 14865 ----
NM_017911chr2211498 ------
NM_017915chr123411 400 141 --1210 --
NM_017919chr941962 1423 1268 470 45736 5510 5491 4612 11899 --
NM_017933chr221523 522 11602 ----
NM_017938chrX52079 1773 1627 387 196 11419 --11475
NM_017958chr263073 3059 2576 571 268 156 ------
NM_017988chr126854 784 383 189 147 90 ------
NM_018003chr1522100 831 --22431 983 12051
NM_018009chr12------1173
NM_018010chr311285 --11490 --
NM_018018chr1251727 1275 757 368 144 ----11557
NM_018027chr1033316 2712 538 --11194 --
NM_018046chr551896 1872 1776 1239 87 1760 --11927
NM_018054chr161263 ------
NM_018084chr252689 2117 708 338 205 ----11083
NM_018085chr1127814 7498 7392 6806 6060 5484 4995 3278 3148 2914 2769 360 12287 15474 --
NM_018086chr231863 676 41 --1216 --
NM_018092chr161250 ----1477
NM_018105chr8----11227 --
NM_018117chr103490 160 98 --2233 153 --
NM_018119chr16--1237 ----
NM_018120chr81324 ------
NM_018121chr10--12169 --22679 510
NM_018126chr43599 404 38 --1290 --
NM_018128chr1721036 470 1417 --161
NM_018137chr12271 257 ------
NM_018147chr3184 ------
NM_018155chr322108 232 1477 13026 12326
NM_018157chr1272825 2512 2313 803 736 398 142 12958 ----
NM_018159chrX31607 449 87 --178 --
NM_018164chr12267 30 ------
NM_018176chr43667 251 113 11537 ----
NM_018184chr351615 1428 710 592 205 ------
NM_018206chr162564 298 ------
NM_018243chr433351 3227 520 21002 272 13952 --
NM_018247chr672785 2086 1069 956 550 507 108 ----12318
NM_018254chr162063 1905 1826 945 701 367 1140 ----
NM_018293chr331183 210 52 12902 3962 871 141 --
NM_018307chr171176 ------
NM_018313chr33943 717 614 ----32231 1041 35
NM_018315chr41429 ------
NM_018327chr2021366 455 ----1738
NM_018328chr21464 ------
NM_018351chr1253648 3146 1088 814 255 ----1955
NM_018362chr1153557 3535 3018 2785 578 ----1465
NM_018364chr143581 3477 419 201 13563 31123 576 146 12809
NM_018367chr11132 --31943 1675 1001 --
NM_018370chr1251964 1463 466 378 114 1781 ----
NM_018374chr724569 126 1283 13951 --
NM_018383chr22730 504 ------
NM_018387chr9--144 ----
NM_018388chrX41455 1341 1302 169 ------
NM_018394chr311427 ----21103 463
NM_018403chr353392 3131 2733 1296 187 33984 1515 1344 1813 --
NM_018433chr21572 ------
NM_018440chr8208679 8138 7944 7854 7456 7293 6913 6670 5878 5705 5266 3085 2727 2694 2628 2292 2225 2148 713 367 12602 21191 236 28308 2055
NM_018444chr842043 1876 823 106 ------
NM_018446chr3127 ------
NM_018452chr6_random43593 3575 2983 2595 12487 33709 2752 655 13371
NM_018489chr152154 1648 756 583 27 --12257 --
NM_018490chr11187 ----1335
NM_018555chr1951989 1773 1742 1467 217 ----11821
NM_018557chr211451 1221 11631 11315
NM_018566chr1104451 4410 4225 3994 1561 1542 988 746 441 334 34920 3645 1778 21336 654 13572
NM_018569chr41411 --1511 --
NM_018584chr131210 82 67 --11047 --
NM_018602chr15138 161 2520 338 1382
NM_018638chr1213630 24573 310 --11183
NM_018640chr1232506 690 35 1389 --1319
NM_018644chr1161758 892 775 667 629 285 2604 443 1180 11388
NM_018650chr121748 697 1905 1654 --
NM_018667chr1642432 2101 1786 504 2883 268 12707 1751
NM_018682chr72702 648 ------
NM_018685chr72741 99 ------
NM_018700chr531239 1064 690 --11616 --
NM_018718chr731763 556 251 --12347 --
NM_018723chr16183 ------
NM_018728chr1541449 1295 1247 389 ------
NM_018833chr62133 62 1430 ----
NM_018834chr51232 ------
NM_018841chr173899 3846 3314 3215 3172 882 344 --11216 --
NM_018844chr721738 217 ------
NM_018846chr72822 239 --1327 --
NM_018847chr921761 1751 ------
NM_018898chr512012 ----11798
NM_018899chr512012 ----11798
NM_018900chr512012 ----11798
NM_018901chr512012 ----11798
NM_018902chr512012 ----11798
NM_018903chr512012 ----11798
NM_018904chr512012 ----11798
NM_018905chr512012 ----11798
NM_018906chr512012 ----11798
NM_018907chr512012 ----11798
NM_018908chr512012 ----11798
NM_018909chr512012 ----11798
NM_018910chr512012 ----11798
NM_018911chr512012 ----11798
NM_018945chr641415 1167 476 412 22585 454 ----
NM_018947chr724608 3286 24703 1244 13631 23507 3218
NM_018958chr15114100 3748 2874 2722 1125 1015 485 386 287 187 105 22716 722 11559 1412
NM_018970chr732783 1130 481 --11149 --
NM_018976chr1252525 1876 1059 685 471 ------
NM_018979chr1222406 2229 ----11622
NM_018983chr4----1270 --
NM_018999chr1074207 4149 4100 3940 606 515 145 34868 4263 920 44485 904 729 268 13317
NM_019000chr54644 574 353 214 129 ----
NM_019001chr373479 1944 1845 1236 380 339 146 13303 1976 --
NM_019006chr151493 ------
NM_019035chr432025 402 340 --11845 --
NM_019044chr294211 3623 3317 3239 2922 464 430 381 46 33384 2889 1058 1811 --
NM_019045chrX3918 784 683 1639 ----
NM_019050chr441989 530 474 80 ------
NM_019067chrX73246 1590 1042 952 920 90 34 11936 14751 11878
NM_019072chr563752 3571 2776 2593 1634 1005 22889 2665 1319 --
NM_019083chr1----11363 1473
NM_019084chr1021788 1701 1279 12498 --
NM_019087chr52528 276 11687 1196 --
NM_019102chr7121 ------
NM_019102chr7121 ------
NM_019116chr1613610 ------
NM_019556chrX----11360 31106 996 520
NM_019590chr102944 242 --1310 123
NM_019593chr202772 424 --22674 292 --
NM_019600chr152508 61 ------
NM_019610chr11877 ----11730
NM_019891chr11962 ------
NM_020062chr2011030 ------
NM_020116chr421187 329 1206 ----
NM_020122chr235483 3642 1822 --11477 --
NM_020123chr1031239 332 245 21491 1447 ----
NM_020144chr742097 1769 1411 602 --1754 31885 747 93
NM_020147chr154816 728 424 298 1120 1914 --
NM_020148chr1892485 2130 2123 2010 1939 931 503 489 383 ------
NM_020150chr1012250 --11636 --
NM_020163chr342157 1658 1443 932 11988 ----
NM_020177chr583305 2642 1049 648 567 140 131 65 --12219 135
NM_020178chr171210 ----11177
NM_020193chr1131301 1227 87 11273 ----
NM_020194chr21628 ------
NM_020204chr11570 ------
NM_020225chr4191 ------
NM_020243chr223791 662 101 ------
NM_020245chr664553 4327 3992 3796 1558 256 13522 13430 --
NM_020310chr1742779 1826 1052 526 ------
NM_020337chr441963 1130 241 126 13095 12695 --
NM_020338chr1042729 495 305 256 --12812 1554
NM_020341chr2042021 1719 397 215 1281 --11531
NM_020346chr1121186 405 1608 197 1314
NM_020348chr1042753 2193 584 258 --1467 11123
NM_020357chr321663 311 --31255 1237 1069 --
NM_020374chr1231944 1415 434 ----1457
NM_020390chr354511 4158 4138 3549 371 2756 355 13758 24535 1933
NM_020403chr1321314 463 1599 11686 --
NM_020420chrY41561 1145 487 467 1502 ----
NM_020425chr631895 1327 295 ----11841
NM_020432chr741861 1586 519 211 --22027 854 --
NM_020438chr92874 549 --1362 11200
NM_020440chr173226 2119 1158 720 674 431 182 ------
NM_020443chr195686 5287 4586 1958 1531 1132 1072 522 89 24857 1998 --16186
NM_020449chrX1524 1266 ----
NM_020453chr421587 269 ------
NM_020455chr622331 828 1125 --11096
NM_020463chr22981 584 --21045 568 --
NM_020466chr684709 4243 3381 3298 1955 1535 1355 1345 --24994 3838 --
NM_020474chr1821879 56 11700 11668 1560
NM_020638chr1221930 697 ----1342
NM_020640chr321539 1484 12173 --1339
NM_020644chr111297 --1194 --
NM_020647chr822175 1614 --1237 11680
NM_020654chr331205 450 285 ------
NM_020673chr20107328 7142 6873 6663 2042 1701 1416 1065 875 547 --26607 1038 --
NM_020686chr1652817 2104 1956 1075 493 12330 1842 --
NM_020699chr174883 4051 3735 2164 1913 1711 1383 ------
NM_020704chr782528 2127 2011 1721 918 784 520 22 11853 12036 --
NM_020718chr1644243 2247 2008 1957 ------
NM_020732chr631372 1131 21 1849 1208 --
NM_020734chr1212600 1378 13040 --
NM_020738chr241745 1710 1213 174 --1560 --
NM_020739chr1544206 3433 3159 1299 --13669 1486
NM_020742chrX52627 2454 2097 1044 484 --1238 --
NM_020749chr84539 262 99 35 183 1309 --
NM_020752chr1032233 1941 550 12350 1687 --
NM_020760chr231856 1603 737 --2752 445 --
NM_020764chr1641292 1054 322 303 21102 368 --1120
NM_020766chrX43933 3414 3165 1685 11204 24317 1127 --
NM_020771chr61977 ------
NM_020772chr17128340 8287 8177 7672 6933 6823 5912 5782 2976 2886 2068 1743 27607 3046 16254 --
NM_020774chr1846019 5752 5578 1919 25677 481 36135 3849 585 --
NM_020779chr242155 2047 371 43 --12642 --
NM_020783chr1812353 --11638 --
NM_020791chr1721430 473 ------
NM_020794chr121221 310 1438 1319 --
NM_020796chr521134 1075 --22024 304 11883
NM_020800chr32115 66 --1142 194
NM_020809chr1142259 462 302 284 1105 11940 --
NM_020810chr1443223 2983 1059 963 13156 11015 --
NM_020824chr101257 ------
NM_020830chr243168 2842 1240 959 13103 32326 2313 360 --
NM_020834chr1411601 1471 ----
NM_020839chr31419 ----11214
NM_020841chr1243966 3828 747 520 --23886 1332 1426
NM_020844chr8157537 6513 5772 5396 5328 2705 1576 1270 1229 1056 1022 660 262 251 188 15993 1168 17313
NM_020850chr1642657 1049 837 537 ----12946
NM_020853chr1242768 1771 1064 617 ------
NM_020854chr1831270 963 71 ------
NM_020856chr1961537 1488 404 310 92 57 --1330 --
NM_020858chr1531919 1708 678 ------
NM_020861chr611023 --1276 --
NM_020866chr132788 262 ------
NM_020868chr221642 126 11334 --11278
NM_020870chr432019 143 75 2766 53 ----
NM_020871chrX3938 620 347 12355 ----
NM_020872chr321420 269 ------
NM_020888chr131606 799 397 ----1634
NM_020918chr1052839 2721 2235 1414 515 11255 13111 1309
NM_020927chr1642401 2187 1975 773 ------
NM_020935chr234094 1082 384 --24130 3606 --
NM_020940chr1042273 1132 555 272 12665 ----
NM_020948chr162513 2415 1189 985 896 696 ------
NM_020975chr1021387 242 1672 1423 --
NM_020977chr441975 719 86 64 ------
NM_021003chr14150 1149 ----
NM_021007chr221678 735 ------
NM_021038chr353105 2987 2587 639 283 1848 21239 623 --
NM_021072chr522210 992 12052 ----
NM_021088chr261843 783 606 577 495 145 11579 ----
NM_021090chr2264192 1866 1637 928 815 511 --2601 497 --
NM_021096chr2272807 2545 2486 816 663 410 121 ----12710
NM_021097chr253020 2629 1146 536 129 12367 1903 1615
NM_021116chr7108820 8682 8213 7881 7788 5945 2604 1317 1215 286 15705 28120 182 38130 6628 571
NM_021120chrX43218 2027 268 261 12994 ----
NM_021132chr10------11102
NM_021136chr141635 ------
NM_021137chr172589 189 22362 874 21947 423 --
NM_021144chr9133 ------
NM_021145chr7----2334 41 1233
NM_021151chr73983 392 22 ------
NM_021183chrX32224 716 210 ----12462
NM_021204chr42957 758 ------
NM_021239chr14------11370
NM_021249chr143471 157 77 --1434 --
NM_021252chr1031951 1313 179 1217 1241 --
NM_021572chr64953 838 312 233 21020 969 ----
NM_021622chr1042107 1490 331 241 ------
NM_021629chr374860 4768 3935 3150 1864 981 716 11132 34312 407 342 --
NM_021637chrX1289 ------
NM_021643chr211812 ------
NM_021649chr52444 419 21391 131 ----
NM_021722chr71562 ------
NM_021723chr71603 ------
NM_021728chr141264 ------
NM_021809chr2041534 851 767 249 --22426 790 11811
NM_021813chr635720 5246 981 24595 4044 11194 --
NM_021814chr6--11092 --150
NM_021817chr11316 ------
NM_021818chr1421070 74 ------
NM_021911chr585531 4155 3919 2036 1589 906 799 603 22244 1030 ----
NM_021912chr1533391 735 155 --54127 4025 3491 1226 901 --
NM_021913chr1951801 1517 1353 1314 46 ------
NM_021945chr6103317 2837 2652 1373 1113 1041 982 744 262 49 13474 ----
NM_021951chr9----1786 --
NM_021956chr631259 435 183 ----128
NM_021961chr1177103 5604 5209 4586 2348 1116 480 25148 2176 22734 1343 12299
NM_021964chr396286 5390 4909 4627 4577 4036 2212 924 383 12406 ----
NM_021970chr42738 142 1499 ----
NM_021973chr41229 ------
NM_021977chr643206 2903 2683 514 13136 ----
NM_021988chr202303 109 --21045 602 --
NM_021998chrX31521 1508 201 ------
NM_021999chr131236 146 ----
NM_022048chr1555191 4448 4078 1868 1613 1383 --14797
NM_022058chr22555 29 ------
NM_022068chr182177 80 ----158
NM_022073chr1421210 305 --11176 11546
NM_022114chr133580 1277 478 ------
NM_022116chr74996 128 58 36 --1823 --
NM_022121chr621096 851 ------
NM_022123chr14------1415
NM_022130chr531391 509 292 ------
NM_022150chr72343 134 --1176 --
NM_022166chr1675970 5385 5371 998 864 532 358 --13946 11980
NM_022336chr211698 1611 ----
NM_022346chr421436 443 ------
NM_022442chr202303 109 --21045 602 --
NM_022456chr1231847 1647 136 27172 5615 17438 --
NM_022459chr1344548 1528 1431 1406 --33876 1967 1775 --
NM_022461chr331239 489 188 21383 151 ----
NM_022465chr1252989 1931 662 241 181 ------
NM_022469chr132246 1064 125 11074 ----
NM_022473chr1544468 3819 2980 1024 1138 --1417
NM_022474chr144950 917 796 627 ------
NM_022497chr342803 2509 835 622 --1534 11087
NM_022650chr52328 97 ------
NM_022658chr1211337 ------
NM_022719chr2293721 3690 3392 3273 3057 1075 946 715 401 1165 13802 11005
NM_022726chr611453 11768 --1676
NM_022735chr141864 1671 1600 1259 11870 ----
NM_022745chr162130 1978 1199 437 308 212 ----1460
NM_022763chr3--22747 2277 --12474
NM_022771chr12156 --1238 --
NM_022780chr231488 673 579 ------
NM_022781chr952267 2226 2213 977 658 --12870 --
NM_022784chr152753 156 ------
NM_022826chr2----11221 --
NM_022828chr531404 383 164 1244 ----
NM_022831chr141804 673 171 74 ------
NM_022832chr461792 1567 1020 973 917 406 ------
NM_022841chr1562512 856 790 726 709 25 --32346 2016 488 --
NM_022842chr332892 2118 292 ----12971
NM_022845chr1642068 1699 556 202 --11507 --
NM_022893chr242994 2279 828 182 --23210 2817 --
NM_022898chr1454629 3798 1437 787 461 21820 193 21700 399 14090
NM_022902chr51321 ------
NM_022912chr272849 2647 2252 2030 1228 1031 33 --12206 --
NM_022918chr1121677 317 ------
NM_022970chr102348 143 1364 ----
NM_022977chrX22445 406 --1744 --
NM_023000chr1431634 481 81 1632 ----
NM_023001chr1431634 481 81 1632 ----
NM_023011chr132725 333 ------
NM_023074chr191915 ------
NM_023923chr163640 3074 1022 578 532 92 12995 ----
NM_023927chr5------11023
NM_023929chr8----1368 --
NM_023934chrX3433 221 141 21523 538 1375 --
NM_024007chr522554 841 --2893 547 12234
NM_024034chr2011063 ------
NM_024057chr12146 ------
NM_024060chr111339 ------
NM_024061chr71605 ------
NM_024086chr1793775 3574 3103 3054 2760 1509 1345 680 587 1100 32491 2429 670 --
NM_024089chr13----1173 --
NM_024107chr172581 177 1201 ----
NM_024336chr16197 ------
NM_024345chr925390 547 14059 45320 4260 2438 1081 21181 1163
NM_024408chr163467 3434 3216 2755 1114 1036 1644 --12343
NM_024415chr51227 ------
NM_024416chr951601 1399 1303 391 326 21590 1549 133 11221
NM_024423chr1854070 3633 1364 456 200 12647 24241 3528 --
NM_024424chr1121177 41 ------
NM_024425chr1121177 41 ------
NM_024426chr1121177 41 ------
NM_024494chr11294 ----156
NM_024513chr373462 3363 2851 1375 721 309 70 12862 33778 3718 3482 --
NM_024524chr322095 1139 ------
NM_024545chr2----1686 --
NM_024548chr321339 1257 ------
NM_024551chr1231979 801 579 12126 22485 1917 --
NM_024551chr1231979 801 579 12126 22485 1917 --
NM_024582chr41873 ------
NM_024612chr1731106 370 245 1270 ----
NM_024613chr811540 --1347 11620
NM_024617chr91713 --1324 --
NM_024626chr131190 1161 24 1641 11453 --
NM_024628chr32915 415 1215 --11133
NM_024639chr621861 550 12722 ----
NM_024645chr821602 256 1358 21515 540 --
NM_024646chr131394 1136 762 12592 23736 3114 33307 3028 2727
NM_024665chr323361 635 1871 24635 3626 --
NM_024692chr231350 1177 215 ------
NM_024721chr82600 512 12359 --11078
NM_024740chr1142865 1451 1088 564 12615 43835 3069 972 247 --
NM_024749chr172291 1986 1700 1622 699 624 182 --12211 1808
NM_024751chr441668 493 351 171 ------
NM_024761chr985250 3687 3636 3447 3415 1874 1866 300 11107 25369 3721 24848 963
NM_024770chr2186684 6595 6437 6362 6313 6275 5706 5668 5372 5103 4994 4297 2412 1557 1323 792 272 174 22402 1103 3589 429 156 --
NM_024828chr921494 362 --11344 --
NM_024852chr1132 ------
NM_024854chr1221502 973 ------
NM_024887chr161605 1398 797 319 220 80 ----11512
NM_024896chr982397 2285 1739 837 810 509 232 154 --22136 24 --
NM_024899chr18----1616 1589
NM_024947chr3129435 9313 9256 8585 6640 6015 5824 3289 3087 2122 1329 1102 13619 48930 7779 3579 115 12880
NM_024949chr451707 1247 668 477 171 --23743 3202 --
NM_024953chr1242243 1895 1836 603 --12782 1344
NM_024989chr288035 5863 5574 2159 1424 1044 360 174 25993 5451 27813 4959 --
NM_024991chr1062526 2076 1083 838 589 46 12881 1302 --
NM_024993chr261461 1399 550 496 235 22 11492 ----
NM_025054chr8--13244 ----
NM_025073chr143667 1372 1243 68 --14289 14419
NM_025074chr462303 1170 1085 720 275 123 --12106 --
NM_025106chr12756 566 ----21575 779
NM_025133chr2----1838 --
NM_025134chr1622139 917 ------
NM_025138chr1311057 ------
NM_025147chr2194 ------
NM_025152chr1451966 1600 1490 1355 707 ------
NM_025160chr144163 2686 1341 589 1665 24092 193 --
NM_025179chr194018 3562 3461 3344 3182 1965 1194 1015 273 1622 ----
NM_025181chr22527 179 ------
NM_025187chr1631355 919 364 ----1241
NM_025203chr251182 1017 449 360 110 --11355 --
NM_025221chr421047 82 11370 1109 --
NM_025222chr342220 2163 1077 303 ------
NM_025237chr1721099 310 21264 442 11366 --
NM_030621chr1463417 2898 2889 2694 1608 1344 ------
NM_030625chr101624 --1890 --
NM_030627chr533053 3039 1059 ----12581
NM_030647chr753853 3832 2296 1326 1193 --1994 --
NM_030648chr4114747 4703 1880 1717 1667 1338 1124 969 927 695 402 14451 ----
NM_030650chr231667 716 524 23723 2682 1678 --
NM_030660chr14163 ------
NM_030667chr1221156 147 --1276 --
NM_030668chr1221156 147 --1276 --
NM_030669chr1221156 147 --1276 --
NM_030670chr1242188 917 819 185 --1755 --
NM_030671chr1242188 917 819 185 --1755 --
NM_030674chr12115368 4407 4051 3629 3554 2041 1792 1696 1634 932 508 25486 1403 34389 3830 2285 --
NM_030755chr1442284 2213 1013 157 --1191 --
NM_030762chr121767 ------
NM_030786chr131231 399 66 11858 ----
NM_030791chr1411139 ------
NM_030806chr1128931 8788 6888 6833 6669 6585 3290 1447 1083 905 577 412 17005 48767 8732 7530 2036 16610
NM_030808chr171298 ------
NM_030816chr123674 3114 --32816 2536 893 11442
NM_030820chr62730 104 ------
NM_030821chr41551 --1717 1515
NM_030881chr2232054 1922 1802 11600 32392 1730 918 --
NM_030885chr321429 57 ------
NM_030906chr11--2179 27 ----
NM_030918chr145029 4861 1377 447 13475 12184 --
NM_030958chr8------1435
NM_030979chr131332 ----1319
NM_031216chr1821706 643 1530 --12163
NM_031217chr111127 ------
NM_031243chr722017 312 1791 ----
NM_031268chr16125411 4605 4496 4463 4188 3695 2075 1824 1650 1329 1229 773 ------
NM_031305chr4----1262 --
NM_031314chr1431430 328 104 ------
NM_031369chr41688 ------
NM_031370chr41688 ------
NM_031371chr131392 96 21 177 2494 302 1173
NM_031371chr131392 96 21 177 2494 302 1173
NM_031411chr512012 ----11798
NM_031418chr1112485 12782 11754 11922
NM_031426chr9------1149
NM_031431chr1311588 ------
NM_031435chr1232980 647 611 ------
NM_031442chrX32166 1107 922 22659 2427 12298 12555
NM_031461chr831543 700 92 ------
NM_031468chr735695 5417 1654 37042 5979 1773 37864 7804 7551 23151 780
NM_031469chr673309 3121 2942 2783 2556 58 41 22974 1125 ----
NM_031483chr2012624 ------
NM_031844chr164140 4131 4014 3984 2855 2556 23789 2546 ----
NM_031845chr263341 3309 2632 2388 607 166 ------
NM_031847chr263341 3309 2632 2388 607 166 ------
NM_031849chr512012 ----11798
NM_031857chr512012 ----11798
NM_031860chr512012 ----11798
NM_031866chr101183 ------
NM_031942chr22927 357 --1312 2903 491
NM_032012chr953699 2095 1298 998 913 15057 11048 --
NM_032028chr51627 ------
NM_032042chr51667 12075 11775 12858
NM_032047chr342117 2056 465 428 1365 11773 --
NM_032050chr2211079 ------
NM_032052chr2221464 136 ------
NM_032144chr231670 423 79 ----122
NM_032145chr671449 1396 439 401 154 35 22 11680 ----
NM_032154chr10------1156
NM_032182chr10------1330
NM_032186chr121286 257 ------
NM_032199chr1033462 3218 237 13547 1843 --
NM_032208chr232793 2413 2365 ------
NM_032217chr41950 ----21429 545
NM_032221chr2021922 1734 --3807 448 215 --
NM_032228chr1133460 3406 2665 11338 13064 --
NM_032236chr12936 744 --1848 --
NM_032239chr431401 1125 922 ------
NM_032246chr151921 --1947 --
NM_032268chr1693265 3177 3088 3043 2699 2109 1222 817 458 ------
NM_032290chr51141 --1376 --
NM_032291chr131904 621 606 1362 11970 --
NM_032294chr172664 35 11796 ----
NM_032317chr711348 21110 633 ----
NM_032320chr11--1182 ----
NM_032321chr253188 2093 1154 1118 165 22605 2132 --22843 85
NM_032352chr1441426 1071 579 430 11042 ----
NM_032360chr1--137 ----
NM_032373chr1065698 4938 4271 3897 966 612 35721 1433 588 24701 1586 --
NM_032380chr53109 97 34 ------
NM_032408chr74881 484 473 215 ----1832
NM_032410chr811209 --1458 --
NM_032411chr21213 ------
NM_032423chr1931554 1248 395 --1172 --
NM_032438chr6----11212 164
NM_032439chr10199 --21369 324 --
NM_032440chr1042924 2866 2176 43 --22805 1832 --
NM_032445chr1531595 471 400 --11045 --
NM_032454chr61385 ------
NM_032457chr433676 3621 387 --11020 --
NM_032458chrX63236 2677 981 835 747 296 --13089 1702
NM_032471chr62891 883 --1951 --
NM_032505chr332706 2588 445 11041 --12378
NM_032521chr20----62338 2107 837 629 274 71 12065
NM_032539chrX----1561 --
NM_032557chr41299 ------
NM_032569chr1641605 1578 524 146 ------
NM_032578chr1011356 21538 1212 11447 --
NM_032581chr741638 1567 550 69 --11359 1465
NM_032582chr17------1128
NM_032598chr17--127 ----
NM_032701chr192632 116 ------
NM_032727chr1011549 ----1288
NM_032778chr333314 513 170 ----22624 265
NM_032784chr6----1156 --
NM_032804chr1032077 1963 269 12552 1137 --
NM_032837chr1741461 1311 727 527 11778 1584 21963 1335
NM_032842chr731713 1539 1452 ------
NM_032859chr1353890 3732 3406 2798 2773 ------
NM_032873chr1193739 3718 3641 3522 2919 2793 710 692 116 ----14034
NM_032900chr102374 271 1920 ----
NM_032924chr72734 362 11132 1309 --
NM_032940chr161806 1881 ----
NM_032968chrX22775 263 --21226 794 1918
NM_032969chrX22775 263 --21226 794 1918
NM_032973chrY24136 2770 --21226 794 1918
NM_032993chr4----1270 --
NM_033014chr951601 1399 1303 391 326 21590 1549 133 11221
NM_033030chr221424 1124 ------
NM_033071chr61572 139 --1552
NM_033081chr2021166 248 ------
NM_033103chr19--21235 346 ----
NM_033138chr732372 428 195 ----11811
NM_033139chr732372 428 195 ----11811
NM_033140chr732372 428 195 ----11811
NM_033143chr453396 785 769 536 155 --21292 1171 12980
NM_033150chr122441 54 ------
NM_033157chr732372 428 195 ----11811
NM_033181chr633775 1424 24 --1824 --
NM_033201chr161456 11072 2448 289 11209
NM_033211chr541906 1307 386 203 ------
NM_033222chr92489 266 --194 --
NM_033224chr737653 6735 1388 ----2863 839
NM_033225chr832440 822 743 --21277 255 --
NM_033260chr61142 --1800 --
NM_033272chr21122 ------
NM_033274chr531437 682 82 --11108 12442
NM_033281chr51658 --1300 --
NM_033285chr873141 1639 1603 866 854 696 323 ------
NM_033326chr1132451 505 28 ------
NM_033331chr932840 2683 537 167 12453 --
NM_033343chr1191 1318 ----
NM_033360chr12--21810 160 ----
NM_033389chr1743994 3567 3032 709 --14054 --
NM_033425chr1183251 3204 2816 2281 1202 961 947 132 11036 ----
NM_033430chr453047 654 538 255 242 23243 925 ----
NM_033437chr453047 654 538 255 242 23243 925 ----
NM_033480chr682926 2772 2624 2548 999 839 422 62 154 1277 --
NM_033481chr682926 2772 2624 2548 999 839 422 62 154 1277 --
NM_033505chr294890 4690 2492 2448 1340 1066 831 328 28 ------
NM_033515chr631305 1037 472 ------
NM_033631chr153756 757 718 455 309 13898 ----
NM_033632chr41429 ------
NM_033637chr1064039 3724 2619 1458 1085 504 21569 202 ----
NM_033644chr522276 156 --11671 --
NM_033645chr522276 156 --11671 --
NM_033656chr2185092 2392 1558 1448 1213 1085 727 194 1995 22257 2029 --
NM_052832chr821870 121 --11116 12464
NM_052834chr181197 --21651 829 1319
NM_052860chr52820 240 --1254 1751
NM_052879chr1264053 3847 3417 1595 406 114 --11115 --
NM_052885chr1253638 3191 1342 749 549 34358 3543 1174 ----
NM_052907chr1234009 3225 3095 14270 1379 --
NM_052917chr23660 636 572 22651 2287 1193 --
NM_052923chr6153 ------
NM_052934chr1----1644 1377
NM_052936chrX1110 ------
NM_052937chr832626 1831 663 ------
NM_052954chr2151745 1671 1637 1521 1450 1545 1247 --
NM_053002chr3------11092
NM_053016chr997163 6739 5882 5798 2076 1232 1202 777 731 24899 1796 35894 5278 2273 --
NM_053023chr1152939 547 449 138 81 --1997 --
NM_053024chr31994 1520 2285 268 --
NM_053025chr331578 592 95 --1508 --
NM_053026chr331578 592 95 --1508 --
NM_053027chr331578 592 95 --1508 --
NM_053028chr331578 592 95 --1508 --
NM_053031chr331578 592 95 --1508 --
NM_053032chr331578 592 95 --1508 --
NM_053056chr1143019 2832 1985 1017 12961 1528 1427
NM_053064chr1442842 2675 1014 984 12444 ----
NM_053067chr91349 ------
NM_053281chrX----1387 --
NM_054025chr1161758 892 775 667 629 285 2604 443 1180 11388
NM_054026chr82889 83 ------
NM_057089chr71501 ------
NM_057159chr91548 ------
NM_057175chr432104 1738 822 2427 390 --11796
NM_057182chr191211 ------
NM_058170chr151609 1550 424 233 115 --11052 --
NM_058237chr142934 419 ------
NM_078470chr101566 1655 --1749
NM_079420chr22255 23 ------
NM_079422chr22255 23 ------
NM_080425chr20------139
NM_080426chr20------139
NM_080491chr1162819 1126 894 277 186 130 --31048 1031 932 13319
NM_080546chr921446 902 ------
NM_080669chr1774767 3949 3507 1774 1646 1597 155 23714 353 13650 --
NM_080738chr1------11738
NM_080759chr133998 652 372 11860 11824 --
NM_080760chr133998 652 372 11860 11824 --
NM_080872chr822855 543 2729 183 ----
NM_080874chr431514 612 200 ------
NM_080927chr342603 503 185 26 --140 --
NM_100264chr102786 648 1722 1816 --
NM_100486chr102786 648 1722 1816 --
NM_130391chr942489 2197 2184 798 1369 ----
NM_130392chr942489 2197 2184 798 1369 ----
NM_130393chr942489 2197 2184 798 1369 ----
NM_130434chr1511110 --1830 --
NM_130773chr21689 2976 700 1383 --
NM_130781chr51535 ------
NM_130797chr71365 ----122
NM_130798chr151309 --11187 --
NM_130809chr52948 391 21256 259 ----
NM_130811chr20--1999 ----
NM_130830chr383160 3076 2672 2608 2432 1301 933 724 ----12500
NM_130838chr15--2685 116 --11245
NM_130839chr15--2685 116 --11245
NM_133170chr2087587 7446 6999 5450 5160 2241 2176 1117 27094 2182 67833 7466 6839 5948 1642 260 12066
NM_133264chr1753181 3001 2845 1353 1196 ----11263
NM_133265chrX51120 920 744 467 354 --11059 --
NM_133334chr495262 4775 4572 2437 2235 1933 1645 1541 415 13931 ----
NM_133370chr462806 2744 1421 1375 847 152 --33465 3021 897 --
NM_133372chr542730 2064 878 245 ------
NM_133433chr51899 ------
NM_133445chr993333 2953 2933 2345 1492 1225 988 802 500 --12942 --
NM_133477chr443142 2713 2520 2362 22977 2267 13057 --
NM_133496chr174349 3878 1814 1650 1087 632 116 ------
NM_133503chr121619 --1725 1719
NM_133504chr121619 --1725 1719
NM_133505chr121619 --1725 1719
NM_133506chr121619 --1725 1719
NM_133507chr121797 --1903 1897
NM_133638chr511403 1376 1950 --
NM_133646chr2115163 4996 4953 4904 4227 3673 1873 1275 804 543 104 35499 4885 709 21183 1102 --
NM_133647chr1572648 2422 1244 1035 1012 348 150 12566 1949 --
NM_133650chr61572 139 --1552
NM_134260chr15------140
NM_134261chr15------140
NM_134262chr15------140
NM_138270chrX32535 2453 223 --1818 --
NM_138286chr1994191 4133 4041 1519 1434 862 630 245 144 14203 13461 --
NM_138288chr1431367 544 325 --12199 --
NM_138328chr1753397 2555 2403 2366 950 --13239 --
NM_138333chr921883 364 --1235 --
NM_138335chr44316 260 228 40 --1570 --
NM_138357chr1021696 62 ------
NM_138364chr4----1133 150
NM_138373chr1931179 664 526 ------
NM_138426chr712257 ------
NM_138444chr1344666 3523 1578 867 ------
NM_138459chr663689 2355 1456 1053 472 75 ----1828
NM_138473chr1283618 3413 3382 1621 1320 902 784 102 14676 11411 --
NM_138576chr1454629 3798 1437 787 461 21820 193 21700 399 14090
NM_138620chr9176 --1356 --
NM_138621chr233858 1123 882 12739 ----
NM_138643chr18183 ------
NM_138644chr18183 ------
NM_138694chr663163 2633 1321 1116 441 337 --12874 13594
NM_138713chr16108123 8025 7452 6025 5375 2016 1827 978 575 150 --1479 13180
NM_138714chr16108123 8025 7452 6025 5375 2016 1827 978 575 150 --1479 13180
NM_138727chr12886 120 ------
NM_138728chr12886 120 ------
NM_138731chr1433923 3824 1009 --11268 12749
NM_138779chr132175 26 ------
NM_138782chr521787 876 --1226 1353
NM_138927chr212772 50 ------
NM_138971chr1163023 1536 1261 358 216 101 1609 --23255 1105
NM_138971chr1163023 1536 1261 358 216 101 1609 --23255 1105
NM_138972chr1163023 1536 1261 358 216 101 1609 --23255 1105
NM_138972chr1163023 1536 1261 358 216 101 1609 --23255 1105
NM_138973chr1163023 1536 1261 358 216 101 1609 --23255 1105
NM_138973chr1163023 1536 1261 358 216 101 1609 --23255 1105
NM_139035chrX--1630 ----
NM_139057chr153715 500 272 ------
NM_139076chr41170 --2511 287 --
NM_139131chr112595 473 192 ----
NM_139167chr81489 ----1429
NM_139168chr52350 176 ------
NM_139211chr42587 90 ------
NM_139212chr42587 90 ------
NM_139276chr1741943 1704 931 562 ----1713
NM_139283chr1211903 ------
NM_139286chr9------160
NM_144498chr2051575 1419 710 679 309 ------
NM_144571chr454954 4545 2444 1930 1334 --26294 2054 --
NM_144578chr1464502 4285 3387 1002 961 168 14439 33927 197 44 13953
NM_144595chr131648 1633 ----
NM_144633chr321388 1238 ----1192
NM_144642chr321327 541 11337 ----
NM_144643chr41121 ------
NM_144654chr9----1280 --
NM_144657chrX1192 ----1633
NM_144664chr11------11693
NM_144684chr1922501 1012 --12294 1634
NM_144703chr2021046 891 --1406 --
NM_144710chr23983 260 148 11510 --1160
NM_144720chr4123 ------
NM_144721chr432590 652 624 --1393 1432
NM_144722chr52935 414 --1216 --
NM_144726chr52931 139 ------
NM_144767chr15104259 4192 4014 3887 1477 1462 1158 990 732 601 23255 506 1285 --
NM_144778chr1322775 2104 ----1601
NM_144949chr252392 2255 2066 839 59 --174 --
NM_144963chr862622 2130 1912 874 574 84 ------
NM_144967chrX--1868 ----
NM_144973chr1275322 5269 4205 3838 3299 1185 1036 24646 3472 ----
NM_144979chr42610 129 ------
NM_145049chr51835 ------
NM_145055chr1843484 1494 885 601 23824 2707 11076 --
NM_145176chr633224 3052 2223 12833 --11252
NM_145251chr1421615 1075 11430 ----
NM_145259chr2127088 6409 5780 5414 2519 1902 1485 1475 1230 337 165 113 22736 1740 37115 5999 1685 --
NM_145307chr1043837 1849 1570 312 ----23311 672
NM_145313chr1031412 1392 660 --21107 34 --
NM_145320chr772962 2794 2653 2268 1295 1019 627 164 ----
NM_145321chr772962 2794 2653 2268 1295 1019 627 164 ----
NM_145322chr772962 2794 2653 2268 1295 1019 627 164 ----
NM_145341chr1031797 673 96 169 1736 --
NM_145686chr223232 2596 1406 23340 2314 11100
NM_145687chr223232 2596 1406 23340 2314 11100
NM_145698chr1022043 1532 ------
NM_145727chr661374 1361 326 306 268 177 --2897 242 --
NM_145753chr31516 ------
NM_145808chr732749 2666 591 ----12514
NM_145810chr22927 357 --1312 2903 491
NM_145861chr1------11738
NM_145891chr1621069 83 --11300 --
NM_145892chr1621069 83 --11300 --
NM_145893chr1621191 205 --11422 --
NM_146388chr1921085 907 ----1796
NM_147147chr664040 3605 3164 1097 708 625 --12600 --
NM_147150chr963758 3244 2762 1450 413 73 --12433 --
NM_147156chr101453 1296 ----
NM_147171chr73481 178 145 ------
NM_147181chr421047 82 11370 1109 --
NM_147182chr421047 82 11370 1109 --
NM_147183chr421047 82 11370 1109 --
NM_147185chr73481 178 145 ------
NM_147223chr212481 ------
NM_148174chr81789 ------
NM_148898chr72716 108 1910 ----
NM_148899chr72716 108 1910 ----
NM_148921chr1762234 1781 621 423 223 29 1568 ----
NM_152233chr143471 157 77 --1434 --
NM_152262chr193726 356 343 ------
NM_152275chr252230 2098 843 456 341 ----1573
NM_152282chr341079 562 347 47 --1161 --
NM_152345chr174774 756 141 133 --1971 11157
NM_152352chr1822552 2388 ------
NM_152380chr121327 251 1643 11654 --
NM_152387chr2--1289 ----
NM_152400chr432006 1752 530 ------
NM_152409chr553179 2506 814 789 682 13334 11407 --
NM_152417chr82126 34 ------
NM_152418chr841896 1320 371 80 11484 ----
NM_152420chr91742 ------
NM_152433chr1131472 514 281 --11549 1566
NM_152440chr1241075 1007 852 764 1730 ----
NM_152450chr1521690 1383 1863 11466 11679
NM_152463chr171507 ------
NM_152470chr1853565 2833 2803 1124 311 1256 23538 119 --
NM_152478chr19--1554 1239 --
NM_152487chr12521 42 --11367 --
NM_152510chr222655 254 --183 --
NM_152519chr222216 2115 11570 12059 --
NM_152520chr21212 ----11259
NM_152522chr22224 163 --1717 --
NM_152529chr244164 2685 1755 1528 ----11645
NM_152546chr5--191 ----
NM_152556chr742512 2189 1798 1744 11700 12569 1296
NM_152589chr12198 ------
NM_152594chr1522195 1692 1263 1796 --
NM_152606chr193766 503 218 ------
NM_152610chr11103 ------
NM_152622chr543339 3048 604 376 1650 23160 907 12637
NM_152629chr933466 3381 3288 22809 2655 33599 3123 484 1458
NM_152636chr1133074 2690 262 ----12486
NM_152638chr1211106 --1413 --
NM_152641chr1262135 692 464 404 371 72 ------
NM_152665chr11859 ------
NM_152667chr201470 --11070 --
NM_152685chr5126 ------
NM_152688chr61335 --1231 --
NM_152704chr132835 247 ------
NM_152723chr111817 1389 --1107
NM_152734chr675246 4829 4611 4443 3800 3389 1499 --1563 --
NM_152745chr71433 ------
NM_152754chr722450 365 ----1115
NM_152756chr561576 1029 884 852 354 272 13872 33837 3558 3174 24335 319
NM_152758chr872220 2092 2014 1209 1091 218 163 --2937 284 12306
NM_152787chrX83932 2897 1379 1287 1013 871 491 44 --22824 2802 1657
NM_152793chr774550 4002 3349 3247 1709 471 393 44788 4128 3533 3494 --14571
NM_152835chr132681 2230 1892 --12011 --
NM_152838chr2013010 11159 --12883
NM_152857chr64827 653 353 74 --1940 --
NM_152858chr64827 653 353 74 --1940 --
NM_152919chr1953756 3706 995 859 220 --11520 1265
NM_152924chr15126542 6394 6217 5906 4987 2570 2342 1940 1428 1205 1123 613 --34950 4944 292 --
NM_152932chr3127 ------
NM_152999chr734978 1517 947 13339 ----
NM_153029chr1644132 4009 3961 3301 ----11656
NM_153042chr651594 707 617 191 166 1524 ----
NM_153050chr2264192 1866 1637 928 815 511 --2601 497 --
NM_153051chr2264192 1866 1637 928 815 511 --2601 497 --
NM_153182chr333314 513 170 ----22624 265
NM_153183chrX2426 316 --181 --
NM_153184chr331879 1626 164 ------
NM_153188chr584203 3593 1426 1326 1079 661 402 315 1133 ----
NM_153207chr1263666 3145 2993 1245 724 415 --23354 2569 --
NM_153261chr1611308 ------
NM_153262chr13773 584 40 23140 3087 ----
NM_153331chr32500 489 ------
NM_153332chr842825 2565 641 97 12170 12750 --
NM_153354chr5----123 --
NM_153377chr121327 ------
NM_153426chr41427 ------
NM_153427chr41427 ------
NM_153447chr192274 246 ------
NM_153456chr1376043 5828 5396 2487 2005 1613 312 --33913 347 46 16317
NM_153487chr6134091 3539 3250 3045 1930 1868 1644 1190 1041 719 620 173 42 ----24651 253
NM_153605chr311043 1400 --2610 407
NM_153607chr552653 1963 455 365 152 2190 143 1591 --
NM_153616chr1531919 1708 678 ------
NM_153617chr1531919 1708 678 ------
NM_153618chr1531919 1708 678 ------
NM_153619chr1573157 2946 2590 2558 932 727 671 ------
NM_153620chr751589 1539 1370 610 142 11299 1457 --
NM_153634chr1221407 1180 ----1309
NM_153645chr2233077 1319 1173 ----22947 761
NM_153689chr261933 1823 907 793 528 47 --1125 --
NM_153695chr94234 80 45 34 ------
NM_153712chr282925 963 684 673 603 473 401 137 12970 135 --
NM_153757chr42853 351 ------
NM_153769chr18183 ------
NM_153810chr10134947 4870 3778 3618 1976 1573 1289 912 782 455 360 266 72 13518 --14841
NM_170587chr82602 64 --1769 1831
NM_170665chr1273234 3207 2781 1456 1141 1023 261 ------
NM_170692chr131144 418 335 --1436 --
NM_170706chr164023 3778 2811 2701 996 327 24323 2997 ----
NM_170719chr1311057 ------
NM_170731chr112988 137 --12923 --
NM_170732chr112988 137 --12923 --
NM_170733chr112988 137 --12923 --
NM_170734chr112988 137 --12923 --
NM_170735chr112988 137 --12923 --
NM_170750chrX1801 ------
NM_170751chr64993 583 266 170 ------
NM_170752chr64993 583 266 170 ------
NM_170768chr1161628 1537 1206 538 154 95 ------
NM_171998chrX4896 820 623 218 22186 427 ----
NM_172037chr8--1185 ----
NM_172058chr83649 243 25 --1629 --
NM_172059chr83649 243 25 --1629 --
NM_172060chr83649 243 25 --1629 --
NM_172070chr242166 1968 1450 685 ----2404 263
NM_172071chr164666 2336 1883 1841 1634 1369 --17195 15560
NM_172103chr621997 996 12464 144 --
NM_172105chr621997 996 12464 144 --
NM_172110chr202470 189 ------
NM_172111chr202470 189 ------
NM_172112chr202470 189 ------
NM_172113chr202470 189 ------
NM_172159chr321840 57 ----1930
NM_172160chr321840 57 ----1930
NM_172206chr172664 35 11796 ----
NM_172216chr1242248 1864 893 98 --12913 12416
NM_172240chr122881 251 178 ----
NM_172337chr141264 ------
NM_172373chr131273 ----11051
NM_172375chr141851 ------
NM_173054chr71349 ----1308
NM_173172chr261490 1375 1023 992 325 228 11151 ----
NM_173198chr942752 1029 954 287 ------
NM_173200chr942752 1029 954 287 ------
NM_173214chr16108123 8025 7452 6025 5375 2016 1827 978 575 150 --1479 13180
NM_173359chr321883 587 ----1353
NM_173468chr443892 2071 1736 1241 13903 22231 1943 --
NM_173469chr1511107 --11129 --
NM_173470chrX32763 2179 514 --12505 --
NM_173476chr16112276 2102 1910 1678 1607 1453 486 425 403 245 76 ----12129
NM_173495chrX52337 1758 1626 1613 422 --12141 --
NM_173511chr232769 1277 216 ------
NM_173550chr9--141 ----
NM_173552chr331960 1826 310 ------
NM_173567chr11217 ------
NM_173576chr102703 690 --12084 11635
NM_173582chr1156239 5243 4982 4099 2135 --15788 14471
NM_173595chr1243347 1594 485 200 14925 --25279 5159
NM_173602chr1232634 1420 236 --11014 1703
NM_173609chr15193 ------
NM_173642chr1169073 9040 8953 8619 8546 7479 7161 7114 6115 6006 3003 2647 571 374 276 248 11311 ----
NM_173648chr25314 214 187 144 44 ------
NM_173683chr821413 497 11801 --1683
NM_173694chrX2199 78 --2500 46 --
NM_173791chr10155 ------
NM_173797chr511221 ------
NM_173808chr183844 3085 1601 1060 931 390 300 204 11023 11783 14370
NM_173825chr31382 12223 --12285
NM_173829chr575444 4914 2223 1339 1313 1189 950 36133 4628 1850 --14330
NM_173851chr873873 3782 3038 2994 2796 869 167 --11354 11348
NM_174890chr10----1117 --
NM_174907chr31123 ------
NM_175069chr93977 354 174 ------
NM_175071chr93791 323 168 ------
NM_175607chr311690 11120 199 --
NM_175612chr311690 11120 199 --
NM_175613chr3----199 --
NM_175623chr1231847 1647 136 27172 5615 17438 --
NM_175736chr12107365 6721 6611 6273 5666 1262 1131 479 297 23 --24759 1734 --
NM_175767chr561875 1194 1149 711 320 224 ------
NM_175861chr1275207 4733 4445 2326 2116 1643 1545 44982 4191 3682 90 15129 --
NM_175863chr631372 1131 21 1849 1208 --
NM_175876chr132454 461 82 --12175 --
NM_175907chr1832366 847 611 --42576 859 775 648 --
NM_175913chr206969 884 822 430 69 49 1313 ----
NM_175921chr554303 3238 3107 1467 724 ------
NM_176824chr421102 513 ----11373
NM_177414chr151713 1543 1087 685 370 1662 ----
NM_177422chr1132 ------
NM_177438chr1463417 2898 2889 2694 1608 1344 ------
NM_177441chr172581 177 1201 ----
NM_177538chr2108831 6839 6064 5377 3406 3308 3073 1208 948 851 --25771 2303 18018
NM_177553chr114790 675 628 378 ------
NM_177952chr14150 1149 ----
NM_177966chr361874 1865 1383 1347 1209 680 1386 ----
NM_177968chr21387 ------
NM_177969chr21736 ------
NM_177972chr1143928 1350 669 436 33290 1150 860 23180 357 13510
NM_177985chr252036 1976 1478 688 388 ----21699 279
NM_177990chr2042021 1719 397 215 1281 --11531
NM_177996chr2053295 3194 2950 2604 2428 --23230 148 --
NM_178013chr1463108 2424 2072 1093 478 309 --11925 --
NM_178123chr22757 736 ------
NM_178151chrX45906 2675 2399 1264 45590 5396 4966 33 21565 688 --
NM_178152chrX45906 2675 2399 1264 45590 5396 4966 33 21565 688 --
NM_178153chrX45906 2675 2399 1264 45590 5396 4966 33 21565 688 --
NM_178154chr14--1221 ----
NM_178155chr14--1221 ----
NM_178156chr14--1221 ----
NM_178157chr14--1221 ----
NM_178270chrX1110 ------
NM_178313chr232045 352 189 1293 32192 1755 568 --
NM_178423chr741182 842 320 101 1131 1865 --
NM_178425chr741182 842 320 101 1131 1865 --
NM_178450chr52135 127 1547 ----
NM_178554chr383183 3022 3001 2834 2337 2294 1377 821 --11225 --
NM_178565chr841503 1354 1090 141 ------
NM_178566chr941566 624 526 204 ----11786
NM_178584chr23983 260 148 11510 --1160
NM_178585chr41167 1203 12475 --
NM_178587chr141113 ------
NM_178815chr1022631 1909 --21949 1865 --
NM_178835chr43687 255 183 1119 1355 1320
NM_178842chr1552123 1473 182 44 29 --1583 --
NM_178857chr81107 ------
NM_180976chr63804 222 212 --1311 --
NM_180977chr63804 222 212 --1311 --
NM_180989chr1342201 1538 874 712 ------
NM_180991chr552376 1790 792 234 219 11739 ----
NM_181054chr1411170 ------
NM_181332chrX52627 2454 2097 1044 484 --1238 --
NM_181354chr83638 439 56 ----11455
NM_181358chr133845 1486 784 13139 23600 2825 --
NM_181361chr321288 986 ------
NM_181443chr2042822 2049 1922 1814 --22634 1958 21932 1880
NM_181481chr1884468 2088 1718 1646 1505 1362 704 401 17070 --26777 1521
NM_181482chr1884468 2088 1718 1646 1505 1362 704 401 17070 --26777 1521
NM_181483chr1884468 2088 1718 1646 1505 1362 704 401 17070 --26777 1521
NM_181492chr221859 ----11169
NM_181504chr553061 2982 2808 1639 538 13139 23116 3107 13566
NM_181521chr1675849 2735 1671 1361 1052 818 415 16214 1265 --
NM_181523chr553061 2982 2808 1639 538 13139 23116 3107 13566
NM_181524chr553061 2982 2808 1639 538 13139 23116 3107 13566
NM_181527chr20----1393 --
NM_181528chr20----1448 --
NM_181598chr141271 ------
NM_181643chr11616 ----11675
NM_181659chr2031299 841 436 --13172 --
NM_181659chr2031299 841 436 --13172 --
NM_181704chr21122 --1529 --
NM_181706chr11----12029 --
NM_181723chr81594 --12196 --
NM_181741chr241199 1128 1030 372 ------
NM_181742chr241199 1128 1030 372 ------
NM_181782chr642206 2008 1771 683 1369 --11434
NM_181784chr231944 464 142 12208 --22449 1988
NM_181789chr1562280 2226 1172 1086 985 936 23246 2996 12891 --
NM_181794chr62891 883 --1951 --
NM_181795chr62891 883 --1951 --
NM_181828chr22103706 3353 2971 2660 2605 2474 1187 630 557 355 11396 ----
NM_181829chr22103706 3353 2971 2660 2605 2474 1187 630 557 355 11396 ----
NM_181830chr22103706 3353 2971 2660 2605 2474 1187 630 557 355 11396 ----
NM_181832chr22103721 3368 2986 2675 2620 2489 1202 645 572 370 11411 ----
NM_181836chr531917 1735 625 ------
NM_181886chr411267 ------
NM_181887chr411267 ------
NM_181888chr411267 ------
NM_181889chr411267 ------
NM_181890chr411267 ------
NM_181891chr411267 ------
NM_181892chr411314 ------
NM_181893chr411267 ------
NM_181897chr31478 12525 22225 299 --
NM_182314chrX31874 1588 550 --31265 661 56 --
NM_182481chr211525 --1314 --
NM_182482chr211525 --1314 --
NM_182484chr21122 --1529 --
NM_182503chr674980 4015 3766 2034 1167 614 553 --23455 1939 --
NM_182515chr19115078 2589 2331 2250 1895 1764 1664 1426 1213 742 645 15358 15781 1753
NM_182524chr41224 ------
NM_182540chrX------1715
NM_182543chr101270 ------
NM_182580chr172152 1666 1032 1005 769 713 700 --12526 --
NM_182641chr17--1708 --1526
NM_182643chr842421 1675 918 522 --32096 1961 662 --
NM_182666chr31241 ------
NM_182680chrX1117 ------
NM_182691chr73943 252 48 ------
NM_182692chr73943 252 48 ------
NM_182697chr71200 --1618 21735 1700
NM_182715chr7171 --21196 824 --
NM_182765chr1032200 545 382 --1314 21744 879
NM_182830chr143572 152 39 --12273 21707 352
NM_182848chr1331046 267 124 ------
NM_182898chr786601 6320 4935 4864 2023 1278 906 559 ------
NM_182899chr786601 6320 4935 4864 2023 1278 906 559 ------
NM_182907chr622117 507 --1967 --
NM_182918chr211267 ------
NM_182931chr72702 648 ------
NM_182943chr32907 357 ------
NM_182948chr153175 3015 606 194 180 12408 12310 --
NM_182961chr61572 139 --1552
NM_182975chr1165 ----1755
NM_183004chr1463056 2604 1213 871 754 499 --11139 --
NM_183006chr2011031 ------
NM_183043chr133336 278 54 ------
NM_183044chr133336 278 54 ------
NM_183061chr3123 ------
NM_183078chr672777 2681 2638 1500 1312 856 103 --13580 --
NM_183238chr1253109 966 860 721 455 12837 1677 --
NM_183353chrX1764 11198 --1833
NM_183419chr81239 --21046 277 11070
NM_183425chr20196 ------
NM_194247chr264275 3057 1573 1265 1252 422 --23144 2840 11049
NM_194278chr1433865 3814 1177 --23373 2748 1856
NM_194285chr1132854 2124 1013 1156 11311 1560
NM_194286chr1223775 1112 25912 254 34319 2376 1874 16172
NM_194292chr141777 1351 560 136 ------
NM_194314chr165020 3674 1569 1440 845 419 ------
NM_194317chr272301 2258 1844 1832 1814 218 133 ------
NM_194328chr952267 2226 2213 977 658 --12870 --
NM_194329chr952267 2226 2213 977 658 --12870 --
NM_194330chr952267 2226 2213 977 658 --12870 --
NM_194332chr952267 2226 2213 977 658 --12870 --
NM_194356chr1211650 --1309 22332 273
NM_194429chr61586 ------
NM_194434chr1855440 4035 3561 1719 1466 11314 --13949
NM_197939chr1741095 973 288 143 ------
NM_197962chr1128 ------
NM_197970chr221424 1124 ------
NM_198057chrX2114 82 ------
NM_198097chr7125 ------
NM_198129chr182342 43 ------
NM_198151chr72183 23 ------
NM_198158chr323073 799 --12710 12812
NM_198159chr323073 799 --12710 12812
NM_198177chr323073 799 --12710 12812
NM_198178chr323073 799 --12710 12812
NM_198195chr31187 --1268 --
NM_198212chr741917 736 631 30 1235 1455 --
NM_198225chr1021331 67 ----1169
NM_198268chr133845 1486 784 13139 23600 2825 --
NM_198269chr133845 1486 784 13139 23600 2825 --
NM_198270chrX41136 1105 828 232 --12285 --
NM_198273chr562260 2222 936 758 497 248 --22316 514 11009
NM_198279chrX41240 1144 975 92 --1830 --
NM_198391chr2011491 --21427 398 --
NM_198400chr1552368 2006 1839 247 136 --12661 --
NM_198401chr831271 477 106 188 ----
NM_198402chr31334 ------
NM_198404chr134874 678 331 32 ------
NM_198439chr1131472 514 281 --11549 1566
NM_198465chrX42869 2443 2132 138 ------
NM_198507chr51189 ------
NM_198513chr831937 1244 652 --11299 --
NM_198521chr121123 ------
NM_198570chr7----2258 248 --
NM_198581chr276476 4981 1917 1431 572 425 240 2783 684 ----
NM_198584chr832668 533 320 --11723 166
NM_198700chr112408 75 --196 --
NM_198721chr4121 ------
NM_198793chr333517 844 67 --34031 1295 525 --
NM_198830chr173285 277 136 --1209 --
NM_198859chr341542 1075 679 83 ----24271 3728
NM_198881chrX1481 ------
NM_198889chr41950 ----21429 545
NM_198896chr1152174 1814 1652 574 229 ----1172
NM_198900chr12107365 6721 6611 6273 5666 1262 1131 479 297 23 --24759 1734 --
NM_198902chr151222 --1102 --
NM_198935chr2073166 2858 2845 2399 1150 991 165 ------
NM_198990chr743335 3180 2146 1077 --12802 2883 266
NM_199000chr732067 2002 490 --21659 725 --
NM_199003chr81276 1284 11511 --
NM_199004chr171459 1431 ----
NM_199044chr133035 2388 318 --12186 12680
NM_199050chr2153718 3195 1133 824 512 13459 ----
NM_199054chr1972023 845 503 422 236 227 120 ------
NM_199072chr762575 2457 1979 1222 425 324 12434 171 --
NM_199131chr1043401 3010 731 551 --12502 --
NM_199138chr132835 247 ------
NM_199144chr202303 109 --21045 602 --
NM_199160chr962006 1623 1601 741 665 138 --11523 --
NM_199188chr1264053 3847 3417 1595 406 114 --11115 --
NM_199189chr51232 ------
NM_199190chr1264053 3847 3417 1595 406 114 --11115 --
NM_199203chr202303 109 --21045 602 --
NM_199320chr432333 869 505 ----1347
NM_199320chr432333 869 505 ----1347
NM_199324chr4--13488 12818 --
NM_199327chr41464 --11164 --
NM_199328chr212883 243 ------
NM_199355chr1631447 202 90 11411 1186 --
NM_199359chr2021579 31 ----1362
NM_199360chr2021579 31 ----1362
NM_199361chr2021579 31 ----1362
NM_199362chr2021579 31 ----1362
NM_199363chr2021579 31 ----1362
NM_199436chr212663 1254 ----
NM_199454chr133580 1277 478 ------
NM_199461chr1042532 2230 1143 380 ------
NM_199483chr202256 35 ------
NM_199511chr32776 570 ------
NM_199512chr32776 570 ------
NM_201263chr132046 1839 406 11336 1712 --
NM_201269chr121286 257 ------
NM_201428chr1111204 ----1175
NM_201429chr1111204 ----1175
NM_201430chr1111130 ----1101
NM_201432chr1746205 5916 2329 1420 21977 1736 --11544
NM_201433chr1746205 5916 2329 1420 21977 1736 --11544
NM_201436chr72603 177 --1109 --
NM_201437chr841275 1254 1194 1083 --11452 --
NM_201516chr72659 233 --1165 --
NM_201517chr72603 177 --1109 --
NM_201570chr1021766 353 ------
NM_201571chr1021766 353 ------
NM_201572chr1021766 353 ------
NM_201590chr1021766 353 ------
NM_201591chr411204 1141 ----
NM_201592chr411204 1141 ----
NM_201593chr1021766 353 ------
NM_201596chr1021766 353 ------
NM_201597chr1021766 353 ------
NM_201613chr121703 ----1153
NM_201624chr12829 364 ----11200
NM_203281chrX----2372 242 --
NM_203283chr41457 ------
NM_203284chr41457 ------
NM_203307chr1921346 1306 1261 1369 11147
NM_203349chr1522017 1389 1100 11696 1291
NM_203350chr131738 267 36 --150 --
NM_203399chr11260 ----1741
NM_203401chr11260 ----1741
NM_203403chr91483 1246 ----
NM_203406chr532932 2155 558 12073 1590 12583
NM_203437chr2----168 --
NM_203446chr2122334 1063 --32959 2287 2027 --
NM_203458chr13902 866 284 33617 607 332 13881 --
NM_203459chr132636 1848 283 ------
NM_203463chr284523 4117 4100 3044 2991 1944 1007 126 ------
NM_203487chr1321314 463 1599 11686 --
NM_203504chr462534 1596 1053 888 776 126 --12092 --
NM_203505chr462534 1596 1053 888 776 126 --12092 --
NM_205836chr51197 ------
NM_205841chr5----1174 --
NM_205860chr152585 2532 2246 2031 87 ------
NM_205861chr161605 1398 797 319 220 80 ----11512
NM_206594chr132779 2576 1280 --1691 --
NM_206595chr132779 2576 1280 --1691 --
NM_206814chr621332 163 --11546 --
NM_206852chr141635 ------
NM_206853chr663485 3415 2706 1343 778 433 ------
NM_206854chr684746 4676 3967 3403 2039 1694 786 473 23270 679 ----
NM_206855chr695711 5641 4932 4368 4015 3973 1751 1438 775 24235 1644 ----
NM_206857chr141635 ------
NM_206866chr2132143 1244 320 --13188 --
NM_206876chr252727 2244 978 326 284 ------
NM_206907chr522057 39 22257 223 11228 --
NM_206909chr8148232 7313 6922 6807 6729 6714 5318 5215 5098 3257 2856 2723 2469 477 26694 1475 25154 636 --
NM_206943chr22849 597 ------
NM_207012chr1062238 2177 717 570 529 104 --12359 1811
NM_207015chr32838 613 11498 ----
NM_207292chr353105 2987 2587 639 283 1848 21239 623 --
NM_207293chr353105 2987 2587 639 283 1848 21239 623 --
NM_207294chr353105 2987 2587 639 283 1848 21239 623 --
NM_207295chr353105 2987 2587 639 283 1848 21239 623 --
NM_207296chr353105 2987 2587 639 283 1848 21239 623 --
NM_207297chr353130 3012 2612 664 308 1873 21264 648 --
NM_207304chr1322662 1991 --11067 1488
NM_207325chr1971801 1656 1289 675 465 331 162 --21696 309 --
NM_207337chr121862 --1419 --
NM_207406chr495383 5215 5021 4898 4292 2595 2139 1821 633 15082 ----
NM_207517chr1561592 1543 1340 783 578 344 ------
NM_207578chr11636 ------
NM_207647chr91155 --11998 --
NM_212460chr741986 1621 783 668 ------
NM_212474chr23421 163 30 1818 1300 --
NM_212475chr23421 163 30 1818 1300 --
NM_212476chr23421 163 30 1818 1300 --
NM_212478chr23421 163 30 1818 1300 --
NM_212482chr23421 163 30 1818 1300 --
NM_212558chr954093 4080 3491 3080 2644 ------
NM_213589chr285524 5177 4907 1995 1954 1720 1565 1458 ------
NM_213593chr11821 --21007 350 1795