TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-22-3p
miRNA Sequence: AAGCUGCCAGUUGAAGAACUGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr5199 1896 ----
NM_000021chr143954 309 126 --1941 --
NM_000024chr51493 ------
NM_000081chr1--11565 1601 --
NM_000084chrX96486 6421 5692 4873 4672 2553 1981 1939 1694 32638 2572 1348 11198 --
NM_000088chr1731282 1091 863 ------
NM_000109chrX1507 12685 ----
NM_000110chr1------1248
NM_000112chr584121 3697 3398 1825 1539 534 281 178 11897 ----
NM_000125chr654180 3500 1551 1257 274 11144 12945 --
NM_000138chr1522573 544 1214 ----
NM_000141chr10----11044 --
NM_000158chr3--1237 ----
NM_000163chr521633 607 --12334 --
NM_000170chr91158 ------
NM_000176chr553888 3279 3233 628 182 ----1618
NM_000182chr22481 51 ------
NM_000192chr121170 ------
NM_000194chrX1552 ------
NM_000202chrX--11445 ----
NM_000214chr202534 439 ------
NM_000216chrX21374 86 12781 ----
NM_000217chr1233811 1720 41 ------
NM_000232chr41318 ------
NM_000245chr722184 390 ------
NM_000259chr1595992 5662 5071 4476 4116 2499 2067 1453 311 24612 1973 14296 --
NM_000260chr113106 79 45 ------
NM_000266chrX1192 --149 --
NM_000267chr1722709 1336 13148 23315 1024 --
NM_000276chrX22022 387 1550 ----
NM_000284chrX41799 1401 640 155 ------
NM_000301chr6185 ------
NM_000314chr1072792 2686 2604 2519 1221 443 206 ----1696
NM_000318chr81567 --1851 --
NM_000319chr1221023 412 11111 ----
NM_000321chr13----11372 --
NM_000330chrX31749 1700 433 --1497 --
NM_000332chr644595 4360 1572 412 16342 --15942
NM_000337chr5131 14504 ----
NM_000353chr163850 314 63 ------
NM_000362chr2222450 484 12630 ----
NM_000367chr642190 2017 498 208 ------
NM_000368chr974593 4444 4146 3351 3256 1282 274 14153 44840 1717 1094 606 --
NM_000378chr11138 1228 ----
NM_000386chr17146 ------
NM_000403chr1138 ------
NM_000430chr1733452 975 600 1673 ----
NM_000439chr522514 409 ------
NM_000460chr3----1323 --
NM_000461chr3--11023 ----
NM_000462chr1511524 ------
NM_000475chrX135 ------
NM_000489chrX1869 23126 635 ----
NM_000495chrX1365 ------
NM_000500chr62182 127 --1393 --
NM_000503chr81122 ------
NM_000516chr20--175 ----
NM_000522chr7--21125 296 ----
NM_000523chr221141 480 ------
NM_000533chrX1553 ------
NM_000538chr13--2585 293 11725 --
NM_000555chrX87785 7303 6602 5863 5041 1708 1611 240 27132 1856 21819 492 --
NM_000609chr1041918 568 544 228 ------
NM_000615chr1142758 913 625 50 ------
NM_000617chr12130 ------
NM_000618chr1246178 5420 4252 2047 11749 ----
NM_000618chr1246178 5420 4252 2047 11749 ----
NM_000633chr1864308 4246 4234 3708 3473 1068 ------
NM_000678chr20----1120 --
NM_000679chr5----1147 --
NM_000724chr10----1265 --
NM_000725chr123294 197 41 ------
NM_000767chr1921158 348 ------
NM_000800chr521212 474 11546 ----
NM_000801chr201930 ------
NM_000817chr2--1328 ----
NM_000824chr41161 ------
NM_000828chrX12007 ------
NM_000831chr145632 5095 1820 577 22293 1334 35557 5487 4406 --
NM_000836chr191362 ------
NM_000840chr7163 ------
NM_000859chr531614 1476 412 ------
NM_000868chrX32311 1676 650 ------
NM_000872chr1031597 249 60 ------
NM_000875chr1575013 4644 4261 2366 2080 2038 200 16018 1665 --
NM_000880chr8172 ------
NM_000891chr1731323 1004 633 ------
NM_000899chr122287 77 ------
NM_000901chr432187 1869 528 ------
NM_000908chr5--1117 ----
NM_000919chr51418 ------
NM_000921chr121487 ------
NM_000927chr71509 ------
NM_000935chr3--11165 ----
NM_000944chr43542 111 85 ------
NM_000945chr22672 350 ------
NM_000949chr51159 ------
NM_000950chrX32844 2268 827 --13499 --
NM_000958chr521309 961 ------
NM_000962chr933011 2264 1934 --22577 719 --
NM_000966chr122778 47 ------
NM_001001132chr2141440 1138 528 163 ------
NM_001001323chr1212231 ------
NM_001001330chr101113 --2910 193 --
NM_001001331chr312259 --12644 --
NM_001001394chr2--1270 1122 --
NM_001001396chr122876 237 ------
NM_001001479chr22----1793 1715
NM_001001481chr823060 806 ------
NM_001001484chr1022378 1672 11858 ----
NM_001001485chr32178 141 ------
NM_001001486chr32120 83 ------
NM_001001487chr32120 83 ------
NM_001001522chr112328 291 --1155 --
NM_001001557chr811416 ------
NM_001001586chr11384 --1198 --
NM_001001740chr1153 ------
NM_001001740chr1153 ------
NM_001001890chr2121643 1001 --14211 13940
NM_001001936chr102966 448 ------
NM_001001971chr101201 ------
NM_001001974chr10--11824 ----
NM_001002233chr821988 477 11920 ----
NM_001002295chr102999 957 --1334 --
NM_001002762chr10112322 2295 1892 1821 1088 816 678 603 591 566 184 --172 --
NM_001002838chrX41441 714 391 185 ------
NM_001002843chr15--1813 ----
NM_001002876chr221376 ------
NM_001002906chrY2383 57 ------
NM_001002909chr172843 105 ------
NM_001003396chr61138 1430 127 --
NM_001003397chr61138 1430 127 --
NM_001003407chr1054560 3572 1365 1257 473 1435 1560 14002
NM_001003408chr1054560 3572 1365 1257 473 1435 1560 14002
NM_001003652chr1868168 6928 6768 2702 1487 966 22686 1846 15388 --
NM_001003674chr1836073 4381 2449 11531 ----
NM_001003675chr1836073 4381 2449 11531 ----
NM_001003681chr2242029 1651 790 674 ------
NM_001003682chr131217 421 135 11356 ----
NM_001003683chr2--1312 136 --
NM_001003688chr43957 850 842 ------
NM_001003694chr31163 --1199 --
NM_001003794chr341988 1980 1888 928 ------
NM_001003800chr91430 129 11094 --
NM_001003810chr41100 1772 ----
NM_001003845chr21529 --165 --
NM_001004127chr131681 11024 ----
NM_001004304chr1222567 517 --2584 335 --
NM_001004317chr673782 3393 3203 2961 904 641 89 ----11182
NM_001004360chr2----1100 --
NM_001004419chr1253268 1413 935 791 514 13017 ----
NM_001004722chr2265 36 ------
NM_001005271chr171145 --11019 --
NM_001005273chr171145 --11019 --
NM_001005291chr174191 131 94 57 ------
NM_001005375chrY41287 1261 1249 73 ------
NM_001005386chr221618 492 --21840 432 --
NM_001005404chr1752792 887 691 672 287 ------
NM_001005463chr10--1926 ----
NM_001005473chr5--36298 6055 1224 --1651
NM_001005474chr331476 276 50 --11112 --
NM_001005505chr31494 --11601 --
NM_001005732chr213660 467 38 ------
NM_001005733chr213617 424 38 ------
NM_001005743chr142990 54 ------
NM_001005744chr142990 54 ------
NM_001005745chr142990 54 ------
NM_001005849chr171485 ------
NM_001006115chr362695 1784 936 803 613 280 --1847 --
NM_001006600chr511712 ------
NM_001006610chr16----1986 --
NM_001006617chr931358 212 33 ------
NM_001006619chr931358 212 33 ------
NM_001006620chr931358 212 33 ------
NM_001006621chr931358 212 33 ------
NM_001007075chr421108 214 ------
NM_001007097chr964916 4280 3569 1296 1183 971 11918 21858 1788 1226
NM_001007156chr1521608 769 --1244 --
NM_001007157chr7136 ------
NM_001007237chr142065 847 265 177 ------
NM_001007246chr212415 285 ------
NM_001007271chr102918 361 --2859 244 --
NM_001007277chr112912 51 1369 1174 --
NM_001007278chr133491 149 22 --12074 11305
NM_001007466chr664884 3612 2020 1509 987 61 ------
NM_001007527chr51291 ------
NM_001007553chr12956 809 ------
NM_001007559chr1831746 1720 183 ------
NM_001008216chr1138 ------
NM_001008220chr542958 2406 812 208 12796 13192 --
NM_001008222chrX2412 190 ------
NM_001008239chr1822703 1128 ----13570
NM_001008392chr331033 528 363 23300 886 ----
NM_001008407chr761636 1533 673 350 94 60 1683 11249 --
NM_001008408chr7106435 6016 5988 5846 4651 3919 1942 1890 1647 757 --15553 --
NM_001008541chr1031651 627 252 ------
NM_001008541chr1031651 627 252 ------
NM_001008660chr1111353 ------
NM_001008701chr1931114 1050 91 --2762 384 --
NM_001008726chr1411385 ------
NM_001008738chr532126 1929 920 ------
NM_001008744chr1421064 581 ------
NM_001008777chr171185 ------
NM_001008801chr1921588 726 ------
NM_001008938chr11131 ------
NM_001009571chr71688 --11542 11261
NM_001009813chr191328 ----1283
NM_001009899chr366226 6161 5987 2432 2103 1456 42325 828 795 518 1395 --
NM_001009958chr7165 ------
NM_001009993chr2104563 3787 3647 3510 2875 1372 1322 1190 785 643 --34165 2917 1678 --
NM_001010000chr1812716 --13261 --
NM_001010853chr642042 1124 947 636 --12190 --
NM_001010862chrX12141 --22763 295 --
NM_001010867chr186390 5490 5413 4117 2537 1341 1335 871 --42665 2109 1266 333 --
NM_001010888chrX33474 2916 2878 --1540 14277
NM_001010891chr534876 2626 1062 --1726 --
NM_001010898chr162890 1285 1208 643 370 197 --1996 --
NM_001010917chr1031992 1878 310 --21712 65 --
NM_001010924chr10196 ------
NM_001010942chr124825 461 228 21 ------
NM_001010980chr133429 2923 1380 --22875 80 --
NM_001010986chrX32426 1914 1549 ------
NM_001011537chr311821 --11796 --
NM_001011658chrX51752 1606 1536 710 378 --11350 --
NM_001011666chr744861 4532 1922 1457 15021 ----
NM_001011713chr141108 ------
NM_001012267chr951906 1734 1691 1218 509 1125 ----
NM_001012329chr152222 2017 1621 1478 79 ------
NM_001012393chr1144795 4502 3797 1715 --13579 --
NM_001012426chr622669 138 ------
NM_001012427chr622669 138 ------
NM_001012478chr192141 126 --1594 --
NM_001012614chr43668 589 141 ------
NM_001012751chr10----1168 --
NM_001012756chr1923060 2464 11256 ----
NM_001012761chr531794 441 219 1382 ----
NM_001012958chr12175 132 ------
NM_001012958chr12175 132 ------
NM_001012977chrX--1964 ----
NM_001012980chrX1219 ------
NM_001012989chrX--1445 ----
NM_001013031chr1042745 2158 692 193 --23084 502 --
NM_001013415chr41330 --1254 --
NM_001013438chr31733 ------
NM_001013439chr31579 ------
NM_001013624chr1711068 --1154 --
NM_001013690chr1242481 1766 1656 755 ------
NM_001013693chr142881 2791 982 401 --2825 697 12937
NM_001013693chr142881 2791 982 401 --2825 697 12937
NM_001013699chr12------1491
NM_001013843chr151300 ------
NM_001014283chr1361714 1588 634 361 331 159 ------
NM_001014431chr143770 159 50 1298 ----
NM_001014432chr143770 159 50 1298 ----
NM_001014797chr1087149 7076 6572 6237 5864 5428 1136 92 26586 5854 17639 --
NM_001014809chr41845 --1834 --
NM_001014812chr15----164 --
NM_001015045chr451579 728 618 81 69 --132 --
NM_001015053chr1711620 ------
NM_001015877chrX32725 414 218 1206 ----
NM_001015881chrX11257 ------
NM_001015887chr31135 ------
NM_001017371chr211273 ------
NM_001017395chr311038 ------
NM_001017405chr42852 644 ------
NM_001017424chr12335 75 ------
NM_001017425chr12335 75 ------
NM_001017440chr777318 7120 5319 2829 2279 1903 32 --57907 6726 6361 2084 1723 --
NM_001017523chr1231726 528 424 --1395 --
NM_001017920chr21114 ------
NM_001017926chr831708 1400 180 ------
NM_001017979chr4----1163 --
NM_001017995chr584338 3720 3684 3098 1645 602 402 93 ------
NM_001018038chr91482 ------
NM_001018056chr92609 75 ------
NM_001018057chr114918 570 445 234 --1968 --
NM_001018067chr195197 5191 5142 4708 4400 4091 3900 3350 224 --13448 --
NM_001018068chr195197 5191 5142 4708 4400 4091 3900 3350 224 --13448 --
NM_001018069chr195197 5191 5142 4708 4400 4091 3900 3350 224 --13448 --
NM_001018072chr1231726 528 424 --1395 --
NM_001018074chr553888 3279 3233 628 182 ----1618
NM_001018075chr553888 3279 3233 628 182 ----1618
NM_001018076chr553888 3279 3233 628 182 ----1618
NM_001018077chr553888 3279 3233 628 182 ----1618
NM_001018108chr1541944 769 264 168 12286 ----
NM_001018111chr732752 1442 1333 1955 1842 11515
NM_001024094chr553888 3279 3233 628 182 ----1618
NM_001024218chr141599 ------
NM_001024226chr13930 731 66 --1202 --
NM_001024227chr13930 731 66 --1202 --
NM_001024228chr13930 731 66 --1202 --
NM_001024380chr822031 655 ------
NM_001024381chr822031 655 ------
NM_001024649chr572536 2101 1182 943 684 406 182 ------
NM_001024660chr321080 104 ------
NM_001024666chrX--1687 ----
NM_001024808chr1241923 1843 955 510 12574 1514 --
NM_001024858chr1482868 2238 1928 1056 924 788 456 52 --22872 2514 --
NM_001024947chr5----1406 --
NM_001024948chr132282 1342 565 32981 797 450 11172 --
NM_001025076chr1065231 4972 4558 4302 3908 538 ------
NM_001025077chr1076589 6330 5916 5660 5266 1896 945 15071 ----
NM_001025079chr362570 2551 809 469 451 178 --13433 1462
NM_001025105chr551275 1185 1164 537 163 ------
NM_001025109chr1129 ------
NM_001025201chr2177 ------
NM_001025266chr384709 3841 1708 1187 1175 974 364 132 ------
NM_001025366chr611813 ------
NM_001025366chr611813 ------
NM_001025367chr611813 ------
NM_001025367chr611813 ------
NM_001025368chr611813 ------
NM_001025368chr611813 ------
NM_001025369chr611829 ------
NM_001025369chr611829 ------
NM_001025370chr611813 ------
NM_001025370chr611813 ------
NM_001025579chr1721075 802 --21138 955 1233
NM_001025580chrX44022 3282 2624 426 ------
NM_001025780chr911041 ------
NM_001029858chr631320 123 99 ------
NM_001029863chr63834 139 56 ------
NM_001029864chr202842 349 --168 --
NM_001029875chr51174 12300 12010 --
NM_001029891chrX3759 207 117 ------
NM_001029989chr151959 ------
NM_001030007chr1643541 1224 579 318 12488 ----
NM_001030055chr1434311 4147 443 13947 14242 --
NM_001030272chr11----1312 --
NM_001030273chr11----1312 --
NM_001031679chr1261421 1335 1271 1265 386 294 1897 1107 --
NM_001031685chr12364 110 --1323 --
NM_001031690chr742235 1086 329 323 --1629 11981
NM_001031695chr2255282 5232 4202 4189 337 --14670 --
NM_001031732chr433438 711 467 13322 ----
NM_001031740chr121059 142 --1597 --
NM_001031748chr12--1106 ----
NM_001031804chr1623243 1668 13797 ----
NM_001032280chr651505 1432 1304 1272 195 1656 ----
NM_001032282chr81284 ------
NM_001032296chr1332215 1993 1887 --12602 --
NM_001032380chr1031663 1590 1292 ------
NM_001032394chr622737 2337 ------
NM_001032395chr622604 2204 ------
NM_001032999chr20134674 4557 4015 3930 3884 1880 1490 513 383 376 369 214 88 ----13383
NM_001033045chr224351 3743 ------
NM_001033047chr42786 356 1907 1725 --
NM_001033049chr2111959 ------
NM_001033057chr312006 12074 ----
NM_001033059chr6184 ------
NM_001033081chr121331 1298 --21275 254 --
NM_001033082chr121331 1298 --21275 254 --
NM_001033087chr2041132 1008 849 659 12804 ----
NM_001033112chr5156 ------
NM_001033117chr364612 4189 3794 1255 729 164 ------
NM_001033551chr1792988 2928 2905 2648 1317 1011 722 715 293 11161 23488 3329 --
NM_001033566chr171882 ------
NM_001033568chr171882 ------
NM_001033602chr1362624 2540 2338 766 448 110 12064 12342 --
NM_001033756chr611747 ------
NM_001033756chr611747 ------
NM_001033925chr1022100 1350 ------
NM_001034845chr41223 1329 ----
NM_001034850chr51614 11369 ----
NM_001034852chr1452074 1565 1548 1537 1453 ------
NM_001035chr11346 ------
NM_001035005chr182505 222 ------
NM_001035260chr101167 ------
NM_001037131chr22193 45 1532 1384 --
NM_001037164chr711518 1446 ----
NM_001037290chr111769 ------
NM_001037332chr542499 1983 816 238 --11969 --
NM_001037333chr542499 1983 816 238 --11969 --
NM_001037339chr121496 168 ------
NM_001037340chr121496 168 ------
NM_001037341chr121496 168 ------
NM_001037341chr121496 168 ------
NM_001037582chr431474 636 331 ------
NM_001037637chr51151 ------
NM_001037954chr1122801 670 --12492 --
NM_001038640chr152859 53 ------
NM_001038707chr11210 --1777 --
NM_001038707chr11210 --1777 --
NM_001039350chr711769 2571 449 1148 --
NM_001039366chr22188 ------
NM_001039459chr71390 ------
NM_001039465chr141511 ------
NM_001039538chr2172 ------
NM_001039547chr337036 2741 200 --21202 33 --
NM_001039569chr232941 2493 229 ------
NM_001039590chrX1714 --1386 --
NM_001039591chrX1714 --1386 --
NM_001039618chr1144345 4205 1924 1790 --12356 --
NM_001039619chr14137 ------
NM_001039690chr1652157 2130 2014 326 160 --12029 --
NM_001039709chr20134674 4557 4015 3930 3884 1880 1490 513 383 376 369 214 88 ----13383
NM_001039762chr1032008 1700 213 ------
NM_001039802chr131277 964 933 ------
NM_001039840chrX45086 4351 1133 1065 21842 1116 1422 --
NM_001039937chr1321564 957 --13733 --
NM_001040001chr621839 1661 ------
NM_001040108chr1453042 2959 2951 2534 121 --12071 --
NM_001040144chr1652157 2130 2014 326 160 --12029 --
NM_001040146chr1652157 2130 2014 326 160 --12029 --
NM_001040152chr713690 --1692 --
NM_001040153chr13174 ------
NM_001040157chr441777 813 302 100 ----1497
NM_001040214chr61705 ------
NM_001040260chr42955 826 --21021 888 --
NM_001040261chr42955 826 --21021 888 --
NM_001040272chr952184 2178 1999 1873 871 ------
NM_001040284chr1612245 --14519 --
NM_001040402chr442055 1070 1052 199 ------
NM_001040409chr21902 --1855 --
NM_001040424chr2172894 2608 2444 888 456 449 248 ------
NM_001040429chr13----11166 --
NM_001040439chr1631202 120 75 --21404 243 --
NM_001040441chr135341 3839 1336 ------
NM_001040624chr842729 2012 1767 850 ------
NM_001040625chr842729 2012 1767 850 ------
NM_001040626chr842729 2012 1767 850 ------
NM_001040627chr842729 2012 1767 850 ------
NM_001040628chr842729 2012 1767 850 ------
NM_001040629chr842729 2012 1767 850 ------
NM_001040630chr842729 2012 1767 850 ------
NM_001040653chr351731 1027 1021 883 760 ------
NM_001040665chr754440 4349 4279 1354 694 24382 1068 14506 --
NM_001040709chr142037 1917 688 163 ------
NM_001040712chr922521 361 ------
NM_001040715chr1631075 896 71 ------
NM_001042353chr202446 360 --1488 --
NM_001042355chr1644836 4658 1022 699 1408 172 --
NM_001042361chr101299 ------
NM_001042364chr101299 ------
NM_001042365chr101299 ------
NM_001042368chr9133 ------
NM_001042387chr101299 ------
NM_001042393chr101299 ------
NM_001042396chr101299 ------
NM_001042397chr101299 ------
NM_001042403chr121698 ------
NM_001042404chr11229 ------
NM_001042412chr1644836 4658 1022 699 1408 172 --
NM_001042413chr924043 839 1781 ----
NM_001042425chr651505 1432 1304 1272 195 1656 ----
NM_001042437chr22951 103 ------
NM_001042440chr531529 1459 1287 ------
NM_001042441chr531529 1459 1287 ------
NM_001042442chr531529 1459 1287 ------
NM_001042443chr531529 1459 1287 ------
NM_001042444chr531529 1459 1287 ------
NM_001042445chr531529 1459 1287 ------
NM_001042446chr531529 1459 1287 ------
NM_001042453chrX----1563 --
NM_001042473chr1021951 1343 ------
NM_001042476chr1661981 788 621 499 413 60 --21715 886 --
NM_001042492chr1722709 1336 13148 23315 1024 --
NM_001042494chr1522634 698 23801 1102 ----
NM_001042495chr1522634 698 23801 1102 ----
NM_001042496chr1522634 698 23801 1102 ----
NM_001042497chr1522634 698 23801 1102 ----
NM_001042506chrX--1964 ----
NM_001042510chr841789 1379 1356 74 --1508 --
NM_001042511chr841789 1379 1356 74 --1508 --
NM_001042537chrX11651 --11613 --
NM_001042539chr16586 77 68 62 50 ------
NM_001042550chr91340 ------
NM_001042555chr1243601 1925 1306 1253 --13843 --
NM_001042576chr201380 --1114 --
NM_001042599chr246681 5958 5048 546 ----16696
NM_001042603chr1214521 ------
NM_001042604chr374228 4185 3993 3691 1825 1278 203 ------
NM_001042632chr2062498 469 211 190 133 67 12033 1340 --
NM_001042633chr2062498 469 211 190 133 67 12033 1340 --
NM_001042663chr151320 1214 1183 500 216 ------
NM_001042664chr151320 1214 1183 500 216 ------
NM_001042665chr151320 1214 1183 500 216 ------
NM_001042681chr112493 11737 ----
NM_001042682chr112493 11737 ----
NM_001042682chr112493 11737 ----
NM_001042702chr2142 ------
NM_001042728chr122778 47 ------
NM_001042749chrX21752 1501 --1156 11305
NM_001042750chrX21752 1501 --1156 11305
NM_001042751chrX21752 1501 --1156 11305
NM_001043318chr1443755 2733 1114 188 23126 1402 1154 --
NM_001043351chr111522 ------
NM_001044305chr621478 1444 11508 1209 --
NM_001044385chr223847 1311 13862 ----
NM_001046chr512994 ------
NM_001087chr2177 ------
NM_001092chr1731819 577 458 --11020 --
NM_001096chr172740 78 --1823 --
NM_001099678chr356088 5423 4255 300 244 34354 2572 2434 ----
NM_001100108chr1106882 6639 5261 2548 2115 974 849 490 354 221 22268 1776 16707 12131
NM_001106chr368425 3740 2529 2438 1025 111 29728 9235 ----
NM_001117chr1822056 2049 --1799 --
NM_001122631chr113521 100 41 --1104 --
NM_001122679chr5199 1896 ----
NM_001128chr1643541 1224 579 318 12488 ----
NM_001144chr16----1316 --
NM_001148chr431889 221 123 --11860 --
NM_001149chr1011152 ------
NM_001160chr124999 701 390 161 --12599 --
NM_001167chrX66487 6047 5604 4437 1980 135 14386 16069 11002
NM_001172chr142547 194 ------
NM_001173chr1434311 4147 443 13947 14242 --
NM_001174chrX41778 797 791 400 --1221 --
NM_001178chr11----1312 --
NM_001189chr42762 21 --1160 --
NM_001191chr2021463 1067 1154 ----
NM_001204chr237278 7257 5270 1662 17733 --
NM_001207chr51151 ------
NM_001219chr7--12166 ----
NM_001222chr103464 134 88 --1610 --
NM_001231chr11505 ------
NM_001241chr252454 1838 1743 1678 960 2438 353 ----
NM_001241chr252454 1838 1743 1678 960 2438 353 ----
NM_001256chr1722185 170 ------
NM_001257chr1611324 ------
NM_001259chr7106278 6056 5939 5384 2480 2381 2011 1883 372 197 ------
NM_001260chr132305 59 ------
NM_001262chr1154 1111 ----
NM_001275chr141110 --1256 --
NM_001277chr113983 736 51 ------
NM_001280chr192685 506 ------
NM_001284chr5166 ------
NM_001304chr1712384 --23436 159 --
NM_001313chr41845 --1834 --
NM_001315chr641947 725 652 249 --11457 --
NM_001328chr43668 589 141 ------
NM_001332chr51233 ------
NM_001349chr21452 ------
NM_001351chr341341 1261 1235 1218 ------
NM_001356chrX52396 2012 1668 501 83 ------
NM_001364chr1124223 3546 ------
NM_001386chr811991 ------
NM_001387chr532978 835 584 --33093 1021 538 --
NM_001394chr82712 88 ----1674
NM_001396chr2112364 --11773 --
NM_001407chr341477 681 332 94 ------
NM_001408chr111641 ------
NM_001412chrX33097 1305 458 12283 ----
NM_001414chr12258 31 ------
NM_001415chrX31373 416 281 ------
NM_001416chr171439 ------
NM_001417chr122356 272 21616 1372 ----
NM_001418chr111275 ------
NM_001418chr111275 ------
NM_001419chr1973784 3289 3016 2985 1530 559 363 11364 23649 3180 --
NM_001420chr1942330 535 105 39 ------
NM_001421chrX61748 1312 1101 459 307 229 11091 ----
NM_001423chr121831 11440 1751 --
NM_001429chr22----1733 --
NM_001430chr241858 1387 1348 23 ------
NM_001431chr61767 --1833 --
NM_001438chr123336 148 ------
NM_001453chr611645 ------
NM_001463chr21697 --1513 --
NM_001478chr121813 ------
NM_001482chr15----1339 --
NM_001483chr71740 ------
NM_001494chr10------1196
NM_001497chr911940 ------
NM_001518chr731069 1027 157 ------
NM_001530chr142454 357 --1384 --
NM_001542chr142065 847 265 177 ------
NM_001554chr11546 ----1476
NM_001560chrX1982 --2936 122 --
NM_001584chr1121171 355 ------
NM_001587chrX22022 387 1550 ----
NM_001610chr111281 --1775 --
NM_001612chr11135 ------
NM_001616chr211354 23339 2256 ----
NM_001634chr6184 ------
NM_001635chr73744 673 292 ----1864
NM_001650chr1833606 3027 1586 23756 1257 11570 --
NM_001656chr531918 1322 447 ------
NM_001658chr13930 731 66 --1202 --
NM_001659chr1232622 2379 328 ------
NM_001663chr1422249 317 ------
NM_001668chr111958 11411 ----
NM_001670chr224710 685 120 107 ------
NM_001677chr11916 ------
NM_001678chr1721580 1256 11785 ----
NM_001682chr1211945 ------
NM_001683chr312259 --12644 --
NM_001684chr112593 ------
NM_001688chr11235 ------
NM_001690chr332393 748 106 --1456 --
NM_001696chr22188 ------
NM_001704chr62564 525 ------
NM_001706chr31180 ------
NM_001709chr1122637 2347 ------
NM_001716chr1141537 507 226 46 --21217 622 1137
NM_001730chr1321090 256 ------
NM_001730chr1321090 256 ------
NM_001746chr572536 2101 1182 943 684 406 182 ------
NM_001750chr531529 1459 1287 ------
NM_001754chr2121643 1001 --14211 13940
NM_001755chr161178 ------
NM_001759chr1244683 1894 723 622 24389 769 13697 --
NM_001773chr12395 37 ------
NM_001777chr362570 2551 809 469 451 178 --13433 1462
NM_001789chr31244 ------
NM_001791chr131277 964 933 ------
NM_001798chr1211132 ------
NM_001804chr52790 339 ------
NM_001810chr20140 --1672 --
NM_001822chr2177 ------
NM_001823chr14157 ------
NM_001830chrX23750 3588 ------
NM_001834chr5291 60 ------
NM_001838chr171117 ------
NM_001842chr9--1225 ----
NM_001854chr1----11250 --
NM_001859chr91316 --23227 443 --
NM_001873chr4--185 ----
NM_001892chr551275 1185 1164 537 163 ------
NM_001895chr202447 65 ------
NM_001896chr162407 162 ----1412
NM_001901chr61893 ------
NM_001903chr52779 321 ------
NM_001918chr167926 7476 7311 7029 3250 615 26218 5844 ----
NM_001924chr1--176 ----
NM_001935chr21387 --1776 --
NM_001936chr711769 2571 449 1148 --
NM_001938chr111502 ------
NM_001945chr511044 ------
NM_001946chr123222 61 49 ------
NM_001954chr63713 558 127 1609 ----
NM_001957chr432298 1659 1516 --2704 351 --
NM_001964chr531225 1077 1049 ------
NM_001981chr11852 ------
NM_001982chr12------143
NM_001987chr1253303 1664 1265 665 347 --23862 961 --
NM_001991chr1762186 817 513 375 34 22 --1345 1196
NM_001995chr441363 1272 1206 393 ------
NM_002006chr432281 1180 703 --23709 472 --
NM_002015chr1353084 2303 2068 883 166 --12398 --
NM_002017chr112934 336 ------
NM_002023chr141377 1184 1064 173 1421 ----
NM_002024chrX21765 720 ------
NM_002025chrX88413 7791 7160 6274 2722 2482 1867 183 36092 2631 1276 12258 --
NM_002031chr61590 ------
NM_002032chr112306 56 ------
NM_002035chr1841471 1088 793 685 13858 ----
NM_002039chr42929 832 ------
NM_002051chr102999 957 --1334 --
NM_002054chr21376 ------
NM_002063chrX1949 1902 ----
NM_002074chr151765 1217 1200 1142 547 ------
NM_002076chr1232727 2701 352 178 1695 --
NM_002077chr941856 1666 1482 307 --31844 1731 183 11753
NM_002084chr52861 301 ------
NM_002090chr4199 ------
NM_002092chr464819 4652 4278 3247 1198 1018 ------
NM_002105chr115864 804 345 281 126 11010 ----
NM_002107chr1----1173 --
NM_002126chr172523 235 12917 12547 12813
NM_002129chr42275 84 ------
NM_002131chr641267 496 211 38 11318 ----
NM_002137chr712333 ------
NM_002138chr41100 1772 ----
NM_002140chr91878 ------
NM_002148chr21560 ------
NM_002156chr2157 ------
NM_002187chr51940 ------
NM_002193chr22493 42 --1315 --
NM_002199chr43903 381 264 ------
NM_002202chr51167 ------
NM_002207chr32555 160 ------
NM_002211chr10--1407 169 --
NM_002214chr742185 1290 1264 1055 --14778 --
NM_002221chr132369 2310 379 ------
NM_002222chr31395 1945 ----
NM_002226chr142777 756 ------
NM_002232chr11886 --1371 --
NM_002233chr11--170 ----
NM_002247chr1021861 1527 ------
NM_002254chr262351 2317 2300 890 348 50 ------
NM_002265chr1741071 1032 419 326 ------
NM_002267chr131156 ------
NM_002268chr311418 ------
NM_002270chr575046 4926 4908 2093 1975 992 860 ------
NM_002271chr1321928 620 1919 --1224
NM_002272chr122410 22 ----1199
NM_002293chr12560 23 --41013 750 724 46 --
NM_002296chr121545 569 --11198 --
NM_002298chr1321453 627 ------
NM_002305chr22----135 --
NM_002309chr2232868 2097 897 --32509 1938 884 --
NM_002313chr1054560 3572 1365 1257 473 1435 1560 14002
NM_002332chr121698 ------
NM_002356chr622786 2079 ------
NM_002359chr1764232 4166 3691 3269 564 453 ------
NM_002360chr73687 38 31 --42477 2048 526 134 --
NM_002373chr151952 ------
NM_002374chr2172 ------
NM_002375chr352213 1718 317 273 189 --1915 --
NM_002382chr14----1274 --
NM_002387chr554277 1790 1186 941 544 --1316 --
NM_002390chr173332 271 234 --31554 1303 379 --
NM_002397chr522014 395 ------
NM_002398chr241288 1099 965 323 ------
NM_002399chr15----11069 --
NM_002401chr1752225 1629 710 278 115 --22216 1826 --
NM_002412chr10197 ------
NM_002430chr2211801 22609 266 11889 --
NM_002431chr142113 85 ------
NM_002442chr1231446 1162 38 ------
NM_002451chr943822 3396 724 98 ----12658
NM_002467chr8--1316 ----
NM_002480chr1231476 243 66 ------
NM_002494chr4146 ------
NM_002499chr1532309 1677 776 --1211 --
NM_002500chr231116 509 76 ------
NM_002501chr1934036 1387 1080 --12947 --
NM_002505chr6----11280 --
NM_002515chr1411966 ------
NM_002519chr1111447 ------
NM_002522chr1733227 2810 992 ------
NM_002523chr72777 150 1482 ----
NM_002537chr153970 358 60 ------
NM_002539chr21266 ------
NM_002545chr1144795 4502 3797 1715 --13579 --
NM_002547chrX43303 1587 960 109 --43689 3260 3172 897 12624
NM_002569chr154489 391 342 306 --1255 --
NM_002574chr1138 ------
NM_002577chr352723 2614 1226 1109 500 23304 2757 ----
NM_002586chr631619 1063 559 --11565 --
NM_002588chr561700 1603 1561 1554 205 32 ------
NM_002595chr12--1576 ----
NM_002600chr121496 168 ------
NM_002613chr1684986 4890 4336 4088 3892 1444 494 55 --1611 --
NM_002628chr31887 ----186
NM_002629chr103762 207 117 ------
NM_002632chr141763 ------
NM_002643chr22130 79 ------
NM_002646chr132089 1944 1519 ------
NM_002648chr631236 1180 1069 ------
NM_002655chr845247 4292 4155 42 ------
NM_002657chr2022923 919 --33223 1567 85 --
NM_002660chr2041030 978 437 92 ----1944
NM_002687chr1411172 ------
NM_002693chr152407 167 ------
NM_002698chr1992980 2694 2647 941 243 156 148 142 30 --22522 2016 --
NM_002699chr121074 337 ------
NM_002713chr121033 426 1484 1772 --
NM_002715chr511076 ------
NM_002731chr12468 345 23117 92 22607 2020 --
NM_002734chr1731867 270 110 ------
NM_002736chr71551 ------
NM_002740chr332593 1068 813 1540 1993 --
NM_002745chr2274419 3965 3010 2990 2967 240 205 --1829 --
NM_002753chr41843 1320 ----
NM_002821chr6----2652 231 --
NM_002822chr1221739 467 ------
NM_002827chr2071747 1708 1438 1276 610 345 267 --11432 --
NM_002828chr18--1649 ----
NM_002829chr9196 ------
NM_002833chr1521170 146 --11453 --
NM_002834chr1243290 3235 1421 1062 21305 296 13496 11044
NM_002839chr922521 361 ------
NM_002840chr141387 1231 1177 576 ------
NM_002843chr1153260 3238 2802 2191 619 ------
NM_002844chr631331 1304 62 1322 ----
NM_002845chr181467 ------
NM_002846chr22599 26 ------
NM_002847chr741257 515 412 136 1145 11269 --
NM_002850chr192115 109 --11077 --
NM_002868chr1242100 1945 962 766 --1182 --
NM_002869chr112629 484 ------
NM_002885chr12919 409 ------
NM_002886chr354887 3698 2075 954 559 15085 1305 --
NM_002892chr1451717 1382 1339 1121 29 ------
NM_002897chr22632 206 ------
NM_002906chr115936 772 514 492 168 ------
NM_002923chr1------1621
NM_002924chr1156 ------
NM_002959chr1--11411 33641 2981 1716 --
NM_002968chr16----1326 --
NM_002971chr32793 202 ------
NM_002977chr233121 156 117 22740 1000 --12565
NM_002998chr831560 612 458 ------
NM_003010chr17--2924 340 ----
NM_003011chr91630 --11176 --
NM_003012chr892892 2320 2234 2156 1127 1079 813 734 190 ------
NM_003013chr41737 --1123 --
NM_003016chr1731617 1606 633 ------
NM_003017chr61985 1405 ----
NM_003020chr152303 128 ------
NM_003021chr1921111 966 --1781 --
NM_003026chr911045 ------
NM_003028chr993443 3151 3011 2905 1511 895 888 844 199 13276 53568 3381 3218 2429 739 --
NM_003029chr111306 --1595 --
NM_003031chr16----1986 --
NM_003043chr383737 3718 3467 3278 3218 1686 1341 433 --129 --
NM_003045chr1383727 3272 3185 1158 489 274 236 30 --2978 657 --
NM_003047chr111421 --1126 --
NM_003051chr12197 32 11779 ----
NM_003069chrX1316 ------
NM_003072chr193305 288 78 ------
NM_003074chr32810 347 --11488 --
NM_003076chr1211104 --11471 --
NM_003081chr2011056 11191 ----
NM_003091chr20128 ------
NM_003107chr642073 979 868 176 --32426 1817 875 --
NM_003108chr276960 6750 6053 4535 2884 2052 505 --12736 --
NM_003111chr211273 ------
NM_003112chr71969 ------
NM_003113chr21331 ------
NM_003126chr1------1429
NM_003128chr242278 581 515 333 ------
NM_003131chr641549 545 384 126 ------
NM_003137chr6----12068 --
NM_003139chr111884 ------
NM_003144chr62521 250 --21801 766 --
NM_003150chr1722081 331 ------
NM_003155chr822389 185 ------
NM_003156chr112432 408 --11130 --
NM_003162chr211084 ------
NM_003164chr112536 346 ------
NM_003165chr931294 721 152 198 ----
NM_003174chr102331 264 ------
NM_003178chr332070 1435 620 ------
NM_003185chr201318 ------
NM_003186chr112328 291 --1155 --
NM_003188chr62628 208 --1606 --
NM_003189chr122208 1200 --191 --
NM_003194chr61581 ------
NM_003199chr18----25376 4192 --
NM_003200chr1952204 2122 1693 820 162 ------
NM_003211chr1231527 48 37 ------
NM_003216chr2262879 2391 2094 553 421 114 --11083 --
NM_003220chr651505 1432 1304 1272 195 1656 ----
NM_003221chr663177 3071 1636 1417 1388 1188 --1753 --
NM_003234chr32473 147 12176 12011 --
NM_003236chr232477 320 293 13436 ----
NM_003246chr153793 737 172 ------
NM_003253chr2111415 --1124 --
NM_003255chr174568 469 325 276 --12246 --
NM_003257chr151886 ------
NM_003262chr364536 3781 3426 1158 964 890 24083 138 ----
NM_003269chr61858 1159 ----
NM_003275chr941502 1364 1357 93 ------
NM_003288chr203628 531 64 ------
NM_003291chr131277 --1561 --
NM_003292chr112059 ------
NM_003315chr17----1222 --
NM_003317chr141618 --1761 --
NM_003325chr221280 ------
NM_003338chr1021533 286 ------
NM_003340chr431122 1084 1056 ------
NM_003342chr1722070 1260 22385 2121 ----
NM_003344chr731495 1113 222 ------
NM_003347chr2231979 1914 1593 --12084 1126
NM_003348chr1221528 1042 1446 ----
NM_003350chr83820 395 304 --11008 --
NM_003356chr11------127
NM_003359chr421296 228 ------
NM_003369chr1142670 2251 1797 646 --11000 --
NM_003374chr51750 ------
NM_003376chr611813 ------
NM_003376chr611813 ------
NM_003380chr10196 ------
NM_003383chr92609 75 ------
NM_003385chr21834 159 ----
NM_003387chr221990 493 ------
NM_003392chr333456 2988 686 --11090 --
NM_003404chr20--11782 11846 --
NM_003405chr223530 152 110 ------
NM_003406chr821972 1355 ------
NM_003409chr182421 130 ------
NM_003411chrY11707 11400 ----
NM_003413chrX21933 1522 11304 ----
NM_003432chr5--1473 162 --
NM_003439chr721015 531 22836 1275 ----
NM_003442chr11153 ------
NM_003458chr373615 3073 1281 1074 740 200 85 ----12573
NM_003459chr21713 ------
NM_003463chr6----1124 --
NM_003468chr244161 4109 745 543 13627 1839 --
NM_003471chr32794 98 ----11990
NM_003473chr101918 1705 ----
NM_003478chr1123267 2324 12423 ----
NM_003482chr1231773 329 81 ------
NM_003483chr1222766 37 12679 ----
NM_003488chr172977 784 ------
NM_003489chr2122608 1000 ------
NM_003498chr1632314 788 675 ------
NM_003502chr162257 205 ------
NM_003506chr8----2981 492 --
NM_003508chr7191 ------
NM_003559chr1793850 3713 3442 3154 3057 2917 2534 2446 753 --23609 3083 --
NM_003564chr11531 --1479 --
NM_003566chr1213159 ------
NM_003574chr1812315 --1528 --
NM_003576chr1332215 1993 1887 --12602 --
NM_003580chr82513 203 ------
NM_003583chr1243641 2674 632 74 ------
NM_003590chr243957 2884 2771 1080 --1879 --
NM_003591chr102296 107 ------
NM_003597chr21109 --22168 2106 --
NM_003603chr421878 459 ------
NM_003607chr173971 3935 3014 1651 1041 213 115 --1289 --
NM_003613chr151256 ------
NM_003615chr333180 2683 1245 ------
NM_003617chr133775 1531 93 24165 3848 ----
NM_003618chr21236 ------
NM_003620chr171136 ------
NM_003624chr1931243 1053 81 ------
NM_003626chr1121214 982 ------
NM_003629chr142686 2596 2476 428 ------
NM_003631chr101154 ------
NM_003633chr532348 2054 588 11966 ----
NM_003653chr17171 ------
NM_003659chr22963 255 ------
NM_003663chr342430 1181 1075 624 ------
NM_003670chr321120 561 ------
NM_003671chr963290 2688 2680 2203 1442 1287 11117 1674 --
NM_003677chr12--11916 ----
NM_003680chr1----2262 151 --
NM_003684chr13825 330 89 --1339 1933
NM_003704chr41214 ------
NM_003709chr21390 ------
NM_003716chr31685 ------
NM_003718chr7168 ------
NM_003735chr561700 1603 1561 1554 205 32 ------
NM_003736chr561700 1603 1561 1554 205 32 ------
NM_003743chr22860 777 --1496 1819
NM_003744chr142990 54 ------
NM_003749chr1321971 96 ------
NM_003750chr10--1904 ----
NM_003758chr1531286 529 407 ------
NM_003758chr1531286 529 407 ------
NM_003778chr35738 606 591 584 553 ------
NM_003783chr121087 939 ------
NM_003787chr1821097 42 ------
NM_003791chr161462 --2249 81 --
NM_003795chr6----1152 --
NM_003822chr133030 1969 728 --1574 --
NM_003825chr1521297 43 2503 137 ----
NM_003850chr13--1204 ----
NM_003858chr141729 ------
NM_003861chr1411065 ------
NM_003872chr2--12912 ----
NM_003873chr1032195 1749 1669 ------
NM_003875chr3136 ------
NM_003877chr12--153 --1160
NM_003884chr32571 556 ------
NM_003885chr1711663 32508 2354 1862 ----
NM_003887chr242147 2026 398 101 1575 ----
NM_003893chr101105 --1427 --
NM_003895chr2121697 794 ------
NM_003896chr22951 103 ------
NM_003907chr31318 --1254 --
NM_003908chr2021130 431 ------
NM_003913chr643220 1070 261 63 ------
NM_003919chr7--153 ----
NM_003924chr431217 587 22 ------
NM_003927chr18----1931 --
NM_003934chr91346 ------
NM_003941chr722337 2176 ------
NM_003943chr42744 85 ------
NM_003947chr32265 29 ------
NM_003955chr171108 --11368 --
NM_003957chr114970 919 879 90 --2128 43 --
NM_003958chr653583 3128 1027 556 396 --13163 --
NM_003972chr1011006 ------
NM_003980chr611234 ------
NM_003992chr151316 ------
NM_003994chr122287 77 ------
NM_004006chrX1507 12685 ----
NM_004007chrX1507 12685 ----
NM_004009chrX1507 12685 ----
NM_004010chrX1507 12685 ----
NM_004011chrX1507 12685 ----
NM_004012chrX1507 12685 ----
NM_004013chrX1507 12685 ----
NM_004014chrX1507 12685 ----
NM_004015chrX1507 12685 ----
NM_004016chrX1421 12599 ----
NM_004017chrX1507 12685 ----
NM_004018chrX1421 12599 ----
NM_004020chrX1507 12685 ----
NM_004021chrX1421 12599 ----
NM_004022chrX1421 12599 ----
NM_004023chrX1421 12599 ----
NM_004028chr1833606 3027 1586 23756 1257 11570 --
NM_004040chr211098 ------
NM_004041chr11--1655 ----
NM_004050chr1461883 1707 846 732 724 344 --1581 --
NM_004075chr12130 1102 ----
NM_004081chrY41287 1261 1249 73 ------
NM_004085chrX2747 573 ------
NM_004089chrX11257 ------
NM_004093chr1332973 821 759 13200 ----
NM_004100chr652367 1973 1666 528 286 12096 12626 --
NM_004111chr11----1240 --
NM_004118chr20122 ------
NM_004124chr142987 379 12634 13370 --
NM_004130chr31591 ------
NM_004157chr32921 811 ------
NM_004161chr2191 ------
NM_004171chr1166172 5879 2069 1874 1388 1256 28073 7556 1621 --
NM_004172chr521620 1613 1505 11538 --
NM_004176chr174191 131 94 57 ------
NM_004186chr31167 --1863 --
NM_004200chr1152396 1991 1232 729 357 --1470 --
NM_004202chrY1249 ------
NM_004227chr792632 2607 1023 756 709 434 348 93 62 --12765 1609
NM_004236chr151594 ------
NM_004242chr61317 ------
NM_004249chr4192 ------
NM_004263chr211643 --21389 1239 --
NM_004272chr5--1189 1757 --
NM_004274chr1421086 361 --12374 --
NM_004277chr621471 136 ------
NM_004279chr721971 343 --11862 --
NM_004286chr2222124 182 178 ----
NM_004290chr511184 ------
NM_004296chr1453179 2783 968 907 54 --12809 11291
NM_004308chr1151202 409 367 160 37 --1692 --
NM_004311chr1042689 997 382 310 ------
NM_004316chr1231049 455 319 11026 ----
NM_004326chr11282 --2856 72 --
NM_004331chr822044 62 12679 ----
NM_004338chr1836073 4381 2449 11531 ----
NM_004341chr2176 ------
NM_004349chr81307 1853 1871 --
NM_004368chr192361 147 1807 ----
NM_004369chr2----1212 --
NM_004370chr621645 1355 11674 11717 --
NM_004379chr211697 --1665 --
NM_004380chr1622347 2287 ------
NM_004389chr21840 ------
NM_004392chr1322584 1677 ------
NM_004393chr362231 2192 868 351 341 182 11699 ----
NM_004395chr52291 93 ------
NM_004396chr171214 ------
NM_004397chr1131527 1446 706 11108 12645 --
NM_004411chr71280 ------
NM_004414chr2121036 95 ------
NM_004426chr123479 276 178 --1182 --
NM_004427chr11365 --1995 --
NM_004428chr13632 621 564 ------
NM_004429chrX21344 451 ------
NM_004430chr8----1830 --
NM_004432chr9--12183 ----
NM_004436chr11608 ------
NM_004437chr183616 3529 3520 3364 3078 2479 1428 1402 --22836 2229 --
NM_004438chr232688 2538 1194 12104 ----
NM_004442chr11352 ------
NM_004447chr121372 ------
NM_004450chr141353 ------
NM_004451chr11191 ------
NM_004454chr362017 1565 923 555 66 42 ------
NM_004456chr7193 ------
NM_004458chrX3359 197 38 12540 ----
NM_004459chr1711414 ------
NM_004475chr1711123 ------
NM_004494chr141273 1048 484 471 ------
NM_004496chr14144 11350 ----
NM_004499chr51187 ------
NM_004501chr123137 181 11485 ----
NM_004504chr243041 862 823 212 --12467 --
NM_004505chr1721709 57 ------
NM_004516chr192900 128 --1171 --
NM_004530chr162420 92 ------
NM_004535chr2041651 434 371 274 --1656 --
NM_004560chr93984 397 220 --1331 --
NM_004566chr1042558 1659 1643 41 ------
NM_004575chr411099 ------
NM_004587chr201380 --1114 --
NM_004588chr1142601 870 713 366 13581 1913 --
NM_004598chr5----1976 --
NM_004602chr2031248 242 131 --1166 --
NM_004612chr953946 3513 3397 3021 3001 --11337 11440
NM_004615chrX--1255 1657 --
NM_004620chr11--1250 1172 --
NM_004626chr113672 628 237 --1130 --
NM_004634chr31163 --1199 --
NM_004637chr321264 285 --11227 --
NM_004654chrY2538 384 ------
NM_004657chr23259 116 45 ------
NM_004660chrY41943 902 501 82 ------
NM_004663chr1531275 391 184 ------
NM_004677chrY2383 57 ------
NM_004687chr1722059 734 --1758 --
NM_004719chr1232776 1872 682 --1711 --
NM_004723chr11392 ------
NM_004725chr101254 ------
NM_004730chr521923 1495 --1623 --
NM_004733chr3------1452
NM_004734chr1322844 2201 --22448 1144 --
NM_004742chr3121 ------
NM_004745chr844751 4579 4359 156 --12222 16643
NM_004747chr102593 30 ------
NM_004761chr62128 56 ------
NM_004762chr173738 301 265 --11306 1175
NM_004768chr11232 ------
NM_004772chr511492 --1597 --
NM_004774chr1713004 ------
NM_004776chr2022551 742 13153 32910 1318 435 --
NM_004783chr161614 ------
NM_004788chr1142726 2179 2006 1813 ----11801
NM_004796chr1411973 ------
NM_004807chr252216 2203 824 767 544 --22210 120 --
NM_004808chr101515 13403 ----
NM_004822chr17103253 2494 1426 1002 816 653 606 547 343 162 1265 ----
NM_004834chr252588 1266 1145 398 229 ------
NM_004836chr21287 ------
NM_004840chrX1422 ------
NM_004841chr12342 167 ------
NM_004845chrX43091 1621 356 107 --12735 --
NM_004850chr241216 1204 569 273 1664 11768 --
NM_004857chr1444543 3544 1607 642 ------
NM_004860chr171125 ------
NM_004874chr81504 ------
NM_004879chr111790 1247 152 --
NM_004884chr1571687 1647 1623 486 378 203 154 ------
NM_004896chr10182 ------
NM_004898chr432615 451 97 12664 ----
NM_004904chr744861 4532 1922 1457 15021 ----
NM_004922chr101253 --1829 --
NM_004926chr1421839 208 ------
NM_004937chr1772572 2364 2355 1991 354 278 259 ------
NM_004947chr342515 1974 288 42 ------
NM_004948chr1811263 ------
NM_004961chrX2622 491 ------
NM_004962chr10182 ------
NM_004963chr12156 ------
NM_004965chr211103 ------
NM_004973chr611321 11427 1568 --
NM_004976chr1174586 3794 3388 3374 3320 755 133 --1796 --
NM_004980chr11163 ------
NM_004985chr121281 13831 11118 --
NM_004992chrX157654 6465 5748 5469 3176 3135 2972 2911 2342 1733 1498 1316 792 378 239 --22989 49 --
NM_004992chrX157654 6465 5748 5469 3176 3135 2972 2911 2342 1733 1498 1316 792 378 239 --22989 49 --
NM_004995chr1461114 1091 466 269 231 62 --11477 --
NM_004998chr151205 ------
NM_004999chr644144 2895 1099 168 11570 ----
NM_005003chr16163 ------
NM_005023chr5148 ------
NM_005029chr10----1120 --
NM_005032chrX11075 1688 ----
NM_005044chrX54294 4262 3180 1620 1256 ------
NM_005045chr72931 261 ------
NM_005063chr1033287 907 291 --23479 1251 --
NM_005066chr12254 112 ------
NM_005072chr161372 ------
NM_005073chr13165 ------
NM_005076chr174202 3956 3510 2791 574 222 30 --34210 3843 3021 --
NM_005087chr31579 ------
NM_005093chr20134674 4557 4015 3930 3884 1880 1490 513 383 376 369 214 88 ----13383
NM_005095chr132060 830 206 --1357 --
NM_005105chr161612 1599 1589 812 341 321 11569 ----
NM_005109chr352005 1885 545 349 23 ------
NM_005110chr51715 ------
NM_005114chr4--2688 612 ----
NM_005118chr91988 ------
NM_005119chr11822 ------
NM_005121chr1712862 ------
NM_005135chr1522634 698 23801 1102 ----
NM_005147chr1641051 1040 981 206 --1236 --
NM_005156chr923638 73 ------
NM_005163chr143770 159 50 1298 ----
NM_005171chr1211190 ------
NM_005173chr1771387 1176 548 357 309 288 254 ------
NM_005180chr10--11440 ----
NM_005188chr11107765 7203 5846 5544 5214 2296 2135 2000 1874 699 37725 807 178 36550 3007 1490 17058
NM_005197chr1435076 4136 1875 24769 4064 ----
NM_005206chr171422 1940 ----
NM_005215chr181148 ------
NM_005219chr521561 198 --125 --
NM_005235chr246681 5958 5048 546 ----16696
NM_005238chr1163491 2935 2502 2313 168 148 --13397 --
NM_005241chr31350 --2339 215 --
NM_005256chr11--1864 ----
NM_005263chr1150 129 ----
NM_005276chr1261586 1445 1338 686 221 189 --11158 --
NM_005276chr1261586 1445 1338 686 221 189 --11158 --
NM_005282chr192944 355 ------
NM_005295chr7----1195 --
NM_005312chr952321 2243 621 484 215 --150 --
NM_005316chr111313 ------
NM_005324chr1722104 830 --22035 1945 2492 281
NM_005329chr1621842 266 11757 11862 --
NM_005336chr241608 1577 601 83 --1816 --
NM_005339chr41960 --32992 1300 479 12691
NM_005342chrX42471 2386 1875 496 12365 1953 --
NM_005359chr1866414 5333 4540 3987 1285 1195 26382 4915 36086 1931 1432 12208
NM_005376chr12966 758 ------
NM_005382chr8----164 --
NM_005386chr202749 26 ------
NM_005392chr941458 576 413 327 --21537 641 1629
NM_005397chr732752 1442 1333 1955 1842 11515
NM_005402chr71273 11188 ----
NM_005407chr141244 --1380 --
NM_005410chr52325 219 ------
NM_005415chr22686 604 ------
NM_005426chr12364 110 --1323 --
NM_005433chr1832599 2370 2083 ------
NM_005436chr1053551 2657 1225 858 832 ------
NM_005437chr1021362 68 ------
NM_005453chr6----128 --
NM_005456chr111178 ------
NM_005458chr921829 1611 --11643 --
NM_005461chr2041768 1349 768 303 --1785 --
NM_005465chr121958 1449 ----12011
NM_005474chr1711620 ------
NM_005475chr1252536 2331 2045 909 324 12569 ----
NM_005487chr2242029 1651 790 674 ------
NM_005497chr1786005 5902 5434 4823 4535 3968 810 52 ------
NM_005502chr931308 665 186 ------
NM_005503chr152383 367 11129 1292 --
NM_005504chr1235800 1117 634 14155 ----
NM_005506chr432880 2106 1102 --2487 288 12449
NM_005510chr6122 ------
NM_005520chr5--128 ----
NM_005523chr721430 506 --1522 --
NM_005537chr131145 ------
NM_005540chr12394 102 ----1116
NM_005542chr71360 --2649 272 --
NM_005550chr163525 456 417 ------
NM_005563chr1--1227 ----
NM_005569chr2231142 1013 315 11626 ----
NM_005575chr51185 ------
NM_005578chr333352 2011 1068 --13818 --
NM_005595chr11232 130 ----
NM_005596chr956378 4993 4510 2103 531 --13882 --
NM_005599chr111215 ------
NM_005600chr11197 ------
NM_005604chr642407 939 406 197 ------
NM_005610chr1--1250 ----
NM_005611chr1611125 --1997 --
NM_005614chr71926 11029 ----
NM_005626chr1156 ------
NM_005629chrX31190 464 36 --1387 --
NM_005634chrX1150 ----1498
NM_005637chr1831746 1720 183 ------
NM_005638chrX1697 ------
NM_005647chrX53423 3263 2495 1301 67 12652 ----
NM_005650chr2221138 1001 --1933 --
NM_005652chr161213 ------
NM_005655chr81284 ------
NM_005663chr41361 ------
NM_005668chr52785 426 --13284 --
NM_005669chr532046 2000 207 22226 723 ----
NM_005688chr321086 124 1299 11214 --
NM_005692chr7140 ------
NM_005717chr131128 825 91 ----1446
NM_005721chr21699 ------
NM_005722chr221618 492 --21840 432 --
NM_005724chr151129 ------
NM_005731chr2270 27 ------
NM_005734chr112724 698 1795 ----
NM_005738chr711518 1446 ----
NM_005746chr712096 ------
NM_005756chrX--21547 1196 ----
NM_005759chr234515 1537 1146 --13487 --
NM_005779chr523167 310 ------
NM_005785chr12161 ------
NM_005786chr1831294 1079 787 ------
NM_005789chr1711466 ------
NM_005796chr161324 ------
NM_005798chr133491 149 22 --12074 11305
NM_005801chr172705 233 1673 ----
NM_005802chr91235 1687 ----
NM_005808chr331033 528 363 23300 886 ----
NM_005814chr141338 1284 546 22 ------
NM_005819chr163037 2427 2370 1181 826 222 --1365 --
NM_005828chr17103901 3857 3828 1979 1908 1362 826 628 372 313 --11468 --
NM_005839chr1148 ------
NM_005840chrX17180 13079 11639 11456
NM_005850chr1177 ------
NM_005852chr171145 --11019 --
NM_005853chr16------159
NM_005857chr1153 ------
NM_005859chr521283 248 ------
NM_005863chr10------1157
NM_005875chr31324 ------
NM_005882chr42852 644 ------
NM_005885chr52425 407 ------
NM_005898chr1122775 1176 --12633 --
NM_005900chr43957 850 842 ------
NM_005901chr1868168 6928 6768 2702 1487 966 22686 1846 15388 --
NM_005904chr183543 508 360 --1528 --
NM_005909chr544126 3864 913 531 --23993 3901 --
NM_005911chr221317 525 11013 11157 --
NM_005920chr163525 2996 2952 1534 1512 691 ------
NM_005933chr1132018 692 79 ------
NM_005935chr444553 4483 3913 854 ------
NM_005937chr1732959 842 457 --24140 3633 --
NM_005941chr833847 2677 107 11392 --1969
NM_005943chr651652 554 488 410 176 --11252 1334
NM_005955chr174852 3777 3740 1971 1783 1743 491 --3686 628 513 --
NM_005957chr183286 1915 1676 1247 1068 940 660 336 11096 31360 1297 484 1139
NM_005962chr1031651 627 252 ------
NM_005962chr1031651 627 252 ------
NM_005966chr21458 1488 ----
NM_005967chr121509 1675 ----
NM_005969chr1141105 915 460 321 --11062 --
NM_005982chr14198 ------
NM_005985chr20--1814 1234 1529
NM_005990chr562231 2007 1879 1065 801 506 --128 --
NM_005996chr122517 112 ------
NM_006007chr943292 1124 804 421 --11669 --
NM_006011chr1554310 3537 3053 1724 1410 ------
NM_006015chr11522 21225 841 ----
NM_006022chr131251 ------
NM_006030chr31494 --11601 --
NM_006037chr253242 801 477 328 204 --23734 3294 --
NM_006040chr162212 82 ------
NM_006047chr20----13406 --
NM_006048chr12775 327 ------
NM_006054chr111282 1508 11211 --
NM_006080chr712094 --12403 --
NM_006089chrX181 --1268 --
NM_006094chr822396 734 ------
NM_006095chr464236 4203 3445 3295 1671 1249 ----14218
NM_006106chr1152730 1097 1025 830 84 --12444 --
NM_006109chr14137 ------
NM_006135chr11957 ------
NM_006141chr16--1812 1698 --
NM_006145chr192968 255 ------
NM_006154chr1521890 668 1511 1356 --
NM_006159chr122405 108 ----199
NM_006160chr1721295 143 --1373 --
NM_006186chr221010 372 ------
NM_006191chr12178 ------
NM_006195chr92897 569 1257 ----
NM_006201chrX3838 62 28 ------
NM_006203chr535354 1901 309 11079 11481 --
NM_006212chr122072 1760 ----11031
NM_006224chr1751900 1685 1667 543 60 1145 ----
NM_006243chr111009 --1690 --
NM_006245chr63941 935 102 ------
NM_006251chr543082 2695 1257 621 ------
NM_006258chr101215 ------
NM_006265chr821346 305 ------
NM_006266chr9133 ------
NM_006267chr23719 129 42 ------
NM_006268chr1131001 783 345 --2164 145 --
NM_006275chr2011611 1644 --155
NM_006277chr2197 ------
NM_006282chr2034618 4517 4282 --23162 1711 --
NM_006283chr864655 4566 4052 3593 3390 3168 14174 13433 --
NM_006292chr11190 ------
NM_006293chr152671 315 --2816 262 --
NM_006298chr633163 488 458 22899 318 ----
NM_006301chr12----1182 --
NM_006306chrX95901 5808 5589 5546 3944 3806 1709 1335 1185 ----1507
NM_006313chr121490 ------
NM_006315chr4124399 4274 4124 3779 3619 3153 2762 1755 1523 1335 1085 599 ------
NM_006317chr51771 ------
NM_006323chr41261 1303 ----
NM_006325chr121224 1595 2169 47 --
NM_006328chr112669 168 ------
NM_006336chr941307 1207 610 269 ------
NM_006338chr1----1124 --
NM_006350chr5149 ------
NM_006351chr192344 23 --1185 --
NM_006352chr131421 648 517 ------
NM_006357chr23484 345 185 ------
NM_006359chrX11651 --11613 --
NM_006361chr1721329 1252 --11667 --
NM_006371chr345160 4592 1274 639 14899 11464 --
NM_006373chr1721033 879 11093 11132 --
NM_006379chr732122 1726 695 ------
NM_006380chr1723568 925 11002 ----
NM_006382chr171233 ------
NM_006390chr121136 --11135 21539 509
NM_006391chr11----1321 --
NM_006401chr9167 --192 --
NM_006407chr331180 124 47 21013 1004 ----
NM_006416chr6180 ------
NM_006422chr12135 ------
NM_006425chr521127 36 ------
NM_006449chr231624 1368 92 ----11355
NM_006451chr5136 ------
NM_006454chr422299 631 --32620 2250 1055 12170
NM_006460chr171159 11601 ----
NM_006465chr1562244 2235 1678 1591 1554 1486 --42168 2012 1451 631 --
NM_006469chr11613 ------
NM_006480chr51405 --1468 --
NM_006482chr1243641 2674 632 74 ------
NM_006489chr1411966 ------
NM_006494chr19----189 --
NM_006496chr141676 1561 315 109 --1803 179
NM_006517chrX12060 --11701 --
NM_006526chr203668 491 474 1867 ----
NM_006527chr41613 ------
NM_006532chr1931626 501 128 --11271 --
NM_006534chr2033028 2422 709 ------
NM_006538chr244073 3462 3357 1423 ------
NM_006539chr16--1501 ----
NM_006544chr1445387 2020 1701 545 14376 11548 --
NM_006546chr1746306 4636 4175 1730 --46562 5610 4091 2039 --
NM_006547chr712101 ------
NM_006548chr31135 --1678 --
NM_006559chr121221 1065 --11191 --
NM_006561chr1065231 4972 4558 4302 3908 538 ------
NM_006565chr161859 ------
NM_006572chr1763408 3038 2180 1298 1045 79 ------
NM_006575chr142540 161 ------
NM_006584chr171110 ------
NM_006599chr1626936 6738 16677 22269 1335 12235
NM_006601chr1221071 282 ------
NM_006603chrX21752 1501 --1156 11305
NM_006618chr111559 11343 ----
NM_006620chr621477 351 23548 69 21446 421 --
NM_006622chr52397 213 ------
NM_006625chr1----130 --
NM_006625chr1----130 --
NM_006625chr1----130 --
NM_006628chr1574447 3934 3895 3562 3536 1786 120 ----24622 3301
NM_006636chr21902 --1855 --
NM_006646chr1362659 2191 1203 704 549 291 ------
NM_006650chr542958 2406 812 208 12796 13192 --
NM_006654chr1243601 1925 1306 1253 --13843 --
NM_006670chr61610 ------
NM_006690chr2032123 1446 847 --173 --
NM_006696chr5--2232 218 ----
NM_006698chr2011370 ------
NM_006699chr12820 790 --2991 78 --
NM_006704chr13----1363 --
NM_006711chr162131 124 ------
NM_006717chr933170 1191 492 ------
NM_006720chr1054560 3572 1365 1257 473 1435 1560 14002
NM_006729chrX85103 4073 3511 3466 3412 2234 1001 84 ------
NM_006732chr192844 352 ------
NM_006734chr611066 ------
NM_006738chr1584523 3715 1709 1102 963 550 513 129 --126 --
NM_006742chr1631747 1614 201 11948 1270 --
NM_006750chr1637930 2075 1160 16291 ----
NM_006751chr21121 ------
NM_006766chr81386 --12098 --
NM_006769chr1--2653 97 ----
NM_006775chr6------1378
NM_006791chr15--1594 ----
NM_006800chrX--2498 154 ----
NM_006802chr131023 993 308 1963 ----
NM_006805chr511118 --141 --
NM_006814chr2042269 1760 735 176 ------
NM_006816chr5----1285 --
NM_006819chr111304 ------
NM_006823chr81289 ------
NM_006827chr1443257 2612 2376 363 --11059 --
NM_006832chr142847 431 ------
NM_006836chr121247 --1502 --
NM_006838chr1221672 1197 ------
NM_006852chr1752381 1129 812 685 585 --1191 --
NM_006861chr1251675 1649 1446 725 639 --11896 --
NM_006874chr42269 41 --1935 --
NM_006885chr1623705 789 --23367 1140 --
NM_006888chr1443138 2534 1160 324 ----13188
NM_006892chr204991 468 280 173 1483 ----
NM_006892chr204991 468 280 173 1483 ----
NM_006908chr721144 564 1413 1403 --
NM_006914chr91444 ------
NM_006915chrX31838 777 240 1286 ----
NM_006916chr2--1114 ----
NM_006922chr212198 --12064 --
NM_006924chr1733180 1095 524 12861 ----
NM_006925chr141511 ------
NM_006931chr1232076 1700 349 ------
NM_006937chr171485 ------
NM_006939chr1421102 369 ------
NM_006940chr1211816 --11719 --
NM_006941chr22191 11025 ----
NM_006943chr2033136 3092 184 ------
NM_006948chr2122491 2028 --11950 --
NM_006965chr181826 ------
NM_006981chr92686 115 ------
NM_006990chr122073 226 ------
NM_006996chr111828 ------
NM_006997chr101325 ------
NM_007005chr931396 117 41 ------
NM_007007chr122173 74 13812 14761 --
NM_007008chr21104 ------
NM_007011chr1585749 4976 4936 4901 4894 2339 2301 787 --46409 5012 2627 158 --
NM_007014chr1661798 1376 1322 1221 195 173 ------
NM_007030chr573437 3322 1327 1136 676 324 131 --21658 684 --
NM_007035chr121616 ------
NM_007038chr2125828 371 1492 --1747
NM_007040chr191406 ------
NM_007050chr2066956 6718 6192 5358 676 72 --1840 --
NM_007064chr321080 104 ------
NM_007067chr17----11432 --
NM_007078chr1042870 2319 355 298 ------
NM_007084chr132272 240 ------
NM_007097chr5291 60 ------
NM_007107chr332028 1973 591 ------
NM_007146chr1732153 552 131 11911 --12687
NM_007158chr12956 809 ------
NM_007159chr311399 ------
NM_007166chr1111353 ------
NM_007167chr12861 699 ------
NM_007170chr11173 ----1323
NM_007173chr113487 218 22 ------
NM_007174chr1221485 747 --11777 --
NM_007182chr32149 39 ------
NM_007192chr1411039 ------
NM_007195chr1833549 1293 1124 ------
NM_007200chr1584523 3715 1709 1102 963 550 513 129 --126 --
NM_007217chr3139 ------
NM_007219chr201786 ------
NM_007222chr831708 1400 180 ------
NM_007232chr202373 141 1310 ----
NM_007238chr2044688 510 379 231 ------
NM_007245chr161586 ------
NM_007246chr42209 97 ------
NM_007247chr171802 ------
NM_007249chr1387073 3428 3095 3036 2098 576 554 290 15886 1714 13333
NM_007260chr12706 252 --1277 --
NM_007271chr611431 ------
NM_007279chr192141 126 --1594 --
NM_007282chr3--1636 ----
NM_007283chr341988 1980 1888 928 ------
NM_007286chr572092 1962 1908 808 601 420 92 --11980 --
NM_007308chr41208 ------
NM_007325chrX12007 ------
NM_007350chr1224335 1799 ------
NM_007353chr73942 469 317 ------
NM_007358chr111690 --1660 --
NM_007363chrX2942 689 ------
NM_007372chr171323 ------
NM_007375chr11540 ------
NM_009588chr64523 204 167 76 ------
NM_012062chr121303 ------
NM_012081chr513718 ------
NM_012082chr82681 327 ------
NM_012102chr112493 11737 ----
NM_012129chr722207 1851 --1405 --
NM_012134chr151537 1454 616 551 301 ------
NM_012141chr1321564 957 --13733 --
NM_012156chr2052771 2358 2222 905 230 ------
NM_012158chr1331376 1139 652 ------
NM_012164chr976405 2832 2804 2757 2334 692 73 ----11354
NM_012180chr4------1597
NM_012193chr1121308 276 13858 ----
NM_012197chr911361 --11307 --
NM_012199chr134592 3723 273 --23941 3872 --
NM_012214chr235993 2309 1479 ------
NM_012216chrX145 ------
NM_012218chr1943037 2252 488 263 1908 ----
NM_012224chr41454 ------
NM_012233chr22349 189 --1453 --
NM_012234chr333275 2761 843 22976 2560 ----
NM_012238chr10------1537
NM_012247chr1031019 916 351 --1212 --
NM_012249chr231172 994 98 ------
NM_012259chr6182 --1202 --
NM_012262chr164126 3997 3851 1610 1164 450 ----11739
NM_012264chr2231965 1631 339 --190 --
NM_012264chr2231965 1631 339 --190 --
NM_012290chr2------1474
NM_012294chr7--2683 564 ----
NM_012297chr432057 737 29 ------
NM_012301chr791984 1847 1733 1666 1581 872 778 289 166 --144 1235
NM_012302chr13487 150 73 ------
NM_012306chr1262880 2763 2681 2635 934 568 --21279 855 --
NM_012309chr1184831 4428 1978 1758 1289 1028 863 653 --2409 206 --
NM_012311chr101414 ------
NM_012316chr134346 3885 1502 1831 ----
NM_012319chr18125 ------
NM_012325chr20----11385 --
NM_012326chr21326 ------
NM_012330chr1021683 284 --1726 --
NM_012333chr121572 344 --1413 --
NM_012334chr543837 3555 1845 524 ------
NM_012382chr524217 3320 ------
NM_012384chr202856 60 ------
NM_012428chr151328 ------
NM_012429chr2231210 1115 314 --2508 441 --
NM_012461chr141283 ------
NM_012470chr71373 ------
NM_012473chr22----1260 --
NM_012479chr782744 2701 2264 2127 1014 934 587 21 12450 ----
NM_012482chr11622 ------
NM_013229chr124999 701 390 161 --12599 --
NM_013230chrY1503 ------
NM_013233chr2----11275 --
NM_013247chr21568 ----1351
NM_013252chr732294 623 465 ------
NM_013253chr114918 570 445 234 --1968 --
NM_013255chr745987 5915 1676 65 16075 23070 310 --
NM_013261chr432988 959 428 12335 ----
NM_013269chr1253195 1340 862 718 441 12944 ----
NM_013286chr363111 1261 926 730 719 712 2609 48 ----
NM_013293chr71653 ------
NM_013316chr72920 278 ------
NM_013322chr721612 380 ------
NM_013357chr81830 ------
NM_013361chr191147 ------
NM_013372chr1512203 ------
NM_013377chr12--1636 ----
NM_013396chr21----1394 --
NM_013437chr8--1195 ----
NM_013446chr731418 71 48 ------
NM_013449chr1242636 917 787 140 ------
NM_013450chr211216 ------
NM_013943chr122596 393 1112 1279 13297
NM_013952chr242356 2132 971 883 --22159 797 --
NM_013953chr242356 2132 971 883 --22159 797 --
NM_013960chr83771 543 246 ------
NM_013992chr242356 2132 971 883 --22159 797 --
NM_013993chr63713 558 127 1609 ----
NM_013994chr63713 558 127 1609 ----
NM_013995chrX12187 --21862 1014 --
NM_014001chr172621 107 ------
NM_014007chr91339 ----1433
NM_014008chrX3631 196 61 ------
NM_014011chr221010 527 ------
NM_014016chr33642 382 23 ------
NM_014023chr102361 229 --11914 --
NM_014030chr172775 134 --1348 --
NM_014048chr1675260 5251 3670 3502 3446 1501 506 ------
NM_014055chr121431 ------
NM_014109chr811000 ------
NM_014110chr121033 426 1484 1772 --
NM_014112chr875472 5041 4440 3694 2036 1812 1049 ------
NM_014117chr162946 458 ------
NM_014155chr1176715 6551 6250 6154 5724 5134 1325 17469 26679 2721 --
NM_014169chr14--1225 ----
NM_014178chr14158 ------
NM_014181chr21264 --12160 --
NM_014182chr121742 --1269 --
NM_014203chr19143 --162 --
NM_014216chr1451312 1197 1157 63 28 1545 ----
NM_014217chr12335 75 ------
NM_014233chr1731345 786 24 ------
NM_014246chr2262095 831 408 399 379 115 1688 12190 --
NM_014250chr2242029 1651 790 674 ------
NM_014253chrX3697 353 215 ------
NM_014260chr6--167 ----
NM_014267chr111781 ------
NM_014279chr91214 ------
NM_014280chr11837 ------
NM_014288chr11120 ------
NM_014289chrX1198 1173 ----
NM_014292chr221231 --21219 360 --
NM_014294chr821378 1303 ------
NM_014309chr2255272 5222 4192 4179 327 --14660 --
NM_014316chr1661981 788 621 499 413 60 --21715 886 --
NM_014317chr10------128
NM_014319chr1221840 168 ------
NM_014333chr1122063 1124 ------
NM_014345chr6----2434 385 --
NM_014372chr11295 21952 633 ----
NM_014376chr542499 1983 816 238 --11969 --
NM_014381chr1453042 2959 2951 2534 121 --12071 --
NM_014382chr331511 508 161 --11487 --
NM_014393chr821590 619 11930 ----
NM_014394chr102965 85 ------
NM_014423chr512255 --23903 463 --
NM_014445chr311857 1377 ----
NM_014449chr12----177 --
NM_014454chr61911 --2777 188 --
NM_014494chr1631838 633 428 --22250 441 --
NM_014502chr111324 ------
NM_014507chr2231214 198 102 --2901 300 --
NM_014522chrX1216 ------
NM_014554chr1232160 628 610 ------
NM_014563chrX51752 1606 1536 710 378 --11350 --
NM_014569chr73982 370 287 ------
NM_014573chr1731673 230 116 1302 11424 --
NM_014574chr141429 ------
NM_014575chr31426 ------
NM_014577chr223794 267 204 ------
NM_014586chr2184057 3036 1539 1064 1013 388 213 121 --34482 3353 1564 13436
NM_014612chr91339 180 ----
NM_014613chr552800 2161 1940 939 881 --11211 --
NM_014615chr1623101 3070 --23513 644 --
NM_014620chr121673 ------
NM_014634chr22143618 3392 3379 3109 3087 2772 2571 1467 1402 1371 595 339 307 88 --1211 --
NM_014636chr964162 3834 3623 1447 921 237 --12675 --
NM_014646chr1822502 182 1323 42108 1164 382 61 --
NM_014649chr19154 ------
NM_014660chr71223 ------
NM_014661chr1082723 2674 1268 899 817 471 315 227 ------
NM_014665chr8153589 3473 3452 3439 3432 3322 3111 3033 2763 1436 1414 1404 1109 918 670 ------
NM_014666chr51202 ------
NM_014667chr342245 2211 2173 762 11882 ----
NM_014670chr2--1199 ----
NM_014677chr821295 553 ------
NM_014678chr22--1521 1137 --
NM_014679chr1121274 380 ------
NM_014683chr1721617 99 --1430 --
NM_014686chr19----1159 --
NM_014689chr21244 153 ----
NM_014690chr742235 1086 329 323 --1629 11981
NM_014701chr152156 133 1344 ----
NM_014703chr311029 --31231 1071 849 --
NM_014705chr732021 2013 1353 12067 11338 1634
NM_014707chr711510 1234 ----
NM_014709chr21492 ------
NM_014711chr161718 1776 ----
NM_014712chr161398 --1168 --
NM_014717chr192745 72 ------
NM_014718chr121725 --1294 --
NM_014720chr1011615 11490 ----
NM_014729chr842228 2159 1951 1786 1467 181 --
NM_014730chr1275034 4906 4552 4486 2015 1984 970 --31861 1731 1400 --
NM_014730chr1275034 4906 4552 4486 2015 1984 970 --31861 1731 1400 --
NM_014731chr203308 188 128 ------
NM_014733chr51209 21981 1472 ----
NM_014735chrX31798 1443 143 --1276 --
NM_014736chr151984 ------
NM_014738chr1711036 --11091 --
NM_014739chr611114 12902 13141 --
NM_014743chr432610 2565 2119 3942 752 309 ----
NM_014747chr165807 1741 1667 862 529 145 --25464 584 --
NM_014751chr832101 1747 834 --1683 --
NM_014752chr112256 185 11965 ----
NM_014755chr263646 1586 1278 947 756 574 --12919 --
NM_014756chr11131 ------
NM_014759chr821302 58 --31404 382 235 --
NM_014761chr1641182 1174 1135 968 --1242 --
NM_014764chr122181 97 ------
NM_014765chr142668 2068 1699 68 --11829 21727 1683
NM_014767chr1083257 3016 2580 2558 1239 750 734 306 --1915 --
NM_014772chr1852849 672 481 365 24 --43184 2548 2255 36 --
NM_014774chr142670 2001 1238 901 11165 32543 632 559 --
NM_014784chr1------1113
NM_014788chr942907 2224 527 41 --22478 949 --
NM_014800chr71390 ------
NM_014807chr11----1539 --
NM_014811chr93666 274 190 --1656 --
NM_014812chr11229 ------
NM_014820chr32556 194 11715 1329 --
NM_014824chr1121715 261 ------
NM_014826chr173971 3935 3014 1651 1041 213 115 --1289 --
NM_014829chr522140 66 --153 --
NM_014832chr1332117 1838 1315 ------
NM_014835chr2022155 1618 1334 11734 --
NM_014836chr1031663 1590 1292 ------
NM_014841chr621164 314 --11172 --
NM_014850chr364612 4189 3794 1255 729 164 ------
NM_014864chr121304 473 ------
NM_014869chr31942 11351 ----
NM_014873chr143574 1889 1329 905 --1397 --
NM_014875chr121180 737 1767 ----
NM_014877chr1746980 5848 5408 493 22376 1959 ----
NM_014881chr10147 ------
NM_014883chr451579 728 618 81 69 --132 --
NM_014891chr721617 1458 --31603 375 196 --
NM_014897chr1742795 2590 658 535 ------
NM_014898chr1912443 --11510 --
NM_014901chr51787 11692 1525 --
NM_014903chr1232052 1903 139 ------
NM_014904chr1023605 3309 ------
NM_014905chr231733 1693 753 ------
NM_014906chr1753817 2725 1254 1161 376 --1191 --
NM_014914chr22193 45 1532 1384 --
NM_014917chr1----1217 --
NM_014921chr1931114 1050 91 --2762 384 --
NM_014923chr1311776 ------
NM_014931chr19123 --1744 --
NM_014941chr22152 ------
NM_014947chr172292 2180 2134 1148 1040 336 226 --12751 --
NM_014952chr1531889 1699 1675 ------
NM_014962chr2062778 2610 2562 2449 852 22 ------
NM_014969chr111083 1772 ----
NM_014974chr1021741 554 --11532 --
NM_014982chr1453633 1189 1039 788 686 11093 ----
NM_014988chr4----12302 --
NM_014990chr141330 ------
NM_014991chr41269 --12383 --
NM_014997chr762262 1972 1852 554 539 67 --21091 809 --
NM_014999chr1221382 361 ------
NM_015000chr1222769 175 13010 143 --
NM_015001chr12977 296 ------
NM_015008chr311038 ------
NM_015009chr31552 ------
NM_015011chr131267 1446 ----
NM_015017chr11350 --11269 --
NM_015020chr1683399 2984 2941 2612 942 567 498 233 13617 ----
NM_015023chr11373 --11419 --
NM_015024chr81990 ------
NM_015025chr232218 2071 749 ------
NM_015026chr1213495 1677 1107 --
NM_015032chr1332180 1894 321 ------
NM_015033chr952932 2649 2130 933 343 ------
NM_015040chr213160 ------
NM_015042chr1563959 3370 1323 1041 1020 518 --22824 1412 13148
NM_015045chr101419 --1403 --
NM_015049chr243326 3218 1297 407 --12934 --
NM_015064chr1232927 2920 1277 --2229 191 --
NM_015068chr712542 ------
NM_015069chr161153 ------
NM_015075chrX42193 1563 694 269 ------
NM_015076chr654347 3904 3831 3389 2864 2779 642 13381 13844
NM_015079chr1573196 2110 2100 1281 1029 504 481 --33057 2224 2090 --
NM_015082chr542000 1769 1758 492 ------
NM_015092chr1623587 3506 11031 ----
NM_015093chr631739 1210 186 ------
NM_015094chr22113796 3616 3283 3227 2925 2839 1768 1466 1295 1201 336 14588 1321 --
NM_015097chr3--11778 ----
NM_015103chr32710 344 --11051 --
NM_015107chrX32356 1706 1587 ----11847
NM_015115chr442055 1070 1052 199 ------
NM_015125chr191206 --1187 --
NM_015130chr41363 ------
NM_015133chr1631202 120 75 --21404 243 --
NM_015134chr171562 ------
NM_015138chr1562480 1127 921 780 295 97 --11942 --
NM_015149chr111816 12054 ----
NM_015153chr61500 ------
NM_015155chr1053199 3133 3041 2437 482 ------
NM_015156chr1463512 3447 689 390 348 334 1110 1317 --
NM_015162chr15121 ------
NM_015170chr81760 ------
NM_015172chr1175 --1526 --
NM_015173chr42459 245 ------
NM_015176chr1146 21381 56 ----
NM_015192chr2032461 2333 531 ------
NM_015197chr1453054 2746 2378 2271 577 ------
NM_015199chr332965 2149 1210 22390 910 ----
NM_015200chr42616 357 --1930 --
NM_015205chr1384147 4027 1920 1799 1109 1076 794 148 --1827 --
NM_015208chr18------12691
NM_015213chr11150 ------
NM_015215chr152773 2280 1008 707 146 --12960 --
NM_015221chr1041485 1152 460 64 ------
NM_015225chr932787 1227 819 --1723 --
NM_015231chr111355 ------
NM_015233chr1362624 2540 2338 766 448 110 12064 12342 --
NM_015236chr411106 ------
NM_015246chr1661459 497 427 283 229 21 --11491 1622
NM_015247chr1644836 4658 1022 699 1408 172 --
NM_015250chr92509 436 ------
NM_015260chr1921560 631 ------
NM_015261chr112330 105 --177 --
NM_015263chr15183 ------
NM_015265chr212088 12046 1677 --
NM_015270chr1241854 1469 829 366 --1331 --
NM_015271chr443737 1277 1217 231 34204 3154 276 1354 --
NM_015272chr162584 237 21824 1404 ----
NM_015278chr633284 1384 345 1618 12811 12826
NM_015282chr232553 2317 302 12023 1790 --
NM_015288chr523179 680 13890 12517 --
NM_015292chr121317 ------
NM_015293chr6135 --2492 117 --
NM_015299chr1473550 3164 2980 2970 2853 2824 1351 --22556 914 --
NM_015305chr1431839 1231 581 ------
NM_015308chr113750 626 573 ------
NM_015310chr8117912 7510 6801 6583 5664 5371 1860 1775 1065 1059 551 --1539 --
NM_015313chr1121280 717 --1182 --
NM_015318chr1931704 278 129 ------
NM_015323chr611661 ------
NM_015326chr11300 --1581 --
NM_015329chr1941845 566 354 168 12370 ----
NM_015335chr1241998 895 675 376 ------
NM_015336chr1211708 ------
NM_015339chr201134 1825 ----
NM_015340chr311255 11264 ----
NM_015346chr1421313 460 ------
NM_015349chr622975 1143 ------
NM_015354chr92366 303 ------
NM_015355chr1721499 1287 11706 ----
NM_015359chr852856 2719 2480 855 264 ------
NM_015365chrX44022 3282 2624 426 ------
NM_015375chr164690 4375 3656 3553 3127 196 --13303 --
NM_015378chr132875 1009 943 ------
NM_015382chr142630 284 ------
NM_015388chr63123 106 40 ------
NM_015396chr31131 ------
NM_015419chrX1417 ------
NM_015435chr81538 11226 1589 --
NM_015443chr1721421 1408 ------
NM_015444chr31223 ------
NM_015455chr513624 ------
NM_015461chr181557 ------
NM_015472chr3------1381
NM_015472chr3------1381
NM_015475chr21350 ------
NM_015477chr151284 ------
NM_015481chr121157 ------
NM_015488chr221453 319 --21125 491 --
NM_015497chr151903 122 ----
NM_015509chr121602 --11424 --
NM_015520chr342704 250 116 24 12772 ----
NM_015534chr11187 ------
NM_015535chr2104024 3782 3406 3300 3201 1599 1314 1004 241 22 --2737 729 --
NM_015541chr3------11089
NM_015542chr101264 1302 ----
NM_015550chr722710 920 13612 1451 --
NM_015553chr634162 3894 3389 ------
NM_015554chr1522806 909 ------
NM_015567chr1311223 ------
NM_015568chr2054094 3430 3034 2672 1449 --23312 93 --
NM_015570chr7----11691 --
NM_015571chr61734 ------
NM_015575chr263404 1438 1369 511 342 272 --32958 1335 237 1887
NM_015576chr34544 143 111 74 ------
NM_015578chr1931821 1535 1491 1172 1496 --
NM_015601chr101645 ------
NM_015602chr121769 244 ------
NM_015605chr101299 ------
NM_015609chr112186 --12911 --
NM_015626chr172946 459 ------
NM_015635chr9126 11632 ----
NM_015640chr195197 5191 5142 4708 4400 4091 3900 3350 224 --13448 --
NM_015646chr124825 461 228 21 ------
NM_015652chr101251 ------
NM_015676chr14174 ------
NM_015678chr1311559 ------
NM_015686chrX1164 1575 12275 --
NM_015695chr612180 --194 --
NM_015831chr71289 ------
NM_015833chr2111959 ------
NM_015872chr131535 671 477 ------
NM_015881chr114918 570 445 234 --1968 --
NM_015886chr825726 1715 ------
NM_015888chr112781 1231 --11266
NM_015902chr81878 ------
NM_015906chr144650 1627 1177 482 ------
NM_015912chr811931 --11564 --
NM_015920chr151422 ------
NM_015949chr74913 810 323 166 --1151 --
NM_015955chr21201 ------
NM_015975chrX21622 111 ------
NM_015980chr541599 1161 433 388 ------
NM_015990chr421108 214 ------
NM_016009chr121618 251 ----13987
NM_016019chr71354 ------
NM_016021chr61459 1176 ----
NM_016025chr1611948 ------
NM_016032chrX2412 190 ------
NM_016037chr12907 342 ------
NM_016045chr201414 11709 11151 --
NM_016047chr21166 ------
NM_016059chr6123 ------
NM_016061chr21256 1274 ----
NM_016072chr1212026 12052 ----
NM_016073chr15------1310
NM_016076chr142725 2593 873 40 ------
NM_016083chr633801 933 21 ------
NM_016096chr841789 1379 1356 74 --1508 --
NM_016120chrX31103 239 29 ------
NM_016131chr211655 ------
NM_016132chr1533060 2568 797 23190 2966 ----
NM_016133chr21104 --11231 --
NM_016173chr3113951 3755 3663 3597 1413 1074 1058 1041 1024 463 320 --21678 188 --
NM_016200chr7----1196 --
NM_016201chr332062 638 294 ------
NM_016206chr357514 2705 2490 382 131 1626 ----
NM_016231chr172250 39 ------
NM_016243chr1137 ------
NM_016248chr1313753 --1540 --
NM_016250chr141569 --1648 --
NM_016258chr11129 ------
NM_016260chr277605 7242 1734 901 822 740 151 ----16863
NM_016261chr17--1784 ----
NM_016263chr1943055 2832 2621 2533 --1110 --
NM_016269chr44838 828 314 49 --1306 --
NM_016271chr1821538 940 ------
NM_016275chr3----11089 --
NM_016284chr16--1985 1346 --
NM_016289chr241960 1700 1522 166 ----22213 510
NM_016302chr34583 275 204 142 --1236 --
NM_016322chr932478 867 829 ------
NM_016339chr1731771 1306 376 ----11213
NM_016340chr511083 ------
NM_016374chr1--1520 ----
NM_016374chr1--1520 ----
NM_016396chr152300 268 31206 1135 1088 ----
NM_016406chr11129 ------
NM_016424chr172615 547 11455 ----
NM_016436chr202438 209 ------
NM_016441chr22599 381 --11504 --
NM_016442chr51902 ------
NM_016453chr32667 29 ------
NM_016480chr5156 ------
NM_016506chr111115 ------
NM_016507chr17------12891
NM_016529chr131138 ------
NM_016530chr1543852 3840 1571 483 --1639 --
NM_016542chrX----1563 --
NM_016559chr32574 335 11475 ----
NM_016569chr122517 112 ------
NM_016578chr11----142 --
NM_016603chr532101 2055 1523 --12118 --
NM_016605chr522034 241 --22566 129 --
NM_016612chr81266 --1632 --
NM_016621chr11114589 4147 4137 3658 3570 3546 3300 3234 2861 1114 38 ----13538
NM_016623chr8165 ----1234
NM_016626chr18----1562 --
NM_016628chr101698 ------
NM_016631chr211415 ------
NM_016653chr231215 1147 1098 ------
NM_016733chr2231142 1013 315 11626 ----
NM_016821chr31416 ------
NM_016827chr31720 ------
NM_016836chr22632 206 ------
NM_016839chr22632 206 ------
NM_016937chrX3881 855 320 ------
NM_016940chr21--1469 ----
NM_016946chr143234 2913 2220 460 ------
NM_016952chr1164078 3433 1477 951 767 565 ------
NM_016953chr244452 4377 772 21 13894 ----
NM_017409chr121780 ------
NM_017412chr8--11147 21426 374 --
NM_017415chr533174 3127 244 11711 1547 --
NM_017420chr1413250 13434 --12574
NM_017423chr4--1183 1346 --
NM_017449chr11352 ------
NM_017450chr1711241 11485 1922 --
NM_017452chr2031248 242 131 --1166 --
NM_017453chr2031248 242 131 --1166 --
NM_017454chr2031248 242 131 --1166 --
NM_017455chr151328 ------
NM_017456chr173738 301 265 --11306 1175
NM_017495chr2031320 1083 276 --21219 549 11418
NM_017519chr611055 ------
NM_017520chr132402 65 1120 ----
NM_017541chr31168 ------
NM_017544chrX1652 1197 ----
NM_017545chr201462 ------
NM_017548chr312166 145 11442 --
NM_017551chr101558 ------
NM_017553chr151966 --1483 --
NM_017570chr8--151 ----
NM_017582chr121456 1348 ------
NM_017590chr2252519 2060 883 868 116 ------
NM_017592chr193620 135 29 11961 ----
NM_017593chr41318 1160 ----
NM_017594chr952681 2635 936 81 26 ------
NM_017599chr1211835 2410 397 ----
NM_017602chrX3720 333 325 ------
NM_017613chr21--1291 ----
NM_017615chr101115 ------
NM_017628chr474667 2109 1998 1078 295 250 112 --11439 24705 3967
NM_017629chr121503 117 --1657 --
NM_017632chr41155 ------
NM_017633chr633228 2495 599 --12701 --
NM_017634chr821931 1436 1607 ----
NM_017635chr112645 90 ------
NM_017637chr938637 2896 1725 --19206 --
NM_017640chr6145 ----1332
NM_017643chr171326 ------
NM_017650chr754098 3773 1183 245 112 15146 15662 --
NM_017658chr1424418 3222 ----11240
NM_017661chr15--1813 ----
NM_017664chr13146 ------
NM_017666chrX--11836 11849 21649 97
NM_017668chr162547 139 ------
NM_017672chr151430 --2368 201 --
NM_017679chr171698 ------
NM_017709chr144082 2954 2697 343 23995 426 ----
NM_017719chr311841 --1689 --
NM_017728chr17122938 2916 2701 2691 2546 2475 2439 938 865 854 847 447 --1203 --
NM_017737chr12656 51 11690 ----
NM_017742chr1821734 119 ------
NM_017744chr112183 ----1842
NM_017748chr171809 ------
NM_017752chrX31729 853 50 ------
NM_017753chr91159 ------
NM_017758chr1751449 1443 1359 1189 1036 --11161 --
NM_017772chr621464 48 --1494 --
NM_017778chr81443 --171 --
NM_017787chr1042840 2284 950 435 --1891 --
NM_017789chr2144 ------
NM_017811chr952869 2175 2100 1909 429 --11250 --
NM_017822chr121761 1313 ----
NM_017824chr1052206 1853 1785 223 26 ------
NM_017845chr41228 ------
NM_017848chrX43140 1824 300 222 --13494 --
NM_017849chr283057 2711 2403 873 596 439 51 30 ------
NM_017860chr11633 ----1656
NM_017873chr981975 1208 1182 568 383 377 295 179 --2623 38 --
NM_017893chr1011272 ------
NM_017902chr1074767 4469 4313 3869 1837 1523 1437 --45333 1452 1244 164 --
NM_017922chr141167 ------
NM_017923chr41291 ------
NM_017926chr143627 313 209 ------
NM_017933chr22333 30 ----1567
NM_017938chrX21907 1415 --1207 --
NM_017944chr1132607 946 778 --1654 --
NM_017949chr171238 --154 --
NM_017954chr71688 --11542 11261
NM_017955chr143866 368 301 ------
NM_017966chr113584 450 324 ------
NM_017972chr143627 313 209 ------
NM_017974chr22333 139 ------
NM_017987chr102349 94 --11967 --
NM_017994chr732942 2837 2620 12256 ----
NM_018011chr13----155 --
NM_018015chrX21065 130 ------
NM_018017chr1011009 ------
NM_018028chr194850 841 225 42 ------
NM_018036chr1444075 3082 339 67 --14144 --
NM_018043chr112936 270 --172 --
NM_018046chr51145 ------
NM_018061chr11493 --11370 --
NM_018071chr144834 327 66 31 ------
NM_018086chr231742 1478 591 ------
NM_018092chr161162 ------
NM_018095chr111115 ------
NM_018098chr32399 288 ------
NM_018115chr41137 ------
NM_018116chr11558 ------
NM_018121chr1053068 2970 2885 2688 2624 12989 ----
NM_018126chr4149 ------
NM_018128chr1711005 ------
NM_018133chr31542 ----160
NM_018151chr22770 639 ------
NM_018155chr341189 503 371 304 ------
NM_018156chr132875 1009 943 ------
NM_018157chr1242954 2193 482 56 1201 --1663
NM_018171chr121730 ------
NM_018172chr117625 573 521 469 417 365 212 ------
NM_018180chr10----143 --
NM_018181chr18----1342 --
NM_018184chr31401 --1686 --
NM_018202chr12923 69 --1814 --
NM_018214chr6----1440 --
NM_018227chr443056 2990 2489 1199 22318 535 ----
NM_018243chr44998 370 268 211 --13249 --
NM_018246chr812316 --22680 675 --
NM_018247chr612843 --12309 --
NM_018275chr71456 ------
NM_018287chr101493 ------
NM_018299chr823060 806 ------
NM_018307chr171882 ------
NM_018312chr111251 ------
NM_018315chr41330 --1254 --
NM_018319chr1421064 581 ------
NM_018322chr63976 940 340 126 195 --
NM_018325chr921461 55 1120 ----
NM_018334chr7162 ------
NM_018342chr4126 ------
NM_018362chr111920 23297 2610 23261 485 11216
NM_018363chr102323 245 1180 ----
NM_018364chr134032 3522 2596 ----13830
NM_018374chr735103 1356 151 ------
NM_018403chr333606 3219 479 --1466 --
NM_018409chr433077 2917 2201 169 ----
NM_018416chr122514 53 --12166 11745
NM_018424chr931779 1697 696 ------
NM_018427chr161335 ------
NM_018429chr5--12893 ----
NM_018433chr21441 --135 --
NM_018440chr856708 5778 2625 917 26 ------
NM_018452chr6_random22943 1341 ------
NM_018469chr172380 309 ------
NM_018482chr81190 --11812 --
NM_018486chrX176 --2389 153 --
NM_018489chr11489 ------
NM_018509chr1711678 --11644 1228
NM_018561chr621009 816 ------
NM_018569chr411430 ------
NM_018584chr1--1301 ----
NM_018638chr1285469 4783 4465 4229 3810 1794 669 29 ----11102
NM_018650chr121555 193 ------
NM_018652chr152859 53 ------
NM_018660chr832464 2278 43 12535 11886 1756
NM_018667chr1682168 2117 2045 1954 1090 930 810 40 ------
NM_018689chr1562453 1670 942 795 102 57 ------
NM_018695chr511712 ------
NM_018696chr18----1392 --
NM_018698chrX1147 --1691 --
NM_018710chr831354 1130 44 1965 ----
NM_018715chr132001 1922 455 1449 143 --
NM_018717chr472660 1862 832 752 712 403 125 ------
NM_018718chr72628 448 ------
NM_018837chr202911 706 ------
NM_018847chr9----11870 --
NM_018890chr721144 564 1413 1403 --
NM_018898chr52591 386 ------
NM_018899chr52591 386 ------
NM_018900chr52591 386 ------
NM_018901chr52591 386 ------
NM_018902chr52591 386 ------
NM_018903chr52591 386 ------
NM_018904chr52591 386 ------
NM_018905chr52591 386 ------
NM_018906chr52591 386 ------
NM_018907chr52591 386 ------
NM_018908chr52591 386 ------
NM_018909chr52591 386 ------
NM_018910chr52591 386 ------
NM_018911chr52591 386 ------
NM_018912chr561700 1603 1561 1554 205 32 ------
NM_018913chr561700 1603 1561 1554 205 32 ------
NM_018914chr561700 1603 1561 1554 205 32 ------
NM_018915chr561700 1603 1561 1554 205 32 ------
NM_018916chr561700 1603 1561 1554 205 32 ------
NM_018917chr561700 1603 1561 1554 205 32 ------
NM_018918chr561700 1603 1561 1554 205 32 ------
NM_018919chr561700 1603 1561 1554 205 32 ------
NM_018920chr561700 1603 1561 1554 205 32 ------
NM_018921chr561700 1603 1561 1554 205 32 ------
NM_018922chr561700 1603 1561 1554 205 32 ------
NM_018923chr561700 1603 1561 1554 205 32 ------
NM_018924chr561700 1603 1561 1554 205 32 ------
NM_018925chr561700 1603 1561 1554 205 32 ------
NM_018926chr561700 1603 1561 1554 205 32 ------
NM_018927chr561700 1603 1561 1554 205 32 ------
NM_018928chr561700 1603 1561 1554 205 32 ------
NM_018929chr561700 1603 1561 1554 205 32 ------
NM_018931chr53726 576 264 ------
NM_018948chr11146 ------
NM_018970chr732522 790 107 --11050 --
NM_018976chr1211826 1521 ----
NM_018977chrX1280 ------
NM_018979chr1222161 592 --1235 --
NM_018993chr201503 --1175 --
NM_018999chr1053376 800 793 345 228 ------
NM_019000chr51614 11369 ----
NM_019001chr374228 4185 3993 3691 1825 1278 203 ------
NM_019004chr73786 715 677 12029 1153 --
NM_019005chr71140 ------
NM_019027chr431643 1628 839 ------
NM_019045chrX1138 ------
NM_019058chr102330 117 --1622 1531
NM_019071chr71672 ------
NM_019074chr153734 331 41 --1215 --
NM_019089chr182536 2238 766 611 526 326 315 251 --179 --
NM_019091chr23872 454 340 ------
NM_019096chr63386 215 185 --183 --
NM_019098chr81535 ----11649
NM_019114chr9----12541 --
NM_019116chr1643452 2523 1360 377 ------
NM_019555chr31678 ----1391
NM_019558chr2--1242 ----
NM_019594chr9----1648 --
NM_019595chr2197 ------
NM_019606chr71556 ------
NM_019610chr1----11355 --
NM_019613chr173899 469 236 ------
NM_019842chr6131 --1122 --
NM_019845chr22785 186 ------
NM_019854chr121206 1679 ----
NM_019858chr12----177 --
NM_019859chr1031628 280 91 ------
NM_019860chr1031676 328 139 ------
NM_019885chr252281 1084 744 467 36 ------
NM_020066chr11280 ------
NM_020069chr11135 ------
NM_020116chr411782 ------
NM_020122chr242421 2093 509 205 --11286 --
NM_020126chr191616 ------
NM_020141chr141903 1539 907 593 --11610 --
NM_020148chr1811155 1274 1860 --
NM_020150chr101641 --11980 --
NM_020159chr42468 249 ------
NM_020160chr191328 ----1283
NM_020177chr522996 584 1507 ----
NM_020179chr111330 ------
NM_020193chr111156 ------
NM_020198chr171396 ----11564
NM_020225chr41318 ------
NM_020235chr31315 ------
NM_020239chr11210 --1777 --
NM_020245chr654790 3518 1926 1415 893 ------
NM_020248chr152222 2017 1621 1478 79 ------
NM_020251chr11--1655 ----
NM_020309chr19----127 --
NM_020311chr23646 170 88 ------
NM_020318chr1141 --1230 --
NM_020336chr2023150 1522 13350 13571 --
NM_020337chr42367 271 --1593 --
NM_020341chr2032002 1769 415 ------
NM_020346chr1111378 ------
NM_020357chr3--1358 21332 1307 --
NM_020373chr122133 35 ------
NM_020381chr63659 593 197 ------
NM_020403chr1311625 ------
NM_020416chr42197 128 12092 1773 --
NM_020418chr31209 --3507 382 180 --
NM_020420chrY41287 1261 1249 73 ------
NM_020429chr752812 2022 634 516 453 12557 11129 --
NM_020432chr732082 1952 1435 --12241 --
NM_020438chr911238 ------
NM_020455chr622737 2337 ------
NM_020463chr221313 988 ------
NM_020466chr643369 3273 1450 207 13913 14399 --
NM_020474chr1821554 422 11265 ----
NM_020532chr21104 ------
NM_020546chr532873 2639 2506 --1360 12595
NM_020630chr102644 522 ------
NM_020631chr151320 1214 1183 500 216 ------
NM_020640chr311678 ------
NM_020644chr111905 --1881 --
NM_020647chr81546 ------
NM_020651chr221788 1439 --1500 --
NM_020654chr32597 443 ------
NM_020666chr52887 579 ------
NM_020697chr821288 1053 ------
NM_020699chr134658 3954 673 --34944 3971 3750 --
NM_020713chr2052035 981 749 448 133 --32832 2021 1154 --
NM_020715chr1432183 1461 852 12286 ----
NM_020718chr1634019 1776 1030 26073 874 11754 --
NM_020727chr2143020 2620 1064 32 ------
NM_020728chr783038 2600 2511 2253 2192 475 236 36 --1243 --
NM_020732chr611055 ------
NM_020742chrX32666 350 154 ------
NM_020748chr1741645 583 362 229 12145 11806 --
NM_020752chr101405 1621 11179 --
NM_020753chr173557 177 149 --1505 --
NM_020764chr1651289 940 893 846 300 --11179 --
NM_020766chrX64482 3744 3351 1848 895 177 --13271 --
NM_020772chr1711302 --17422 18088
NM_020773chr452082 874 266 195 84 ------
NM_020777chr452150 926 712 627 552 --2576 64 --
NM_020778chr1584771 4664 4033 3962 3711 1279 906 54 11247 24278 1971 --
NM_020791chr171470 ------
NM_020792chr322765 345 ------
NM_020794chr11235 ------
NM_020795chr1731996 1469 1396 ------
NM_020796chr522599 2571 1916 ----
NM_020801chr521782 1047 ------
NM_020806chr141599 ------
NM_020807chr1641773 1665 208 199 ------
NM_020809chr111101 ------
NM_020810chr1443525 1306 789 663 ------
NM_020814chr251142 1027 454 355 169 ------
NM_020820chr2031451 274 67 --11234 --
NM_020830chr273037 2796 2248 697 508 69 40 ------
NM_020845chr1252107 1982 1834 1547 396 --11863 --
NM_020850chr1643032 3024 2012 1236 --12483 --
NM_020856chr1931578 1337 30 ----11416
NM_020858chr152479 258 1167 ----
NM_020859chr431199 1166 372 ------
NM_020861chr61857 ------
NM_020866chr131305 ------
NM_020868chr2----1100 --
NM_020870chr42819 60 ------
NM_020871chrX22103 762 --12059 --
NM_020888chr171847 1689 1538 790 490 471 66 11504 2269 225 --
NM_020922chrX41441 714 391 185 ------
NM_020926chrX1151 ------
NM_020935chr263981 1829 1316 390 202 24 --14464 --
NM_020940chr102930 356 ------
NM_020948chr131216 1003 100 ------
NM_020951chr1922243 1761 ------
NM_020956chr19184585 4515 4359 4294 3915 3710 3573 3486 3312 1911 1833 1755 1677 1581 1338 1194 927 819 --22958 994 --
NM_020962chr1541636 964 893 297 ------
NM_020971chr191793 ------
NM_020977chr431889 221 123 --11860 --
NM_020983chr1241854 1469 829 366 --1331 --
NM_020987chr1011152 ------
NM_020993chr1241923 1843 955 510 12574 1514 --
NM_021003chr141751 ------
NM_021005chr151785 ------
NM_021020chr863211 2194 1286 1262 587 352 ----1934
NM_021033chr1322731 579 ------
NM_021038chr313069 12996 ----
NM_021064chr621282 403 --125 --
NM_021069chr421878 459 ------
NM_021076chr22--1373 ----
NM_021079chr1753369 3043 2437 1126 883 ------
NM_021090chr2274458 3917 3076 1838 1508 687 24 --13345 --
NM_021097chr22687 225 ------
NM_021109chrX1323 ------
NM_021109chrX1323 ------
NM_021120chrX53122 2826 841 715 448 --22617 2608 --
NM_021132chr1011292 ------
NM_021140chrX--181 ----
NM_021144chr9--1409 ----
NM_021145chr71965 --124 --
NM_021155chr1952525 1877 1017 697 290 ------
NM_021156chr202145 66 ------
NM_021183chrX3775 608 538 ------
NM_021190chr1----11010 --
NM_021191chr1222155 1971 ------
NM_021200chr1131127 966 910 ------
NM_021215chr2022425 383 --1808 --
NM_021222chr11160 11370 ----
NM_021235chr19143 ------
NM_021238chr121205 ------
NM_021239chr14--1249 --11096
NM_021242chrX1750 ------
NM_021252chr10194 --11280 --
NM_021255chr1443407 2665 2494 1034 13993 1486 --
NM_021257chr143942 638 21 --1923 --
NM_021260chr143384 378 158 ------
NM_021620chr61569 ------
NM_021622chr10--11824 ----
NM_021627chr31385 ------
NM_021637chrX----2904 38 --
NM_021639chr11296 ------
NM_021705chr6----11280 --
NM_021738chr102331 264 ------
NM_021783chrX21503 31 11982 ----
NM_021808chr122598 480 --1208 --
NM_021814chr611249 ------
NM_021831chr2----1300 --
NM_021914chr1432061 480 415 ------
NM_021926chr112241 182 ------
NM_021931chr201817 ------
NM_021940chr621478 1444 11508 1209 --
NM_021945chr652533 598 400 326 315 --32572 840 41 --
NM_021951chr91918 ------
NM_021954chr1342498 1195 617 409 1799 ----
NM_021956chr61155 --1576 --
NM_021960chr122414 68 ------
NM_021961chr1167453 7100 6028 2702 2446 198 1901 ----
NM_021962chr1731819 577 458 --11020 --
NM_021964chr312377 --11459 --
NM_021969chr1145 ------
NM_021984chrX2622 491 ------
NM_021987chrX2622 491 ------
NM_021990chrX2622 491 ------
NM_021998chrX1997 ------
NM_022003chr1121042 488 --142 --
NM_022037chr21343 ------
NM_022041chr1622107 377 --181 --
NM_022048chr1564116 2437 1015 515 161 59 ------
NM_022062chr1121413 133 ------
NM_022079chr101645 ------
NM_022080chr2022705 1933 129 ----
NM_022087chr7------1602
NM_022114chr134537 3415 1083 --23972 2983 --
NM_022130chr511091 ------
NM_022137chr1452074 1565 1548 1537 1453 ------
NM_022169chr111237 ------
NM_022173chr21343 ------
NM_022343chr941284 1054 998 492 --21199 986 --
NM_022346chr41339 ------
NM_022361chr6--1472 ----
NM_022373chr71960 --1916 --
NM_022374chr21418 ------
NM_022437chr21168 1390 --1342
NM_022457chr1153 ------
NM_022462chr192705 69 ------
NM_022465chr12----22704 585 --
NM_022467chr192378 136 ------
NM_022473chr1553850 3431 2873 936 725 --23330 150 --
NM_022474chr142465 104 --21989 170 --
NM_022477chr2031457 1222 545 ------
NM_022484chr72507 115 ------
NM_022485chr31137 --1376 --
NM_022497chr383769 3670 3447 2520 1517 1350 447 236 13604 ----
NM_022552chr2126 ------
NM_022566chr15--1412 ----
NM_022572chr221453 319 --21125 491 --
NM_022574chr75777 591 540 438 42 ------
NM_022652chr123222 61 49 ------
NM_022658chr122151 60 ------
NM_022719chr2243250 3165 2420 1047 --43615 3580 391 52 --
NM_022725chr1151743 807 410 307 158 ------
NM_022728chr7----1623 --
NM_022735chr12558 431 ------
NM_022737chr1911224 ------
NM_022739chr171295 ------
NM_022744chr1631023 1000 295 --183 --
NM_022751chr181242 ------
NM_022753chr152793 2534 2323 1922 844 12088 1276 --
NM_022776chr31321 ------
NM_022780chr231627 1472 239 183 ----
NM_022781chr922377 2294 --1728 2482 347
NM_022782chr121290 ------
NM_022817chr252008 1988 1789 1443 26 ------
NM_022821chr12417 58 --1198 --
NM_022824chr531915 541 164 ------
NM_022828chr51252 ------
NM_022831chr131629 627 520 ------
NM_022841chr1512724 ------
NM_022843chr131262 --2403 84 --
NM_022845chr161132 ------
NM_022893chr222749 784 --13142 --
NM_022898chr1453940 3664 565 189 129 ------
NM_022899chr32349 183 ------
NM_022912chr222414 2142 --1891 --
NM_022970chr10----11044 --
NM_022977chrX3359 197 38 12540 ----
NM_023000chr1451717 1382 1339 1121 29 ------
NM_023001chr1451717 1382 1339 1121 29 ------
NM_023010chrX141 ------
NM_023016chr232768 1896 359 1606 ----
NM_023037chr13139 --1189 --
NM_023071chr12----1259 --
NM_023074chr1911262 --1218 --
NM_023076chr1662678 2630 2464 2251 946 327 12012 ----
NM_024007chr512989 ------
NM_024015chr172322 47 ------
NM_024019chr41372 ------
NM_024052chr1731088 952 637 --2428 224 --
NM_024055chr52612 225 ------
NM_024061chr7165 ------
NM_024090chr411585 193 2743 135 --
NM_024117chr931358 212 33 ------
NM_024293chr22577 96 ----1128
NM_024312chr1251244 1221 1037 206 96 ------
NM_024332chrX11292 --1657 --
NM_024415chr5--1190 ----
NM_024421chr1811055 ------
NM_024423chr1853150 1160 1137 1065 668 ------
NM_024424chr11138 1228 ----
NM_024425chr11138 1228 ----
NM_024426chr11138 1228 ----
NM_024430chr1851426 1243 385 333 190 --11792 --
NM_024520chr2137 ------
NM_024522chr12720 49 --11708 --
NM_024524chr342687 807 738 123 ------
NM_024539chrX1331 ------
NM_024541chr1031176 683 157 21724 308 11872 --
NM_024556chr112379 321 ------
NM_024563chr51721 --1547 --
NM_024567chr81101 --1120 --
NM_024586chr1140 ----1193
NM_024594chr511873 ------
NM_024595chr12910 263 ------
NM_024612chr171178 ------
NM_024613chr821299 397 ------
NM_024624chr221089 595 ------
NM_024639chr611172 ------
NM_024646chr143611 3076 2654 355 ------
NM_024652chr151794 ------
NM_024656chr193597 302 164 1357 11316 --
NM_024665chr384662 4257 3906 3755 2974 1848 1761 413 14316 ----
NM_024674chr122215 823 --1497 --
NM_024698chr112440 121 ----165
NM_024704chr202866 213 --170 --
NM_024705chr133795 255 22 --2221 162 --
NM_024713chr151208 21444 454 ----
NM_024721chr83661 407 76 ----12105
NM_024738chr1231885 208 112 ----1579
NM_024740chr1134199 3054 2802 1223 23757 457 --
NM_024742chr1611606 --11224 --
NM_024744chr222536 583 1561 ----
NM_024749chr1--1445 ----
NM_024755chr151300 ------
NM_024771chr1161685 1647 1509 773 503 239 --1477 --
NM_024783chr111380 ------
NM_024808chr132342 326 ------
NM_024811chr1121334 175 ------
NM_024828chr91982 11254 ----
NM_024834chr1031840 602 363 ------
NM_024874chr12496 310 --179 --
NM_024887chr131743 1467 1353 11695 --1463
NM_024900chr432028 618 547 12313 ----
NM_024900chr432028 618 547 12313 ----
NM_024911chr11285 --1170 --
NM_024920chr411304 ------
NM_024939chr1621307 663 --191 --
NM_024947chr378356 8178 7428 3450 3019 2568 32 12045 ----
NM_024949chr484756 3077 3057 1277 774 469 410 305 ------
NM_024953chr121249 ------
NM_024954chr102591 188 ------
NM_025054chr833240 1073 805 ------
NM_025057chr14138 --1548 --
NM_025074chr4----11141 --
NM_025090chr1741259 1247 1136 485 ------
NM_025133chr21354 ------
NM_025134chr1612316 ----1420
NM_025146chr322560 259 12701 1605 --
NM_025147chr21109 ------
NM_025151chr821988 477 11920 ----
NM_025160chr123747 509 ------
NM_025181chr21193 ------
NM_025187chr1621280 432 ------
NM_025195chr811459 --1464 --
NM_025209chr10----1109 --
NM_025211chr9197 ------
NM_025219chr2032368 2130 92 1201 11864 --
NM_025222chr342735 721 710 40 2613 600 1421 --
NM_025235chr1012028 ------
NM_025236chr6147 ------
NM_025248chr1742206 1238 968 844 ------
NM_025260chr6122 ------
NM_030579chr1643488 3034 731 370 13632 22571 739 --
NM_030594chr1521060 454 ------
NM_030621chr1434120 3420 3347 ------
NM_030629chr1611905 ------
NM_030647chr756125 5914 1424 916 92 --11296 --
NM_030648chr454468 1748 1429 1410 1390 34439 2115 1739 ----
NM_030664chr1022378 1672 11858 ----
NM_030674chr1244926 3969 1442 949 --24174 598 --
NM_030751chr1041700 1316 660 241 ------
NM_030751chr1041700 1316 660 241 ------
NM_030759chr101768 ------
NM_030762chr1221265 624 ------
NM_030786chr1--11900 ----
NM_030791chr14--1692 ----
NM_030795chr83402 66 50 ------
NM_030802chr173926 776 209 --1217 --
NM_030803chr22333 139 ------
NM_030806chr187115 6948 6718 6659 6435 1769 1178 489 11754 27416 5940 --
NM_030808chr172989 716 --21052 869 1147
NM_030809chr122875 90 1312 1807 --
NM_030813chr111916 ----1365
NM_030817chr1242484 1334 1282 69 ------
NM_030884chr352213 1718 317 273 189 --1915 --
NM_030885chr342116 1757 1562 937 ------
NM_030906chr111223 ------
NM_030912chr101599 ------
NM_030914chr92889 236 ------
NM_030918chr174900 4617 4594 3389 1951 1275 260 --14491 --
NM_030920chr112035 ----1462
NM_030935chr7177 ------
NM_030937chr131216 342 260 11369 21059 276 --
NM_030938chr172745 133 ------
NM_030939chr6147 2733 722 ----
NM_030953chr511508 ------
NM_030964chr573302 2987 2748 1102 853 569 329 ------
NM_031243chr712333 ------
NM_031262chr91821 ------
NM_031263chr91878 ------
NM_031266chr51187 ------
NM_031267chr7168 ------
NM_031268chr1684986 4890 4336 4088 3892 1444 494 55 --1611 --
NM_031283chr22914 165 ------
NM_031309chr842324 577 536 460 --11507 --
NM_031369chr41100 1772 ----
NM_031370chr41100 1772 ----
NM_031371chr1--1520 ----
NM_031371chr1--1520 ----
NM_031411chr52591 386 ------
NM_031417chr1922263 1008 11780 141 --
NM_031418chr112973 592 ------
NM_031419chr331476 276 50 --11112 --
NM_031422chr181108 ------
NM_031424chr202446 360 --1488 --
NM_031427chr1435776 3947 458 --25223 2377 --
NM_031439chr82658 304 ------
NM_031442chrX53150 2524 2311 350 109 12029 ----
NM_031445chr232722 863 416 --12642 --
NM_031453chr1042299 926 204 180 1531 ----
NM_031461chr8--1250 ----
NM_031468chr777318 7120 5319 2829 2279 1903 32 --57907 6726 6361 2084 1723 --
NM_031476chr1632657 1094 615 ------
NM_031844chr123137 181 11485 ----
NM_031845chr2172 ------
NM_031847chr2172 ------
NM_031849chr52591 386 ------
NM_031857chr52591 386 ------
NM_031860chr52591 386 ------
NM_031892chrX--1687 1289 --
NM_031899chr351367 1225 490 230 62 ------
NM_031908chr51285 11336 11128 --
NM_031911chr432698 2204 1708 ------
NM_031935chr1--1240 1103 --
NM_031938chr111769 ------
NM_031940chr822031 655 ------
NM_031942chr23976 876 202 ------
NM_032012chr924089 1232 ------
NM_032013chr2031457 1222 545 ------
NM_032041chr842729 2012 1767 850 ------
NM_032051chr222581 169 ------
NM_032052chr222477 96 --1392 --
NM_032088chr561700 1603 1561 1554 205 32 ------
NM_032092chr561700 1603 1561 1554 205 32 ------
NM_032102chr1121194 598 ------
NM_032105chr1107779 7493 7319 6250 5421 3222 2107 1573 973 561 --14944 --
NM_032108chr195814 779 345 288 28 ------
NM_032121chrX22605 768 ------
NM_032131chr61133 ------
NM_032147chr121698 ------
NM_032174chr1130 --1173 1573
NM_032182chr1011533 11665 ----
NM_032193chr1121424 595 --11315 --
NM_032199chr1052849 1556 1248 1063 765 ------
NM_032208chr212236 22389 769 ----
NM_032228chr1122476 1136 ------
NM_032229chr1311046 ------
NM_032233chr14----1841 --
NM_032268chr1663262 3091 2777 2360 2338 2060 --12317 --
NM_032272chr81470 ------
NM_032281chr1942330 535 105 39 ------
NM_032287chr2263689 2623 918 906 43 22 --33415 3013 397 --
NM_032288chr311821 --11796 --
NM_032289chr5----11789 1112
NM_032291chr1------1269
NM_032294chr1731562 684 32 ------
NM_032312chr2--1179 ----
NM_032320chr11----2313 155 --
NM_032327chr10----174 --
NM_032329chr2114269 3977 3820 3743 3638 1678 945 885 462 358 340 --23381 466 --
NM_032353chr172481 438 ------
NM_032364chr121235 ------
NM_032373chr1033679 1217 370 --1727 --
NM_032403chr561700 1603 1561 1554 205 32 ------
NM_032408chr71928 ------
NM_032420chr51341 ------
NM_032440chr1022544 1922 ------
NM_032445chr1521840 1818 --1719 --
NM_032457chr423183 1454 ------
NM_032458chrX33055 744 548 1536 ----
NM_032466chr81604 --11198 11119
NM_032468chr81604 --11198 11119
NM_032482chr1972386 2017 1886 1033 855 679 143 --12340 --
NM_032505chr312662 --1637 --
NM_032509chr821742 435 ------
NM_032510chr1822162 899 --11550 --
NM_032511chr6169 ------
NM_032538chr63977 687 75 ------
NM_032547chr421414 1253 ------
NM_032550chr102966 448 ------
NM_032560chr141414 ------
NM_032574chr2----162 --
NM_032575chr1621937 108 --41510 1460 1373 39 --
NM_032582chr1721280 57 --11718 --
NM_032583chr16161 --133 --
NM_032595chr1721086 219 ------
NM_032598chr17139 ------
NM_032603chr21293 ------
NM_032632chr1411729 --1553 --
NM_032638chr321428 1355 1155 ----
NM_032682chr372547 2453 1461 1299 1276 1107 762 12668 12529 12414
NM_032711chr1764232 4166 3691 3269 564 453 ------
NM_032737chr1962598 2441 2066 659 603 509 --12478 --
NM_032758chr222567 46 --1131 --
NM_032810chr101997 1610 ----
NM_032833chr121722 602 --21034 78 --
NM_032837chr1722105 789 --1150 11986
NM_032842chr731160 508 145 ------
NM_032859chr1323136 757 22425 1233 ----
NM_032864chr11500 ----189
NM_032866chr1532513 983 193 23159 1056 ----
NM_032867chr112457 222 --1160 --
NM_032871chr113662 464 79 11614 ----
NM_032876chr141626 ------
NM_032883chr203845 626 180 ------
NM_032900chr1053148 1564 1448 1156 93 ------
NM_032905chr101463 --11100 --
NM_032924chr731032 927 217 ------
NM_032927chr41460 1216 ----
NM_032961chr4--1864 ----
NM_032966chr1141537 507 226 46 --21217 622 1137
NM_032968chrX44191 4136 3880 3827 13272 ----
NM_032969chrX44191 4136 3880 3827 13272 ----
NM_032973chrY44183 4128 3872 3819 13267 ----
NM_032983chr732913 2132 1067 1558 ----
NM_032999chr731069 1027 157 ------
NM_033000chr731069 1027 157 ------
NM_033001chr731069 1027 157 ------
NM_033008chr31209 --3507 382 180 --
NM_033009chr31209 --3507 382 180 --
NM_033010chr31209 --3507 382 180 --
NM_033018chrX3838 62 28 ------
NM_033020chr144650 1627 1177 482 ------
NM_033025chr192868 744 ------
NM_033030chr211156 ------
NM_033055chr11788 ------
NM_033058chr83167 46 31 ------
NM_033071chr6135 --2492 117 --
NM_033081chr201459 1439 ----
NM_033116chr142264 79 ------
NM_033133chr1722434 414 13752 23036 1399 13102
NM_033151chr16161 --133 --
NM_033181chr633801 933 21 ------
NM_033224chr736721 2303 809 12326 12151 --
NM_033225chr812568 ------
NM_033227chr51448 ------
NM_033228chr51488 ------
NM_033285chr811451 --24268 3806 --
NM_033304chr8128 ------
NM_033315chr1741917 1709 1674 1540 --1511 --
NM_033316chr31117 --1144 --
NM_033326chr1121682 491 ------
NM_033331chr963290 2688 2680 2203 1442 1287 11117 1674 --
NM_033337chr31692 ----1262
NM_033348chr113278 73 21 ------
NM_033360chr121402 13952 11239 --
NM_033380chrX1365 ------
NM_033381chrX1365 ------
NM_033389chr1724387 1692 ------
NM_033396chr11241 31 ------
NM_033420chr1961126 1077 446 268 256 226 ------
NM_033425chr1122801 670 --12492 --
NM_033426chr1422068 2013 11098 ----
NM_033427chr71602 ------
NM_033428chr931959 1716 1452 ------
NM_033429chr151686 ------
NM_033449chr551946 1419 744 626 432 --11892 --
NM_033495chrX21014 782 ------
NM_033515chr6----1252 --
NM_033549chr51942 ------
NM_033550chr2021799 776 ----12186
NM_033631chr163748 3668 3014 2897 1242 370 --13283 --
NM_033632chr41330 --1254 --
NM_033656chr2165945 4526 4465 3656 370 328 25194 344 26012 2273 --
NM_048368chr184733 621 130 59 ------
NM_052811chr133491 149 22 --12074 11305
NM_052827chr1211132 ------
NM_052832chr81149 22940 1982 ----
NM_052839chr222983 880 ------
NM_052849chr15176 ------
NM_052850chr19139 ------
NM_052875chr1172070 1558 1538 1373 696 230 64 ------
NM_052879chr1221367 90 ------
NM_052886chr832038 1997 21 1542 ----
NM_052898chr82179 92 --1159 --
NM_052900chr811584 ------
NM_052904chr61556 --21371 1076 --
NM_052905chr221710 1354 --1686 --
NM_052906chr22134764 4622 4404 3780 3623 1633 1481 1015 768 749 625 569 71 13442 34596 3772 1395 --
NM_052907chr1244023 3591 3243 1725 21297 442 ----
NM_052910chr1322087 1338 11936 2699 451 --
NM_052918chr1042944 2357 891 392 --23283 701 --
NM_052927chr521511 114 ------
NM_052954chr211903 ------
NM_052978chr1421295 214 --2182 160 11228
NM_053001chr81160 ------
NM_053016chr987993 7720 7568 2997 1973 306 121 32 ------
NM_053023chr1122484 250 --1496 --
NM_053024chr311209 ----1408
NM_053025chr33485 154 23 1223 ----
NM_053026chr33485 154 23 1223 ----
NM_053027chr33485 154 23 1223 ----
NM_053028chr33485 154 23 1223 ----
NM_053031chr33485 154 23 1223 ----
NM_053032chr33485 154 23 1223 ----
NM_053043chr7106435 6016 5988 5846 4651 3919 1942 1890 1647 757 --15553 --
NM_053274chr11117 ------
NM_053279chr832576 673 582 12696 ----
NM_054016chr11368 11737 --1206
NM_054016chr11368 11737 --1206
NM_054016chr11368 11737 --1206
NM_054027chr552154 1458 1417 677 343 ------
NM_057158chr82712 88 ----1674
NM_057164chr2----1212 --
NM_057165chr2----1212 --
NM_057166chr2----1212 --
NM_057167chr2----1212 --
NM_057175chr41979 ------
NM_058170chr11567 --11399 --
NM_058172chr431334 651 111 ------
NM_058229chr81162 ------
NM_058241chr252354 1738 1643 1578 860 2338 253 ----
NM_058241chr252354 1738 1643 1578 860 2338 253 ----
NM_058243chr192869 671 --1154 --
NM_078471chr173830 277 21 ------
NM_078473chr822031 655 ------
NM_078487chr95855 719 695 203 60 ------
NM_078626chr1154 1111 ----
NM_078629chrX--2498 154 ----
NM_078630chrX--2498 154 ----
NM_080391chr11572 ------
NM_080392chr11621 ------
NM_080422chr181321 130 ----
NM_080423chr181321 130 ----
NM_080425chr20--175 ----
NM_080426chr20--175 ----
NM_080544chr321288 349 --11395 --
NM_080546chr9--11798 ----
NM_080550chr171802 ------
NM_080591chr933011 2264 1934 --22577 719 --
NM_080594chr162131 124 ------
NM_080599chr101264 1302 ----
NM_080616chr20----1247 --
NM_080629chr1----11250 --
NM_080630chr1----11250 --
NM_080632chrX141 ------
NM_080645chr621645 1355 11674 11717 --
NM_080654chr1121235 150 ------
NM_080666chr1411385 ------
NM_080669chr17114606 4048 3730 1542 1370 1231 1071 1009 349 116 69 ------
NM_080670chr52872 140 --1316 --
NM_080671chr231647 900 97 --1335 --
NM_080676chr2041132 1008 849 659 12804 ----
NM_080717chr121170 ------
NM_080738chr111772 --41893 1693 156 140 --
NM_080759chr1322584 1677 ------
NM_080760chr1322584 1677 ------
NM_080764chr2222533 2134 1423 ----
NM_080867chr1444692 3689 1563 96 21720 837 ----
NM_080881chr52291 93 ------
NM_080927chr323387 551 --11282 --
NM_100264chr101698 ------
NM_100486chr101698 ------
NM_130385chr112801 366 12287 --12634
NM_130387chr3--2166 75 --1866
NM_130391chr922521 361 ------
NM_130392chr922521 361 ------
NM_130393chr922521 361 ------
NM_130436chr2112364 --11773 --
NM_130438chr2122941 2165 1569 12350 --
NM_130439chr1031651 627 252 ------
NM_130439chr1031651 627 252 ------
NM_130440chr141387 1231 1177 576 ------
NM_130442chr71390 ------
NM_130459chr931127 450 192 ------
NM_130773chr22728 179 ------
NM_130787chr19143 --162 --
NM_130797chr711769 2571 449 1148 --
NM_130798chr1521297 43 2503 137 ----
NM_130811chr2011056 11191 ----
NM_130830chr322589 1361 --11555 --
NM_130838chr1511524 ------
NM_130839chr1511524 ------
NM_133170chr2066956 6718 6192 5358 676 72 --1840 --
NM_133265chrX32896 2378 456 --13162 --
NM_133370chr433438 711 467 13322 ----
NM_133372chr532126 1929 920 ------
NM_133445chr941240 698 432 163 ------
NM_133477chr421246 661 ------
NM_133478chr22429 211 ------
NM_133496chr12803 417 ------
NM_133647chr1522634 698 23801 1102 ----
NM_133650chr6135 --2492 117 --
NM_134265chr172946 459 ------
NM_134268chr177979 892 865 278 178 145 31 ------
NM_134325chr1----2348 64 --
NM_134428chr91309 ------
NM_134442chr211697 --1665 --
NM_138270chrX1869 23126 635 ----
NM_138274chr6122 ------
NM_138277chr61192 ------
NM_138285chr21160 ------
NM_138316chr101880 ------
NM_138340chr18----151 --
NM_138350chr151270 1048 985 414 230 ------
NM_138385chr441355 1288 433 55 ------
NM_138396chr124893 681 260 132 --1212 --
NM_138426chr71172 ------
NM_138434chr731337 1198 108 ------
NM_138444chr1353661 1460 888 705 127 1804 21189 592 --
NM_138453chr5----123 --
NM_138457chr622669 138 ------
NM_138459chr643372 1398 920 806 --22346 1012 --
NM_138462chr91146 ------
NM_138468chr232394 1686 196 11214 --15468
NM_138473chr1233857 3753 63 --24739 1167 --
NM_138479chr13727 182 44 ------
NM_138492chr511129 --1133 1353
NM_138554chr912211 ------
NM_138558chr121033 426 1484 1772 --
NM_138569chr61295 ------
NM_138576chr1453940 3664 565 189 129 ------
NM_138578chr2021463 1067 1154 ----
NM_138619chr172621 107 ------
NM_138621chr244073 3462 3357 1423 ------
NM_138635chr732569 658 182 --12402 --
NM_138638chr1432061 480 415 ------
NM_138694chr632593 1467 768 22437 203 ----
NM_138713chr1626936 6738 16677 22269 1335 12235
NM_138714chr1626936 6738 16677 22269 1335 12235
NM_138727chr112183 ----1842
NM_138728chr112183 ----1842
NM_138730chr61342 ------
NM_138766chr51418 ------
NM_138771chr7--11289 ----
NM_138775chr11----1260 --
NM_138782chr522236 1940 1675 ----
NM_138795chr151366 1308 1097 608 455 ------
NM_138799chr221651 1365 197 1639 --
NM_138821chr51418 ------
NM_138822chr51418 ------
NM_138927chr21--169 ----
NM_138931chr31180 ------
NM_138939chr3--181 ----
NM_138940chr3--181 ----
NM_138967chr151244 --22439 2049 --
NM_138970chr1411973 ------
NM_138980chr41712 1189 ----
NM_138981chr41843 1320 ----
NM_138982chr41712 1189 ----
NM_139012chr641947 725 652 249 --11457 --
NM_139014chr642027 805 732 329 --11537 --
NM_139015chr121636 ------
NM_139035chrX1316 ------
NM_139071chr1211104 --11471 --
NM_139072chr22806 142 ------
NM_139126chr6--1674 ----
NM_139135chr11522 21225 841 ----
NM_139207chr1231965 1389 268 1812 ----
NM_139214chrY190 ------
NM_139276chr1722081 331 ------
NM_139279chr243039 1156 1066 385 --1993 --
NM_139280chr1751283 1089 366 313 171 --1551 --
NM_139283chr121201 --1692 --
NM_139316chr73744 673 292 ----1864
NM_139318chr141209 ------
NM_139323chr20--11782 11846 --
NM_144498chr2022155 1618 1334 11734 --
NM_144507chr191118 ------
NM_144571chr486529 5203 4743 2794 2556 1274 1076 174 --26850 4894 --
NM_144582chr231605 906 692 ------
NM_144588chr1031391 314 297 ------
NM_144595chr13174 ------
NM_144600chr1621494 347 ------
NM_144604chr161369 171 ----
NM_144607chr1732646 1729 672 --1455 --
NM_144633chr311241 2282 26 ----
NM_144642chr32300 142 ------
NM_144643chr4147 ------
NM_144718chr321605 849 31976 1931 923 ----
NM_144732chr191406 ------
NM_144767chr1584523 3715 1709 1102 963 550 513 129 --126 --
NM_144949chr221010 527 ------
NM_144963chr811789 1770 ----
NM_144973chr1254364 3296 1182 308 99 13265 ----
NM_145044chr341758 1485 1236 734 192 ----
NM_145055chr1822703 1128 ----13570
NM_145071chr32915 384 --1124 --
NM_145074chr21568 ----1351
NM_145102chr73982 370 287 ------
NM_145112chr14----1274 --
NM_145113chr142995 176 --1546 --
NM_145117chr1123002 1279 --12290 --
NM_145159chr142777 756 ------
NM_145166chr352440 1812 872 830 352 --21916 920 --
NM_145173chr1922262 2233 ----11849
NM_145175chr211088 11239 ----
NM_145185chr1941424 591 570 299 ------
NM_145251chr1411426 ------
NM_145253chr161173 --1491 --
NM_145259chr246439 2442 2138 137 ------
NM_145260chr24575 564 543 82 1214 ----
NM_145296chr191261 ------
NM_145313chr1021292 657 ------
NM_145320chr722710 920 13612 1451 --
NM_145321chr722710 920 13612 1451 --
NM_145322chr722710 920 13612 1451 --
NM_145331chr62628 208 --1606 --
NM_145332chr62776 356 --1754 --
NM_145333chr62776 356 --1754 --
NM_145349chr1751878 1549 888 182 155 --1851 --
NM_145350chr1751230 565 479 293 240 --2396 203 --
NM_145659chr16171 ------
NM_145686chr252588 1266 1145 398 229 ------
NM_145687chr252588 1266 1145 398 229 ------
NM_145690chr821972 1355 ------
NM_145698chr1021951 1343 ------
NM_145714chr16151 ------
NM_145731chr224224 108 48 28 ------
NM_145738chr224224 108 48 28 ------
NM_145798chr173715 584 119 ------
NM_145800chrX168 ------
NM_145803chr11--1250 1172 --
NM_145808chr733059 2567 384 ------
NM_145810chr23976 876 202 ------
NM_145859chr3139 ------
NM_145860chr3139 ------
NM_145861chr111772 --41893 1693 156 140 --
NM_145891chr1621385 675 ------
NM_145892chr1621385 675 ------
NM_145893chr1611507 ------
NM_145899chr641267 496 211 38 11318 ----
NM_145901chr641267 496 211 38 11318 ----
NM_145902chr641267 496 211 38 11318 ----
NM_145903chr641267 496 211 38 11318 ----
NM_145904chr641267 496 211 38 11318 ----
NM_145905chr641267 496 211 38 11318 ----
NM_145912chr22114272 4158 3612 3569 3310 3220 1247 1085 516 389 52 1472 ----
NM_147156chr102965 567 ------
NM_147161chr161092 909 843 439 207 196 ------
NM_147164chr9--1225 ----
NM_147223chr21960 1171 1679 --
NM_147233chr22860 777 --1496 1819
NM_148177chr81162 ------
NM_148414chr162134 35 ------
NM_148415chr16174 ------
NM_148416chr16151 ------
NM_148904chr1140 ----1193
NM_148905chr1140 ----1193
NM_148906chr1140 ----1193
NM_148907chr1140 ----1193
NM_148908chr1140 ----1193
NM_148909chr1140 ----1193
NM_148977chr101880 ------
NM_148978chr101880 ------
NM_152222chr113662 464 79 11614 ----
NM_152230chr10155 ------
NM_152253chr2284077 3367 2788 2731 1217 456 236 130 11097 24018 1451 --
NM_152261chr1222319 779 ------
NM_152265chr121166 224 11425 ----
NM_152272chr82356 280 ------
NM_152280chr142808 2739 1001 353 11238 13367 --
NM_152284chr81651 --1240 --
NM_152287chr163464 423 399 --1585 --
NM_152344chr1711314 ------
NM_152371chr141637 607 155 132 ------
NM_152374chr111686 --11432 --
NM_152375chr122428 2284 --12382 --
NM_152387chr2----1224 --
NM_152388chr223847 1311 13862 ----
NM_152409chr542277 1372 970 565 22645 836 ----
NM_152410chr61460 ------
NM_152420chr9--1642 ----
NM_152424chrX43299 3248 2935 1445 --11392 --
NM_152442chr1221377 1267 ------
NM_152455chr1542303 1837 844 175 --11810 --
NM_152470chr1863309 3300 3028 2755 848 419 --13051 --
NM_152482chr1941786 1726 1219 28 ------
NM_152493chr131322 173 55 --1615 --
NM_152520chr22811 79 ------
NM_152529chr224351 3743 ------
NM_152538chr31135 ------
NM_152542chr41862 ----1306
NM_152551chr643024 2295 2235 1069 ------
NM_152554chr62687 212 ------
NM_152556chr732509 2263 1766 ------
NM_152557chr741417 503 69 61 ------
NM_152563chr117625 573 521 469 417 365 212 ------
NM_152570chr92100 89 ------
NM_152594chr1521876 483 ------
NM_152622chr542731 985 890 237 ------
NM_152624chr595814 5754 5663 5532 4941 1390 1147 1015 562 2751 181 ----
NM_152629chr924043 839 1781 ----
NM_152641chr121539 ------
NM_152653chr3162 ------
NM_152660chr11861 ------
NM_152663chr1--1344 ----
NM_152678chr3194 ------
NM_152699chr343400 1490 842 321 13536 1451 --
NM_152705chr1311065 ------
NM_152713chr11192 ------
NM_152716chr1111097 --195 --
NM_152722chr1141622 1540 1212 181 ------
NM_152734chr6125375 5292 4939 4823 4792 3640 1168 862 798 374 362 158 23354 1707 25357 3375 --
NM_152737chr621991 1588 --1366 --
NM_152745chr711026 ------
NM_152753chr62731 65 ------
NM_152756chr5192 23229 130 12641 --
NM_152758chr81640 ------
NM_152765chr82581 101 ----12306
NM_152787chrX13077 --11269 --
NM_152793chr734368 4045 238 ------
NM_152832chr11----1379 --
NM_152835chr11773 12772 12524 --
NM_152838chr20----13406 --
NM_152860chr1211097 ------
NM_152862chr2270 27 ------
NM_152896chr9--1115 ----
NM_152903chr13--31790 1768 1755 ----
NM_152924chr1585749 4976 4936 4901 4894 2339 2301 787 --46409 5012 2627 158 --
NM_152989chr1211816 --11719 --
NM_152994chr21207 ------
NM_152996chr121691 420 ------
NM_152998chr7193 ------
NM_152999chr754440 4349 4279 1354 694 24382 1068 14506 --
NM_153020chr62574 410 167 ----
NM_153029chr1653489 2560 1024 772 119 1269 23315 3211 --
NM_153050chr2274458 3917 3076 1838 1508 687 24 --13345 --
NM_153051chr2274458 3917 3076 1838 1508 687 24 --13345 --
NM_153184chr321251 707 ----11668
NM_153188chr575046 4926 4908 2093 1975 992 860 ------
NM_153207chr1211529 ------
NM_153211chr181174 ------
NM_153218chr132734 708 1205 ----
NM_153244chr101159 ------
NM_153260chr1521276 517 1292 ----
NM_153262chr12989 37 123 ----
NM_153273chr362695 1784 936 803 613 280 --1847 --
NM_153332chr841290 1091 669 52 ------
NM_153341chr11252 ------
NM_153350chr162681 206 --11530 --
NM_153367chr1073733 3652 3384 2429 1393 699 519 --12641 --
NM_153374chr151145 ------
NM_153453chr6----1687 --
NM_153499chr1282401 2196 2177 2055 1099 776 629 100 ------
NM_153500chr1282401 2196 2177 2055 1099 776 629 100 ------
NM_153607chr522835 2759 --12336 --
NM_153616chr152479 258 1167 ----
NM_153617chr152479 258 1167 ----
NM_153618chr152479 258 1167 ----
NM_153619chr15164 21405 1108 ----
NM_153620chr72186 105 --1398 --
NM_153633chr121673 ------
NM_153649chr111522 ------
NM_153685chr12----179 --
NM_153689chr2--1186 ----
NM_153690chr3----1354 --
NM_153756chr111356 131 ----
NM_153759chr2126 ------
NM_153810chr102878 317 43817 3747 3601 3383 14713 --
NM_153812chr11890 --22112 293 --
NM_153828chr21104 ------
NM_170600chr9127 ------
NM_170606chr711604 --131 --
NM_170662chr32140 115 ------
NM_170665chr1253656 3270 2818 1666 343 13317 12857 --
NM_170674chr15----11069 --
NM_170675chr15----1745 --
NM_170676chr15----1745 --
NM_170677chr15----11069 --
NM_170692chr12342 167 ------
NM_170712chr32149 39 ------
NM_170713chr32149 39 ------
NM_170714chr32149 39 ------
NM_170731chr1122637 2347 ------
NM_170732chr1122637 2347 ------
NM_170733chr1122637 2347 ------
NM_170734chr1122637 2347 ------
NM_170735chr1122637 2347 ------
NM_170768chr1111615 1581 11437 --
NM_170769chr6147 ------
NM_171998chrX1243 ------
NM_171999chr182730 124 ------
NM_172037chr811090 ------
NM_172058chr81122 ------
NM_172059chr81122 ------
NM_172060chr81122 ------
NM_172071chr177170 7113 4580 2934 2443 2322 1844 ------
NM_172103chr652367 1973 1666 528 286 12096 12626 --
NM_172105chr652367 1973 1666 528 286 12096 12626 --
NM_172127chr412051 11849 ----
NM_172128chr412007 11805 ----
NM_172159chr32794 98 ----11990
NM_172160chr32794 98 ----11990
NM_172169chr103464 134 88 --1610 --
NM_172170chr103464 134 88 --1610 --
NM_172171chr103464 134 88 --1610 --
NM_172173chr103464 134 88 --1610 --
NM_172198chr11163 ------
NM_172206chr1731562 684 32 ------
NM_172226chr1282401 2196 2177 2055 1099 776 629 100 ------
NM_172240chr12------1869
NM_172315chr15----11069 --
NM_172316chr15----11069 --
NM_172375chr1411143 ------
NM_173054chr72931 261 ------
NM_173060chr531529 1459 1287 ------
NM_173061chr531529 1459 1287 ------
NM_173063chr531529 1459 1287 ------
NM_173074chr22274 223 ------
NM_173078chrX1137 ------
NM_173079chr1751909 1881 1587 1359 125 ------
NM_173082chr61526 ------
NM_173156chr122213 92 --11907 --
NM_173171chr221010 372 ------
NM_173172chr211318 ------
NM_173173chr221010 372 ------
NM_173198chr92686 115 ------
NM_173200chr92686 115 ------
NM_173214chr1626936 6738 16677 22269 1335 12235
NM_173470chrX12364 ------
NM_173473chr1032244 1023 598 ------
NM_173476chr1672223 507 483 225 168 162 113 1528 ----
NM_173478chr1721051 369 ------
NM_173495chrX62354 1774 1664 1586 651 466 12033 ----
NM_173510chr2262508 1814 946 486 210 155 ------
NM_173511chr243066 1529 1503 1394 ------
NM_173536chr431330 1151 167 14908 ----
NM_173552chr312315 ------
NM_173561chr6178 ------
NM_173576chr10----12212 --
NM_173582chr1111977 ------
NM_173595chr1255097 5044 4256 1939 141 --11330 1522
NM_173602chr1211137 1411 ----
NM_173630chr18179 ------
NM_173642chr1109017 8819 7420 7381 7189 7010 6062 5781 3042 709 12226 29067 6108 --
NM_173647chr2------11056
NM_173653chr32332 77 ------
NM_173667chr53817 490 51 --1240 --
NM_173681chr741997 1870 1382 646 --31613 682 460 --
NM_173797chr51940 ------
NM_173808chr142841 2792 1110 577 1883 --11089
NM_173812chr12------11250
NM_173822chr2----22158 579 --
NM_173828chr5----1257 --
NM_173829chr565756 5098 4697 2355 1272 543 1356 ----
NM_173832chr8143312 3232 3183 3142 3093 3068 3043 3018 2969 2877 2453 1496 707 389 --1821 --
NM_173834chrX1393 ------
NM_173851chr83950 209 63 ----11156
NM_174887chr171320 ------
NM_174890chr101278 ------
NM_174909chr51564 ------
NM_174916chr152712 689 1439 ----
NM_174934chr1173262 3041 3025 2859 2738 862 23 ------
NM_174953chr1771387 1176 548 357 309 288 254 ------
NM_174954chr1771398 1187 559 368 320 299 265 ------
NM_174955chr1771343 1132 504 313 265 244 210 ------
NM_174956chr1771398 1187 559 368 320 299 265 ------
NM_174957chr1771387 1176 548 357 309 288 254 ------
NM_175061chr7142 ------
NM_175607chr321160 248 ------
NM_175610chr151886 ------
NM_175612chr321160 248 ------
NM_175629chr2126 ------
NM_175634chr81307 1853 1871 --
NM_175635chr81307 1853 1871 --
NM_175636chr81307 1853 1871 --
NM_175709chr2262344 2202 1174 1134 861 305 --12067 --
NM_175733chr1121869 445 1730 11933 --
NM_175747chr62901 211 ------
NM_175767chr52708 163 ----11671
NM_175848chr204991 468 280 173 1483 ----
NM_175848chr204991 468 280 173 1483 ----
NM_175849chr204991 468 280 173 1483 ----
NM_175849chr204991 468 280 173 1483 ----
NM_175850chr204991 468 280 173 1483 ----
NM_175850chr204991 468 280 173 1483 ----
NM_175852chr131088 307 40 --13003 --
NM_175854chr1321842 398 ------
NM_175856chr51191 ------
NM_175861chr1275619 4762 3738 1542 1515 1428 152 14044 ----
NM_175863chr611055 ------
NM_175866chr1--1483 ----
NM_175873chr531464 291 125 1337 ----
NM_175895chr1241053 388 306 209 ------
NM_175898chr154544 278 228 73 ------
NM_175920chr51185 ------
NM_176814chr71215 ------
NM_176863chr1711466 ------
NM_177438chr1434120 3420 3347 ------
NM_177553chr11--1864 ----
NM_177559chr202447 65 ------
NM_177560chr202447 65 ------
NM_177952chr141751 ------
NM_177968chr21454 ------
NM_177990chr2032002 1769 415 ------
NM_177996chr2052771 2358 2222 905 230 ------
NM_177999chr982538 2426 1131 946 940 858 742 356 --31186 601 400 --
NM_178010chr1211816 --11719 --
NM_178011chr1033055 2898 919 ------
NM_178037chr1232927 2920 1277 --2229 191 --
NM_178038chr1232927 2920 1277 --2229 191 --
NM_178126chr172888 411 ------
NM_178151chrX87785 7303 6602 5863 5041 1708 1611 240 27132 1856 21819 492 --
NM_178152chrX87785 7303 6602 5863 5041 1708 1611 240 27132 1856 21819 492 --
NM_178153chrX87785 7303 6602 5863 5041 1708 1611 240 27132 1856 21819 492 --
NM_178190chr1----167 --
NM_178191chr1----11408 --
NM_178423chr71148 ------
NM_178425chr71148 ------
NM_178426chr112058 11511 ----
NM_178427chr111958 11411 ----
NM_178441chr143384 378 158 ------
NM_178450chr51494 ------
NM_178500chr172633 278 ------
NM_178502chr121612 ------
NM_178505chr102929 333 127 13437 --
NM_178509chr1773981 2876 2818 1117 961 785 635 ------
NM_178562chr72824 283 ----1646
NM_178565chr811280 ------
NM_178568chr1761265 1171 1139 700 553 329 ------
NM_178578chr2042269 1760 735 176 ------
NM_178583chr4--1200 ----
NM_178585chr41269 --12383 --
NM_178812chr831567 606 488 ------
NM_178815chr103933 140 80 12565 ----
NM_178830chr193681 189 27 ------
NM_178835chr43865 618 608 2305 221 ----
NM_178860chr17124 ------
NM_180976chr63941 935 102 ------
NM_180977chr63941 935 102 ------
NM_181050chr162257 205 ------
NM_181054chr142503 92 ------
NM_181077chr1521772 792 11983 1731 --
NM_181093chr1----1463 --
NM_181332chrX32666 350 154 ------
NM_181349chr752812 2022 634 516 453 12557 11129 --
NM_181351chr1142758 913 625 50 ------
NM_181358chr154208 3263 2746 1101 521 1283 1707 --
NM_181442chr201134 1825 ----
NM_181443chr2062778 2610 2562 2449 852 22 ------
NM_181458chr221249 118 ------
NM_181460chr211062 ------
NM_181481chr1836073 4381 2449 11531 ----
NM_181482chr1836073 4381 2449 11531 ----
NM_181483chr1836073 4381 2449 11531 ----
NM_181486chr121170 ------
NM_181492chr2221076 939 --1871 --
NM_181504chr522693 1101 --13556 --
NM_181523chr522693 1101 --13556 --
NM_181524chr522693 1101 --13556 --
NM_181528chr20166 ------
NM_181552chr72686 26 --1872 --
NM_181571chr102263 28 1164 ----
NM_181645chr111294 ----1140
NM_181656chr17123 1142 167 1921
NM_181659chr2033028 2422 709 ------
NM_181659chr2033028 2422 709 ------
NM_181670chr121415 ------
NM_181672chrX11488 ------
NM_181673chrX11488 ------
NM_181689chr202749 26 ------
NM_181696chr1138 ------
NM_181697chr1138 ------
NM_181701chr991990 1960 1588 887 789 596 422 69 46 --1869 --
NM_181712chr121973 1355 ------
NM_181713chr21876 ------
NM_181714chr62504 424 21630 138 ----
NM_181715chr11326 ------
NM_181782chr6----22017 537 --
NM_181784chr222262 628 ------
NM_181809chr152969 1428 1255 1020 673 1492 13697 --
NM_181836chr542193 2151 1692 256 ------
NM_181839chr81289 ------
NM_181861chr124999 701 390 161 --12599 --
NM_181868chr124999 701 390 161 --12599 --
NM_181869chr1241084 786 475 246 --12684 --
NM_181876chr42197 128 12092 1773 --
NM_181886chr431122 1084 1056 ------
NM_181887chr431122 1084 1056 ------
NM_181888chr431122 1084 1056 ------
NM_181889chr431122 1084 1056 ------
NM_181890chr431122 1084 1056 ------
NM_181891chr431122 1084 1056 ------
NM_181892chr431169 1131 1103 ------
NM_181893chr431122 1084 1056 ------
NM_182481chr2121037 411 --21302 1027 --
NM_182482chr2121037 411 --21302 1027 --
NM_182485chr43838 690 403 ------
NM_182493chr1634899 3809 2158 ------
NM_182507chr1242013 726 683 75 --1785 --
NM_182526chr1482608 1259 1185 917 722 519 500 205 --23033 2815 --
NM_182527chr2212172 --11726 --
NM_182557chr112898 183 --41701 1579 546 166 --
NM_182580chr112326 --12024 --
NM_182641chr1711414 ------
NM_182643chr822396 734 ------
NM_182645chr6----1687 --
NM_182646chr43838 690 403 ------
NM_182678chr23484 345 185 ------
NM_182685chr13632 621 564 ------
NM_182691chr711424 --11055 --
NM_182692chr711424 --11055 --
NM_182697chr731495 1113 222 ------
NM_182700chr761481 1353 754 731 629 429 --11666 --
NM_182717chr101433 1569 ----
NM_182718chr102263 28 1164 ----
NM_182719chr102263 28 1164 ----
NM_182720chr101433 1569 ----
NM_182721chr101433 1569 ----
NM_182722chr101433 1569 ----
NM_182723chr101433 1569 ----
NM_182724chr102263 28 1164 ----
NM_182725chr102263 28 1164 ----
NM_182760chr31767 ------
NM_182763chr122403 57 ------
NM_182765chr103756 533 479 ------
NM_182767chr1231622 485 414 ------
NM_182769chr102263 28 1164 ----
NM_182770chr102263 28 1164 ----
NM_182771chr102263 28 1164 ----
NM_182772chr102263 28 1164 ----
NM_182789chr5136 ------
NM_182811chr2041030 978 437 92 ----1944
NM_182830chr14--12027 ----
NM_182831chr1661676 226 172 70 31 25 ------
NM_182850chr102263 28 1164 ----
NM_182853chr101433 1569 ----
NM_182898chr744861 4532 1922 1457 15021 ----
NM_182899chr744861 4532 1922 1457 15021 ----
NM_182935chr32703 174 ------
NM_182943chr3--11165 ----
NM_182948chr12468 345 23117 92 22607 2020 --
NM_182961chr6135 --2492 117 --
NM_182964chr1123002 1279 --12290 --
NM_182970chr2054294 3387 3369 2864 1479 --21158 470 1442
NM_182972chr122426 2273 ----12026
NM_182976chr11547 ------
NM_183011chr101433 1569 ----
NM_183012chr101433 1569 ----
NM_183013chr101433 1569 ----
NM_183049chr41319 ------
NM_183060chr102263 28 1164 ----
NM_183078chr653489 3034 933 462 302 --13069 --
NM_183238chr1233501 768 99 33026 1112 840 32551 821 754 --
NM_183323chr5136 ------
NM_183353chrX31103 239 29 ------
NM_183376chr1522317 629 ------
NM_183381chr3--1636 ----
NM_183383chr3--1636 ----
NM_183384chr3--1636 ----
NM_183393chr31685 ------
NM_183394chr31685 ------
NM_183398chr511184 ------
NM_183399chr511184 ------
NM_183400chr511184 ------
NM_183401chr511184 ------
NM_183416chr11835 11351 1196 --
NM_183419chr81538 11226 1589 --
NM_183422chr131251 ------
NM_183425chr2041619 1382 575 277 --11518 11717
NM_184231chr32667 29 ------
NM_194247chr273753 3330 1718 554 444 286 162 1223 ----
NM_194272chr1531001 319 89 --11042 --
NM_194278chr1443755 2733 1114 188 23126 1402 1154 --
NM_194282chr411070 ------
NM_194285chr1132645 2604 1200 13089 ----
NM_194292chr1----31496 1276 152 --
NM_194301chr141158 ------
NM_194328chr922377 2294 --1728 2482 347
NM_194329chr922377 2294 --1728 2482 347
NM_194330chr922377 2294 --1728 2482 347
NM_194332chr922377 2294 --1728 2482 347
NM_194358chr12161 ------
NM_194359chr12161 ------
NM_194434chr1812315 --1528 --
NM_194442chr121545 569 --11198 --
NM_194463chrX1331 ------
NM_197939chr171966 --1185 --
NM_197941chr552381 2318 1046 708 396 --12120 --
NM_197970chr211156 ------
NM_198040chr11365 --1995 --
NM_198043chr10----174 --
NM_198044chr10----174 --
NM_198045chr10----174 --
NM_198046chr10----174 --
NM_198057chrX11257 ------
NM_198066chr1422544 2103 ------
NM_198081chr622023 1180 ------
NM_198086chr141626 ------
NM_198123chr811584 ------
NM_198124chr811584 ------
NM_198128chr1821538 940 ------
NM_198215chr101201 ------
NM_198217chr131145 ------
NM_198218chr131145 ------
NM_198219chr131145 ------
NM_198225chr1031663 1590 1292 ------
NM_198236chr1------1113
NM_198268chr154208 3263 2746 1101 521 1283 1707 --
NM_198269chr154208 3263 2746 1101 521 1283 1707 --
NM_198270chrX32385 204 104 ------
NM_198273chr52374 182 ------
NM_198275chr11------166
NM_198336chr71272 --2561 184 --
NM_198390chr1611905 ------
NM_198400chr1521890 668 1511 1356 --
NM_198401chr821106 103 ------
NM_198463chr3154 ------
NM_198465chrX2164 49 ----12002
NM_198467chr71121 ------
NM_198472chr101260 --1219 --
NM_198504chr31288 ------
NM_198513chr821277 553 ------
NM_198516chr111209 ------
NM_198546chr1----128 --
NM_198552chr13464 192 176 ------
NM_198560chr383212 2676 2546 2371 1507 1402 1180 684 --1711 --
NM_198569chr622604 2204 ------
NM_198581chr276536 5593 5264 4967 1490 812 513 ------
NM_198597chr101253 --1829 --
NM_198679chr952321 2243 621 484 215 --150 --
NM_198681chr151320 1214 1183 500 216 ------
NM_198793chr362566 2547 805 465 447 174 --13429 1458
NM_198794chr142540 161 ------
NM_198829chr721144 564 1413 1403 --
NM_198830chr172740 78 --1823 --
NM_198834chr172816 434 11415 ----
NM_198836chr172816 434 11415 ----
NM_198837chr172816 434 11415 ----
NM_198838chr172816 434 11415 ----
NM_198839chr172816 434 11415 ----
NM_198859chr323903 3426 --24231 1588 --
NM_198896chr112629 484 ------
NM_198902chr151129 ------
NM_198935chr2042540 488 67 35 --2784 71 --
NM_198956chr761481 1353 754 731 629 429 --11666 --
NM_198991chr182274 78 ------
NM_199000chr7------1426
NM_199003chr8----1172 --
NM_199039chr421108 214 ------
NM_199051chr11340 ------
NM_199131chr1061128 1108 742 635 578 290 ------
NM_199132chr1921588 726 ------
NM_199168chr1021401 208 1308 ----
NM_199188chr1221367 90 ------
NM_199190chr1221367 90 ------
NM_199192chr2171 ------
NM_199193chr2171 ------
NM_199229chr2--1114 ----
NM_199244chr92994 163 ------
NM_199262chr1742267 1970 903 300 ------
NM_199282chr17255 24 --2455 172 --
NM_199320chr41513 --1751 --
NM_199320chr41513 --1751 --
NM_199324chr453116 2714 1283 613 92 ------
NM_199359chr203628 531 64 ------
NM_199360chr203628 531 64 ------
NM_199361chr203628 531 64 ------
NM_199362chr203628 531 64 ------
NM_199363chr203628 531 64 ------
NM_199421chr1444692 3689 1563 96 21720 837 ----
NM_199424chr1661798 1376 1322 1221 195 173 ------
NM_199440chr2157 ------
NM_199454chr134537 3415 1083 --23972 2983 --
NM_199462chr164690 4375 3656 3553 3127 196 --13303 --
NM_199478chrX1553 ------
NM_201266chr2--12912 ----
NM_201279chr2--12912 ----
NM_201428chr111282 1508 11211 --
NM_201429chr111282 1508 11211 --
NM_201430chr111208 1434 11137 --
NM_201535chr141569 --1648 --
NM_201536chr141569 --1648 --
NM_201537chr141569 --1648 --
NM_201538chr141569 --1648 --
NM_201539chr141569 --1648 --
NM_201540chr141569 --1648 --
NM_201541chr141569 --1648 --
NM_201542chr1150 ------
NM_201567chr31244 ------
NM_201568chr122213 92 --11907 --
NM_201569chr122213 92 --11907 --
NM_201570chr10----1265 --
NM_201571chr10----1265 --
NM_201572chr10----1265 --
NM_201590chr10----1265 --
NM_201593chr10----1265 --
NM_201596chr10----1265 --
NM_201597chr10----1265 --
NM_201624chr11350 --11269 --
NM_201627chr51338 ------
NM_201630chr1----1124 --
NM_201633chr52333 259 ------
NM_201999chr42269 41 --1935 --
NM_203318chr173830 277 21 ------
NM_203342chr183616 3529 3520 3364 3078 2479 1428 1402 --22836 2229 --
NM_203343chr183616 3529 3520 3364 3078 2479 1428 1402 --22836 2229 --
NM_203346chr241608 1577 601 83 --1816 --
NM_203349chr1521964 339 ------
NM_203351chr1752225 1629 710 278 115 --22216 1826 --
NM_203399chr1--1227 ----
NM_203401chr1--1227 ----
NM_203406chr5--1921 ----
NM_203417chr2121036 95 ------
NM_203418chr2121036 95 ------
NM_203446chr2132507 1958 1838 ------
NM_203454chr13989 258 234 --1485 --
NM_203458chr142612 1532 1326 547 ------
NM_203459chr112166 ------
NM_203463chr244232 3978 574 75 --13887 --
NM_203487chr1311625 ------
NM_203499chr171323 ------
NM_203504chr432057 737 29 ------
NM_203505chr432057 737 29 ------
NM_205768chr131421 648 517 ------
NM_205846chr511129 --1133 1353
NM_205860chr133030 1969 728 --1574 --
NM_205861chr131743 1467 1353 11695 --1463
NM_206594chr123336 148 ------
NM_206595chr123336 148 ------
NM_206827chr13--149 ----
NM_206839chr15--1594 ----
NM_206853chr62844 272 ------
NM_206854chr632105 1533 32 ------
NM_206855chr622498 997 --1529 --
NM_206860chr101325 ------
NM_206861chr101325 ------
NM_206862chr101325 ------
NM_206884chr7127 ------
NM_206885chr7127 ------
NM_206886chr1172 ------
NM_206907chr543082 2695 1257 621 ------
NM_206909chr8117912 7510 6801 6583 5664 5371 1860 1775 1065 1059 551 --1539 --
NM_207042chr11608 ------
NM_207045chr11608 ------
NM_207046chr11608 ------
NM_207121chr202446 360 --1488 --
NM_207123chr42929 832 ------
NM_207292chr313069 12996 ----
NM_207293chr313069 12996 ----
NM_207294chr313069 12996 ----
NM_207295chr313069 12996 ----
NM_207296chr313069 12996 ----
NM_207297chr313094 13021 ----
NM_207299chr91159 ------
NM_207325chr1941637 1477 1303 91 12029 1452 --
NM_207371chr102996 479 ------
NM_207396chr161807 1518 1331 1298 522 218 ------
NM_207406chr475800 5760 2210 1768 1510 749 28 ------
NM_207429chr1122062 514 ------
NM_207442chr1431045 845 823 ------
NM_207520chr21104 ------
NM_207521chr21104 ------
NM_207577chr1172168 2074 1085 1057 973 323 211 ------
NM_207647chr91244 159 11668 --
NM_212460chr711518 1446 ----
NM_212469chr113983 736 51 ------
NM_212471chr1731867 270 110 ------
NM_212472chr1731867 270 110 ------
NM_212543chr35738 606 591 584 553 ------
NM_212551chr1----1166 --
NM_212554chr1011500 ----1124
NM_212558chr933183 2852 218 1650 ----
NM_213589chr255282 4731 2041 1514 1365 ------
NM_213590chr133491 149 22 --12074 11305
NM_213662chr1722175 425 --136 --