TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-22-5p
miRNA Sequence: AGUUCUUCAGUGGCAAGCUUUA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000051chr1183380 3102 3011 2995 2664 1324 508 433 22856 187 12277 1612
NM_000084chrX115963 5737 5302 4718 4595 4522 4450 2696 778 478 186 35511 4978 238 --135
NM_000112chr5114858 4728 4668 4529 4408 4299 1101 1079 716 421 199 35327 4552 3755 122 14893
NM_000125chr6114299 4235 2962 2841 2820 1617 1430 1320 1251 455 421 52968 2677 1154 1060 405 ----
NM_000163chr542116 226 45 23 --32015 1860 176 11879
NM_000208chr19124683 4444 3531 3192 1910 1764 1717 1684 1440 977 531 458 74495 4216 4176 3870 3276 1786 1345 14456 --
NM_000216chrX73250 1633 1533 1359 1202 700 225 22595 1461 2660 139 21004 236
NM_000217chr12105278 5190 4860 4511 4311 4151 3936 3495 3412 1621 45256 4263 4157 1399 ----
NM_000245chr742153 2004 1959 361 22060 1982 11849 1836
NM_000259chr15125292 4792 4534 1330 1031 423 400 289 275 266 255 52 --15412 --
NM_000297chr472025 1333 746 737 531 401 40 21539 1415 21932 1449 --
NM_000332chr6186856 6797 6386 6116 6088 5088 4514 2506 2414 2047 1521 1466 1078 532 340 264 258 212 55576 4807 2674 706 599 46970 6876 6787 5335 11289
NM_000337chr5156142 6072 5719 5304 4391 4173 4144 4005 2358 1961 1566 1434 994 551 237 46171 5331 2468 940 ----
NM_000362chr22103500 3366 3349 2842 2658 2608 1132 597 443 256 1431 33358 2230 263 --
NM_000368chr9154660 4338 4141 3748 3542 3533 3098 2938 1863 1438 1385 1339 1200 1086 818 33986 3433 1432 34468 4177 865 34523 3551 572
NM_000376chr12122965 2878 2787 2741 2475 2254 2080 1043 955 908 612 349 12411 22184 959 1643
NM_000379chr231077 547 358 21424 541 11134 21435 63
NM_000390chrX83426 2804 2578 1197 916 673 666 656 2428 169 172 --
NM_000439chr572371 1945 941 793 481 387 379 22350 1699 ----
NM_000533chrX112009 1721 1650 1559 723 560 526 506 498 395 371 21766 1452 ----
NM_000555chrX157793 7404 6762 5990 2997 2253 2221 2115 1368 1132 1046 675 569 459 420 37153 6952 2241 22257 1924 21081 481
NM_000599chr2143859 3704 3416 3342 3228 2978 1719 1710 520 320 302 289 272 134 --44467 3693 1829 281 31582 1539 376
NM_000610chr1192987 2751 2693 2500 2057 1173 1136 388 230 42870 2798 2792 351 1764 --
NM_000615chr1152596 2310 2079 332 318 --11090 22072 1914
NM_000618chr12126476 5252 4667 4500 4341 4113 4001 1673 1195 1127 302 25 44246 4123 3994 677 34764 4041 1074 --
NM_000618chr12126476 5252 4667 4500 4341 4113 4001 1673 1195 1127 302 25 44246 4123 3994 677 34764 4041 1074 --
NM_000633chr1885254 4030 3177 883 619 572 474 426 34004 1244 1127 34150 4114 4034 31275 677 408
NM_000719chr12226724 5827 5791 5691 5664 5629 5525 5476 5437 5131 5125 4995 4128 2434 2298 2121 1565 806 436 329 235 172 22277 2041 ----
NM_000793chr14164952 4819 4690 4215 3795 1839 1824 1613 1342 1161 900 824 331 294 252 63 15157 13627 44150 3412 1300 130
NM_000806chr541433 438 239 103 2222 141 --1748
NM_000814chr1583779 3574 2867 2779 2754 2682 1594 1180 22938 1265 33122 3064 1625 --
NM_000817chr221258 1186 1207 --21228 126
NM_000827chr592289 2097 1864 1000 935 614 516 320 127 --3787 737 153 1669
NM_000831chr1195345 4771 4003 2316 2156 1600 1484 1471 1267 1248 1144 1133 1036 854 648 510 382 66 46 44995 1513 1493 732 11669 --
NM_000861chr372215 811 432 421 394 331 210 42314 2272 2146 2133 12553 1166
NM_000875chr15196926 6590 6507 6359 6301 6038 5640 5268 5236 5158 5031 4972 2105 1082 884 829 406 286 246 65674 5488 5419 2663 2280 990 --14487
NM_000899chr12114412 3406 2827 2789 1656 1566 1356 912 741 300 253 23528 751 1223 1783
NM_000902chr373156 2874 2630 2212 1245 490 183 --12199 32296 396 375
NM_000912chr893355 3098 2953 2519 1379 1094 563 526 40 33448 3024 185 ----
NM_001001331chr3102728 2496 2229 2104 2080 2066 1963 1924 1820 1698 1850 42455 2133 792 582 --
NM_001001344chrX111937 1644 994 917 701 294 272 246 237 216 159 22582 824 1321 --
NM_001001389chr1192987 2751 2693 2500 2057 1173 1136 388 230 42870 2798 2792 351 1764 --
NM_001001390chr1192987 2751 2693 2500 2057 1173 1136 388 230 42870 2798 2792 351 1764 --
NM_001001391chr1192987 2751 2693 2500 2057 1173 1136 388 230 42870 2798 2792 351 1764 --
NM_001001392chr1193033 2797 2739 2546 2103 1219 1182 434 276 42916 2844 2838 397 1810 --
NM_001001395chr1271999 1992 1136 971 471 88 76 22438 27 12699 --
NM_001001396chr1104400 3937 2953 2747 1428 1218 965 433 127 118 21043 442 12960 13164
NM_001001419chr5165199 4944 4852 4737 4184 3827 3747 3527 2012 1990 1836 1771 1180 1113 815 375 13624 23755 1486 14414
NM_001001420chr5165199 4944 4852 4737 4184 3827 3747 3527 2012 1990 1836 1771 1180 1113 815 375 13624 23755 1486 14414
NM_001001481chr883478 3433 3071 3026 2878 2287 2277 573 12539 12958 --
NM_001001549chr762732 2536 2436 2173 54 34 22261 299 11741 32289 2086 79
NM_001001550chr762732 2536 2436 2173 54 34 22261 299 11741 32289 2086 79
NM_001001555chr762732 2536 2436 2173 54 34 22261 299 11741 32289 2086 79
NM_001001557chr8121891 1796 1713 1576 1456 1422 1371 848 822 721 457 91 1593 2627 461 --
NM_001001664chr293473 3280 3114 1423 1197 1167 704 677 59 12717 32898 767 497 --
NM_001001665chr2103307 2826 2754 1292 1107 995 498 468 454 85 21055 916 12891 --
NM_001001928chr22108005 7894 7633 7125 2845 2320 1780 779 580 569 45912 3044 1587 185 28108 999 11840
NM_001002814chr8153808 3545 3483 3448 3372 3138 3044 2989 2449 1299 1201 997 732 424 67 13187 33704 3074 756 12839
NM_001003407chr10134686 4245 3917 3847 3708 1642 1616 1398 1375 442 347 89 33 21681 698 14906 13312
NM_001003408chr10134686 4245 3917 3847 3708 1642 1616 1398 1375 442 347 89 33 21681 698 14906 13312
NM_001003652chr18178138 8000 7854 7601 7323 6446 5429 3480 2960 2468 1908 1882 1778 860 848 582 218 26757 6059 37224 7077 3104 15846
NM_001003674chr18156433 5770 5544 4882 4503 4321 2829 2684 2076 1700 1460 527 396 269 30 66070 5986 5691 4270 1663 1477 66494 5800 4299 2251 1299 427 11504
NM_001003675chr18156433 5770 5544 4882 4503 4321 2829 2684 2076 1700 1460 527 396 269 30 66070 5986 5691 4270 1663 1477 66494 5800 4299 2251 1299 427 11504
NM_001003679chr121682 88 11733 --21963 1504
NM_001003712chr1254089 4019 1518 1079 175 --23578 1577 13107
NM_001003760chr673415 3011 2903 1385 1034 949 793 13609 1830 132
NM_001003800chr973657 3568 3338 3270 2426 1259 1086 23773 3728 23031 2780 1592
NM_001003937chr241406 1320 1150 364 --11204 21354 452
NM_001004065chr993655 3160 2624 2577 1107 1022 685 535 216 63737 3588 2779 765 585 279 11026 1353
NM_001004330chr12111444 1371 1360 1293 1164 640 328 276 198 166 99 21717 1341 ----
NM_001004419chr12174201 4085 3936 3773 2977 1576 1527 1420 1126 1109 1100 968 943 718 436 149 39 44378 3435 1219 476 11367 13678
NM_001005473chr5196334 5922 4666 2243 1913 1890 1206 1194 1069 1049 1017 1001 988 968 956 939 886 665 37 36148 4197 2482 25568 993 35944 1448 982
NM_001005502chr12175247 5140 4587 4041 3774 3541 3246 1547 1475 1204 789 782 593 340 183 125 103 14617 ----
NM_001007023chr14164952 4819 4690 4215 3795 1839 1824 1613 1342 1161 900 824 331 294 252 63 15157 13627 44150 3412 1300 130
NM_001007094chr1084149 4042 3578 3066 1115 954 379 107 33664 2888 70 13801 13731
NM_001007466chr6124297 4105 3887 3626 3434 1973 1658 1498 941 750 141 98 24149 3687 13696 --
NM_001009554chr484268 3772 3663 3227 1458 1073 337 139 34430 4371 3681 ----
NM_001009554chr484268 3772 3663 3227 1458 1073 337 139 34430 4371 3681 ----
NM_001009894chr1261631 1479 1281 669 631 121 11684 21127 689 --
NM_001009899chr366003 5956 5792 2600 1854 84 36366 2490 1944 24735 1302 26102 2531
NM_001009993chr2114540 4266 3952 3303 3049 2775 1414 1094 1076 990 895 13492 ----
NM_001010846chr1124207 4117 3400 3305 3293 2822 1832 1485 993 972 769 723 --23153 1792 13733
NM_001010891chr5196883 5532 4915 4885 4664 2496 2111 2085 1903 1703 1280 786 693 537 506 475 265 238 122 11046 --11036
NM_001011513chr472598 1583 1467 155 121 38 23 1867 22850 296 --
NM_001011537chr382127 1709 1574 863 753 698 280 58 21761 183 1887 1775
NM_001011657chrX7459 384 333 261 211 167 84 3908 204 72 --1223
NM_001011666chr7156540 6370 6251 6058 5949 5037 4924 4913 4014 2488 1994 1981 1949 1296 1210 25158 1900 34928 2170 33 16072
NM_001011708chr262970 2474 1976 737 712 258 ----1596
NM_001012393chr11164625 4380 4361 4288 4102 3869 3750 3726 3487 3180 1790 1682 1452 1409 1379 424 --31831 1742 1234 11324
NM_001012418chr6113343 2967 2900 2717 1636 1249 1219 1028 478 418 27 13370 --34271 4020 184
NM_001012420chr15102764 2261 1082 1066 832 707 640 555 31 21 --12473 --
NM_001012755chrX54478 1942 589 405 131 54498 4028 3542 643 163 1620 14881
NM_001013620chr12158307 8174 7895 7853 6304 6152 5929 5393 3262 2844 2755 2719 2638 361 176 46584 1214 1048 62 22606 880 16700
NM_001013659chr19155354 4991 4978 4574 4426 4174 3712 3342 3308 1965 1499 1297 1112 882 364 34318 4003 1543 --25312 4028
NM_001013746chr772192 1646 1590 1531 936 297 151 32153 2147 1460 5483 403 385 319 66 --
NM_001014380chr1375031 4346 1187 784 604 466 52 --24131 446 2711 144
NM_001014797chr10208106 8019 8012 7341 7018 6844 6775 6534 6272 6068 5925 5302 5107 5076 4972 4962 3298 1547 527 243 36518 5764 869 12073 13137
NM_001017440chr7298057 7678 7652 7635 7311 7180 7152 6985 6962 6951 6839 6687 6583 6493 6456 6141 5873 5555 5512 5453 5101 3041 2608 2566 2433 1832 1289 479 137 47039 6350 5434 3119 --36125 2691 2361
NM_001017535chr12122965 2878 2787 2741 2475 2254 2080 1043 955 908 612 349 12411 22184 959 1643
NM_001017995chr5134019 3661 1491 1232 1078 1003 993 951 804 515 499 352 268 54765 4604 3705 3553 977 13584 --
NM_001018090chr1572798 2204 2062 2027 795 522 453 --32397 597 570 11108
NM_001018102chr1572798 2204 2062 2027 795 522 453 --32397 597 570 11108
NM_001018111chr793882 3579 3481 3461 3315 2917 2767 2581 326 43516 1033 863 382 --32930 2593 1116
NM_001024647chr12177579 7146 6222 5958 5576 5547 5324 5236 2915 2613 2415 2143 1642 1500 839 565 497 56564 2451 2035 1586 1450 45644 1979 1819 203 --
NM_001024948chr1153222 3120 2774 2128 1328 1308 1295 1111 927 900 851 551 466 257 41 ------
NM_001025077chr10137464 6801 6465 5941 5789 5460 3044 2247 2116 986 523 513 430 37392 6441 942 ----
NM_001025252chr8123149 2979 2953 2709 2643 2458 2421 2358 2343 2221 2034 488 ------
NM_001025253chr8123149 2979 2953 2709 2643 2458 2421 2358 2343 2221 2034 488 ------
NM_001025580chrX84150 3766 3239 1474 848 784 730 415 13136 --1883
NM_001025616chr46669 595 438 272 119 41 ----21334 501
NM_001030007chr16203937 3702 3640 3526 3272 3185 2773 2610 2497 1516 1391 1020 960 719 694 638 308 115 57 46 12616 ----
NM_001030288chr16114857 4597 3846 1970 1955 1811 1216 1176 1096 746 734 25279 4976 45471 2174 1864 1791 1739
NM_001031685chr14288 149 140 52 1857 3158 127 33 --
NM_001031695chr22165402 5215 4822 4314 3978 3660 3541 1985 1396 1093 1008 579 454 347 332 99 1146 180 13490
NM_001031732chr493476 3302 3087 2921 2511 873 252 168 123 11411 --13061
NM_001033507chr151920 1436 1315 1274 94 1251 --21323 384
NM_001033551chr1763907 1576 1498 1304 950 345 2701 351 1266 33499 1593 464
NM_001033925chr1031923 529 499 2597 371 --21963 154
NM_001034841chr16135551 5086 4883 4760 3853 3659 2099 1105 963 328 320 290 248 24008 1317 --1533
NM_001039479chr1462465 2302 911 735 576 246 2945 590 1671 21490 728
NM_001039547chr3147948 7304 7058 6095 5669 5321 5165 5090 3057 2242 1139 938 909 100 51109 702 459 326 250 --16125
NM_001039615chr8122145 1878 928 843 736 652 615 320 245 230 190 24 ------
NM_001039618chr11135918 5569 4215 4004 2378 2274 2078 1442 1379 1098 921 914 462 ------
NM_001039693chr2104061 3431 2740 1542 1345 1134 857 472 330 164 14003 23607 782 --
NM_001039762chr10102133 1967 1848 1826 1793 1656 1611 833 501 402 21818 842 1429 --
NM_001039840chrX155988 5869 5777 5215 4887 4368 4300 4237 3959 2054 1613 1200 1096 744 153 65839 5725 5164 2099 471 456 ----
NM_001039937chr1343765 3225 1440 1183 13282 11533 33230 1464 478
NM_001040108chr14103238 3139 3033 2923 2776 2709 2601 2195 2117 1245 32942 611 28 23279 3091 13039
NM_001040142chr262383 2168 1701 611 277 191 22321 2201 --1246
NM_001040143chr262383 2168 1701 611 277 191 22321 2201 --1246
NM_001040152chr7114861 4227 4116 4087 4072 3594 3575 3391 781 203 196 14423 ----
NM_001040214chr63589 302 44 1684 12236 21682 81
NM_001040429chr13113351 2859 2266 2231 1412 1076 738 342 296 264 97 1591 1300 --
NM_001040441chr1145315 5198 4644 3815 3418 2032 1896 1733 1383 1199 1042 967 563 211 34180 1310 448 --13450
NM_001040450chr15102836 2652 2354 2095 1924 1795 808 733 68 60 22534 497 ----
NM_001040453chr15102836 2652 2354 2095 1924 1795 808 733 68 60 22534 497 ----
NM_001042355chr16155114 4902 4802 4623 4603 4431 4385 4089 3747 1886 1716 1663 1291 801 425 15269 ----
NM_001042412chr16155114 4902 4802 4623 4603 4431 4385 4089 3747 1886 1716 1663 1291 801 425 15269 ----
NM_001042473chr1032119 422 187 11647 2683 516 1273
NM_001042533chr392779 2403 2239 1236 714 583 565 340 322 22757 184 11229 --
NM_001042555chr1274438 4252 1579 1445 712 629 456 34373 3713 181 --11706
NM_001042599chr2197729 7654 7513 6535 6352 5458 3018 2732 2425 2264 1659 1349 1242 1198 1031 936 567 421 244 64894 2817 2348 1667 1642 484 2264 202 14829
NM_001042601chr3102621 2567 2397 2316 2101 1277 1143 1010 947 43 22644 2404 ----
NM_001042603chr12115380 5267 4993 4673 4555 4474 3985 1816 1136 825 703 34305 3296 1635 44884 3989 707 613 2782 597
NM_001042604chr3114279 4077 3942 3235 3094 1851 1255 926 721 498 402 --13102 --
NM_001042669chr46669 595 438 272 119 41 ----21334 501
NM_001044385chr293967 3473 3346 2981 2782 2598 1083 980 22 13188 --13947
NM_001045556chr8141555 1366 1304 1273 1248 1170 1119 678 563 533 419 387 343 178 138 2666 255 1297
NM_001045557chr8141555 1366 1304 1273 1248 1170 1119 678 563 533 419 387 343 178 138 2666 255 1297
NM_001099678chr3156150 5595 5413 5330 5212 4925 4212 3982 2499 1802 1594 1129 947 348 167 66461 6035 5810 4469 2430 2265 --1297
NM_001100108chr1207748 7530 7417 7223 6564 6328 5601 5316 2827 2769 2456 2167 1883 1327 1313 1055 964 637 533 56 47602 7289 6383 1965 12253 --
NM_001106chr3279748 9721 8942 8910 8743 8404 7864 7490 7483 7435 7351 6748 6680 3724 3514 3493 3023 2561 2015 1939 1827 1820 1418 800 787 469 44 79544 8802 8787 8775 7157 2311 452 43443 756 427 295 --
NM_001113490chrX82995 2945 2634 2542 2416 1300 975 462 11292 13542 1353
NM_001117chr1892337 1835 1778 1662 1570 907 768 695 525 21797 241 1780 1888
NM_001123chr102714 82 1245 --2804 781
NM_001128chr16203937 3702 3640 3526 3272 3185 2773 2610 2497 1516 1391 1020 960 719 694 638 308 115 57 46 12616 ----
NM_001167chrX106201 5021 4208 4120 2597 2431 2423 2337 1713 1596 24284 240 --11557
NM_001201chr483892 3489 2990 2449 1554 696 338 176 42467 728 392 294 ----
NM_001204chr2137715 7307 6121 5012 3034 2818 2268 1691 1247 1210 735 699 655 35405 5267 1946 15957 --
NM_001256chr17132734 2639 2579 2242 1916 1159 1004 860 655 633 448 322 302 12562 --22247 865
NM_001259chr7156109 5890 4867 4858 4242 4201 4147 4052 4003 3905 2492 1809 684 260 240 32026 883 498 11945 22020 39
NM_001278chr1031115 403 108 ----2490 153
NM_001289chrX3631 490 129 184 1518 11438
NM_001292chr1571038 742 721 370 359 190 76 3696 309 171 1725 2384 81
NM_001304chr1763293 2682 964 375 106 81 --1686 166
NM_001346chr38954 844 791 708 663 585 430 154 --42781 2097 1816 1035 22726 2184
NM_001364chr11123919 3065 2977 1539 1321 1309 1168 568 526 480 211 162 21798 883 --248 36
NM_001420chr1972212 2021 1983 1057 630 588 310 43075 2165 1936 1079 --1443
NM_001438chr193259 2945 2841 2800 1425 1007 672 565 73 33363 2225 942 --1991
NM_001460chr1123047 2611 2448 1343 1336 1268 1113 763 339 265 101 33 22979 69 ----
NM_001609chr10154512 4495 4209 4086 4062 4050 4011 3976 3827 3181 3148 2845 2811 1422 871 13157 23749 2913 12894
NM_001616chr252957 2478 2331 2288 1217 13173 1258 1195
NM_001650chr1883957 2904 2881 2707 2636 2624 989 176 53752 3600 3151 666 520 23794 169 --
NM_001683chr3102728 2496 2229 2104 2080 2066 1963 1924 1820 1698 1850 42455 2133 792 582 --
NM_001759chr12144441 4245 4148 3923 3746 3683 3603 3303 2098 1235 537 491 459 405 14068 11573 --
NM_001858chr674252 3237 1544 1380 1083 565 512 11368 34523 3432 1280 --
NM_001874chr12175247 5140 4587 4041 3774 3541 3246 1547 1475 1204 789 782 593 340 183 125 103 14617 ----
NM_001918chr1189121 9009 8228 8128 7588 7413 7380 6475 6020 3411 3301 3215 3012 2886 1812 1178 1162 485 47597 7467 2997 1472 27741 2547 --
NM_001973chr13303 40 26 1352 134 --
NM_002006chr474477 4008 3846 1651 1480 1212 42 13546 25631 4770 25004 4205
NM_002025chrX188745 8541 7984 7682 7494 6869 6449 6058 5893 5718 5629 2489 1997 1971 1338 681 388 320 48722 8062 7758 441 26125 3583 28599 805
NM_002035chr18113579 3553 3324 3018 2721 2712 2435 1517 1157 841 21 22887 286 1817 --
NM_002040chr2182860 2787 2513 2468 1942 1150 695 611 2600 574 ----
NM_002092chr4133728 3713 3468 3180 3134 1947 1736 1678 1573 1252 1127 474 174 13512 ----
NM_002214chr7115607 5520 4577 4403 3905 3767 3723 2138 1684 1126 413 45142 4253 485 343 13458 1292
NM_002264chr375033 4728 4369 4073 3542 1531 880 43848 1982 1808 1190 34743 4344 668 --
NM_002270chr595230 4220 4126 3474 1795 723 423 353 271 11063 1529 23538 389
NM_002313chr10134686 4245 3917 3847 3708 1642 1616 1398 1375 442 347 89 33 21681 698 14906 13312
NM_002334chr1171914 1864 1818 1570 486 468 415 31903 1652 1544 1494 11823
NM_002336chr12104779 3496 3291 1959 1837 1001 573 387 165 95 13115 --13398
NM_002350chr83781 278 54 11084 2883 860 1150
NM_002395chr641391 1329 999 270 --31395 1213 956 1141
NM_002427chr1131039 94 79 1218 31155 183 83 139
NM_002451chr9183926 3737 3719 3680 3647 3629 3621 3522 3279 2736 2681 1505 1039 522 349 341 199 23 --23544 3283 13596
NM_002481chr1237794 7606 7500 7472 7462 7305 7278 7089 6479 6037 5819 5758 5599 5491 5258 2915 2623 2564 2237 1050 566 257 24 37044 5219 1748 16228 1111
NM_002505chr671496 1475 1402 1116 1067 977 563 11568 --21545 345
NM_002545chr11164625 4380 4361 4288 4102 3869 3750 3726 3487 3180 1790 1682 1452 1409 1379 424 --31831 1742 1234 11324
NM_002547chrX143619 3151 3007 2856 2715 2615 2599 1638 1500 1464 1107 575 497 315 23659 1549 1255 1106
NM_002577chr3103701 3673 3339 1274 1151 1080 830 611 602 211 13822 ----
NM_002581chr9165442 5261 5215 4832 4685 4545 4425 1904 1685 1608 1357 1304 1267 628 465 26 53603 2233 2209 2133 1323 22246 152 --
NM_002610chr233026 1906 726 12651 12983 22570 1083
NM_002612chr781416 1324 1304 647 543 500 263 145 1300 32005 1420 174 --
NM_002613chr16115025 4720 4697 4584 3973 3638 3611 3529 998 882 155 34604 1224 182 14569 --
NM_002645chr1153030 2932 2675 1006 509 11190 22699 2621 --
NM_002655chr874529 1968 1857 1782 1658 1255 1161 15284 --14742
NM_002698chr1972838 2188 773 685 527 419 358 22179 1874 22100 1950 22919 2406
NM_002709chr263148 2549 2348 1365 1359 1046 32902 2879 43 22780 476 --
NM_002737chr17136471 6081 5447 5382 5239 4180 4154 2569 2485 2321 2284 1209 728 31103 434 186 --46411 6218 4610 2586
NM_002745chr2253683 3090 2813 1579 174 14362 --22895 1004
NM_002834chr12113160 3083 2860 2671 2603 1221 1078 609 422 289 231 33956 468 71 ----
NM_002837chr12104044 3970 3962 3857 3649 3441 1726 550 542 129 21757 967 ----
NM_002886chr395132 1782 1678 1659 1160 810 526 511 487 45211 4495 3738 1363 1500 --
NM_002977chr283294 3281 2945 2404 1256 209 198 73 13468 12576 --
NM_003010chr1792199 1934 1728 985 852 777 490 59 43 --1437 1382
NM_003034chr12208121 7843 7785 7176 6953 6155 5893 5863 5839 5703 5420 5052 3085 2038 1962 1239 1001 622 412 22 67641 7454 6197 2126 1073 980 21989 328 --
NM_003099chr15196461 5905 5513 5280 5201 4971 4945 4873 4838 4516 4498 4041 1989 1814 1038 970 748 621 316 35671 5442 1965 15327 24163 2242
NM_003108chr2136523 6420 6317 6066 5348 2709 2301 2231 661 566 557 146 60 16392 12184 12416
NM_003123chr16114857 4597 3846 1970 1955 1811 1216 1176 1096 746 734 25279 4976 45471 2174 1864 1791 1739
NM_003161chr1762919 2420 1045 979 611 350 21368 409 --23188 970
NM_003189chr163274 2776 2674 2141 2132 573 32941 2904 2879 11351 --
NM_003199chr1885693 5481 5215 4846 4770 2264 2062 444 12098 14892 1602
NM_003298chr386111 5436 5046 4862 4469 4376 4327 332 21535 1443 26115 4313 --
NM_003326chr1102366 2245 2202 1731 867 693 601 434 417 90 12551 1572 --
NM_003392chr394256 3467 3201 1654 998 762 695 150 109 --12842 1576
NM_003410chrX22401 1060 42850 2564 1071 582 11052 11917
NM_003412chr3113097 2658 2469 2355 2279 2164 1929 730 555 163 77 --22359 940 --
NM_003421chr1084149 4042 3578 3066 1115 954 379 107 33664 2888 70 13801 13731
NM_003441chr471371 1149 985 904 890 239 25 --3925 523 108 1194
NM_003471chr332354 686 420 1356 11535 2542 274
NM_003489chr21103286 3176 3140 3111 2649 2527 1097 1024 569 191 22444 75 12385 --
NM_003574chr1885594 5457 5448 5249 5161 1972 309 272 45416 4306 3907 3654 11459 25300 4979
NM_003615chr341577 963 271 262 23400 78 --1424
NM_003617chr184835 4776 4572 3711 3703 3694 3036 1864 43772 1648 1558 370 13316 --
NM_003618chr241100 868 383 282 21238 42 1925 --
NM_003659chr27906 871 847 482 407 377 282 31176 865 448 --1762
NM_003671chr993443 2560 2431 1380 831 695 582 136 28 11180 32564 760 354 --
NM_003672chr131212 527 516 1131 --21961 98
NM_003679chr163216 3170 2609 2380 2285 2097 12134 13001 1979
NM_003743chr292229 2111 1962 1590 1562 1432 651 406 358 11553 1334 1710
NM_003759chr4124263 3844 3549 3250 3027 2956 2761 1151 1138 673 495 339 34139 2997 2666 --1806
NM_003774chr1293267 2630 2300 1140 992 568 317 64 55 --12466 --
NM_003800chr652196 1716 45 38 31 22262 1970 ----
NM_003822chr1113140 2317 1256 1188 546 458 369 359 308 78 66 22257 2209 --171
NM_003983chr1674240 3279 3128 3061 1678 1330 309 44433 4213 3534 806 21529 1271 21005 859
NM_003994chr12114412 3406 2827 2789 1656 1566 1356 912 741 300 253 23528 751 1223 1783
NM_004028chr1883957 2904 2881 2707 2636 2624 989 176 53752 3600 3151 666 520 23794 169 --
NM_004087chr361927 1904 1802 1660 1629 249 1514 --11670
NM_004094chr1442192 971 646 564 42906 2499 253 33 --12448
NM_004113chr361818 1418 1353 580 371 96 21978 1389 --11844
NM_004171chr11107209 7027 6726 5917 3728 3145 2569 2337 632 254 79044 8486 7253 6925 3337 1194 673 29053 8282 38533 8049 3273
NM_004274chr1483254 3162 3131 2738 2380 2008 816 531 32588 2444 2093 ----
NM_004293chr983395 3289 2940 2824 1163 833 519 161 43784 3760 1227 450 --11029
NM_004316chr124894 151 132 107 ----21011 286
NM_004338chr18156433 5770 5544 4882 4503 4321 2829 2684 2076 1700 1460 527 396 269 30 66070 5986 5691 4270 1663 1477 66494 5800 4299 2251 1299 427 11504
NM_004342chr772005 1953 1762 942 921 904 435 11720 21776 1644 --
NM_004397chr11113997 2874 1687 1375 510 307 297 284 176 156 124 1808 2434 326 --
NM_004412chr1095823 5622 4623 1480 1399 1230 1000 787 756 24796 4290 12362 45954 4889 643 537
NM_004438chr293039 2991 2844 2316 1078 882 775 514 455 32128 991 443 168 --
NM_004440chr691250 1238 1221 703 681 530 446 318 121 31693 331 46 ----
NM_004441chr3121169 1121 1071 1052 912 899 361 347 338 110 40 24 11322 1132 1282
NM_004464chr4103857 3794 3637 1065 1058 934 784 773 172 75 34190 375 338 ----
NM_004586chrX84663 4089 1785 1768 1673 1466 979 209 1795 24201 4159 --
NM_004612chr9114675 4272 4252 4178 3700 3258 3165 1742 1642 1330 101 11447 34311 3366 3084 1552
NM_004643chr146765 150 62 49 42 31 ------
NM_004650chrX81804 1353 1177 653 426 409 332 203 ----2483 294
NM_004660chrY62221 1670 1621 718 154 90 ----1551
NM_004726chrX65262 4846 4604 949 368 335 24277 3520 25371 4687 15710
NM_004734chr1333189 1168 762 1973 33046 2457 2237 22128 569
NM_004744chr4103504 3428 3414 2673 2634 2510 1347 1224 1099 533 43692 3013 1432 169 1444 23407 2838
NM_004745chr8106293 5950 5648 5373 5321 4773 1775 1268 1259 1077 25215 383 ----
NM_004748chr15104165 3857 3833 3779 3741 3584 3016 2796 1319 904 23152 218 43760 1089 1078 376 --
NM_004774chr17102960 2339 2302 2201 2176 2053 1133 1100 109 36 12420 21081 502 1684
NM_004776chr2063363 2879 2497 725 607 121 43031 2659 813 98 1749 22141 452
NM_004808chr10103096 2724 2527 2210 2203 1095 1014 903 706 280 1239 --184
NM_004834chr2113125 2384 2354 2303 1319 1104 1018 922 687 534 54 22961 2395 --12325
NM_004845chrX113620 3308 2751 2676 1614 1257 1232 658 266 183 21 1644 11236 13701
NM_004857chr14114444 4392 4275 3933 3559 1206 1137 938 824 290 203 23608 3218 146 --
NM_004859chr1741114 1021 824 271 2963 728 2300 121 11893
NM_004863chr14175353 5146 4603 4474 4340 4150 3827 3696 2138 2085 2011 1706 1464 1399 897 369 77 34739 2064 1339 127 --
NM_004904chr7156540 6370 6251 6058 5949 5037 4924 4913 4014 2488 1994 1981 1949 1296 1210 25158 1900 34928 2170 33 16072
NM_004956chr7104507 4324 4148 4046 3943 3348 1523 1384 1292 922 43784 3751 3388 1377 --11667
NM_004976chr11114772 4732 4655 4225 3500 1812 1193 1033 672 225 153 11154 51694 1644 1247 1172 166 11537
NM_004985chr1243335 3190 1513 983 11178 --23969 3453
NM_004992chrX107575 5735 2594 2315 2258 1618 1198 1092 920 606 45143 2681 2629 40 28041 7566 11465
NM_004992chrX107575 5735 2594 2315 2258 1618 1198 1092 920 606 45143 2681 2629 40 28041 7566 11465
NM_004999chr694094 4019 3787 3556 3346 3081 2993 591 326 23287 2766 --13334
NM_005036chr22108005 7894 7633 7125 2845 2320 1780 779 580 569 45912 3044 1587 185 28108 999 11840
NM_005044chrX133860 3305 2975 2895 1756 1678 1130 737 708 667 594 59 25 23323 109 ----
NM_005056chr12115624 5511 5237 4917 4799 4718 4229 2060 1380 1069 947 34549 3540 1879 45128 4233 951 857 21026 841
NM_005079chr8123149 2979 2953 2709 2643 2458 2421 2358 2343 2221 2034 488 ------
NM_005156chr984993 4975 4205 4171 4045 2013 1434 302 54356 4288 3821 1745 1738 14754 --
NM_005160chr22116501 6414 5365 5331 4955 4369 4162 2363 1203 984 195 22039 751 --32466 1646 717
NM_005188chr11148305 8029 7999 7974 7901 7309 6863 6556 6162 2116 1991 1192 760 471 48137 7773 5828 844 11539 11024
NM_005197chr14176234 5970 5671 5368 5131 4295 4156 4105 3974 3919 2474 1963 1903 1268 863 705 190 34002 2228 367 25958 504 --
NM_005207chr2253237 3022 2897 2279 452 21192 991 12956 33539 3500 3115
NM_005235chr2197729 7654 7513 6535 6352 5458 3018 2732 2425 2264 1659 1349 1242 1198 1031 936 567 421 244 64894 2817 2348 1667 1642 484 2264 202 14829
NM_005238chr1193585 3128 2762 2692 1380 1300 1017 492 241 23227 47 11406 1789
NM_005311chr762732 2536 2436 2173 54 34 22261 299 11741 32289 2086 79
NM_005338chr793760 3633 3056 2711 1403 1395 937 868 273 11491 53907 3766 3175 1247 536 --
NM_005339chr483482 2984 2862 2632 1550 930 867 269 --12736 1694
NM_005359chr18116530 6374 6303 6095 6011 5021 2504 1994 817 269 229 --36403 6146 1643 --
NM_005397chr793882 3579 3481 3461 3315 2917 2767 2581 326 43516 1033 863 382 --32930 2593 1116
NM_005400chr232739 649 463 1340 --22083 1167
NM_005426chr14288 149 140 52 1857 3158 127 33 --
NM_005475chr1242806 2472 2119 966 43113 2941 2014 856 23090 970 1950
NM_005497chr17145414 3850 2440 2365 2307 2203 2057 2012 1361 591 545 516 337 254 11026 23980 2390 22260 259
NM_005502chr982841 2619 2336 2305 809 106 85 79 --141 --
NM_005504chr12146641 6105 6086 5903 5301 5278 5249 5159 5135 4955 4735 1940 1720 1017 42585 2425 2266 2227 16509 35283 4966 2346
NM_005596chr9115510 4896 4520 4253 4004 1636 1150 963 783 225 179 45925 5369 4100 2260 35892 3934 83 --
NM_005607chr85766 404 384 255 71 ----21014 293
NM_005665chr1114321 3803 3599 3491 3314 3294 1765 1677 1467 1312 1190 14102 --11097
NM_005668chr594281 3804 2948 1797 1790 601 365 352 124 23107 230 1356 --
NM_005715chr682781 2651 2180 2130 2025 1035 437 296 3752 729 111 1916 12097
NM_005725chr152012 1623 464 351 332 11791 11574 31970 1640 296
NM_005748chr1273035 2963 2614 2364 2334 1371 533 1429 --12851
NM_005759chr2104788 4572 4498 3734 3701 3602 975 832 466 98 11186 --14736
NM_005828chr17184795 4347 4039 3995 3698 3431 3398 3319 3299 3145 2035 1584 1289 1250 1237 996 520 75 ------
NM_005840chrX247504 7473 7383 7369 7237 7186 6805 6651 6355 6337 6033 5648 5416 5058 2968 2724 2020 1993 1983 1816 1703 1649 1407 1161 --15551 --
NM_005901chr18178138 8000 7854 7601 7323 6446 5429 3480 2960 2468 1908 1882 1778 860 848 582 218 26757 6059 37224 7077 3104 15846
NM_005902chr15134114 3489 3385 1825 1789 1780 1603 1377 1118 901 732 101 62 14101 23493 420 13099
NM_005903chr5165199 4944 4852 4737 4184 3827 3747 3527 2012 1990 1836 1771 1180 1113 815 375 13624 23755 1486 14414
NM_005909chr5123946 3711 3684 3105 2664 1639 1387 1260 628 493 420 392 33980 1047 641 11363 --
NM_005935chr4105164 4826 4273 4031 3374 1659 895 488 414 347 45125 3810 2035 247 31607 1266 542 --
NM_005941chr893681 3068 2658 2549 1021 384 316 302 67 23403 3247 32907 2870 2564 --
NM_005955chr1115364 5197 5187 5047 4429 1775 1481 942 172 97 90 35387 4024 1670 25413 3911 --
NM_006007chr984280 4078 3218 1805 900 767 488 414 33231 269 69 11683 --
NM_006037chr274568 4170 4065 3909 3828 3745 305 11514 13430 1732
NM_006060chr7104187 3915 3737 3136 1643 1468 1423 1005 363 56 ----11570
NM_006080chr782726 2717 2418 1196 1069 1013 572 339 1212 --32731 1999 1954
NM_006139chr272757 2648 2246 1770 1158 767 385 2773 744 12379 --
NM_006154chr1542531 2098 144 119 22633 2143 2872 814 --
NM_006203chr5135275 5266 5197 5159 5078 5052 4938 3710 2182 2022 1849 1565 373 31578 1491 426 12084 --
NM_006252chr1187548 7423 6194 6121 6000 5842 5834 5577 5558 4783 2879 2479 2377 2023 1958 1710 688 460 36517 5494 2452 47029 2483 2207 578 15978
NM_006256chr152085 1745 735 598 361 11821 11831 12684
NM_006283chr8104506 4037 1257 1243 1062 990 711 658 576 176 33804 3472 1743 23768 1551 1593
NM_006306chrX135628 5584 5535 5215 5125 4855 3592 1299 1237 1175 1082 412 146 --13579 25437 151
NM_006371chr3175092 5081 4887 4722 4703 4223 4014 2010 1842 1764 1719 1619 1455 1387 1225 1159 1009 34895 4267 1413 13697 11360
NM_006393chr1084471 4224 3364 3182 1323 1058 951 149 12779 14090 23268 502
NM_006415chr93227 209 164 196 --21100 439
NM_006457chr472598 1583 1467 155 121 38 23 1867 22850 296 --
NM_006464chr2164148 4125 3848 3598 3578 3453 3260 3101 1536 1356 1150 907 859 567 136 90 13219 ----
NM_006524chr76898 372 309 290 226 204 --51059 814 394 142 58 --
NM_006534chr2093360 2307 2234 1118 818 733 615 101 70 31324 434 371 22238 381 13235
NM_006544chr14146020 5726 5110 5027 5018 4997 4624 4298 4043 2330 1370 1215 794 46 24346 1278 1981 25917 5422
NM_006546chr17156331 6270 5399 5199 4517 4322 4071 4065 1873 1508 1210 647 628 564 318 12167 26369 161 11888
NM_006557chr941307 707 520 239 31344 226 220 1529 2555 138
NM_006599chr16127707 7006 6952 6360 5843 5361 3211 2360 897 525 500 23 46133 5167 1307 149 11280 --
NM_006609chr272253 1014 937 823 390 209 104 2790 500 --12196
NM_006620chr6114826 4681 4386 4121 3723 3682 3531 1497 1353 523 62 21944 85 13862 --
NM_006621chr171534 1245 753 730 374 231 166 21903 1283 --11967
NM_006628chr1541496 1459 443 194 14307 --23909 2849
NM_006654chr1274438 4252 1579 1445 712 629 456 34373 3713 181 --11706
NM_006699chr132626 2261 2135 62490 843 679 500 492 339 12100 --
NM_006720chr10134686 4245 3917 3847 3708 1642 1616 1398 1375 442 347 89 33 21681 698 14906 13312
NM_006721chr102714 82 1245 --2804 781
NM_006729chrX125619 5536 5020 4296 2058 1914 1078 982 975 397 381 298 24939 389 --21482 65
NM_006748chr8141555 1366 1304 1273 1248 1170 1119 678 563 533 419 387 343 178 138 2666 255 1297
NM_006750chr16187411 7318 6412 6032 5925 5512 2702 2270 1900 1609 1601 1486 1308 1029 951 289 116 23 57503 6500 3209 1886 1446 45395 5368 1540 158 --
NM_006851chr1282643 2381 2178 2163 2126 1846 899 145 31054 1036 694 ----
NM_006902chr193217 3136 2614 2525 2468 1009 986 189 160 22044 1332 33366 667 135 --
NM_006922chr262486 1958 546 472 457 239 11991 11925 --
NM_006924chr1783711 3196 3119 3060 2723 1738 391 378 11534 1736 --
NM_006955chr1093131 3020 2987 2849 2673 2640 461 314 70 22760 2748 22652 2124 --
NM_006981chr962572 2564 2095 1183 1009 107 32762 992 393 --12455
NM_007011chr15135742 5716 5571 5369 5107 4636 2236 1751 1294 679 480 427 373 21080 365 12136 --
NM_007038chr21105601 5547 4795 4295 4184 2391 2368 1697 550 522 24545 4402 --26027 5375
NM_007039chr1462287 2006 1994 1781 179 154 42142 1951 1898 1840 11546 --
NM_007050chr20237844 6993 6518 6397 6344 6298 6224 6099 5702 5549 5446 5333 5287 4967 3200 3043 2692 2142 2029 1921 1435 853 122 --16914 --
NM_007106chr1352219 1948 1055 500 167 22271 175 ----
NM_007114chr363079 2973 792 735 393 303 22704 384 2952 307 --
NM_007137chrX84143 1843 1563 1300 490 324 188 163 22105 660 44147 2145 1082 921 --
NM_007153chr19194419 4240 4020 3893 3798 3712 3624 3557 3433 3303 3193 3186 2956 2948 1350 920 659 154 140 24084 2991 41310 429 260 91 31057 906 598
NM_007172chr22123312 2930 2812 2205 2169 969 653 404 290 198 130 100 --13136 12672
NM_007203chr993655 3160 2624 2577 1107 1022 685 535 216 63737 3588 2779 765 585 279 11026 1353
NM_007249chr13187690 6825 6232 5786 3194 2834 2750 2411 1918 1498 1023 1001 876 622 506 237 191 32 58406 2971 2283 1940 1552 38370 2882 784 --
NM_007287chr373156 2874 2630 2212 1245 490 183 --12199 32296 396 375
NM_007288chr373156 2874 2630 2212 1245 490 183 --12199 32296 396 375
NM_007289chr373156 2874 2630 2212 1245 490 183 --12199 32296 396 375
NM_007345chr1842315 621 139 28 ----157
NM_007350chr1284418 3811 3168 896 828 467 432 45 23377 3264 14275 13174
NM_012096chr392876 2827 2689 2589 1199 1183 413 277 259 1394 23665 3618 --
NM_012120chr651138 723 646 279 189 23011 2446 1799 --
NM_012141chr1343765 3225 1440 1183 13282 11533 33230 1464 478
NM_012153chr11112537 2214 2118 1981 1831 1623 837 758 545 145 59 22505 2132 11952 1626
NM_012164chr9137225 7125 6877 6597 6579 5131 4993 4809 1746 1381 1120 1066 474 57302 2030 1979 980 736 ----
NM_012199chr1154263 4242 4182 4028 3573 3410 3121 1738 927 870 498 479 450 78 34 ----13188
NM_012214chr2136152 5522 5229 4811 4754 4686 4499 4360 4160 3907 2225 2194 1448 35511 4845 1195 14112 --
NM_012244chr1451392 612 603 322 182 ----2652 617
NM_012252chr7105030 4955 4935 4174 3807 3587 1996 1344 875 161 34767 933 713 35299 1095 149 --
NM_012281chr772440 1652 825 464 73 66 51 --11864 --
NM_012287chr364512 4375 3404 2842 974 967 22826 422 23829 183 --
NM_012288chr6135569 5464 5292 5168 5011 4072 3520 1659 1620 1545 1275 664 509 24397 2243 11943 --
NM_012316chr1165599 5534 5306 5124 4801 4535 4341 3601 3451 1815 1255 1215 990 919 611 492 --24222 1219 23835 56
NM_012347chr662913 2381 1985 688 618 476 2937 61 --1192
NM_012395chr7123322 3025 2486 2165 2133 1221 898 856 494 229 77 56 32517 730 23 --1870
NM_013231chr14113927 3188 3014 2917 871 640 570 513 418 304 282 21320 50 1889 14021
NM_013255chr7208855 8427 7917 7778 7671 7530 7296 6349 6176 5739 5628 5591 3305 2404 2021 1417 1037 863 796 280 11772 32788 1852 887 --
NM_013261chr463631 3445 2714 2479 712 204 53284 2659 1338 1208 156 ----
NM_013269chr12164128 4012 3863 3700 2904 1503 1454 1347 1053 1036 1027 895 870 645 363 76 44305 3362 1146 403 11294 13605
NM_013309chr1541825 913 790 324 12499 11796 11911
NM_013313chr22133222 2683 2486 2457 2383 2188 1393 1386 1346 1003 818 549 250 ------
NM_013341chr262970 2474 1976 737 712 258 ----1596
NM_013374chr332942 2387 723 2643 481 22767 2319 12934
NM_013989chr14164952 4819 4690 4215 3795 1839 1824 1613 1342 1161 900 824 331 294 252 63 15157 13627 44150 3412 1300 130
NM_014011chr232233 2198 2041 1466 1306 1327
NM_014048chr16104980 4642 4557 1562 1524 1279 957 916 305 273 53961 3930 1377 125 43 24299 1010 --
NM_014112chr8125304 4639 4527 4280 4185 3825 3798 3389 1770 1332 474 205 13457 14291 11462
NM_014155chr11287119 6825 6476 6441 6288 5942 5616 5277 5263 4620 2701 2632 2618 2600 2581 2292 2133 1721 1676 1265 982 951 945 902 594 398 179 32 66463 4858 2574 2511 204 25 1515 22610 61
NM_014240chr3113863 3591 2714 1517 1446 1209 1088 863 745 549 98 --2926 749 13034
NM_014243chr461857 1835 1773 408 212 34 ----1131
NM_014296chr361398 1301 621 328 162 61 21109 570 11524 --
NM_014309chr22165392 5205 4812 4304 3968 3650 3531 1975 1386 1083 998 569 444 337 322 89 1136 170 13480
NM_014331chr4147013 6186 6097 6013 4774 2997 2203 1894 1534 1446 1267 605 326 267 27343 7172 25888 5458 --
NM_014350chr55986 919 422 171 68 21052 935 180 --
NM_014381chr14103238 3139 3033 2923 2776 2709 2601 2195 2117 1245 32942 611 28 23279 3091 13039
NM_014423chr5125624 4337 4204 4151 4113 4046 1962 787 480 104 98 60 43876 2010 820 502 ----
NM_014586chr21154760 4654 4632 4282 3820 3782 3756 3665 3495 3428 1152 1117 604 591 533 54380 3919 3853 3718 412 23363 1332 --
NM_014613chr5143042 2860 2777 2409 2376 2100 1961 1879 1025 794 602 460 451 164 ----12959
NM_014636chr994172 3767 3743 2934 2917 2901 1637 1422 623 33368 2699 382 13604 169
NM_014667chr362407 1822 1662 830 461 210 42465 2006 1989 1771 --11857
NM_014701chr1582866 2484 2285 2121 1096 1046 421 193 1320 11325 --
NM_014721chr6207336 6154 5496 5269 2911 2861 2821 2777 2470 1637 1252 1198 1174 1039 678 556 494 438 198 122 56194 5173 4554 2165 1107 ----
NM_014730chr12205005 4878 4643 4095 4050 4029 3967 3578 3487 3393 3252 2088 1688 1554 1532 1374 1244 854 468 314 44688 4419 4380 1108 23855 3617 --
NM_014730chr12205005 4878 4643 4095 4050 4029 3967 3578 3487 3393 3252 2088 1688 1554 1532 1374 1244 854 468 314 44688 4419 4380 1108 23855 3617 --
NM_014739chr693376 3358 2921 1581 1458 849 780 559 80 44020 3808 1446 675 --14218
NM_014774chr193203 2697 2638 2478 2107 1062 993 171 140 --42788 2686 640 495 --
NM_014803chr10132755 2660 2622 2292 1899 1843 753 579 516 466 432 145 48 --1715 --
NM_014810chr193325 3093 2571 2427 2281 1163 1127 712 627 23204 3174 22332 1435 --
NM_014864chr194160 3916 3904 3504 3438 2960 2759 2689 630 1288 23515 1529 1559
NM_014873chr1114702 4217 3879 3508 3280 1596 1515 1152 1034 813 265 24361 210 1466 14047
NM_014877chr17117015 5636 5536 5371 2652 2598 1939 1931 1068 924 27 ----11054
NM_014898chr19102114 1522 990 967 822 760 722 379 217 63 31598 461 140 ----
NM_014912chr1072695 2433 2343 1376 1026 1007 950 11404 21066 124 12539
NM_014920chr6103279 3163 3084 3037 2641 1161 1124 652 599 37 12559 13707 --
NM_014923chr1351975 1637 1479 719 564 32364 708 640 21512 943 --
NM_014932chr381784 1632 1569 795 310 245 132 105 11443 --11858
NM_014936chr662657 1068 695 576 451 108 390 66 53 --22826 2208
NM_014946chr293070 2868 2751 2424 2211 2100 922 845 46 2370 345 12860 --
NM_014982chr14135426 5137 5128 4543 4221 2117 1709 1642 1314 956 935 692 248 35265 4813 427 14418 169
NM_015026chr1264335 4104 3232 3192 2908 347 24168 3313 13905 178
NM_015032chr1382834 2817 2114 728 599 372 247 116 22079 2011 ----
NM_015035chr20125907 5645 5450 4997 4387 2483 2255 1914 1903 1268 1011 575 44903 4827 1943 1683 262 25 --
NM_015040chr282975 2506 1261 911 545 335 57 35 22707 51 ----
NM_015049chr2122943 2916 2824 2731 2322 394 385 371 225 172 137 46 --12529 --
NM_015051chr953072 2898 2714 2248 2160 32772 2105 913 1819 23354 2924
NM_015064chr12133584 3331 3238 3199 2781 2751 2506 2266 880 495 420 356 199 21234 1179 2645 617 21161 431
NM_015068chr7123713 3079 2968 2939 2924 2446 2427 1380 1199 1142 995 940 13275 11050 --
NM_015071chr5255414 5389 5301 5198 4607 4592 4360 4079 4064 3947 2588 2535 2349 2242 2012 1858 1823 1783 1621 1319 670 530 401 337 246 ----11984
NM_015076chr6163865 3762 3567 3252 1781 1514 1252 1210 965 918 847 807 754 298 123 72 11068 23767 664 --
NM_015090chr1175588 4949 4891 4762 4524 4210 4034 2449 2374 2177 1611 933 883 847 687 471 51 26251 449 34780 3941 1640 1823
NM_015092chr1673406 3166 2861 1704 431 228 124 14445 34232 3922 606 --
NM_015093chr651639 1289 444 416 353 21423 424 1482 --
NM_015144chr1693778 3470 3433 3330 2880 2695 1170 974 363 33963 2872 560 22490 508 31552 1507 293
NM_015155chr1032652 2534 566 22089 1182 --22875 1072
NM_015192chr2072855 2101 2041 1148 944 320 145 13034 32105 216 157 1303
NM_015247chr16155114 4902 4802 4623 4603 4431 4385 4089 3747 1886 1716 1663 1291 801 425 15269 ----
NM_015299chr14133576 3256 2842 2701 2692 2545 2455 1209 657 642 625 508 441 43876 1458 634 403 23824 3116 12771
NM_015310chr8288369 7617 7589 7486 7056 7030 6850 6702 6381 6274 5956 5895 5407 5305 3366 2658 2561 2534 2106 1575 1372 1143 1049 720 688 623 499 360 68076 8038 7198 6138 5097 2482 37148 5485 5208 --
NM_015365chrX84150 3766 3239 1474 848 784 730 415 13136 --1883
NM_015375chr1214923 4738 4306 4093 3842 3704 3418 3256 3233 1924 1735 1634 1608 1457 1297 1242 881 672 258 169 68 1772 ----
NM_015532chr1572798 2204 2062 2027 795 522 453 --32397 597 570 11108
NM_015564chr593306 3011 2933 2917 2439 1431 1235 1136 1073 23489 2200 --22514 2324
NM_015569chr1134776 4637 4267 4237 4031 3542 1565 1283 1055 959 833 734 613 44166 3717 1099 550 --13886
NM_015576chr352837 2450 950 582 276 22327 751 2648 262 11125
NM_015578chr1941420 646 86 80 21954 688 11984 --
NM_015713chr8113579 3190 2373 2243 1437 1322 1113 1095 843 657 98 4833 624 601 240 12592 21141 578
NM_015726chr191645 1598 1463 1443 1376 733 720 694 140 ----2726 145
NM_015852chr783070 2738 2634 988 651 617 533 197 23610 3084 121402 1237 1156 1072 904 820 568 484 400 316 232 64 --
NM_015879chr18208519 8312 8040 7953 7562 7546 7461 7434 7414 7333 7317 6482 6051 5817 3053 2397 2176 1938 1327 999 48478 8021 6002 1194 58441 7280 6890 3386 3281 48097 6321 2507 1004
NM_015886chr8135600 5375 4501 3690 3637 3565 1944 1679 1541 1418 987 981 857 12093 --12190
NM_015981chr5113159 2531 2286 2244 1028 914 697 497 487 386 364 22424 1122 --1502
NM_016009chr1104948 4596 4172 3752 3545 3018 1522 1509 436 202 54583 4196 1891 629 396 24699 1313 --
NM_016083chr663090 814 295 206 64 34 1519 22950 685 23987 3682
NM_016206chr3118652 7297 6823 3294 3253 2243 1440 848 498 185 109 35608 1064 794 37832 2675 2394 28451 8028
NM_016217chr6113595 3571 3373 3362 3292 3144 1320 1015 343 324 249 12463 1759 --
NM_016220chr772192 1646 1590 1531 936 297 151 32153 2147 1460 5483 403 385 319 66 --
NM_016224chr632014 893 21 31625 1594 1459 22200 807 1795
NM_016257chr1113489 3349 3312 3219 2868 2738 2235 1231 1223 936 928 12769 1709 --
NM_016260chr2116667 6558 6076 3033 2675 2648 1014 194 185 53 40 37554 6360 258 21595 443 12569
NM_016272chr2292646 2409 2057 1065 1041 1026 411 321 75 22465 2166 12495 --
NM_016513chr6103279 3163 3084 3037 2641 1161 1124 652 599 37 12559 13707 --
NM_016531chr4124113 3845 3186 2969 2907 1682 1609 1600 1542 744 346 212 1287 22827 1620 14212
NM_016953chr2125438 5299 4104 3731 2428 1968 1443 1004 761 722 461 292 46049 2445 1134 1045 --25387 182
NM_017447chr2163611 3525 1102 737 76 66 1982 23175 654 --
NM_017540chr563217 2702 1047 653 472 128 43260 3057 1985 759 --42708 921 320 199
NM_017628chr475210 4377 3987 3429 617 125 95 ----14994
NM_017633chr6133583 3277 3143 3021 1343 1229 937 908 784 762 725 412 297 23075 2936 12626 23253 1262
NM_017637chr9218998 8597 8532 7898 7675 7605 7590 7541 7349 7330 6821 6152 5869 3738 3376 2406 2323 1872 1525 494 451 17239 16861 38885 7611 6931
NM_017644chr3125061 4436 3552 1875 1748 1433 1389 726 449 420 238 23 --13683 --
NM_017650chr7115843 5473 5133 4639 4355 3848 2131 1292 1078 982 681 55742 5437 4735 1416 336 31212 313 130 --
NM_017660chr1973431 3413 3171 2869 2851 1263 839 23197 119 165 2790 778
NM_017709chr1113988 3588 3380 1665 1360 827 661 607 569 333 194 --23771 1290 --
NM_017754chr694939 4847 3871 3360 2001 1789 1652 1323 585 54806 4194 1631 1516 548 ----
NM_017813chr8105398 5093 5011 4085 3950 3688 1748 1460 1025 367 1886 25283 4377 --
NM_017919chr9195758 5419 5396 5065 4162 4155 4004 3967 3878 2172 1721 1386 1332 1061 942 803 543 408 302 2959 415 ----
NM_018036chr1464472 3589 3229 3150 375 76 64461 4386 4314 691 512 111 ----
NM_018167chr149961 853 823 398 275 156 118 93 40 2810 79 ----
NM_018247chr6143025 2377 2223 2204 2156 2054 2032 1935 770 702 656 611 450 384 1586 11906 --
NM_018254chr152292 2205 1750 653 79 2480 85 1903 1762
NM_018299chr883478 3433 3071 3026 2878 2287 2277 573 12539 12958 --
NM_018362chr1163894 3627 3601 1101 1018 934 22522 1292 --11418
NM_018373chr14165967 5895 5149 4478 4448 4120 3907 2475 2178 2148 1653 1214 557 368 202 191 21131 664 31468 1059 625 2895 475
NM_018425chr1092665 2359 2340 1967 690 160 109 47 21 31758 251 175 32098 1631 748 --
NM_018440chr8198331 7956 7440 7162 6617 6330 6103 5848 5510 3315 3278 3017 2582 2527 1767 1605 343 306 65 58425 8137 3245 2616 1846 28505 6948 11414
NM_018452chr6_random123680 3581 3189 2736 2392 1419 1391 1184 1000 941 406 75 31440 1118 99 ----
NM_018566chr1104614 4241 4203 3458 3211 1668 1461 715 436 329 84783 4017 3561 1989 1680 1643 987 89 ----
NM_018638chr12115655 5637 5475 5105 5098 4937 4706 4635 4291 3780 1882 24421 1121 ----
NM_018640chr1271999 1992 1136 971 471 88 76 22438 27 12699 --
NM_018660chr8132891 2716 2481 2165 1238 1118 1105 1062 885 844 405 274 100 1343 1796 12853
NM_018945chr693641 3194 3180 2963 2688 2520 1102 285 273 1451 22524 289 --
NM_018993chr2061174 1036 934 461 311 217 --11178 11056
NM_019001chr3114279 4077 3942 3235 3094 1851 1255 926 721 498 402 --13102 --
NM_019008chr22113784 3741 3378 3315 2717 2401 2292 1358 1241 923 562 22504 1073 43212 2557 2405 476 --
NM_019027chr442164 2075 69 47 32458 2266 75 1111 --
NM_019044chr2124676 4538 4502 4292 3601 3392 3298 2979 1684 981 907 388 33880 3363 1657 24039 333 33303 912 233
NM_020133chr6166390 6328 6270 6224 6069 5681 5071 4113 2309 2034 1778 1357 1282 1168 783 167 56147 5184 5088 4731 2022 24698 1609 12447
NM_020182chr20113565 3111 3071 3014 993 861 692 504 465 81 69 ----13345
NM_020205chr193103 3071 3000 1214 1120 769 704 531 367 52663 2401 782 171 69 1625 --
NM_020245chr6114203 4011 3793 3532 3340 1879 1564 1404 847 656 47 24055 3593 13602 --
NM_020297chr1282744 2449 2390 2352 733 617 522 417 42753 430 375 229 --12562
NM_020336chr20123829 3782 3205 2724 2524 1312 1001 939 462 293 135 107 1675 --12357
NM_020341chr2041539 681 596 578 1347 31379 685 272 160
NM_020440chr1133194 3109 2664 2609 2398 2140 1327 1276 899 760 748 350 58 ------
NM_020443chr1166910 6828 6245 6171 5752 5501 5214 4768 2365 2269 1232 1201 1094 992 187 174 --56249 2565 1820 1101 629 1116
NM_020466chr6114426 3502 3100 1669 1545 1371 1324 1272 488 220 21 34600 4516 1980 1833 11491
NM_020673chr20177267 7183 6809 6685 6406 5494 5449 4971 2844 2797 2690 2427 1741 1490 798 782 203 36773 2965 258 26984 5584 16767
NM_020699chr1165373 4535 4458 4333 4213 4140 3961 3492 1777 1661 1626 1093 773 715 702 302 --54617 4564 1618 1018 621 --
NM_020718chr16136394 5447 5206 5180 5084 4824 4657 4633 4099 1040 627 382 308 25198 1647 11278 14387
NM_020727chr2194026 3603 3571 2697 2669 2631 1048 989 432 41294 1085 220 97 23120 824 --
NM_020734chr1273118 3106 2219 2072 1006 869 416 43059 2583 2510 974 --1295
NM_020739chr15104165 3857 3833 3779 3741 3584 3016 2796 1319 904 23152 218 43760 1089 1078 376 --
NM_020742chrX81715 710 536 509 457 76 64 57 2975 377 ----
NM_020752chr1082611 1814 1123 1048 184 146 66 21 2937 165 1418 --
NM_020772chr17188510 8004 7401 7337 6319 6235 6026 6003 5897 5710 5646 3315 3155 3010 2712 2563 1544 1042 18433 36014 771 103 25876 1256
NM_020774chr18136092 5533 5446 5433 5045 4770 4444 4377 4146 2406 2270 728 259 22083 640 ----
NM_020782chr1294844 4788 4598 3593 3271 3015 2983 1044 839 34358 3708 1009 23751 1921 14467
NM_020802chr11113205 2866 2690 2675 2649 2448 2079 2056 1350 1335 316 ------
NM_020809chr11111946 1878 1655 1553 858 737 730 605 576 362 298 2787 31 --1487
NM_020824chr101277 ----2706 171
NM_020825chr16103784 3443 3310 3115 3026 1502 754 737 656 124 1549 13385 1762
NM_020841chr1254089 4019 1518 1079 175 --23578 1577 13107
NM_020844chr8157675 6494 6460 6245 6008 5976 5281 2750 1549 1215 1172 1124 725 571 237 36679 1249 752 --12887
NM_020918chr1083545 3249 2649 2504 1365 1129 619 320 13161 --12964
NM_020921chr14113490 3116 3108 2946 2774 1173 1103 954 897 270 246 12574 ----
NM_020927chr1682258 2235 2223 1861 1543 909 30 21 1446 42142 1870 1800 1609 --
NM_020960chr9134931 4889 4629 3797 3580 1777 1690 1599 1065 450 385 365 255 --1270 23726 1695
NM_021007chr262383 2168 1701 611 277 191 22321 2201 --1246
NM_021032chr361818 1418 1353 580 371 96 21978 1389 --11844
NM_021033chr1393297 3225 2562 2345 1180 818 413 342 111 22514 2412 1353 --
NM_021038chr393148 2856 2434 1360 1152 1021 159 65 35 43230 2869 259 41 ----
NM_021120chrX93158 3076 2852 2463 2004 1109 792 323 37 22898 2694 13162 32978 2165 90
NM_021191chr1242441 2173 1894 753 2984 472 1740 1662
NM_021252chr1011514 21520 452 --21835 403
NM_021647chr484268 3772 3663 3227 1458 1073 337 139 34430 4371 3681 ----
NM_021705chr671496 1475 1402 1116 1067 977 563 11568 --21545 345
NM_021813chr685694 4217 4209 4062 3943 1896 1816 91 44295 4258 3958 101 24066 1366 14747
NM_021815chr262842 2552 1204 1171 726 166 1274 --2782 667
NM_021912chr1583779 3574 2867 2779 2754 2682 1594 1180 22938 1265 33122 3064 1625 --
NM_021949chrX122232 1939 996 589 567 541 532 511 454 302 133 24 22877 1119 1616 --
NM_021960chr1112564 2219 2089 1983 1861 1766 800 735 408 191 170 31867 319 155 12104 --
NM_021961chr11106178 6076 5632 2951 2018 1897 1045 726 541 493 65892 5740 5603 5145 1628 1574 15224 12323
NM_021964chr3136233 6080 4871 4642 4544 4106 4072 2575 2262 1922 1749 584 525 2839 99 35320 2152 1431 --
NM_022048chr15166140 6030 6012 5322 4660 4104 2223 1804 1678 1141 932 481 458 418 315 126 1877 34141 1022 485 --
NM_022058chr261452 1419 1298 300 133 50 1686 21574 460 --
NM_022114chr1134695 4568 4322 4148 3862 3121 1799 1761 1731 1502 870 756 648 44611 1233 435 222 44572 1533 80 55 --
NM_022133chr841794 592 84 50 21641 107 177 --
NM_022456chr12177579 7146 6222 5958 5576 5547 5324 5236 2915 2613 2415 2143 1642 1500 839 565 497 56564 2451 2035 1586 1450 45644 1979 1819 203 --
NM_022459chr13116180 5815 4290 4112 4025 3930 2310 1748 908 874 832 23955 2522 15051 --
NM_022465chr1262565 2207 1927 1910 1201 647 --32298 2040 612 12775
NM_022473chr15104458 4232 3765 3562 3161 2717 1461 1120 223 102 32893 1153 582 24338 3110 --
NM_022497chr373424 3146 2392 1362 706 263 131 33374 1374 948 11282 23158 398
NM_022748chr772678 2544 2117 762 752 363 241 32816 768 158 32397 2363 617 --
NM_024007chr5123082 2878 2728 2622 2426 2240 2004 1249 1156 176 110 34 --22893 407 --
NM_024345chr9125569 5386 5112 4636 4443 4195 3914 3817 2222 956 412 25 24327 872 ----
NM_024408chr193564 2908 2509 2410 995 840 732 281 89 --11454 2737 58
NM_024423chr18124271 3968 3509 2631 1651 1038 963 849 678 616 142 95 22833 841 ----
NM_024512chr3113465 3237 2949 2439 2374 1273 932 857 548 290 186 31038 684 100 22565 82 --
NM_024524chr373127 1980 1226 1178 1164 515 304 22378 1966 12162 12819
NM_024563chr551897 715 688 540 303 2460 153 21757 507 11273
NM_024590chr461803 1747 1711 1458 1261 655 ----3715 487 329
NM_024740chr11133801 3795 3716 3601 2861 2751 1336 1015 885 876 804 403 311 126 31393 625 337 1316
NM_024761chr9165106 5066 4925 4830 4780 4415 3931 3795 3483 1814 1408 855 826 706 274 25 41803 1775 1446 108 32118 1909 232 --
NM_024770chr2146108 5550 5541 5529 5382 5237 4520 4246 2558 2104 1787 1151 99 51 36523 2239 765 14404 12631
NM_024817chr15155983 5715 5474 5035 4223 4208 4115 4053 3966 3633 2366 2112 2064 1508 1461 12145 44495 4197 3817 728 --
NM_024884chr14104597 4451 4175 3544 1712 1694 1426 1299 230 52 43596 3170 3115 410 13802 24485 4374
NM_024930chr532150 1983 104 11999 --11991
NM_024947chr3157881 7757 7249 7130 6225 3333 3235 2438 1388 897 842 622 605 575 325 69255 3849 3693 3164 1578 1070 16858 --
NM_024949chr4114846 4285 3966 3384 3341 1998 1500 1444 1002 954 722 51767 731 657 651 639 21110 127 --
NM_024989chr2107051 6084 3083 2596 2025 1804 1765 1216 1194 102 11689 17849 --
NM_025027chr1981055 864 793 310 226 157 144 49 1165 ----
NM_025054chr894115 4102 3805 2713 2648 1693 1523 1517 1105 22726 732 ----
NM_025073chr1144267 3750 3709 3657 3518 3409 3225 1447 1328 1014 878 575 531 43 34444 4301 3415 13507 --
NM_025146chr3102706 2595 2477 2239 2229 2059 1826 1761 227 167 --11863 1233
NM_025152chr143310 235 125 21638 600 --11775
NM_025160chr1164205 3656 3474 3357 3167 2911 2724 1713 1688 1633 1542 946 926 451 429 123 33059 1219 905 33451 1114 250 1839
NM_025179chr1104031 3604 3127 1564 736 604 353 248 233 29 24159 224 23827 611 41743 1402 1192 74
NM_030627chr573838 3653 3529 3324 3160 544 138 2570 379 --1898
NM_030647chr7146331 4719 3934 3882 2091 1851 1669 1572 1251 793 439 412 321 203 1111 24486 3821 26013 125
NM_030674chr12175511 5496 5392 4358 4224 4140 3955 3844 1818 1431 1416 1313 1258 1107 917 427 419 34599 4543 1453 35396 4916 1214 --
NM_030777chr2042434 2278 2043 320 22327 2311 --1277
NM_030806chr1259030 9008 8089 7799 7788 7215 7013 6810 6636 6199 6071 6031 5816 3676 3605 3286 2976 2663 2028 1676 1311 1236 894 654 548 39195 8456 3032 --16928
NM_030816chr1123633 3536 3369 3275 3187 2790 1325 1275 634 553 163 96 ------
NM_030918chr1105335 4949 4333 4201 3952 3584 1548 910 404 281 53969 3892 1502 459 425 11411 --
NM_030945chr531909 364 322 32591 2569 445 1179 2774 71
NM_031268chr16115025 4720 4697 4584 3973 3638 3611 3529 998 882 155 34604 1224 182 14569 --
NM_031305chr46669 595 438 272 119 41 ----21334 501
NM_031427chr14145346 5326 5279 5181 5097 4774 4673 4452 4323 2392 1890 1829 1713 474 35740 323 48 35113 4039 1375 25838 4520
NM_031468chr7298057 7678 7652 7635 7311 7180 7152 6985 6962 6951 6839 6687 6583 6493 6456 6141 5873 5555 5512 5453 5101 3041 2608 2566 2433 1832 1289 479 137 47039 6350 5434 3119 --36125 2691 2361
NM_031469chr6103786 3509 3498 3419 2981 2629 2567 1588 1524 441 24126 1454 11461 --
NM_031911chr492789 2556 2471 2087 2060 1892 930 806 548 32365 2046 195 ----
NM_032102chr1162889 2470 904 891 528 89 22356 2281 --1708
NM_032105chr1237927 7739 7633 7605 7595 7438 7411 7222 6612 6170 5952 5891 5732 5624 5391 3048 2756 2697 2370 1183 699 390 157 37177 5352 1881 16361 1244
NM_032116chr1375031 4346 1187 784 604 466 52 --24131 446 2711 144
NM_032199chr1073303 2696 2546 1240 1215 921 859 --33745 1342 299 13538
NM_032208chr283469 2988 2976 2529 554 476 443 76 33234 3084 2821 --1833
NM_032221chr2061686 769 649 324 137 89 --21690 425 1376
NM_032281chr1972212 2021 1983 1057 630 588 310 43075 2165 1936 1079 --1443
NM_032288chr382127 1709 1574 863 753 698 280 58 21761 183 1887 1775
NM_032373chr1085634 4507 4286 4080 3853 2285 1892 559 25672 4627 --194
NM_032440chr1082553 2165 2137 2091 1090 991 495 373 1261 12516 1524
NM_032441chrX7459 384 333 261 211 167 84 3908 204 72 --1223
NM_032778chr392779 2403 2239 1236 714 583 565 340 322 22757 184 11229 --
NM_032859chr13103322 3066 2626 2606 2594 2444 1186 120 98 56 23133 2421 ----
NM_032873chr11143801 3735 3174 1554 1186 775 730 501 465 360 270 234 184 23 1400 ----
NM_032932chr17146105 5974 5877 4746 4406 1995 1858 1790 1747 1735 1372 926 788 307 36405 4055 1812 --1865
NM_032973chrY63743 3275 1252 1216 1149 1116 21139 647 ----
NM_033138chr772005 1953 1762 942 921 904 435 11720 21776 1644 --
NM_033139chr772005 1953 1762 942 921 904 435 11720 21776 1644 --
NM_033140chr772005 1953 1762 942 921 904 435 11720 21776 1644 --
NM_033143chr4114188 4125 3968 1396 1389 1265 1115 1104 503 406 113 34521 706 669 ----
NM_033157chr772005 1953 1762 942 921 904 435 11720 21776 1644 --
NM_033181chr663090 814 295 206 64 34 1519 22950 685 23987 3682
NM_033224chr7108000 6449 5264 2783 2612 2063 1245 512 228 205 77890 5940 5045 2653 1455 622 164 47700 6457 6354 1949 12220
NM_033290chrX73370 2933 2727 1282 738 487 222 13057 13006 1730
NM_033331chr993443 2560 2431 1380 831 695 582 136 28 11180 32564 760 354 --
NM_033340chr1081328 1084 1051 486 415 252 99 61 1923 --21089 1063
NM_033360chr1253456 3311 1634 1104 87 11299 --24090 3574
NM_033430chr4114189 3701 3497 3381 3366 2988 1503 1380 1293 804 377 34072 3418 619 --13566
NM_033437chr4114189 3701 3497 3381 3366 2988 1503 1380 1293 804 377 34072 3418 619 --13566
NM_033480chr662913 2381 1985 688 618 476 2937 61 --1192
NM_033481chr662913 2381 1985 688 618 476 2937 61 --1192
NM_033505chr2126315 5913 5846 5745 5202 4972 2110 1886 1855 1287 1035 816 15735 16437 --
NM_033512chr852692 1057 876 808 799 1127 12253 12924
NM_052840chr157645 500 354 94 58 48 39 1373 ----
NM_052851chr1392241 1680 1620 1582 1482 230 172 162 35 12104 2104 96 --
NM_052879chr12103228 3010 3001 2662 1528 1329 545 402 337 99 23459 2801 1462 13220
NM_052885chr1274469 4093 1720 1454 1021 148 48 21171 186 23412 3299 153
NM_052927chr592226 1925 1800 1658 1499 291 266 238 174 146 ----
NM_052996chr1691463 1443 1351 701 506 404 234 160 145 41182 307 120 73 --1706
NM_053016chr9157612 7447 7383 6372 5960 5848 5358 4983 3180 3086 2904 2443 2132 1868 206 35337 1297 753 1624 11290
NM_053064chr1463010 2748 1187 869 572 98 32766 2605 1129 32186 110 24 --
NM_058172chr481665 1606 1555 1344 1328 1167 359 311 ----2257 108
NM_080669chr17184068 3773 3756 3322 3200 3042 1839 1752 1697 1614 1477 1170 1138 1027 813 587 517 478 --24245 3266 --
NM_080737chrX51398 1296 1278 59 51 2222 69 1990 --
NM_080867chr1443323 3275 3169 759 14154 --14683
NM_133170chr20237844 6993 6518 6397 6344 6298 6224 6099 5702 5549 5446 5333 5287 4967 3200 3043 2692 2142 2029 1921 1435 853 122 --16914 --
NM_133265chrX82995 2945 2634 2542 2416 1300 975 462 11292 13542 1353
NM_133367chr692722 2127 1321 764 654 449 271 50 30 22215 1185 21039 997 --
NM_133370chr493476 3302 3087 2921 2511 873 252 168 123 11411 --13061
NM_133445chr993616 3203 3046 2898 1498 1488 1304 579 218 43356 3005 636 494 23673 2530 13086
NM_133468chr792388 2362 2308 2110 2070 2063 806 441 363 --3653 71 60 --
NM_133474chr491457 1258 1154 1146 1089 608 307 149 54 ----1518
NM_133493chr694541 4239 3750 3423 1829 1613 1366 933 399 14166 --24524 77
NM_133496chr184425 3618 3573 1798 1764 1683 1531 372 13847 --13303
NM_138286chr1953763 680 455 399 303 34132 3524 954 22866 95 --
NM_138292chr1183380 3102 3011 2995 2664 1324 508 433 22856 187 12277 1612
NM_138316chr1041359 1025 64 43 137 21379 309 11277
NM_138444chr13104239 3618 3155 1844 1640 1507 1043 1017 820 227 14978 2643 237 14703
NM_138459chr693441 3295 2522 2504 349 292 240 48 42 22789 445 ----
NM_138713chr16127707 7006 6952 6360 5843 5361 3211 2360 897 525 500 23 46133 5167 1307 149 11280 --
NM_138714chr16127707 7006 6952 6360 5843 5361 3211 2360 897 525 500 23 46133 5167 1307 149 11280 --
NM_138731chr1463895 1640 1381 1112 930 560 ----13839
NM_138959chr1126235 5491 4649 4500 4375 2614 2194 2144 2126 1720 1186 164 25370 2284 26305 4504 --
NM_139248chr36962 871 837 779 765 190 --2773 354 --
NM_139279chr2123294 3241 3046 2759 2507 2268 2163 839 401 296 173 150 22477 468 ----
NM_139321chr20134162 3819 3322 3232 3197 3136 3076 1680 1296 1102 984 938 288 54155 3301 1143 1036 956 24202 1300 --
NM_144571chr4106872 6605 6434 6206 5854 5343 4463 2813 924 664 56773 5048 4605 4591 1063 14382 14771
NM_144578chr14105419 5018 4402 3543 3375 2106 2053 1583 957 791 21798 113 1783 11659
NM_144599chr1575302 3690 1593 1332 594 80 31 64272 3997 3806 1871 1430 1418 ----
NM_144628chr20152943 2746 2489 2197 2137 2047 2029 1219 834 630 484 448 429 274 58 22896 2245 22914 2751 --
NM_144684chr1992922 2193 2141 1979 1140 1025 956 402 32 52810 2741 2532 2272 105 ----
NM_144949chr232233 2198 2041 1466 1306 1327
NM_144973chr12144876 4775 4747 4316 3707 3416 1809 1592 1506 1069 982 834 355 336 34831 1558 674 24786 3531 --
NM_145176chr693157 2545 2477 1316 1299 1274 459 171 120 ----12991
NM_145207chr464183 3875 3859 3755 3743 3617 24474 2147 11600 13820
NM_145259chr2216747 6640 6540 6306 5938 5896 5887 5808 5623 5175 4741 4664 2502 2337 2289 2216 2026 1710 1502 1088 258 36464 6187 336 21237 1126 --
NM_145307chr1094506 3898 3356 1565 1484 1310 1256 1055 156 21128 1085 ----
NM_145686chr2113125 2384 2354 2303 1319 1104 1018 922 687 534 54 22961 2395 --12325
NM_145687chr2113125 2384 2354 2303 1319 1104 1018 922 687 534 54 22961 2395 --12325
NM_145698chr1032119 422 187 11647 2683 516 1273
NM_145735chr1322474 1844 11755 21075 959 22230 475
NM_145808chr792989 2956 2855 2673 858 717 507 471 191 33139 944 864 131 --
NM_147150chr993655 3160 2624 2577 1107 1022 685 535 216 63737 3588 2779 765 585 279 11026 1353
NM_147223chr2102412 2294 2145 1773 1745 1615 1540 834 589 541 11736 2517 156 1893
NM_147233chr292229 2111 1962 1590 1562 1432 651 406 358 11553 1334 1710
NM_148170chr11155609 5386 4539 4413 4311 4255 4197 3932 3572 2037 1923 1534 532 517 267 44890 4363 2001 337 41438 1193 1067 509 --
NM_148955chr15196461 5905 5513 5280 5201 4971 4945 4873 4838 4516 4498 4041 1989 1814 1038 970 748 621 316 35671 5442 1965 15327 24163 2242
NM_148977chr1041359 1025 64 43 137 21379 309 11277
NM_148978chr1041359 1025 64 43 137 21379 309 11277
NM_152261chr1242079 1927 889 155 22558 856 11904 21642 909
NM_152263chr1135886 5336 5057 5035 4824 4803 4509 4434 4309 4198 2080 1150 247 16037 24331 275 23983 1549
NM_152280chr1113226 3198 3063 2890 2510 943 936 785 755 636 108 21195 140 22867 1300 12189
NM_152388chr293967 3473 3346 2981 2782 2598 1083 980 22 13188 --13947
NM_152414chr881667 1588 1273 525 298 139 130 44 11170 --11376
NM_152542chr492178 2029 1920 1748 1673 1610 868 793 786 22171 229 12085 --
NM_152624chr5136985 6881 6689 5023 2816 2478 2396 2021 1553 1504 1243 713 433 27023 613 --16166
NM_152734chr6165215 4846 4840 4810 4692 4536 4186 4107 3990 3972 3556 3507 3426 1291 971 207 41895 1664 1536 24 25453 3478 --
NM_152754chr7112905 1440 1215 1065 1033 849 524 494 426 221 27 43280 3241 2483 194 23023 1054 1908
NM_152756chr551489 912 840 578 265 34194 3593 2715 2959 582 --
NM_152787chrX103772 3522 3055 2938 2544 625 280 259 124 55 13269 13285 --
NM_152793chr7155203 4811 4805 4218 4054 3900 3814 3716 3670 1864 1840 405 333 303 24 24125 3530 ----
NM_152826chr15196461 5905 5513 5280 5201 4971 4945 4873 4838 4516 4498 4041 1989 1814 1038 970 748 621 316 35671 5442 1965 15327 24163 2242
NM_152836chr841794 592 84 50 21641 107 177 --
NM_152837chr841794 592 84 50 21641 107 177 --
NM_152924chr15135742 5716 5571 5369 5107 4636 2236 1751 1294 679 480 427 373 21080 365 12136 --
NM_153182chr392779 2403 2239 1236 714 583 565 340 322 22757 184 11229 --
NM_153184chr341913 1745 1643 49 21586 442 --1425
NM_153188chr595230 4220 4126 3474 1795 723 423 353 271 11063 1529 23538 389
NM_153207chr1284098 4049 3832 3374 3308 1229 1199 845 11314 --11435
NM_153235chr6122329 2250 1999 1731 1562 1554 1547 1535 1526 1511 690 105 --12067 --
NM_153262chr153074 1987 302 173 148 13226 2102 87 --
NM_153332chr8103305 2906 2875 2856 2745 2714 2520 636 615 47 1450 1570 13015
NM_153442chr10276439 6421 6410 6389 6366 6330 6297 5762 5699 5642 5542 5051 4995 4646 4505 4372 4048 2523 2240 1515 1506 1483 938 825 391 50 23 25661 5599 46426 6022 5260 2062 16102
NM_153456chr13145751 5717 5615 5178 5116 4791 2280 1751 1367 1333 935 815 334 75 35219 4343 1022 ----
NM_153645chr22123312 2930 2812 2205 2169 969 653 404 290 198 130 100 --13136 12672
NM_153712chr273536 2843 2684 1456 1419 1005 132 13195 12873 22849 1215
NM_153757chr44823 319 38 23 --1983 11162
NM_153810chr10174687 4583 4555 4422 4238 4163 3449 3173 2041 1959 1891 1742 1341 1092 657 259 125 34226 1672 338 23318 345 --
NM_153831chr85766 404 384 255 71 ----21014 293
NM_171825chr5113159 2531 2286 2244 1028 914 697 497 487 386 364 22424 1122 --1502
NM_172071chr1117507 7409 7046 6177 5528 5401 5151 2857 2090 811 97 26256 944 25574 66 --
NM_172159chr332354 686 420 1356 11535 2542 274
NM_172160chr332354 686 420 1356 11535 2542 274
NM_172240chr1261307 1156 1027 987 516 173 21075 562 1202 --
NM_173065chr1133640 3331 3231 2699 2486 778 750 583 433 404 115 93 26 1195 2452 97 12704
NM_173198chr962572 2564 2095 1183 1009 107 32762 992 393 --12455
NM_173200chr962572 2564 2095 1183 1009 107 32762 992 393 --12455
NM_173214chr16127707 7006 6952 6360 5843 5361 3211 2360 897 525 500 23 46133 5167 1307 149 11280 --
NM_173468chr4136060 5752 5687 5619 4583 4495 2313 1610 1561 1122 878 554 187 45641 5594 4553 3918 --15716
NM_173510chr22122860 2679 2556 2220 2162 1154 772 473 462 371 335 186 --32791 2083 41 --
NM_173511chr263671 3536 2688 2627 399 141 13767 11256 12562
NM_173582chr11146120 6007 5517 5451 5284 5196 4721 4711 4388 2438 2251 2180 1425 57 25664 1067 14127 --
NM_173602chr1273579 2595 2581 1436 1118 988 922 33600 570 70 43057 2609 599 39 --
NM_173642chr1209209 8497 8394 8100 8011 7857 7736 7719 7671 7143 6421 6350 6082 3610 3569 3491 2874 2540 2336 1199 99200 9111 8696 7463 6582 2471 1569 1349 204 28032 7723 --
NM_173808chr1154224 4104 3760 3143 2932 2911 2900 2892 2879 2871 2863 2825 2769 1480 743 14342 23243 2937 --
NM_173829chr595739 4440 3886 3771 2369 2328 1716 1130 1093 46001 5935 5272 4497 --12106
NM_173851chr893587 3146 1310 916 819 712 159 98 87 53316 3297 1481 745 327 --33277 2766 1320
NM_174911chr863835 3458 3195 3007 2617 175 12744 23711 402 22463 1286
NM_175623chr12177579 7146 6222 5958 5576 5547 5324 5236 2915 2613 2415 2143 1642 1500 839 565 497 56564 2451 2035 1586 1450 45644 1979 1819 203 --
NM_175624chr12177674 7241 6317 6053 5671 5642 5419 5331 3010 2708 2510 2238 1737 1595 934 660 592 56659 2546 2130 1681 1545 55739 2074 1914 298 90 --
NM_175625chr12177674 7241 6317 6053 5671 5642 5419 5331 3010 2708 2510 2238 1737 1595 934 660 592 56659 2546 2130 1681 1545 55739 2074 1914 298 90 --
NM_175736chr12207384 7302 7278 7030 6569 5755 5736 5091 2942 2903 2497 2440 2287 2236 2220 2164 1547 1424 1219 646 57579 6604 5440 1612 1467 11027 37307 6306 602
NM_175854chr13102801 2362 2159 1917 1898 1834 1025 796 691 183 42542 1710 595 373 31780 219 164 11839
NM_176081chr1095823 5622 4623 1480 1399 1230 1000 787 756 24796 4290 12362 45954 4889 643 537
NM_176083chr1095823 5622 4623 1480 1399 1230 1000 787 756 24796 4290 12362 45954 4889 643 537
NM_176823chr1133839 3500 3477 3120 3029 2888 2829 2391 1173 824 659 396 138 33182 1315 39 ----
NM_177398chr151920 1436 1315 1274 94 1251 --21323 384
NM_177399chr151920 1436 1315 1274 94 1251 --21323 384
NM_177538chr2148082 7619 7612 7223 6699 3459 3314 2790 2327 2315 2255 2039 989 41 37116 2401 1835 12879 --
NM_177990chr2041539 681 596 578 1347 31379 685 272 160
NM_178006chr1392241 1680 1620 1582 1482 230 172 162 35 12104 2104 96 --
NM_178007chr1392241 1680 1620 1582 1482 230 172 162 35 12104 2104 96 --
NM_178011chr1063134 2394 1186 470 251 63 23165 53 32237 1240 1190 --
NM_178037chr12133584 3331 3238 3199 2781 2751 2506 2266 880 495 420 356 199 21234 1179 2645 617 21161 431
NM_178038chr12133584 3331 3238 3199 2781 2751 2506 2266 880 495 420 356 199 21234 1179 2645 617 21161 431
NM_178151chrX157793 7404 6762 5990 2997 2253 2221 2115 1368 1132 1046 675 569 459 420 37153 6952 2241 22257 1924 21081 481
NM_178152chrX157793 7404 6762 5990 2997 2253 2221 2115 1368 1132 1046 675 569 459 420 37153 6952 2241 22257 1924 21081 481
NM_178153chrX157793 7404 6762 5990 2997 2253 2221 2115 1368 1132 1046 675 569 459 420 37153 6952 2241 22257 1924 21081 481
NM_178539chr1281468 1375 1363 1308 645 467 279 247 ----11631
NM_178812chr871345 1253 1082 1044 1023 329 243 21560 261 ----
NM_181332chrX81715 710 536 509 457 76 64 57 2975 377 ----
NM_181351chr1152596 2310 2079 332 318 --11090 22072 1914
NM_181457chr261189 1024 461 382 375 80 1953 --11099
NM_181458chr261322 1157 594 515 508 213 11086 166 11232
NM_181459chr261088 923 462 360 281 274 1852 1466 1998
NM_181460chr271135 970 509 407 328 321 26 1899 1513 11045
NM_181481chr18156433 5770 5544 4882 4503 4321 2829 2684 2076 1700 1460 527 396 269 30 66070 5986 5691 4270 1663 1477 66494 5800 4299 2251 1299 427 11504
NM_181482chr18156433 5770 5544 4882 4503 4321 2829 2684 2076 1700 1460 527 396 269 30 66070 5986 5691 4270 1663 1477 66494 5800 4299 2251 1299 427 11504
NM_181483chr18156433 5770 5544 4882 4503 4321 2829 2684 2076 1700 1460 527 396 269 30 66070 5986 5691 4270 1663 1477 66494 5800 4299 2251 1299 427 11504
NM_181521chr16107280 6247 6018 5720 5424 4416 2671 2532 1398 357 35010 1989 1540 27155 1896 --
NM_181659chr2093360 2307 2234 1118 818 733 615 101 70 31324 434 371 22238 381 13235
NM_181659chr2093360 2307 2234 1118 818 733 615 101 70 31324 434 371 22238 381 13235
NM_181705chr5115309 5293 5274 4322 4079 3916 2030 1202 878 662 167 35801 4706 176 ----
NM_181706chr1131623 290 251 32298 2090 1826 --11798
NM_181714chr641346 1283 191 185 1680 1440 11233
NM_182485chr483547 2785 2744 1492 1299 1110 1088 84 --22289 1258 --
NM_182493chr1674602 3492 721 394 334 185 61 21415 1101 35412 4249 1306 --
NM_182503chr6155573 5118 4744 4616 4302 3737 3634 3576 2164 2058 1903 1852 1825 1819 1396 2819 387 ----
NM_182515chr1985520 5480 4734 1254 1199 982 576 32 24807 2479 34190 514 182 21106 264
NM_182646chr483547 2785 2744 1492 1299 1110 1088 84 --22289 1258 --
NM_182728chr1451392 612 603 322 182 ----2652 617
NM_182734chr2073102 2348 2288 1191 567 392 230 23281 45 32352 463 404 1550
NM_182762chr7226020 5570 5543 5438 4818 4628 4174 4131 4085 4043 4000 3960 2386 2168 1832 1750 1701 1597 801 603 584 157 34254 2348 1969 26120 3784 --
NM_182763chr1112553 2208 2078 1972 1850 1755 789 724 397 180 159 31856 308 144 12093 --
NM_182898chr7156540 6370 6251 6058 5949 5037 4924 4913 4014 2488 1994 1981 1949 1296 1210 25158 1900 34928 2170 33 16072
NM_182899chr7156540 6370 6251 6058 5949 5037 4924 4913 4014 2488 1994 1981 1949 1296 1210 25158 1900 34928 2170 33 16072
NM_194247chr274367 4135 3747 3395 1410 890 128 33581 3119 1333 1105 --
NM_194283chr5174183 4067 3966 3794 3606 3489 3477 3443 3307 3266 3101 2764 2598 1251 860 776 297 53885 3524 2706 569 523 34152 3481 955 --
NM_194285chr11113156 2996 2895 2257 1251 1234 1069 789 496 115 71 12123 ----
NM_194286chr12175903 5833 5715 5409 4223 3985 2453 2370 1909 1361 1347 817 735 571 265 236 135 --14814 25039 4160
NM_194317chr2112637 2533 1997 1889 1877 1089 1023 988 512 394 152 ----1307
NM_194434chr1885594 5457 5448 5249 5161 1972 309 272 45416 4306 3907 3654 11459 25300 4979
NM_198181chr1592533 2521 2241 1101 1085 1028 845 720 653 22871 2181 ----
NM_198270chrX63190 3157 2768 2435 1388 434 ----22905 63
NM_198281chr492937 1312 1234 922 834 805 493 456 100 42569 671 515 202 ----
NM_198320chr12175247 5140 4587 4041 3774 3541 3246 1547 1475 1204 789 782 593 340 183 125 103 14617 ----
NM_198321chr563217 2702 1047 653 472 128 43260 3057 1985 759 --42708 921 320 199
NM_198392chr682247 1778 1735 1606 760 232 128 97 1340 --22207 1745
NM_198400chr1542531 2098 144 119 22633 2143 2872 814 --
NM_198468chr683812 3756 3684 3577 1093 989 727 163 11240 11105 13666
NM_198484chr3206161 6019 5942 5724 5335 5246 5138 5003 4871 4844 4648 4542 4185 4095 2445 1793 1513 1313 649 237 45705 4908 2067 2016 26092 2268 --
NM_198715chr1116184 5961 5881 5729 5237 4702 4268 1340 774 618 341 24615 2043 14241 --
NM_198859chr3144827 4050 3999 3820 3746 3223 1978 1783 1203 1148 1097 109 43 27 43844 1802 1154 625 21274 1232 --
NM_198900chr12207384 7302 7278 7030 6569 5755 5736 5091 2942 2903 2497 2440 2287 2236 2220 2164 1547 1424 1219 646 57579 6604 5440 1612 1467 11027 37307 6306 602
NM_199169chr20113565 3111 3071 3014 993 861 692 504 465 81 69 ----13345
NM_199170chr20113565 3111 3071 3014 993 861 692 504 465 81 69 ----13345
NM_199171chr20113565 3111 3071 3014 993 861 692 504 465 81 69 ----13345
NM_199188chr12103228 3010 3001 2662 1528 1329 545 402 337 99 23459 2801 1462 13220
NM_199190chr12103228 3010 3001 2662 1528 1329 545 402 337 99 23459 2801 1462 13220
NM_199324chr453351 3122 2285 905 749 13505 --22575 711
NM_199421chr1443323 3275 3169 759 14154 --14683
NM_199436chr293070 2868 2751 2424 2211 2100 922 845 46 2370 345 12860 --
NM_199454chr1134695 4568 4322 4148 3862 3121 1799 1761 1731 1502 870 756 648 44611 1233 435 222 44572 1533 80 55 --
NM_199462chr1214923 4738 4306 4093 3842 3704 3418 3256 3233 1924 1735 1634 1608 1457 1297 1242 881 672 258 169 68 1772 ----
NM_199478chrX112009 1721 1650 1559 723 560 526 506 498 395 371 21766 1452 ----
NM_203382chr561471 1342 520 331 176 48 --1311 2482 288
NM_203458chr193767 3345 3325 3113 1437 1074 621 519 453 43492 997 951 460 ----
NM_203463chr2154385 4318 4005 3965 3451 1887 1740 1642 1396 1277 1098 831 780 337 169 11874 34334 603 173 11292
NM_205860chr1113140 2317 1256 1188 546 458 369 359 308 78 66 22257 2209 --171
NM_206594chr193259 2945 2841 2800 1425 1007 672 565 73 33363 2225 942 --1991
NM_206595chr193259 2945 2841 2800 1425 1007 672 565 73 33363 2225 942 --1991
NM_206854chr664919 3947 3282 1583 1273 1265 24889 4878 11022 1248
NM_206855chr695884 4912 4247 4066 3902 2548 2238 2230 512 25854 5843 34119 1987 982 11213
NM_206876chr263148 2549 2348 1365 1359 1046 32902 2879 43 22780 476 --
NM_206909chr8288369 7617 7589 7486 7056 7030 6850 6702 6381 6274 5956 5895 5407 5305 3366 2658 2561 2534 2106 1575 1372 1143 1049 720 688 623 499 360 68076 8038 7198 6138 5097 2482 37148 5485 5208 --
NM_207015chr371776 970 765 733 623 604 240 32071 348 163 1456 --
NM_207292chr393148 2856 2434 1360 1152 1021 159 65 35 43230 2869 259 41 ----
NM_207293chr393148 2856 2434 1360 1152 1021 159 65 35 43230 2869 259 41 ----
NM_207294chr393148 2856 2434 1360 1152 1021 159 65 35 43230 2869 259 41 ----
NM_207295chr393148 2856 2434 1360 1152 1021 159 65 35 43230 2869 259 41 ----
NM_207296chr393148 2856 2434 1360 1152 1021 159 65 35 43230 2869 259 41 ----
NM_207297chr383173 2881 2459 1177 1046 184 90 60 43255 2894 284 66 ----
NM_207303chr1084048 3942 2730 1618 897 853 787 159 13461 --11047
NM_207361chr13165439 5350 5339 5310 4926 4508 4406 1777 1471 1324 947 874 590 574 347 258 75387 5059 4662 1479 1017 682 182 --24374 2514
NM_207406chr486357 6173 5865 5833 5323 1893 1803 370 35962 5505 549 24695 1682 --
NM_207481chr23559 154 132 1271 21151 103 1126
NM_207578chr13180 150 120 --3532 109 63 1155
NM_212467chr1582546 2388 2228 1733 670 454 313 53 --2818 34 22359 1627
NM_213589chr2105193 5183 4762 4029 3875 3514 3488 3469 1676 294 32090 1855 1123 ----