TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-221-3p
miRNA Sequence: AGCUACAUUGUCUGCUGGGUUUC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000052chrX22988 712 12408 22498 864 12913
NM_000084chrX116927 6639 6116 5745 5477 5104 5075 4901 2552 2157 1430 16280 11644 14726
NM_000112chr553938 1610 1311 499 177 34801 4038 3455 1399 --
NM_000129chr6146 ------
NM_000176chr563749 3718 3278 2489 270 146 22821 1364 ----
NM_000222chr451939 1628 1453 1433 435 ----11966
NM_000248chr3--11163 ----
NM_000259chr1566321 5774 4305 2498 2065 2013 12446 15002 1799
NM_000332chr666221 4359 2563 1312 409 389 15032 --11633
NM_000408chr243418 2173 973 97 --12738 13002
NM_000449chr11219 ------
NM_000555chrX87097 6968 6855 6808 2066 1854 1791 1221 26829 55 11088 --
NM_000574chr1------1902
NM_000609chr1012883 --13165 1163
NM_000610chr1132705 2196 1186 1556 ----
NM_000633chr1864737 3877 1502 1355 1142 333 21714 1333 23472 3413 --
NM_000806chr521948 1202 11486 --11408
NM_000813chr535369 1994 66 13887 25339 4367 --
NM_000933chr2011209 ------
NM_000945chr221585 242 1195 1349 1366
NM_000949chr5----185 --
NM_001001331chr3--12588 ----
NM_001001344chrX22559 784 ----1774
NM_001001389chr1132705 2196 1186 1556 ----
NM_001001390chr1132705 2196 1186 1556 ----
NM_001001391chr1132705 2196 1186 1556 ----
NM_001001483chr112457 60 ------
NM_001001668chr1953006 1131 877 720 585 13063 11327 11346
NM_001003712chr1222982 129 11145 12556 13964
NM_001003810chr4----1592 1316
NM_001004328chr1252225 446 204 185 50 2793 211 ----
NM_001006610chr16------1166
NM_001007257chr11989 11104 --11353
NM_001008239chr1833262 2773 1212 33821 1176 107 23062 867 1948
NM_001008408chr755165 4918 2113 499 288 21527 1125 14944 --
NM_001009881chr11485 ------
NM_001009882chr11485 ------
NM_001009899chr395562 5486 5209 4862 4320 4059 1454 365 139 ----12610
NM_001010891chr554931 4533 2139 1309 1208 1748 36213 979 420 26655 723
NM_001010895chr9--1711 ----
NM_001011551chrX--163 ----
NM_001012393chr1175133 4479 3794 3399 3192 602 216 ----14409
NM_001012506chr3------1141
NM_001013746chr7--21541 573 --6742 489 409 325 241 157
NM_001014797chr10117103 6782 6714 6529 6449 5289 5182 2422 901 779 759 ----16187
NM_001015877chrX23058 2335 13066 --11940
NM_001017395chr343567 3179 1345 316 11175 13395 1228
NM_001017405chr41883 ------
NM_001017979chr42592 100 ------
NM_001018074chr563749 3718 3278 2489 270 146 22821 1364 ----
NM_001018075chr563749 3718 3278 2489 270 146 22821 1364 ----
NM_001018076chr563749 3718 3278 2489 270 146 22821 1364 ----
NM_001018077chr563749 3718 3278 2489 270 146 22821 1364 ----
NM_001020825chr521224 1193 1296 ----
NM_001024094chr563749 3718 3278 2489 270 146 22821 1364 ----
NM_001024934chr61461 ------
NM_001024935chr61461 ------
NM_001024936chr61461 ------
NM_001024937chr17----1726 --
NM_001025203chr212136 43 ------
NM_001025204chr212136 43 ------
NM_001025580chrX54239 3200 2739 2646 273 14275 --23063 2775
NM_001025603chr11219 ------
NM_001025780chr9----21502 1435 --
NM_001030007chr1633299 1223 793 ------
NM_001030055chr1464520 4327 3469 862 656 451 21328 285 11005 11709
NM_001030059chr10185 ------
NM_001031746chr10----11166 --
NM_001031803chr171256 ------
NM_001033057chr352072 2011 1908 1293 442 11394 2429 421 --
NM_001033117chr393951 3874 3404 1373 1361 1186 959 906 38 ----23983 3111
NM_001033925chr1012135 1689 ----
NM_001037225chr11193 ------
NM_001038628chr33399 343 195 11586 31347 425 368 --
NM_001039479chr142750 698 1923 1871 --
NM_001039547chr3127399 6938 6630 5486 5192 4942 2482 2302 2194 1624 1184 474 1236 ----
NM_001039615chr852224 446 204 185 50 1211 --1792
NM_001039618chr1174969 4943 4822 4778 4768 4541 2324 25349 4042 11923 15423
NM_001039619chr14--158 ----
NM_001039693chr243713 3138 2955 2656 --23889 3597 --
NM_001039840chrX75426 4334 1840 1114 755 692 589 --14288 13795
NM_001039937chr1322802 1654 --12664 13357
NM_001040001chr611915 ------
NM_001040113chr161883 ------
NM_001040114chr161742 ------
NM_001040402chr422054 926 2350 170 --1408
NM_001040429chr13------13568
NM_001040876chr41164 ------
NM_001042355chr1654786 4714 3893 975 406 14768 --11899
NM_001042370chr11223 ------
NM_001042412chr1654786 4714 3893 975 406 14768 --11899
NM_001042537chrX----11645 --
NM_001042555chr1244240 3246 1305 159 44199 3584 3054 1386 1434 --
NM_001042599chr256862 6587 5957 5227 2859 23139 2931 11079 16634
NM_001042604chr354227 3992 2976 1573 454 --1907 --
NM_001048183chr143393 1524 1328 401 1231 --1147
NM_001077628chr11599 ------
NM_001085487chr1178 ------
NM_001099678chr324894 1865 --12570 11724
NM_001106chr389233 7705 6560 6195 2909 2287 2024 1176 37777 3268 1521 29700 1385 29211 2584
NM_001126chr1----1320 --
NM_001128chr1633299 1223 793 ------
NM_001172chr14--1491 ----
NM_001173chr1464520 4327 3469 862 656 451 21328 285 11005 11709
NM_001200chr201413 ------
NM_001204chr287066 6239 6042 5175 4981 2920 2655 915 17254 ----
NM_001278chr10----1385 11031
NM_001391chr18----1120 --
NM_001397chr122660 2332 ------
NM_001418chr111163 --1768 --
NM_001418chr111163 --1768 --
NM_001438chr123146 2486 ------
NM_001453chr61527 ------
NM_001493chrX1314 ------
NM_001616chr232254 1036 781 --1263 --
NM_001642chr11----1259 --
NM_001663chr1432743 2340 1898 --12492 12216
NM_001668chr1----11453 11890
NM_001683chr3--12588 ----
NM_001759chr1244746 4682 4387 580 21327 391 34955 872 767 --
NM_001792chr182870 92 ------
NM_001873chr4159 --1616 146
NM_001903chr51814 ------
NM_001924chr1162 ------
NM_001942chr182672 263 11918 1743 11516
NM_001951chr8----1585 --
NM_001969chr142951 519 --23917 204 --
NM_001999chr511106 ------
NM_002025chrX89188 9122 9101 6916 6719 6273 2714 2304 48550 8215 3675 536 11555 12462
NM_002033chr1163551 3257 2851 2557 483 364 --13830 12896
NM_002135chr12----1554 --
NM_002138chr4----1592 1316
NM_002158chr2------23630 3322
NM_002223chr1241554 1505 678 527 1410 --11099
NM_002271chr1352425 2250 1636 917 111 ----11587
NM_002317chr51314 ------
NM_002336chr1254039 4028 3999 3424 1415 11684 1441 --
NM_002356chr6--11064 --12419
NM_002382chr1411221 ------
NM_002389chr151528 1457 246 214 188 1748 1236 --
NM_002399chr15--1577 ----
NM_002474chr161742 ------
NM_002489chr71275 ------
NM_002494chr4145 ----123
NM_002515chr1431965 307 290 11919 --12073
NM_002527chr12------159
NM_002545chr1175133 4479 3794 3399 3192 602 216 ----14409
NM_002590chr13----1172 --
NM_002613chr16125415 5357 4985 4889 4138 4028 3594 3440 1994 1842 620 402 ------
NM_002758chr171368 ------
NM_002825chr7--1151 1490 --
NM_002827chr2011437 ----11635
NM_002852chr3----1480 --
NM_002894chr18----1218 --
NM_002940chr41164 ------
NM_002959chr154140 3406 1494 981 65 --33946 1409 1292 12737
NM_002970chrX181 ------
NM_002977chr253428 3417 2457 620 285 ----12132
NM_003036chr1----1151 --
NM_003072chr191320 --190 --
NM_003108chr287056 6859 6169 6119 5776 5153 1331 68 11473 16211 14717
NM_003112chr741963 965 903 234 13236 ----
NM_003199chr1894524 4387 3811 2240 1959 1363 1179 966 833 24561 3958 ----
NM_003202chr511828 ------
NM_003246chr1511794 11605 1792 1808
NM_003275chr91157 ----11094
NM_003298chr366211 5807 5210 4640 1546 1021 11421 --16198
NM_003319chr2----1926 --
NM_003341chr31574 ----1239
NM_003390chr111317 ----1759
NM_003403chr14------1645
NM_003410chrX12723 ------
NM_003430chr1931298 473 44 ----41503 1167 307 223
NM_003441chr4--1445 --71177 1094 931 529 368 358 31
NM_003470chr1611843 ------
NM_003472chr6--1399 ----
NM_003601chr4----1149 --
NM_003607chr164271 4154 1433 1040 978 552 ----13544
NM_003659chr21144 ------
NM_003673chr17198 ------
NM_003677chr12--11710 11824 --
NM_003685chr191815 ------
NM_003688chrX1113 ------
NM_003692chr91956 2851 114 1930 --
NM_003750chr10--1866 ----
NM_003781chr33399 343 195 11586 31347 425 368 --
NM_003794chr31354 1936 --2803 157
NM_003797chr11----1134 --
NM_003816chr8----1393 --
NM_003862chr51228 ------
NM_003931chr61461 ------
NM_003934chr911032 --1862 --
NM_003955chr171107 ----21250 167
NM_004036chr21190 ------
NM_004097chr21335 ------
NM_004171chr11129678 9550 8257 8081 8070 7475 7114 7036 3453 2744 1555 317 31916 1363 855 19210 --
NM_004236chr15--1517 ----
NM_004241chr10--1125 ----
NM_004331chr832677 2218 738 ----12206
NM_004349chr811165 ------
NM_004385chr5----1468 --
NM_004458chrX----1341 --
NM_004464chr464114 3679 3249 2956 806 723 --12756 22999 1417
NM_004469chrX1348 ------
NM_004501chr153144 2641 1483 640 495 23490 881 ----
NM_004505chr17156 1246 31277 309 100 --
NM_004524chr171228 ------
NM_004576chr5--1348 ----
NM_004598chr523305 844 ----13214
NM_004646chr191432 ------
NM_004713chr142536 245 ------
NM_004857chr1444602 1335 989 731 166 14036 23622 3468
NM_004859chr1741080 977 319 22 12381 12714 --
NM_004939chr2145 ------
NM_004953chr31110 ------
NM_004961chrX1404 11417 ----
NM_005065chr1435365 3829 1802 34991 4632 4166 --14311
NM_005103chr11----1273 --
NM_005104chr61625 ------
NM_005119chr1------1468
NM_005156chr911785 25375 5159 --14485
NM_005171chr12----1994 --
NM_005180chr1021438 121 --1475 --
NM_005188chr11117041 5703 5632 3179 2328 2284 2188 1466 1337 1316 987 18366 37680 2541 361 15244
NM_005235chr256862 6587 5957 5227 2859 23139 2931 11079 16634
NM_005277chr421910 697 31841 1547 1515 11342 --
NM_005339chr423265 1733 23773 3607 --13167
NM_005359chr1866501 6466 5068 2251 1492 472 --14539 15016
NM_005388chr92170 104 11536 ----
NM_005504chr1276401 6259 6079 5143 4153 2196 633 1121 25409 113 --
NM_005575chr5----1192 --
NM_005596chr964509 2101 1869 1265 797 624 ----15486
NM_005648chr8154 ------
NM_005657chr15--1168 ----
NM_005744chr15--1121 ----
NM_005779chr563550 3311 1445 1053 970 883 12792 ----
NM_005828chr1774790 4641 4200 3386 3114 1354 196 44773 4618 657 178 --13825
NM_005832chr32314 126 2968 907 --11305
NM_005836chr8121 ------
NM_005863chr10--11081 ----
NM_005882chr41883 ------
NM_005904chr1811195 ------
NM_006007chr911048 24341 730 24059 278 --
NM_006016chr61222 ----22087 1924
NM_006039chr1711055 ------
NM_006099chr12889 756 ------
NM_006109chr14--158 ----
NM_006154chr1552286 2252 988 804 22 --192 1935
NM_006195chr951323 941 896 255 84 --11417 --
NM_006197chr8----1281 --
NM_006246chr14----11025 154
NM_006298chr611366 --22360 487 12398
NM_006317chr51709 ------
NM_006359chrX----11645 --
NM_006380chr1754302 3293 737 430 411 23001 1371 --11320
NM_006391chr11134 ------
NM_006449chr232183 2097 529 ------
NM_006489chr1431965 307 290 11919 --12073
NM_006496chr111956 --1314 1760
NM_006524chr741063 902 305 230 ----5820 736 400 148 64
NM_006530chr12----1468 --
NM_006547chr721704 286 ------
NM_006599chr1643011 2217 1486 1447 21341 932 --16164
NM_006644chr131158 ------
NM_006654chr1244240 3246 1305 159 44199 3584 3054 1386 1434 --
NM_006667chrX1255 ------
NM_006722chr3--11163 ----
NM_006726chr42209 147 ------
NM_006758chr212136 43 ------
NM_006806chr21----1412 --
NM_006826chr22941 265 --1356 11123
NM_006898chr22647 50 ------
NM_006914chr92537 443 ----11243
NM_006922chr211913 11716 ----
NM_007006chr1642418 1277 77 66 23024 3004 11146 --
NM_007011chr15106933 6280 5920 4682 4453 2528 2425 1363 1127 506 26144 4320 ----
NM_007038chr2165939 4943 4700 4678 1172 776 --12166 1577
NM_007114chr372955 2920 2872 1209 663 510 64 ----1153
NM_007157chrX12616 22644 1968 130 2834 339
NM_007207chr1197 ------
NM_007212chr1--1460 ----
NM_007276chr71210 11058 ----
NM_007347chr152987 276 12958 1440 13037
NM_007361chr142570 138 ------
NM_012141chr1322802 1654 --12664 13357
NM_012156chr20--22423 1139 --12948
NM_012157chr3--1832 ----
NM_012177chr6--1113 ----
NM_012214chr245988 4980 4456 1270 34525 4443 1102 --14008
NM_012322chr71277 ------
NM_012334chr544232 3554 3401 3206 ----1826
NM_012341chr101420 ------
NM_012343chr511095 2764 98 1288 1841
NM_012402chr1121296 1288 ------
NM_013261chr433460 3199 867 --11072 13229
NM_013281chr20--1390 1200 --
NM_013300chr12----1155 --
NM_013316chr71938 ------
NM_014011chr252570 2301 1927 1682 430 12280 2736 547 --
NM_014028chr622659 2233 ----23234 813
NM_014033chr12------12276
NM_014048chr1655259 4867 4770 1745 594 ----14066
NM_014109chr8--1227 --180
NM_014112chr885316 3987 3871 3482 2146 2000 1396 785 --14949 24879 1638
NM_014283chr111522 165 ----
NM_014290chr9------160
NM_014363chr131427 145 1911 --
NM_014372chr1--11605 --21563 1311
NM_014456chr10--1347 ----
NM_014607chr21479 ------
NM_014616chr333400 1201 324 23362 113 --13450
NM_014661chr1093868 3795 3616 3385 3134 1466 1267 876 830 --11341 --
NM_014667chr342389 1626 632 403 --11880 1239
NM_014670chr211612 --21263 1243 --
NM_014721chr686863 6511 6023 5836 2874 1607 531 168 24884 851 15778 --
NM_014729chr821950 465 ----1394
NM_014733chr52761 208 11422 --1889
NM_014736chr151891 ------
NM_014747chr134096 1629 157 ----54425 3597 2285 620 517
NM_014752chr112203 184 ----1331
NM_014761chr1621173 973 21108 754 ----
NM_014810chr162995 2508 2399 1439 552 152 13103 --12287
NM_014826chr164271 4154 1433 1040 978 552 ----13544
NM_014850chr393951 3874 3404 1373 1361 1186 959 906 38 ----23983 3111
NM_014872chr972286 2206 1807 1742 1688 1524 838 22145 344 --1149
NM_014905chr2----1630 --
NM_014906chr1724047 687 --11160 --
NM_014912chr1053476 2875 1114 298 208 --13134 1475
NM_014950chr141496 ------
NM_014969chr1----1223 11127
NM_014989chr621766 1736 2613 122 --11700
NM_014990chr142903 329 ----21281 1198
NM_014996chr3----1350 --
NM_015008chr343567 3179 1345 316 11175 13395 1228
NM_015009chr3--1758 ----
NM_015026chr1233709 3499 3214 1824 1647 24175 1599
NM_015032chr1322320 234 12618 12715 12412
NM_015040chr242731 2215 821 129 12236 ----
NM_015051chr9--22695 2310 --21241 679
NM_015074chr154629 4244 4000 856 106 24264 3315 1221 11542
NM_015076chr644346 4131 1670 676 1329 1777 14216
NM_015094chr221868 ------
NM_015107chrX6977 842 836 830 807 714 ------
NM_015115chr422054 926 2350 170 --1408
NM_015143chr41278 ------
NM_015176chr1----11379 11709
NM_015184chr3153 ----1161
NM_015208chr1833964 3948 421 1671 1759 1135
NM_015216chr5----11495 --
NM_015247chr1654786 4714 3893 975 406 14768 --11899
NM_015260chr19----11574 --
NM_015269chr11485 ------
NM_015271chr41402 13735 1274 1916
NM_015285chr1822374 926 1942 32387 1689 222 1442
NM_015294chr172748 57 --1239 --
NM_015310chr867740 6213 5940 5663 1940 399 23282 2644 13202 --
NM_015365chrX54239 3200 2739 2646 273 14275 --23063 2775
NM_015520chr342770 2709 2606 1991 12092 21127 1119 1681
NM_015550chr721072 204 32937 2615 1272 33610 3075 2722 11400
NM_015649chr191265 ------
NM_015716chr17----1726 --
NM_015852chr732653 992 320 ----101243 1162 1078 826 658 574 490 406 238 70
NM_015866chr11989 11104 --11353
NM_015879chr18108509 7772 6096 5497 2666 2216 1605 1312 862 831 11202 ----
NM_015886chr853606 3591 1902 1220 416 25628 5132 25725 1492 --
NM_016022chr11991 ------
NM_016132chr1513164 --12986 1626
NM_016220chr7--21541 573 --6742 489 409 325 241 157
NM_016227chr111522 165 ----
NM_016260chr257377 7319 6410 5797 1548 36791 2735 2600 37169 6752 781 --
NM_016300chr31471 ------
NM_016441chr2--11615 ----
NM_016475chr14--11129 ----
NM_016587chr71210 11058 ----
NM_016620chr1------11305
NM_017412chr841145 984 454 326 ------
NM_017569chr13----1324 --
NM_017628chr455294 4767 4562 3816 3582 2942 868 24935 3843 23963 3731
NM_017637chr968635 8018 6508 3517 1189 136 --12731 13230
NM_017658chr1454417 3875 1520 1389 307 13697 13221 11826
NM_017693chr131134 ------
NM_017714chr201149 ------
NM_017758chr1711490 ------
NM_017944chr1163015 2605 2334 1907 1051 708 --23071 1061 --
NM_017946chr711349 ------
NM_018047chr5193 ------
NM_018084chr232671 2538 27 1471 --12607
NM_018085chr156777 6572 5015 1948 852 37386 6984 5003 14973 --
NM_018133chr321503 1473 ----2760 539
NM_018137chr111159 ----1263
NM_018144chr10----1363 --
NM_018293chr31817 ------
NM_018370chr1242286 1903 1719 204 ----1850
NM_018374chr775221 4720 4641 1585 1327 964 141 11906 11355 25059 4415
NM_018386chr131142 ------
NM_018387chr91467 ------
NM_018403chr342753 2565 1170 266 11257 33889 3249 2790 --
NM_018433chr2------1179
NM_018638chr1275296 4464 3800 1343 919 507 202 15160 1661 --
NM_018650chr162026 1641 1483 192 108 83 2772 465 11554 --
NM_018710chr811353 ----11182
NM_019001chr354227 3992 2976 1573 454 --1907 --
NM_019027chr4--1371 --12602
NM_019028chr112457 60 ------
NM_019045chrX1790 ------
NM_019046chr101687 ------
NM_019072chr523803 3403 13795 ----
NM_019852chr141115 ------
NM_019859chr1011627 ----11206
NM_019860chr1011675 ----11254
NM_020066chr12854 807 ------
NM_020194chr2----1689 --
NM_020198chr171270 ----2569 535
NM_020382chr12--1154 ----
NM_020466chr6134719 4146 3401 3367 1907 1761 1691 1157 1050 1000 719 457 304 13847 --14104
NM_020703chr1--1462 ----
NM_020718chr1696249 5599 5175 5012 4380 2240 2030 1029 639 1865 14638 --
NM_020766chrX23213 423 --1782 --
NM_020772chr1737819 6689 1499 48172 5780 3043 1598 12684 16490
NM_020818chr141378 ------
NM_020832chr1--1621 ----
NM_020841chr1222982 129 11145 12556 13964
NM_020860chr4----11130 --
NM_020861chr6178 ----1967
NM_020948chr123079 673 1860 11429 --
NM_021033chr1333477 1007 578 11054 ----
NM_021038chr343282 2994 2648 936 ------
NM_021145chr721111 386 --1204 --
NM_021159chr42678 272 ------
NM_021238chr1211675 --22003 587 --
NM_021252chr1051906 1792 1584 1446 708 --21865 526 1214
NM_021911chr535369 1994 66 13887 25339 4367 --
NM_021949chrX32854 1815 1079 ----11069
NM_021957chr12----1504 --
NM_021984chrX1404 11417 ----
NM_021987chrX1404 11417 ----
NM_021990chrX1404 11417 ----
NM_022037chr2--153 ----
NM_022166chr1655985 5836 5718 5250 3952 15218 15126 1755
NM_022173chr2--153 ----
NM_022373chr7--1269 ----
NM_022470chr311160 ------
NM_022483chr521872 1811 ------
NM_022753chr122695 2105 12790 12065 --
NM_022763chr323175 1098 ------
NM_022776chr31368 ------
NM_022826chr21332 ------
NM_022841chr15----11012 22129 23
NM_022844chr161883 ------
NM_022913chr5----194 --
NM_022977chrX----1341 --
NM_023033chr12----1512 --
NM_023923chr143393 1524 1328 401 1231 --1147
NM_024511chr443453 3271 2917 634 11395 --1158
NM_024624chr211441 ------
NM_024665chr384531 4314 4256 3962 3442 3022 1085 931 13748 1809 --
NM_024744chr22932 787 ----1738
NM_024745chr16176 --1851 --
NM_024763chr1129 ------
NM_024852chr11273 ------
NM_024947chr379526 8656 7810 6898 2992 1946 1888 48775 7607 1849 1219 --17216
NM_024949chr434709 1890 1820 24401 3213 13289 11310
NM_024953chr1222524 2500 ----12070
NM_024989chr268100 7361 7006 5698 5160 1291 28154 7862 25882 2542 27258 207
NM_025079chr11253 ------
NM_025164chr11--12096 ----
NM_025260chr6127 ------
NM_030621chr1444236 2964 400 196 13072 1868 12887
NM_030627chr532957 2549 1067 33921 3377 104 23088 3044 --
NM_030648chr445484 3403 1428 639 21496 967 --23590 463
NM_030790chr161218 ------
NM_030912chr101848 ------
NM_030953chr5--11505 128 --
NM_030980chr11471 ------
NM_031268chr16125415 5357 4985 4889 4138 4028 3594 3440 1994 1842 620 402 ------
NM_031306chr11848 ------
NM_031369chr4----1592 1316
NM_031370chr4----1592 1316
NM_031427chr14105613 4432 4143 4010 2398 1682 1199 1100 756 266 25895 4896 --1741
NM_031435chr1213462 ------
NM_031844chr153144 2641 1483 640 495 23490 881 ----
NM_032012chr995316 4983 3369 3242 1582 1393 1324 471 68 21153 805 14453 1893
NM_032017chr1184 ------
NM_032021chr1121080 942 ------
NM_032124chr1821157 426 1996 ----
NM_032128chr4----2866 738 1964
NM_032149chr41191 ------
NM_032186chr1------11305
NM_032208chr2--12830 ----
NM_032458chrX33388 2665 225 13396 --12270
NM_032466chr821053 603 --11312 1352
NM_032468chr821053 603 --11312 1352
NM_032505chr362733 2712 2403 2065 1699 960 ----22701 2464
NM_032842chr7----1144 11157
NM_032949chr13----1172 --
NM_032961chr41534 --21311 862 --
NM_032978chr18----1120 --
NM_032979chr18----1120 --
NM_032981chr18----1120 --
NM_033132chr13----11530 --
NM_033143chr464445 4010 3580 3287 1137 1054 --23087 96 23330 1748
NM_033167chr33399 343 195 11586 31347 425 368 --
NM_033168chr33399 343 195 11586 31347 425 368 --
NM_033169chr33399 343 195 11586 31347 425 368 --
NM_033389chr1731691 1346 917 13123 --23461 3134
NM_033656chr2175332 5070 3674 1726 1609 1260 943 35932 4523 182 ----
NM_044472chr11532 ------
NM_052834chr1822374 926 1942 32387 1689 222 1442
NM_052998chr11180 ------
NM_053016chr9117992 7735 6749 5812 5664 2608 2300 651 618 488 362 1454 17567 11377
NM_053043chr755165 4918 2113 499 288 21527 1125 14944 --
NM_080546chr91644 ------
NM_080867chr1474563 4431 4304 3200 1863 1352 236 --31718 1149 710 13368
NM_080927chr343386 3252 550 124 23138 3065 22868 2542 --
NM_130469chr141871 ------
NM_133378chr2----1926 --
NM_133432chr2----1926 --
NM_133437chr2----1926 --
NM_138274chr6127 ------
NM_138277chr61197 ------
NM_138288chr1442208 1721 674 233 11405 ----
NM_138423chr1522045 862 ----21762 343
NM_138713chr1643011 2217 1486 1447 21341 932 --16164
NM_138714chr1643011 2217 1486 1447 21341 932 --16164
NM_138795chr1----11287 --
NM_144571chr476528 5468 2532 2374 1881 794 70 36847 4904 4336 11016 --
NM_144599chr151439 --25442 1511 12194
NM_144610chr17149 ------
NM_144728chr1197 ------
NM_144729chr1197 ------
NM_144778chr1312520 --21892 126 --
NM_144949chr252570 2301 1927 1682 430 12280 2736 547 --
NM_144973chr1264943 4362 3309 1414 1013 163 14266 24761 3432 21294 447
NM_144979chr4--145 ----
NM_144982chr12--1782 ----
NM_145011chr1032022 1896 810 11936 --12229
NM_145012chr101688 ------
NM_145036chr17--1353 ----
NM_145055chr1833262 2773 1212 33821 1176 107 23062 867 1948
NM_145112chr1411221 ------
NM_145113chr1411493 ------
NM_145174chr221278 ----11028
NM_145320chr721072 204 32937 2615 1272 33610 3075 2722 11400
NM_145321chr721072 204 32937 2615 1272 33610 3075 2722 11400
NM_145322chr721072 204 32937 2615 1272 33610 3075 2722 11400
NM_145341chr10--1347 ----
NM_145701chr141528 ------
NM_145753chr321508 1253 ----11629
NM_152240chr311160 ------
NM_152551chr612234 21139 446 33023 2294 501 11894
NM_152622chr542923 801 401 182 21324 977 --1491
NM_152624chr567074 7002 5662 1385 1300 624 --26530 1791 1721
NM_152692chrX--163 ----
NM_152774chr7--11002 12036 --
NM_152924chr15106933 6280 5920 4682 4453 2528 2425 1363 1127 506 26144 4320 ----
NM_153827chr17----1726 --
NM_170606chr71624 ----11254
NM_170663chr17----1726 --
NM_170674chr15--1577 ----
NM_170675chr15--1253 ----
NM_170676chr15--1253 ----
NM_170677chr15--1577 ----
NM_172193chr14--11206 ----
NM_172315chr15--1577 ----
NM_172316chr15--1577 ----
NM_172354chr151528 1457 246 214 188 1748 1236 --
NM_173156chr1--22139 540 1439 --
NM_173157chr12----1554 --
NM_173172chr2--11460 11078 --
NM_173214chr1643011 2217 1486 1447 21341 932 --16164
NM_173519chr821838 1574 1281 --1447
NM_173531chr1943811 3375 3062 2528 23785 563 --12925
NM_173533chr1----1254 --
NM_173576chr101818 ------
NM_173582chr11115877 5072 4727 3949 3822 2255 2191 2130 1394 1202 544 16150 1896 --
NM_173808chr143520 3107 881 333 11085 --11243
NM_173829chr555909 5755 2003 1507 981 ----12135
NM_175634chr811165 ------
NM_175635chr811165 ------
NM_175636chr811165 ------
NM_175874chr121149 ------
NM_175876chr122221 1009 12563 --1443
NM_175910chr19--11756 --9888 809 725 641 557 473 221 137 53
NM_175920chr5----1192 --
NM_177422chr11273 ------
NM_177438chr1444236 2964 400 196 13072 1868 12887
NM_177974chr1522045 862 ----21762 343
NM_177996chr20--22423 1139 --12948
NM_178151chrX87097 6968 6855 6808 2066 1854 1791 1221 26829 55 11088 --
NM_178152chrX87097 6968 6855 6808 2066 1854 1791 1221 26829 55 11088 --
NM_178153chrX87097 6968 6855 6808 2066 1854 1791 1221 26829 55 11088 --
NM_178426chr1----11553 11990
NM_178427chr1----11453 11890
NM_181358chr194248 3385 3186 3076 1626 1496 1339 1166 191 --11646 13840
NM_181361chr32314 126 2968 907 --11305
NM_181674chr5--1348 ----
NM_181675chr5--1348 ----
NM_181676chr5--1348 ----
NM_181677chr5--1348 ----
NM_181678chr5--1348 ----
NM_181698chr10----1513 --
NM_181784chr21398 12277 12604 --
NM_181836chr532150 1017 438 1623 ----
NM_182515chr1935561 4690 4159 14941 --21273 604
NM_182666chr31574 ----1239
NM_182765chr1011724 --22130 430 137
NM_182797chr2011229 ------
NM_182917chr31110 ------
NM_182944chr14----1289 --
NM_182977chr511095 2764 98 1288 1841
NM_183004chr142951 519 --23917 204 --
NM_194247chr274142 3293 2755 1796 613 397 285 24410 4000 1242 11250
NM_194301chr142731 157 ----21109 1026
NM_194449chr181627 ------
NM_198158chr3--11163 ----
NM_198159chr3--11163 ----
NM_198177chr3--11163 ----
NM_198178chr3--11163 ----
NM_198215chr101912 ------
NM_198241chr31110 ------
NM_198242chr31110 ------
NM_198243chr15--1649 ----
NM_198244chr31110 ------
NM_198268chr194248 3385 3186 3076 1626 1496 1339 1166 191 --11646 13840
NM_198269chr194248 3385 3186 3076 1626 1496 1339 1166 191 --11646 13840
NM_198391chr20--1390 1200 --
NM_198400chr1552286 2252 988 804 22 --192 1935
NM_198467chr72592 407 --1120 --
NM_198506chr4--11119 ----
NM_198859chr343566 1917 1619 648 11585 21640 546 23494 957
NM_199044chr112162 --22278 653 22023 781
NM_199421chr1474563 4431 4304 3200 1863 1352 236 --31718 1149 710 13368
NM_201269chr1------11305
NM_201568chr1--22139 540 1439 --
NM_201569chr1--22139 540 1439 --
NM_201591chr421910 697 31841 1547 1515 11342 --
NM_201592chr421910 697 31841 1547 1515 11342 --
NM_201632chr511828 ------
NM_201634chr511927 ------
NM_203291chr18----1218 --
NM_203292chr18----1211 --
NM_203434chr91268 ------
NM_203446chr2122543 2272 ----22923 2050
NM_206594chr123146 2486 ------
NM_206595chr123146 2486 ------
NM_206853chr633920 3847 2924 23287 649 22952 1392 --
NM_206854chr655181 5108 4185 3723 57 24548 1910 14213 --
NM_206855chr666146 6073 5150 4688 1022 691 15513 15178 --
NM_206909chr867740 6213 5940 5663 1940 399 23282 2644 13202 --
NM_207015chr312200 ----1554
NM_207292chr343282 2994 2648 936 ------
NM_207293chr343282 2994 2648 936 ------
NM_207294chr343282 2994 2648 936 ------
NM_207295chr343282 2994 2648 936 ------
NM_207296chr343282 2994 2648 936 ------
NM_207297chr353307 3019 2673 961 25 ------
NM_207303chr102655 505 --11637 1497
NM_207304chr1312407 --11779 --
NM_207406chr456262 5919 5799 4580 1509 2175 25 11607 26113 4400
NM_207645chr11--11345 ----
NM_213648chr511828 ------