TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-221-5p
miRNA Sequence: ACCUGGCAUACAAUGUAGAUUU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000020chr1262296 2052 1595 579 485 319 --2451 404 --
NM_000037chr852312 1893 1856 445 176 21636 900 ----
NM_000051chr1143116 2514 1242 775 1297 ----
NM_000081chr131475 1185 609 ------
NM_000084chrX56506 4623 2780 2655 2563 26224 4312 11711 --
NM_000089chr72687 528 ------
NM_000109chrX21074 642 1865 ----
NM_000125chr644010 3081 1483 462 ------
NM_000129chr631455 1066 451 ------
NM_000138chr1521702 424 ------
NM_000161chr1431671 263 44 ------
NM_000163chr521544 234 11714 11663 --
NM_000176chr533790 3325 1251 ------
NM_000189chr241869 918 425 81 1638 ----
NM_000194chrX2547 154 ------
NM_000214chr203529 312 27 ------
NM_000217chr1225166 4649 13630 15247 --
NM_000232chr442778 2321 1284 1044 12495 ----
NM_000245chr711593 --1556 1766
NM_000259chr1574368 3919 2324 1359 1180 926 461 ----14763
NM_000264chr922352 722 1737 --1118
NM_000267chr1763013 2847 2781 2659 1181 143 1273 ----
NM_000276chrX32204 1581 1574 ------
NM_000297chr421519 105 ------
NM_000304chr171829 ------
NM_000314chr1053018 2224 1170 684 99 ------
NM_000315chr11122 ------
NM_000332chr686582 6551 4541 1736 476 311 234 195 ----1337
NM_000335chr372167 1958 1675 1591 763 661 229 122 ----
NM_000337chr566200 4910 4353 4123 2097 68 22136 549 --11115
NM_000354chrX1251 ------
NM_000362chr2222364 249 2875 759 ----
NM_000399chr101371 ------
NM_000408chr243389 3246 2966 160 ----1791
NM_000449chr131223 1075 512 --11340 11166
NM_000450chr131834 1141 111 ------
NM_000452chr1331979 1861 1701 ------
NM_000454chr213267 234 53 ------
NM_000461chr354468 3409 3284 1328 730 --13267 --
NM_000480chr111282 21690 305 ----
NM_000503chr831654 1452 130 ------
NM_000533chrX3740 511 225 ------
NM_000554chr1942474 2339 2122 958 83244 3203 3108 2853 2408 2158 2129 650 11201 1707
NM_000555chrX26877 265 13055 ----
NM_000599chr264152 3371 1804 1775 1259 513 13280 --13259
NM_000601chr71175 ------
NM_000609chr1052386 2265 1095 582 521 12056 190 1416
NM_000610chr1131951 637 168 ------
NM_000612chr1133288 3015 2999 13453 13050 12755
NM_000615chr1111888 12383 ----
NM_000617chr1232242 1858 662 ------
NM_000618chr1266217 5500 5019 4885 1498 1210 22362 1158 ----
NM_000618chr1266217 5500 5019 4885 1498 1210 22362 1158 ----
NM_000621chr1311178 ----1912
NM_000627chr21653 ------
NM_000681chr1021335 1230 --1188 --
NM_000682chr261608 1316 513 196 165 44 11765 ----
NM_000686chrX--1583 21424 1071 --
NM_000719chr1256582 6539 6007 2217 417 25688 2423 12410 14404
NM_000726chr21576 ----156
NM_000782chr2031266 203 117 ------
NM_000793chr14--1706 ----
NM_000795chr114833 803 355 192 --1182 --
NM_000813chr534458 548 335 ------
NM_000814chr1523738 492 ------
NM_000826chr442542 1909 975 149 ------
NM_000827chr542577 2222 1990 947 --11717 --
NM_000831chr185751 5372 4920 4818 3943 1395 1115 226 22406 128 25437 4799 1152
NM_000840chr71161 ------
NM_000868chrX2585 524 ------
NM_000870chr551545 606 538 187 52 ------
NM_000875chr1596653 6134 5448 5072 4907 4659 2761 2304 1550 24708 2166 12070 --
NM_000879chr5185 ------
NM_000891chr1731313 1014 567 --11000 11216
NM_000899chr1241537 1190 561 505 13443 ----
NM_000919chr5147 ------
NM_000926chr1159226 6656 6261 6249 1949 23791 61 18289 --
NM_000933chr201456 ------
NM_000944chr42514 281 1132 ----
NM_000959chr142706 909 329 135 ------
NM_000962chr9103081 2829 2586 944 851 458 342 280 244 67 ------
NM_000965chr311128 ------
NM_001001323chr1232983 2166 462 ------
NM_001001331chr321891 729 12406 --12488
NM_001001389chr1131951 637 168 ------
NM_001001390chr1131951 637 168 ------
NM_001001391chr1131951 637 168 ------
NM_001001392chr1131997 683 214 ------
NM_001001395chr12------12145
NM_001001436chr161214 ----137
NM_001001484chr1011729 ------
NM_001001557chr81190 21793 605 ----
NM_001001664chr213850 --11184 --
NM_001001665chr252634 2566 711 577 281 12228 11320 --
NM_001001669chr552080 2026 1852 879 113 32106 291 206 12189 --
NM_001001787chr11494 ----1459
NM_001001890chr2133434 2972 162 2145 89 11080 --
NM_001001924chr831582 1514 735 ------
NM_001001925chr831582 1514 735 ------
NM_001001931chr831582 1514 735 ------
NM_001001971chr10--1315 1527 --
NM_001001995chrX21608 753 --1288 --
NM_001002243chr21607 ------
NM_001002295chr1031028 776 434 ------
NM_001002762chr1052600 2369 1806 879 42 32606 2129 539 11976 12283
NM_001002860chr1441774 971 638 91 ------
NM_001002914chr17--1955 --11086
NM_001003398chr122499 28 ------
NM_001003712chr1212991 ----1220
NM_001003722chr92683 89 ------
NM_001003800chr943518 2713 1002 415 --180 11016
NM_001004065chr913418 11078 13100 --
NM_001004722chr21157 ------
NM_001005271chr1751006 968 911 894 79 1121 ----
NM_001005273chr1751006 968 911 894 79 1121 ----
NM_001005386chr21316 ------
NM_001005463chr1032427 774 723 --12065 --
NM_001005474chr3141 ------
NM_001005505chr331509 1466 126 --11432 1557
NM_001005609chrX83510 3405 2930 2833 1496 1333 1213 300 23078 54 ----
NM_001005746chr21576 ----156
NM_001005747chr21576 ----156
NM_001005781chr21143 ------
NM_001005861chr3----165 --
NM_001005920chr1661107 689 395 290 252 25 1227 ----
NM_001006115chr352412 2140 1104 480 202 --22337 2160 --
NM_001006600chr511694 ------
NM_001006612chrX1437 ------
NM_001006613chrX1437 ------
NM_001006614chrX1437 ------
NM_001006618chr9187 ------
NM_001007023chr14--1706 ----
NM_001007024chr1763807 3569 3498 400 332 154 24061 3819 --1627
NM_001007025chr1763807 3569 3498 400 332 154 24061 3819 --1627
NM_001007102chr6----1570 --
NM_001007156chr151549 --11715 11527
NM_001007237chr132493 2212 116 --22646 722 --
NM_001007246chr213766 497 342 ------
NM_001007257chr141442 570 168 152 ------
NM_001007565chr3135 --1303 --
NM_001008220chr583833 3172 514 463 421 279 247 132 13231 2780 745 1323
NM_001008222chrX41347 517 432 205 ------
NM_001008239chr1832377 1158 457 13550 1326 --
NM_001008405chr731621 1323 1232 11378 ----
NM_001008495chr811451 ------
NM_001008541chr10----11906 --
NM_001008541chr10----11906 --
NM_001008564chr1342273 2039 1705 512 2712 581 11497 --
NM_001008701chr1972566 2243 2229 2008 1091 457 39 22435 1055 1181 --
NM_001008738chr522009 161 ------
NM_001008938chr112180 126 ------
NM_001009555chr411741 1213 ----
NM_001009571chr7----21134 478 --
NM_001009880chr22104763 4583 4225 1654 1436 773 394 148 121 34 --14836 --
NM_001009881chr1188 ------
NM_001009882chr1188 ------
NM_001009899chr352182 1016 439 174 153 11537 12207 11594
NM_001010846chr153788 3202 2910 351 99 33618 3384 603 14446 --
NM_001010867chr1126571 6506 6267 6172 4729 4367 2256 2022 1412 1251 769 264 66431 4436 2188 1836 1824 1611 16225 26164 1920
NM_001010888chrX63777 3071 2820 619 229 216 --13655 --
NM_001010897chr131152 ------
NM_001010932chr71175 ------
NM_001010942chr1231320 65 31 ------
NM_001010984chr142182 1812 1665 480 11822 12106 --
NM_001010989chr161442 ------
NM_001010990chr161442 ------
NM_001011513chr431141 899 500 1596 ----
NM_001011515chr41177 ------
NM_001011516chr41177 ------
NM_001011538chr42970 764 1839 1157 --
NM_001011546chr202612 84 1782 ----
NM_001011713chr1441168 573 234 120 ------
NM_001012267chr931653 774 563 11699 --11859
NM_001012393chr1154998 4899 4327 1690 1334 ----11377
NM_001012398chr163193 118 39 ----11125
NM_001012426chr652751 2699 1012 843 672 1825 23368 765 --
NM_001012427chr652751 2699 1012 843 672 1825 23368 765 --
NM_001012614chr4------1125
NM_001012751chr101361 ------
NM_001012754chr1321911 818 21871 1778 ----
NM_001012755chrX84487 3419 3306 1760 1389 1069 577 80 1241 --1721
NM_001012756chr1922542 2170 ----12602
NM_001012761chr532711 2348 812 ------
NM_001012974chr62105 74 ------
NM_001013415chr41364 ------
NM_001013693chr182511 2482 2334 2225 2077 1181 524 107 23001 496 22169 537 12085
NM_001013693chr182511 2482 2334 2225 2077 1181 524 107 23001 496 22169 537 12085
NM_001013699chr121171 ------
NM_001013843chr151106 ------
NM_001014286chr132109 93 ------
NM_001014765chr161898 1300 644 219 91 53 1580 ----
NM_001014797chr1077458 7355 5664 5470 2759 2111 249 ----12085
NM_001014809chr43732 638 66 ------
NM_001014812chr151193 ------
NM_001015508chr81264 ------
NM_001015877chrX21918 1058 ------
NM_001017395chr312704 --23437 1459 --
NM_001017424chr121824 473 ------
NM_001017425chr121824 473 ------
NM_001017440chr767488 5463 2878 2589 1359 1019 47888 6509 6445 252 35992 2866 2825 --
NM_001017926chr811776 ------
NM_001017969chr9--1259 ----
NM_001018064chr921569 720 ------
NM_001018074chr533790 3325 1251 ------
NM_001018075chr533790 3325 1251 ------
NM_001018076chr533790 3325 1251 ------
NM_001018077chr533790 3325 1251 ------
NM_001018090chr1532699 934 80 ------
NM_001018091chr1532809 1044 190 ------
NM_001018102chr1532699 934 80 ------
NM_001018111chr733553 3500 1385 21110 374 ----
NM_001024094chr533790 3325 1251 ------
NM_001024218chr14----1262 --
NM_001024380chr832165 2125 1872 11788 12061 --
NM_001024381chr832165 2125 1872 11788 12061 --
NM_001024649chr541960 809 768 315 ------
NM_001024845chr13270 141 74 1110 2641 402 --
NM_001024858chr1482732 2544 2266 825 616 562 460 119 --11189 --
NM_001024912chr1911215 11191 1690 21371 558
NM_001024948chr112241 --11373 --
NM_001024959chr37770 732 720 642 539 204 150 1237 ----
NM_001024960chr37770 732 720 642 539 204 150 1237 ----
NM_001025076chr1025516 4989 15755 ----
NM_001025077chr1026874 6347 27113 520 ----
NM_001025079chr333772 2965 2742 ------
NM_001025105chr521147 594 ----21525 1487
NM_001025107chr142516 2302 198 85 --2407 183 --
NM_001025107chr142516 2302 198 85 --2407 183 --
NM_001025203chr21130 ------
NM_001025204chr21130 ------
NM_001025252chr842806 2251 340 33 12894 11125 13212
NM_001025253chr842806 2251 340 33 12894 11125 13212
NM_001025266chr313790 33922 1789 1212 ----
NM_001025389chr111282 21690 305 ----
NM_001025390chr111282 21690 305 ----
NM_001025580chrX53556 3116 2695 1679 299 ------
NM_001025603chr131223 1075 512 --11340 11166
NM_001025777chr221476 60 1615 11332 1654
NM_001025780chr92200 100 ------
NM_001029859chr11150 21942 291 11873 --
NM_001029863chr622725 637 ------
NM_001029875chr51562 ------
NM_001030007chr1622989 1242 ------
NM_001030055chr1423603 1772 --14056 --
NM_001030287chr121188 457 1824 ----
NM_001031679chr1233030 811 575 21039 744 ----
NM_001031711chr531744 357 251 ------
NM_001031732chr433316 2907 2696 ------
NM_001031804chr1633530 305 74 ------
NM_001032280chr61186 ------
NM_001032288chr2011593 --1490 --
NM_001032296chr1372889 2820 2505 2456 2074 1980 131 ------
NM_001032394chr632321 2214 104 12377 ----
NM_001033025chr131470 1272 496 ------
NM_001033049chr211207 1392 31850 1817 427 --
NM_001033057chr31737 ------
NM_001033081chr11546 1392 1342 --
NM_001033082chr11546 1392 1342 --
NM_001033117chr374582 4420 3675 1414 1289 1245 1111 24194 3683 14382 --
NM_001033507chr131266 592 88 11680 --21605 1584
NM_001033566chr172671 73 1867 ----
NM_001033568chr172671 73 1867 ----
NM_001033723chr822547 928 21931 111 --1514
NM_001033925chr1032086 1551 1544 ------
NM_001034845chr4--180 ----
NM_001034850chr521183 249 ------
NM_001034954chr1023046 2354 1734 ----
NM_001034955chr1023046 2354 1734 ----
NM_001034956chr1023046 2354 1734 ----
NM_001034957chr1023046 2354 1734 ----
NM_001035260chr1011327 11418 ----
NM_001037164chr731712 1408 777 ------
NM_001038702chr572434 2008 1705 1683 1041 487 98 ------
NM_001039141chr2232744 2503 1730 22113 1799 ----
NM_001039350chr731701 1352 109 --11255 11413
NM_001039538chr262994 2708 1043 1018 699 564 ------
NM_001039547chr377512 7378 5866 5481 2820 2423 1947 47445 5550 2128 1309 --12878
NM_001039569chr243053 2571 1270 484 32960 1203 1135 ----
NM_001039585chr152963 1166 586 392 136 ------
NM_001039618chr1134341 3959 1618 --25503 241 --
NM_001039802chr141179 1129 1005 216 ------
NM_001039840chrX66041 5802 4772 4251 2218 1307 ------
NM_001040002chr1731168 355 95 --11134 --
NM_001040152chr735010 4926 446 ----14139
NM_001040159chr41463 1480 ----
NM_001040167chr7--11124 ----
NM_001040172chr551545 606 538 187 52 ------
NM_001040173chr551545 606 538 187 52 ------
NM_001040202chr412145 1447 ----
NM_001040214chr661915 1805 741 734 329 23 ------
NM_001040402chr41454 --11038 11115
NM_001040429chr13--12830 --12449
NM_001040445chr265736 3955 1695 1072 769 182 35125 1687 1629 ----
NM_001040450chr1532783 1035 924 11104 1826 --
NM_001040453chr1532783 1035 924 11104 1826 --
NM_001040619chr121638 1116 11274 ----
NM_001040653chr352617 2311 2132 867 329 ----22183 975
NM_001040712chr953619 2973 2386 1202 349 ------
NM_001042355chr1674790 3798 1970 1139 948 730 92 14681 14502 --
NM_001042357chr102598 204 ------
NM_001042358chr102598 204 ------
NM_001042360chr102598 204 ------
NM_001042363chr102598 204 ------
NM_001042368chr93831 166 92 ------
NM_001042383chr353415 910 823 514 231 --12883 --
NM_001042389chr102598 204 ------
NM_001042390chr102598 204 ------
NM_001042392chr102598 204 ------
NM_001042395chr102598 204 ------
NM_001042404chr1--146 ----
NM_001042406chr641137 1044 1013 373 ------
NM_001042412chr1674790 3798 1970 1139 948 730 92 14681 14502 --
NM_001042413chr962911 994 959 597 453 96 ------
NM_001042424chr473199 2899 2377 2022 1256 775 731 1110 11163 --
NM_001042425chr61186 ------
NM_001042492chr1763013 2847 2781 2659 1181 143 1273 ----
NM_001042494chr1552722 1360 633 314 66 11429 13410 --
NM_001042495chr1552722 1360 633 314 66 11429 13410 --
NM_001042496chr1552722 1360 633 314 66 11429 13410 --
NM_001042497chr1552722 1360 633 314 66 11429 13410 --
NM_001042498chrX2766 759 ----11079
NM_001042599chr257843 5897 5274 5087 3084 1241 ----
NM_001042603chr1233620 3532 590 ------
NM_001042604chr334012 3723 594 ----1495
NM_001042632chr2082273 1800 983 904 822 261 177 26 12083 ----
NM_001042633chr2082273 1800 983 904 822 261 177 26 12083 ----
NM_001043318chr1453546 2820 2563 472 261 --11123 --
NM_001046chr522561 1168 21876 641 ----
NM_001083620chr442540 1907 974 149 ------
NM_001092chr17112377 2338 2323 2256 2201 2147 2141 1669 940 613 415 22250 915 1284 --
NM_001099678chr354872 4805 4737 735 379 25103 984 14581 --
NM_001106chr358420 8393 3861 2934 2786 16667 16594 12887
NM_001111chr142516 2302 198 85 --2407 183 --
NM_001113490chrX32553 1306 1184 ------
NM_001126chr11186 ------
NM_001128chr1622989 1242 ------
NM_001146chr811471 --158 --
NM_001149chr10270 41 --1441 --
NM_001167chrX86015 5686 5260 4356 2391 2061 1276 1210 16084 ----
NM_001173chr1423603 1772 --14056 --
NM_001187chr212410 35 141 --198
NM_001198chr622352 53 ------
NM_001204chr276702 4959 4891 2378 2263 1357 99 ----15186
NM_001206chr922916 22 ----11951
NM_001218chr1552372 2267 2247 849 348 --21666 123 --
NM_001237chr42970 236 ----1245
NM_001237chr42970 236 ----1245
NM_001241chr221738 679 ------
NM_001241chr221738 679 ------
NM_001259chr776321 6291 2161 2113 987 643 318 --22242 378 --
NM_001265chr133736 721 65 1148 ----
NM_001271chr1572952 2756 2702 1081 1049 879 805 --2749 355 --
NM_001304chr1723264 2987 --13005 --
NM_001313chr43732 638 66 ------
NM_001328chr4------1125
NM_001343chr51656 --11071 --
NM_001356chrX32431 1781 984 ------
NM_001364chr1144702 3575 3036 368 13059 24026 238 --
NM_001387chr553080 761 693 465 347 1974 ----
NM_001391chr1821152 788 ------
NM_001396chr2112303 --1604 --
NM_001397chr152337 1917 1768 899 655 1823 12446 --
NM_001399chrX83510 3405 2930 2833 1496 1333 1213 300 23078 54 ----
NM_001417chr1231715 513 277 ------
NM_001420chr1953177 2904 2844 2803 2686 ------
NM_001432chr422615 1430 --11473 11527
NM_001438chr131470 1167 616 ----22411 1315
NM_001439chr131470 1272 496 ------
NM_001463chr2------1608
NM_001478chr12----129 2773 58
NM_001497chr952323 1969 1047 976 39 12633 22609 1700 --
NM_001508chr23803 255 168 ------
NM_001518chr73999 888 864 ------
NM_001530chr143758 440 293 ------
NM_001542chr132493 2212 116 --22646 722 --
NM_001543chr5124411 4187 4077 3664 1929 1348 969 855 769 759 462 426 11360 21858 1410 14481
NM_001584chr111136 ------
NM_001587chrX32204 1581 1574 ------
NM_001614chr17187 --1445 --
NM_001614chr17187 --1445 --
NM_001616chr232751 1184 342 ------
NM_001620chr111515 ------
NM_001650chr1813039 ----11631
NM_001655chr111792 ------
NM_001656chr511853 --1676 --
NM_001659chr1252245 1825 1722 511 100 1557 ----
NM_001663chr142711 269 ------
NM_001664chr31366 ------
NM_001674chr121188 457 1824 ----
NM_001677chr111132 ----11097
NM_001682chr1232697 1880 176 ------
NM_001683chr321891 729 12406 --12488
NM_001701chr91353 ------
NM_001704chr61163 ----1107
NM_001706chr31256 ------
NM_001714chr121383 ------
NM_001717chr151103 ------
NM_001731chr121678 --1243 --
NM_001746chr541960 809 768 315 ------
NM_001754chr2133434 2972 162 2145 89 11080 --
NM_001759chr1233961 3882 654 25091 574 ----
NM_001769chr122302 135 ------
NM_001777chr333772 2965 2742 ------
NM_001791chr141179 1129 1005 216 ------
NM_001792chr18177 ------
NM_001830chrX43431 1031 547 417 11255 11627 --
NM_001842chr91530 ------
NM_001845chr1311328 ----1317
NM_001855chr91219 ------
NM_001858chr654487 1629 1387 1038 127 ------
NM_001875chr21163 ------
NM_001892chr521147 594 ----21525 1487
NM_001895chr201943 ------
NM_001936chr731701 1352 109 --11255 11413
NM_001938chr111365 ------
NM_001949chr633099 2738 2157 --12987 --
NM_001962chr52409 114 --1501 --
NM_001969chr1431210 731 406 ----13346
NM_001987chr1243888 3299 2990 862 23208 468 13711 13189
NM_002006chr465607 3613 2046 1919 624 534 14863 ----
NM_002009chr1541891 1873 1719 447 ------
NM_002024chrX1445 21847 869 ----
NM_002025chrX38964 6978 6745 --17866 17644
NM_002026chr21947 ------
NM_002040chr2142601 877 778 686 1264 --12993
NM_002051chr1031028 776 434 ------
NM_002054chr2143 ------
NM_002061chr111837 21771 1296 ----
NM_002063chrX11037 ------
NM_002074chr11332 ------
NM_002077chr911477 ----1433
NM_002092chr444357 3964 3519 800 --1107 --
NM_002094chr161151 ------
NM_002114chr61154 ------
NM_002126chr17------12674
NM_002130chr521636 330 ----11608
NM_002140chr911230 ------
NM_002146chr171364 ------
NM_002158chr243664 3412 3089 323 ------
NM_002187chr511069 ----1307
NM_002198chr51257 ------
NM_002211chr103436 397 222 --1181 --
NM_002221chr172380 2179 980 885 637 459 254 --21138 424 --
NM_002239chr21822 ------
NM_002247chr1022174 1493 ------
NM_002249chr1----1396 --
NM_002264chr343079 1448 1242 32 --24979 3742 1656
NM_002267chr1331713 653 328 ------
NM_002270chr524075 1213 ------
NM_002286chr12159 ------
NM_002310chr534504 402 52 ----11649
NM_002359chr1774006 3844 3296 3000 1148 894 158 --12793 --
NM_002373chr1541181 1170 1020 97 ------
NM_002374chr262994 2708 1043 1018 699 564 ------
NM_002375chr342276 1894 1813 281 22180 1953 1132 --
NM_002383chr164691 581 196 159 1651 1615 --
NM_002384chr181149 ------
NM_002397chr542227 1651 1570 121 ----11688
NM_002399chr1521266 250 --156 --
NM_002401chr1772487 2318 548 364 210 165 25 --1994 --
NM_002479chr12779 88 --1617 1105
NM_002480chr1211147 ------
NM_002504chr931062 151 60 --1768 --
NM_002505chr611296 21400 211 ----
NM_002515chr141237 ------
NM_002522chr1762410 1212 1202 1146 959 573 --22597 2557 --
NM_002537chr15----21081 367 1750
NM_002539chr2181 ------
NM_002545chr1154998 4899 4327 1690 1334 ----11377
NM_002546chr81204 ------
NM_002577chr323404 400 ------
NM_002581chr925624 1572 140 ----
NM_002583chr12167 ------
NM_002588chr541442 1190 1151 524 --11285 --
NM_002589chr4196 ------
NM_002595chr1211796 ------
NM_002609chr571607 567 505 466 241 89 46 --11598 --
NM_002613chr1683985 3659 1642 1198 1166 1049 794 92 1868 11571 136
NM_002618chr22404 129 ------
NM_002641chrX31853 1560 716 ----1728
NM_002651chr11234 ------
NM_002657chr2053570 2977 2930 2887 440 ------
NM_002660chr2051156 1056 801 409 140 1294 --1784
NM_002711chr71632 ------
NM_002731chr1--13120 ----
NM_002736chr721455 610 ------
NM_002742chr14299 58 ------
NM_002745chr2254475 4092 1723 1187 1058 ------
NM_002748chr151805 ------
NM_002752chr5126 ------
NM_002753chr42731 629 ------
NM_002811chr16168 ------
NM_002815chr17------172
NM_002822chr122483 474 11505 ----
NM_002829chr91410 ------
NM_002833chr1521220 1212 --21362 280 --
NM_002834chr1264035 1493 1387 1099 909 565 13110 --13361
NM_002837chr1233250 761 87 ----13310
NM_002839chr953619 2973 2386 1202 349 ------
NM_002844chr621376 1225 --11145 --
NM_002845chr181533 ------
NM_002849chr121428 ------
NM_002855chr1153070 2387 1272 1070 146 13421 12351 13363
NM_002874chr911706 22498 1640 ----
NM_002886chr354732 3174 734 590 112 11167 ----
NM_002904chr6----1143 --
NM_002906chr111125 ------
NM_002941chr3162 ------
NM_002942chr3------1216
NM_002948chr31233 ------
NM_002958chr3----165 --
NM_002968chr16----1321 --
NM_002998chr82569 338 ----12133
NM_002999chr203342 107 49 --1172 1432
NM_003012chr872933 2505 1032 883 755 200 104 ------
NM_003028chr973500 3447 3228 3082 2662 1507 53 1953 --13805
NM_003029chr121274 108 ------
NM_003043chr353614 3141 2678 825 388 33538 3081 2764 22652 1477 --
NM_003045chr1354333 4220 4169 3102 219 34424 3229 994 24047 3649 --
NM_003051chr11569 ------
NM_003069chrX2736 217 ------
NM_003074chr331876 1855 705 ------
NM_003081chr2021162 144 --1400 --
NM_003107chr652587 2558 787 218 29 2743 613 ----
NM_003108chr276908 6000 5301 4723 2676 1956 1925 ------
NM_003128chr232684 2201 618 ------
NM_003131chr632190 1494 400 --12059 --
NM_003133chr12387 161 ------
NM_003137chr632170 1496 399 ------
NM_003149chr321601 1301 ------
NM_003156chr111503 1876 11307 --
NM_003161chr1722280 2210 1987 ----
NM_003164chr111567 ------
NM_003173chrX11300 --2910 92 1983
NM_003174chr101299 ------
NM_003178chr341975 1958 1430 149 ------
NM_003179chrX21307 1147 1105 ----
NM_003189chr152659 2607 865 520 353 2623 29 ----
NM_003199chr1834068 1859 1688 13534 ----
NM_003200chr1931986 381 115 ------
NM_003216chr2233067 2420 1142 23324 2177 1750 --
NM_003220chr61186 ------
NM_003221chr662903 2752 2663 1113 832 729 13168 ----
NM_003236chr262920 2724 1245 332 78 27 12972 ----
NM_003246chr151376 ------
NM_003247chr621235 145 --11332 --
NM_003275chr941390 1201 1110 1011 ----1579
NM_003281chr1104809 4762 4312 3724 1775 1728 1703 1404 778 708 14077 1540 --
NM_003286chr201285 ------
NM_003298chr365445 4990 4572 2009 1324 303 14381 25969 729 --
NM_003304chr311263 ------
NM_003309chr611792 ------
NM_003338chr101365 ------
NM_003341chr3173 ------
NM_003342chr1772970 2451 2277 1179 584 443 154 12124 ----
NM_003349chr2011593 --1490 --
NM_003350chr81296 --1793 --
NM_003371chr972050 801 514 483 390 282 174 --2640 551 --
NM_003373chr1011795 11918 1725 1664
NM_003380chr101218 ------
NM_003390chr113949 102 50 --1173 --
NM_003392chr323374 531 ------
NM_003405chr222751 714 ------
NM_003406chr8----11464 --
NM_003409chr1821178 74 ----11445
NM_003410chrX62228 2164 655 466 427 226 ------
NM_003411chrY2618 465 --11624 --
NM_003412chr332532 2028 1069 ------
NM_003452chr9------1848
NM_003453chr13157 ------
NM_003454chr162564 162 ------
NM_003458chr383566 2816 1211 747 619 459 401 244 11201 11571 13413
NM_003463chr641209 538 309 217 --12859 --
NM_003468chr213053 23689 3288 --13200
NM_003483chr1222144 837 12116 ----
NM_003486chr1682225 2199 2058 865 706 678 196 23 ------
NM_003489chr2122242 2169 ------
NM_003508chr71111 ------
NM_003557chr1161 --11241 --
NM_003559chr1723617 510 32704 2687 1429 13212 12940
NM_003562chr171298 ------
NM_003564chr1----1116 --
NM_003566chr1222350 815 ------
NM_003567chr11327 ------
NM_003574chr1821518 232 ----13904
NM_003576chr1372889 2820 2505 2456 2074 1980 131 ------
NM_003590chr263297 3197 2642 2587 1207 861 13318 ----
NM_003603chr431672 750 36 ------
NM_003607chr123898 807 13635 12757 1484
NM_003626chr1111166 ------
NM_003629chr133351 1168 675 21408 155 ----
NM_003631chr103950 374 159 --163 1385
NM_003632chr17----1316 --
NM_003663chr3----1394 1228
NM_003671chr943257 2545 2404 789 ----11257
NM_003673chr172444 120 2144 60 ----
NM_003688chrX178 ------
NM_003702chr81269 ------
NM_003713chr131655 379 211 ------
NM_003718chr71471 ------
NM_003722chr342310 2174 235 43 ----12731
NM_003735chr541442 1190 1151 524 --11285 --
NM_003736chr541442 1190 1151 524 --11285 --
NM_003749chr132964 39 ----1382
NM_003759chr411392 --23120 970 --
NM_003768chr13583 225 218 ------
NM_003794chr31970 ------
NM_003797chr11171 ------
NM_003798chr91193 ------
NM_003800chr632414 2157 948 --1806 12389
NM_003812chr21207 ------
NM_003822chr133126 2915 2581 ----23138 973
NM_003831chr1831357 146 45 ------
NM_003872chr242697 2606 1903 574 ------
NM_003873chr1041848 885 559 119 ------
NM_003877chr121162 ------
NM_003887chr221737 68 --11802 --
NM_003891chr131271 ------
NM_003913chr633302 1493 1339 ------
NM_003924chr44572 348 269 49 ------
NM_003932chr2221817 1496 ------
NM_003934chr92931 263 ------
NM_003943chr41127 ------
NM_003972chr102502 32 ------
NM_003980chr611036 --11267 --
NM_003982chr14----1236 --
NM_003983chr1633876 1536 1227 13858 21102 320 13647
NM_003994chr1241537 1190 561 505 13443 ----
NM_004006chrX21074 642 1865 ----
NM_004007chrX21074 642 1865 ----
NM_004009chrX21074 642 1865 ----
NM_004010chrX21074 642 1865 ----
NM_004011chrX21074 642 1865 ----
NM_004012chrX21074 642 1865 ----
NM_004013chrX21074 642 1865 ----
NM_004014chrX21074 642 1865 ----
NM_004015chrX21074 642 1865 ----
NM_004016chrX2988 556 1779 ----
NM_004017chrX21074 642 1865 ----
NM_004018chrX2988 556 1779 ----
NM_004020chrX21074 642 1865 ----
NM_004021chrX2988 556 1779 ----
NM_004022chrX2988 556 1779 ----
NM_004023chrX2988 556 1779 ----
NM_004024chr121547 1025 11183 ----
NM_004028chr1813039 ----11631
NM_004050chr1432111 157 25 143 12293 --
NM_004055chr1162079 2025 1950 1670 844 837 41581 1548 1502 84 1470 --
NM_004061chr51191 ------
NM_004073chr12245 209 --138 --
NM_004086chr141814 --1621 --
NM_004093chr13--1709 1687 --
NM_004094chr1443031 2536 1035 171 12188 21876 340 --
NM_004111chr111139 --1217 --
NM_004114chrX21039 98 ------
NM_004124chr1443520 2714 1116 842 --13364 --
NM_004133chr832409 2241 856 1825 ----
NM_004137chr5----132 --
NM_004162chr311213 ----11250
NM_004171chr1168672 7525 6767 2548 1887 285 12149 26368 3660 13671
NM_004185chr1----1188 --
NM_004200chr1173007 2418 655 638 481 325 126 1448 12971 --
NM_004225chr821473 1020 ------
NM_004227chr743113 2232 2072 737 22601 340 1730 --
NM_004229chrX1249 ----1881
NM_004232chr1833231 3183 159 ------
NM_004263chr221457 1150 ------
NM_004272chr5------1527
NM_004274chr1411215 --12082 --
NM_004279chr732162 2070 1504 --2714 504 --
NM_004293chr933693 1010 641 ------
NM_004296chr1483851 3668 3129 3079 1253 1073 1019 537 ------
NM_004319chr162345 2168 1066 690 204 28 1665 ----
NM_004321chr283250 2793 2670 2494 970 896 197 95 32638 2591 2517 43303 2984 493 140 --
NM_004326chr111228 ------
NM_004331chr81300 ------
NM_004342chr71749 ------
NM_004354chr42724 639 196 ----
NM_004385chr51507 ------
NM_004389chr22757 87 ------
NM_004392chr1321789 1024 ------
NM_004407chr41902 1821 1331 --
NM_004420chr1162355 2155 1493 918 773 38 --3871 650 271 --
NM_004426chr12--1759 1393 --
NM_004429chrX41173 588 221 86 1523 11302 --
NM_004430chr84303 190 183 53 ----12029
NM_004432chr922079 161 ------
NM_004433chr131459 499 148 --11448 --
NM_004436chr13475 97 21 1105 ----
NM_004437chr133414 2756 388 --21187 523 --
NM_004447chr12183 ------
NM_004451chr115660 632 529 180 116 ------
NM_004457chr231379 598 240 11511 ----
NM_004459chr173783 442 89 ------
NM_004484chrX1281 ------
NM_004491chr1933887 3835 1496 23396 1436 31123 370 176 1788
NM_004500chr1411804 ------
NM_004520chr51265 ------
NM_004527chr1731168 355 95 --11134 --
NM_004571chr2141278 1134 433 141 ----12443
NM_004586chrX55170 3414 1484 730 719 11553 ----
NM_004588chr1173502 2565 1131 1048 641 573 254 22880 2484 ----
NM_004612chr964351 3924 3596 3463 3264 3034 11738 ----
NM_004654chrY3900 443 163 ------
NM_004655chr17--1485 ----
NM_004657chr231227 542 49 1627 ----
NM_004660chrY22168 1713 ------
NM_004690chr61582 ------
NM_004709chrX1403 ------
NM_004713chr141774 ------
NM_004717chr721442 1251 --11305 --
NM_004718chr21173 ------
NM_004726chrX54507 2036 1293 806 707 ------
NM_004730chr51198 ------
NM_004736chr11430 ------
NM_004774chr1742797 2274 1943 229 --11259 --
NM_004775chr181708 --1838 --
NM_004776chr2063062 2826 2762 2225 2092 1285 11279 23211 2560 12507
NM_004822chr1792746 2738 2716 2456 1277 1128 851 238 38 22807 1584 ----
NM_004859chr1743054 2652 633 474 ------
NM_004869chr181272 1677 ----
NM_004871chr1763807 3569 3498 400 332 154 24061 3819 --1627
NM_004872chr11324 ------
NM_004884chr1511194 ------
NM_004887chr521096 778 ------
NM_004888chr91398 ------
NM_004896chr1011242 11333 ----
NM_004898chr432680 2199 1919 --21906 403 --
NM_004899chr21133 ------
NM_004901chr8--1202 ----
NM_004926chr143630 286 203 ------
NM_004929chr8126 ------
NM_004949chr1831704 837 733 ------
NM_004956chr733859 3839 3725 ------
NM_004965chr211270 ------
NM_004966chr101355 --1906 --
NM_004976chr1195004 3627 3523 3516 3163 1545 273 243 160 1933 24410 1201 --
NM_004978chr141522 1123 1073 128 ------
NM_004985chr1262922 2757 1731 1003 859 186 ------
NM_004992chrX198127 8093 8045 7672 7633 6426 6230 6093 5980 5939 3391 3204 3030 2297 1679 1646 1387 827 209 38224 7537 661 28023 5728 --
NM_004992chrX198127 8093 8045 7672 7633 6426 6230 6093 5980 5939 3391 3204 3030 2297 1679 1646 1387 827 209 38224 7537 661 28023 5728 --
NM_004999chr653966 1094 685 664 280 ------
NM_005016chr12------1322
NM_005032chrX1412 --1213 --
NM_005054chr231555 429 276 ------
NM_005056chr1243864 3776 3412 834 13439 ----
NM_005063chr1043353 3256 486 41 --11300 --
NM_005065chr1475191 4894 4739 4645 1469 1418 1339 --11003 --
NM_005067chr31380 1100 ----
NM_005079chr842806 2251 340 33 12894 11125 13212
NM_005097chr101124 ------
NM_005103chr11------1235
NM_005109chr341683 776 647 300 21653 116 12493 22069 394
NM_005121chr1733595 2960 1381 ------
NM_005135chr1552722 1360 633 314 66 11429 13410 --
NM_005155chr61543 --173 --
NM_005156chr923831 732 14907 ----
NM_005188chr1198221 6777 6382 5814 5466 5056 2425 2404 1650 --46605 5226 2514 970 15853
NM_005191chr321452 488 --1415 --
NM_005197chr1465104 3983 2395 691 442 317 14205 --32381 564 56
NM_005201chr32309 50 ------
NM_005202chr122056 1426 --1223 1538
NM_005203chr102380 85 ------
NM_005206chr17--11254 ----
NM_005207chr2263159 2654 1382 1375 1181 1028 --13284 12563
NM_005215chr182716 267 ------
NM_005219chr511139 11409 --11512
NM_005229chrX1213 ------
NM_005235chr257843 5897 5274 5087 3084 1241 ----
NM_005238chr1142468 2386 675 593 1186 11432 --
NM_005242chr521312 458 ----1139
NM_005245chr42277 149 ------
NM_005249chr141167 ------
NM_005254chr151487 ------
NM_005276chr1241429 363 211 23 --1448 1511
NM_005276chr1241429 363 211 23 --1448 1511
NM_005296chrX1404 21062 900 ----
NM_005316chr111763 ------
NM_005334chrX51459 1384 1332 349 63 ------
NM_005338chr793580 3067 2822 2760 2658 2519 1054 827 26 13514 11587 --
NM_005339chr423784 3246 --1365 --
NM_005342chrX32221 713 160 --12197 --
NM_005359chr1846388 4928 2285 285 12211 24004 200 --
NM_005397chr733553 3500 1385 21110 374 ----
NM_005402chr7--11390 ----
NM_005406chr1821016 306 ------
NM_005436chr1043815 2824 2731 154 ------
NM_005455chr12550 205 ------
NM_005458chr912391 11689 1512 --
NM_005465chr1------11677
NM_005475chr123941 534 131 --12248 --
NM_005497chr1755263 4360 4226 1511 1130 45929 5539 5197 4293 --12385
NM_005499chr191146 ------
NM_005504chr1255921 5217 4783 1105 158 --1648 --
NM_005517chr121227 566 --2975 444 --
NM_005542chr721619 369 ------
NM_005544chr21856 ------
NM_005546chr522396 538 ------
NM_005570chr1831102 1050 762 ------
NM_005578chr324421 739 23701 3160 13824 --
NM_005587chr151750 ------
NM_005596chr936373 6003 1259 1525 ----
NM_005614chr72867 795 ------
NM_005638chrX2573 102 ------
NM_005644chr11384 ------
NM_005664chr151221 ------
NM_005668chr51403 31108 866 479 23622 319 --
NM_005717chr131325 1192 403 1409 ----
NM_005718chr37770 732 720 642 539 204 150 1237 ----
NM_005722chr21316 ------
NM_005730chr1263326 3170 2832 2411 1218 173 --12698 12680
NM_005735chr24796 578 563 280 --1245 --
NM_005738chr731712 1408 777 ------
NM_005746chr722688 757 ------
NM_005759chr224687 40 13768 21515 1497 --
NM_005777chr3184 ------
NM_005779chr5113227 3105 3090 2460 2400 2366 1420 915 742 707 256 ------
NM_005786chr1831148 902 492 ------
NM_005789chr1731974 1783 1699 11408 1395 --
NM_005802chr92555 230 ------
NM_005813chr232340 2249 838 ------
NM_005819chr112781 ----1438
NM_005822chr61535 1152 ----
NM_005828chr1754785 4577 4218 4078 3092 --23560 293 --
NM_005832chr31354 ------
NM_005839chr1----1114 1604
NM_005840chrX32777 2645 223 26798 5286 1135 --
NM_005852chr1751006 968 911 894 79 1121 ----
NM_005859chr531293 1151 623 ------
NM_005880chr1611426 ------
NM_005885chr5----1666 --
NM_005898chr111156 ------
NM_005904chr18------2550 334
NM_005909chr534117 2954 576 --1298 --
NM_005911chr21435 --21497 535 --
NM_005933chr1162883 2770 2634 2374 451 405 22337 1036 12681 --
NM_005935chr414947 1127 --24269 3899
NM_005938chrX71387 1354 970 521 405 112 45 --11238 --
NM_005941chr813459 191 1594 1907
NM_005955chr165231 2074 2049 1440 1020 994 15176 21551 786 --
NM_005962chr10----11906 --
NM_005962chr10----11906 --
NM_005966chr231734 1512 436 ------
NM_005977chr131224 ------
NM_005990chr562367 2269 1914 497 294 108 --1863 --
NM_005996chr1241448 1389 1344 156 --11028 --
NM_006007chr934231 4196 3854 ----13365
NM_006030chr331509 1466 126 --11432 1557
NM_006040chr163394 314 270 1132 ----
NM_006047chr2043479 3310 371 343 ------
NM_006054chr11194 ------
NM_006070chr3135 --1303 --
NM_006095chr453199 2929 987 334 264 ------
NM_006108chr1142343 288 236 144 ------
NM_006135chr1----1101 --
NM_006141chr1642477 664 518 190 ------
NM_006154chr1542069 1974 1966 244 --1351 --
NM_006164chr21166 ------
NM_006166chr1242530 2384 2034 297 12106 12501 --
NM_006180chr921569 720 ------
NM_006186chr211098 ------
NM_006190chr231038 741 450 ------
NM_006201chrX4351 299 279 258 ----1925
NM_006203chr544053 3528 2161 1324 --13661 1107
NM_006206chr42467 188 ------
NM_006216chr21602 ------
NM_006226chr21141 ------
NM_006237chr1332286 2050 814 ------
NM_006238chr611282 --1783 12019
NM_006242chr2021848 1338 11374 --1331
NM_006258chr1051586 1346 998 536 62 ------
NM_006266chr93831 166 92 ------
NM_006281chr81235 ------
NM_006281chr81235 ------
NM_006298chr662866 2340 2122 1346 717 112 ------
NM_006301chr121122 ------
NM_006306chrX55832 4850 4667 1344 788 35641 4562 4171 1593 14745
NM_006310chr172877 284 ------
NM_006320chr421076 24 ------
NM_006323chr4159 ------
NM_006325chr123680 634 62 ------
NM_006357chr21447 1359 ----
NM_006366chr63879 505 352 ------
NM_006371chr364522 4497 4326 3511 1942 417 11406 11076 --
NM_006372chr61408 ------
NM_006373chr17--21279 1208 ----
NM_006375chrX21362 112 ------
NM_006379chr71377 ------
NM_006380chr1721269 580 13604 --24269 3433
NM_006386chr2212161 --2673 181 --
NM_006415chr91134 ------
NM_006420chr2032267 2111 489 22430 533 ----
NM_006421chr81234 ------
NM_006434chr1023046 2354 1734 ----
NM_006439chr41497 ------
NM_006454chr493001 2970 2172 654 598 570 464 158 51 --22867 2428 12389
NM_006457chr431141 899 500 1596 ----
NM_006459chr1031459 778 586 --11451 --
NM_006460chr1721355 483 ------
NM_006467chr51360 ------
NM_006472chr141218 1166 984 316 ------
NM_006489chr141237 ------
NM_006504chr1022865 1984 ------
NM_006520chrX3223 92 47 ------
NM_006521chrX41402 1343 1322 374 157 --1400
NM_006526chr20140 ------
NM_006534chr2033053 915 332 ------
NM_006539chr161485 ------
NM_006540chr83310 118 105 ------
NM_006544chr1444657 4378 306 30 15435 ----
NM_006546chr17116484 6429 5927 5852 4265 1610 1453 711 570 226 110 25288 4996 14537 15059
NM_006548chr351701 1437 207 199 139 ------
NM_006549chr1242483 2348 2067 1110 1603 12725 12279
NM_006558chr81376 ------
NM_006561chr1025516 4989 15755 ----
NM_006580chr32358 122 ------
NM_006587chr431592 1320 29 --1255 --
NM_006599chr1646880 5738 5188 2250 25698 2318 ----
NM_006601chr121723 ------
NM_006609chr2----12410 11047
NM_006612chr17------2195 45
NM_006624chr1011660 --11400 --
NM_006625chr11438 ----1991
NM_006625chr11438 ----1991
NM_006625chr11438 ----1991
NM_006629chr1842145 1995 958 614 --12868 --
NM_006640chr1751679 1243 446 368 346 11485 --1137
NM_006646chr1342816 2691 782 389 ----12097
NM_006650chr583833 3172 514 463 421 279 247 132 13231 2780 745 1323
NM_006675chr1252610 2511 1100 1090 446 --3897 785 175 --
NM_006682chr732365 464 120 1398 ----
NM_006690chr2072319 2156 2065 1465 263 216 43 --21442 586 1293
NM_006698chr2021347 345 11133 1380 --
NM_006704chr131341 ------
NM_006717chr932392 1291 125 --12588 --
NM_006731chr932229 1782 1731 25080 1301 1197 21994 633
NM_006734chr611236 ------
NM_006736chr251790 1543 1451 690 252 1594 1226 --
NM_006738chr1583931 3539 3455 3067 1659 1110 1025 462 21050 310 11001 --
NM_006750chr1667360 5736 2154 1278 784 439 ------
NM_006751chr21151 ------
NM_006756chr811410 --11251 --
NM_006758chr21130 ------
NM_006763chr131699 1520 754 21534 655 ----
NM_006766chr8----11769 --
NM_006775chr622101 479 ------
NM_006777chrX52228 1958 1170 513 479 --11993 --
NM_006788chr1851434 706 235 158 73 ----11621
NM_006795chr1131039 359 275 143 1382 11510
NM_006802chr121119 204 --1890 --
NM_006807chr1711345 ------
NM_006823chr821369 340 ------
NM_006836chr121474 ------
NM_006854chr71699 11683 ----
NM_006861chr1251763 559 508 464 354 ----12074
NM_006870chr202612 84 1782 ----
NM_006874chr41780 ------
NM_006885chr1633463 2960 175 --12751 --
NM_006888chr142851 345 12348 1657 --
NM_006914chr91576 ------
NM_006920chr21163 ------
NM_006938chr1821043 71 ------
NM_006946chr111458 1416 2103 53 185
NM_006948chr211342 --1455 --
NM_006965chr1821003 110 --11064 --
NM_006991chr32931 143 2371 212 1780 --
NM_006996chr121232 1222 ------
NM_007008chr2173 ------
NM_007011chr1575384 5131 5055 4980 4940 4861 2724 ------
NM_007013chr8----1751 --
NM_007014chr1651770 1712 1595 584 438 ------
NM_007024chr3----1197 1456
NM_007026chr171188 ------
NM_007030chr594259 3362 1408 1385 1374 1076 670 135 30 23314 3235 33852 3642 823 11122
NM_007032chr2232744 2503 1730 22113 1799 ----
NM_007033chr161592 1571 805 502 395 259 11943 1311 --
NM_007034chr12755 303 ------
NM_007039chr1421703 1443 --12103 --
NM_007042chr352217 2028 1912 428 190 1955 1422 --
NM_007050chr2096928 6848 6780 5226 4989 2210 1761 1625 25 25500 4883 37949 6688 1326 --
NM_007051chr1--157 ----
NM_007052chrX172 ------
NM_007054chr532852 1169 657 ----11238
NM_007069chr11260 22 ------
NM_007073chr643425 1392 1342 1327 21549 776 ----
NM_007107chr351631 907 693 295 76 ------
NM_007172chr2223263 2911 --11136 1743
NM_007175chr821090 463 --1585 --
NM_007189chr731259 1141 997 126 ----
NM_007200chr1583931 3539 3455 3067 1659 1110 1025 462 21050 310 11001 --
NM_007203chr913418 11078 13100 --
NM_007212chr121843 1412 ------
NM_007222chr811776 ------
NM_007249chr1363561 2655 2254 1700 1347 312 11258 23521 2052 --
NM_007275chr32886 357 2733 289 ----
NM_007276chr71725 11041 ----
NM_007345chr1831739 1688 373 ------
NM_007347chr1552982 2816 2435 996 337 11224 12645 --
NM_007350chr1224489 524 --11561 --
NM_007371chr9------1633
NM_012072chr2094314 4295 1701 1158 948 888 765 750 311 ------
NM_012081chr542710 1378 958 652 ----11159
NM_012098chr931408 1322 959 11074 --140
NM_012104chr1133617 3010 1493 1639 ----
NM_012104chr1133617 3010 1493 1639 ----
NM_012129chr72515 151 1800 ----
NM_012134chr121736 1723 21494 387 11514 --
NM_012137chr142711 1986 324 26 --22241 637 --
NM_012155chr19121 --128 --
NM_012164chr986788 6303 5006 2852 2413 1533 822 155 --2148 40 --
NM_012193chr1144132 2044 1356 48 ------
NM_012197chr92481 204 --11516 --
NM_012199chr133626 3090 1387 13219 ----
NM_012214chr265959 5147 4795 4692 1919 1395 11328 26165 2456 --
NM_012218chr19184 ------
NM_012238chr1021441 1107 11428 ----
NM_012243chr12704 325 ------
NM_012250chr1131390 1160 446 133 ----
NM_012262chr175166 5104 4415 4143 3507 1668 172 ------
NM_012264chr2261590 1450 756 482 170 47 183 ----
NM_012264chr2261590 1450 756 482 170 47 183 ----
NM_012281chr741954 1673 858 485 ------
NM_012294chr763734 2638 1350 713 311 165 ------
NM_012297chr412544 ------
NM_012306chr12102644 2568 2358 1254 1216 1071 1041 850 456 118 33081 2885 2196 1940 --
NM_012308chr1151885 963 670 426 291 ----32445 2108 284
NM_012309chr1151920 1780 1483 1142 1033 13957 31528 1352 301 --
NM_012316chr165173 5071 4615 4482 4428 1062 14682 ----
NM_012326chr24586 132 109 96 ----1538
NM_012383chr93421 173 69 ------
NM_012384chr2052167 430 356 315 300 11693 ----
NM_012395chr713396 12206 ----
NM_012399chr2241960 1721 1370 1320 ------
NM_012402chr1131131 1107 350 11198 1909 --
NM_012412chr71215 1751 1618 --
NM_012416chr921074 305 ------
NM_012421chr12349 147 ------
NM_012425chr1032324 2189 2111 --2785 169 --
NM_012479chr772241 1089 754 654 538 290 187 ------
NM_012482chr11264 ------
NM_013231chr1443061 1236 1071 357 ------
NM_013283chr5--1278 ----
NM_013286chr342385 1400 1266 295 --21502 774 13320
NM_013293chr72472 143 ------
NM_013313chr2233199 496 361 1430 23094 1293 --
NM_013336chr361485 802 757 698 232 146 11491 ----
NM_013374chr333155 2884 2042 --12866 --
NM_013433chr1951484 1478 719 678 579 1371 121 --
NM_013437chr821198 525 ----11362
NM_013444chrX1798 ----1962
NM_013449chr1252655 2287 2024 1020 913 ------
NM_013451chr101167 ------
NM_013960chr83634 297 32 ------
NM_013989chr14--1706 ----
NM_013995chrX31871 939 793 ------
NM_013999chr1731205 392 132 --11171 --
NM_014000chr1011795 11918 1725 1664
NM_014001chr1721023 37 --21315 238 --
NM_014011chr21131 ------
NM_014021chr133292 3225 572 --11289 --
NM_014023chr1062243 2054 1870 1141 670 35 ------
NM_014030chr1751150 906 793 760 138 ------
NM_014048chr1663947 1920 1494 1444 695 477 ------
NM_014056chr321979 354 ----11449
NM_014089chr1342273 2039 1705 512 2712 581 11497 --
NM_014106chr1522725 610 2989 777 ----
NM_014109chr821123 210 ------
NM_014112chr864973 4027 1428 1045 937 803 14989 24495 2087 --
NM_014117chr1632371 2346 2115 --1411 --
NM_014141chr784637 4039 4020 3702 2127 1720 579 551 --15105 --
NM_014155chr1177370 6907 6753 4938 2037 369 189 12419 --15483
NM_014159chr3291 34 ----1455
NM_014181chr21409 ------
NM_014217chr121824 473 ------
NM_014223chr11719 1121 ----
NM_014235chrX71745 1503 1168 523 485 123 35 --1130 11420
NM_014240chr343648 1554 1294 44 23745 3390 --13238
NM_014241chr102355 145 ------
NM_014292chr2261822 1295 1262 536 516 170 --11585 --
NM_014331chr467572 6545 1348 1324 1210 682 ------
NM_014345chr6------1751
NM_014351chr2221309 358 11206 ----
NM_014363chr13--193 ----
NM_014382chr31569 --11172 11377
NM_014393chr82451 87 ------
NM_014423chr534514 1283 165 15335 ----
NM_014445chr332214 761 421 ------
NM_014500chrX1234 ------
NM_014548chr1511213 11026 ----
NM_014572chr1321665 44 ----11142
NM_014584chr1411590 ------
NM_014607chr23808 398 221 --1193 --
NM_014613chr542351 2143 2113 1976 ------
NM_014615chr1632284 2259 493 1991 13200 12695
NM_014620chr121146 ------
NM_014629chr82515 26 --1938 --
NM_014634chr22103609 2995 2915 2890 2696 2505 549 467 461 407 12458 ----
NM_014635chr231527 393 240 ------
NM_014636chr983608 2953 2772 896 773 630 185 95 --11034 --
NM_014647chr1611728 ------
NM_014655chr161473 1458 932 726 284 50 --1515 --
NM_014660chr71338 --1173 --
NM_014665chr8113253 3194 3084 3041 3017 2663 2554 1391 1379 744 687 --22726 239 11446
NM_014680chr172525 108 ----1390
NM_014685chr161442 ------
NM_014701chr1532223 1270 775 ----11030
NM_014702chr642708 2496 839 371 ------
NM_014709chr21151 ------
NM_014720chr1021526 196 --21361 1258 --
NM_014721chr696526 6266 5140 5102 4988 2395 1686 631 615 11710 --14942
NM_014729chr8----11609 --
NM_014730chr1275157 5088 3664 1856 1627 1347 640 24473 952 21843 1005 14944
NM_014730chr1275157 5088 3664 1856 1627 1347 640 24473 952 21843 1005 14944
NM_014732chr16135867 5535 5201 4435 4015 3953 3829 3565 1822 1731 1706 1626 1604 14540 21243 265 --
NM_014735chrX51920 1782 1393 805 218 ------
NM_014746chr254206 3319 1025 1011 365 --1129 --
NM_014747chr175726 4289 4078 3518 844 767 644 122 12202 14684
NM_014751chr822067 1393 ------
NM_014754chr83799 763 179 ------
NM_014755chr233197 2910 835 13938 ----
NM_014756chr112180 126 ------
NM_014757chr542398 2005 694 579 ------
NM_014762chr172262 2026 1979 1722 1660 616 43 --12506 --
NM_014772chr18103315 3211 3178 1440 1247 858 644 562 460 378 22950 1286 --12818
NM_014781chr811156 ------
NM_014784chr11185 --11006 --
NM_014795chr21900 ------
NM_014798chr1751756 1376 1345 600 33 11559 --1117
NM_014802chr122751 390 ----1328
NM_014812chr1--146 ----
NM_014820chr321439 528 ------
NM_014826chr123898 807 13635 12757 1484
NM_014827chr11331 ------
NM_014828chr1432043 1989 155 ----12461
NM_014830chr1273385 3248 2411 1229 1115 1104 663 33567 3146 46 ----
NM_014835chr203787 542 470 ------
NM_014840chr1282723 2152 903 642 512 436 202 186 ----12327
NM_014841chr611159 ------
NM_014847chr11446 ------
NM_014850chr374582 4420 3675 1414 1289 1245 1111 24194 3683 14382 --
NM_014869chr331205 506 195 --1451 --
NM_014872chr942350 2090 2050 40 ----11958
NM_014877chr17107400 7103 6973 6328 5362 2987 2156 1878 1035 142 16112 26542 2777 --
NM_014893chrY32267 573 355 --1889 --
NM_014901chr512223 --3437 311 136 --
NM_014903chr1231771 1592 82 ------
NM_014904chr1013517 ------
NM_014905chr21263 ------
NM_014906chr1723278 1110 1348 1850 --
NM_014910chr193791 320 73 ------
NM_014912chr1021251 326 1741 ----
NM_014913chr181299 ------
NM_014921chr1972566 2243 2229 2008 1091 457 39 22435 1055 1181 --
NM_014923chr1311463 ------
NM_014932chr341909 569 512 386 ------
NM_014935chr193611 2663 2584 1440 1282 898 254 170 147 --33720 2502 2422 --
NM_014945chr511844 --1134 --
NM_014946chr232419 2332 790 ------
NM_014947chr153112 433 296 272 211 ------
NM_014962chr2052172 2156 1136 741 96 ------
NM_014969chr1--1282 ----
NM_014974chr1051677 1449 1132 565 479 ------
NM_014982chr1423800 850 --13443 1737
NM_014990chr141923 ------
NM_014991chr422979 1104 ------
NM_014996chr3152 ------
NM_015000chr1221936 180 ------
NM_015002chr121233 ------
NM_015008chr312704 --23437 1459 --
NM_015017chr13991 911 428 ------
NM_015020chr1653736 2726 1043 314 60 --11182 --
NM_015023chr141575 1280 732 66 --11262 --
NM_015032chr131406 ----12824
NM_015035chr2096381 6088 5901 5813 5403 2460 1558 491 410 15337 35594 4476 619 16249
NM_015039chr164335 3363 1736 1549 1019 47 11475 12980 --
NM_015040chr233178 2585 315 11141 ----
NM_015045chr1021391 385 --1818 --
NM_015051chr953133 2677 2378 1090 291 --21035 1019 1205
NM_015052chr721342 220 ------
NM_015059chr1553998 3527 2808 2646 2512 --11256 --
NM_015062chr10191 ------
NM_015074chr163978 3324 3107 1873 1812 1076 23290 3254 33616 1489 1067 --
NM_015075chrX42158 680 504 167 11398 ----
NM_015077chr17104444 4424 3010 1793 1715 1693 1605 1550 453 200 14339 ----
NM_015090chr196072 5998 4574 4247 2260 1992 1751 1041 630 --22421 2147 --
NM_015092chr1644384 3793 3088 1651 ------
NM_015093chr621598 143 ------
NM_015094chr2294279 4046 3427 1476 1415 529 496 357 197 23992 3214 23874 1001 --
NM_015097chr332248 464 308 ------
NM_015101chr162252 1991 1931 1136 969 392 1767 ----
NM_015103chr33950 246 22 ------
NM_015115chr41454 --11038 11115
NM_015132chr741339 484 456 319 ------
NM_015144chr1663441 3201 2654 2434 424 203 ------
NM_015149chr142229 2121 1808 478 21662 678 ----
NM_015153chr6------184
NM_015156chr1463493 3451 2936 1102 929 523 ----11009
NM_015172chr11630 --11228 --
NM_015178chr862399 2215 629 600 506 357 ------
NM_015185chrX42914 2675 2043 650 12650 ----
NM_015191chr1172489 2291 1768 935 811 697 29 ----11725
NM_015197chr1463348 3163 2762 2517 1348 1038 1340 --1170
NM_015199chr32787 229 ----1272
NM_015206chr1521114 656 22690 710 ----
NM_015247chr1674790 3798 1970 1139 948 730 92 14681 14502 --
NM_015250chr921820 473 1274 1264 --
NM_015254chr842408 2206 2090 58 22377 80 1643 1264
NM_015264chr22104763 4583 4225 1654 1436 773 394 148 121 34 --14836 --
NM_015269chr1188 ------
NM_015270chr1242208 834 818 525 22270 775 32163 1829 769 --
NM_015275chr1232075 769 60 ------
NM_015299chr1453857 3648 322 267 34 23078 178 33089 1328 450 --
NM_015310chr837630 7500 6451 12428 ----
NM_015315chr532567 2318 1209 ----13304
NM_015316chr1451348 965 866 313 33 ----1916
NM_015317chr211885 --12030 --
NM_015318chr19101831 1571 1337 603 438 367 355 265 197 144 --11693 --
NM_015327chr111155 31108 405 66 --1824
NM_015332chr743553 3505 3317 1025 11221 21370 1019 --
NM_015336chr1221954 1884 12260 ----
NM_015344chr811948 1465 ----
NM_015365chrX53556 3116 2695 1679 299 ------
NM_015374chr2241428 393 323 26 --1359 --
NM_015375chr194253 4068 3768 1871 1529 828 694 586 512 44187 3415 419 404 ----
NM_015384chr5129 ------
NM_015385chr1023046 2354 1734 ----
NM_015397chr911855 ----1706
NM_015423chr1121324 1203 ----11446
NM_015446chr111276 ------
NM_015455chr543253 203 162 156 ------
NM_015458chr854852 4041 3816 1180 234 13974 ----
NM_015475chr22776 26 ------
NM_015483chr7----1902 --
NM_015490chr102625 604 --1120 124
NM_015497chr153873 154 63 ------
NM_015503chr161663 ------
NM_015508chr341076 994 211 137 ------
NM_015527chr16----193 --
NM_015530chr22200 188 --2256 165 --
NM_015532chr1532699 934 80 ------
NM_015534chr12826 740 ----11091
NM_015535chr231141 323 237 13863 12733 --
NM_015541chr3----11212 --
NM_015557chr193543 3504 2981 2485 2365 1336 903 726 686 23492 2814 160 11226
NM_015564chr543610 3295 3131 2835 --22256 494 --
NM_015565chr211711 ------
NM_015569chr11648 ----1516
NM_015571chr641963 1882 1706 128 --12004 --
NM_015578chr191543 ------
NM_015609chr142527 2476 904 340 1704 1937 --
NM_015630chr2--1429 ----
NM_015646chr1231320 65 31 ------
NM_015652chr101138 ------
NM_015686chrX72270 1769 1726 1598 1568 1552 577 ------
NM_015695chr641598 424 117 77 --2657 641 --
NM_015702chr2168 ------
NM_015726chr121356 675 11641 ----
NM_015833chr211207 1392 31850 1817 427 --
NM_015840chr142516 2302 198 85 --2407 183 --
NM_015841chr142516 2302 198 85 --2407 183 --
NM_015844chr181149 ------
NM_015846chr181149 ------
NM_015847chr181149 ------
NM_015850chr872371 2076 1633 973 572 495 230 ------
NM_015859chr141108 ------
NM_015866chr141442 570 168 152 ------
NM_015879chr1888431 8388 8288 7098 2969 2800 1497 1098 17747 38142 7006 3237 1553
NM_015895chr61205 ------
NM_015898chr1942431 2280 2042 1979 1731 --12010
NM_015905chr7164 ------
NM_015906chr133712 892 503 ------
NM_015907chr41354 ----1318
NM_015980chr531591 1260 224 11009 ----
NM_015984chr13554 352 120 ------
NM_015995chr15114951 4086 3846 3385 1926 1899 1633 1159 787 736 712 --14837 1803
NM_016018chr811000 ------
NM_016019chr72275 114 ------
NM_016021chr622085 1046 1746 --11883
NM_016032chrX41347 517 432 205 ------
NM_016037chr131159 421 121 1993 1255 --
NM_016045chr2011267 ------
NM_016061chr22560 432 ------
NM_016066chr1235 24 ------
NM_016072chr1232378 674 583 ------
NM_016076chr132252 1015 395 ------
NM_016083chr611446 ----11397
NM_016090chr113815 723 341 ------
NM_016131chr221573 930 1459 1887 --
NM_016132chr1522844 2640 --12397 --
NM_016133chr2------197
NM_016152chr311128 ------
NM_016169chr1053165 2615 2267 814 684 13074 13042 12232
NM_016173chr364545 4114 3774 2818 1239 28 13826 ----
NM_016201chr352224 925 731 345 338 ------
NM_016205chr42945 351 ------
NM_016206chr377427 7088 2367 1957 1711 966 694 17594 --21437 327
NM_016217chr623524 571 13290 1831 --
NM_016224chr63594 437 392 ------
NM_016248chr133746 661 331 --11543 --
NM_016257chr11616 33185 2736 2266 32730 1352 1301 --
NM_016258chr1--1633 ----
NM_016260chr234854 2288 1459 --17149 --
NM_016264chr192501 376 1178 ----
NM_016269chr431053 289 166 ------
NM_016271chr1812130 --1947 --
NM_016277chr621239 470 ----11298
NM_016281chr1211157 ------
NM_016284chr16130 ------
NM_016287chr131872 387 161 11330 ----
NM_016289chr232007 1555 1498 ------
NM_016300chr3----1198 --
NM_016303chrX1437 ------
NM_016308chr121683 659 ------
NM_016312chr12----199 --
NM_016315chr211542 ------
NM_016374chr111358 ------
NM_016374chr111358 ------
NM_016395chr152295 29 1772 ----
NM_016396chr1513053 ------
NM_016448chr161866 1751 1601 1326 750 384 ------
NM_016470chr202407 345 ------
NM_016522chr1131305 1217 311 ------
NM_016526chr1192435 2290 1612 992 973 466 430 421 210 1289 12471 --
NM_016531chr471388 773 764 398 388 351 321 ------
NM_016556chr17141 1132 ----
NM_016559chr321180 208 --11406 --
NM_016569chr1241448 1389 1344 156 --11028 --
NM_016570chr121420 ------
NM_016574chr114833 803 355 192 --1182 --
NM_016587chr71725 11041 ----
NM_016598chr331474 1329 1192 1402 ----
NM_016603chr51848 --196 --
NM_016607chrX3527 475 94 ----11125
NM_016621chr1194392 4207 3323 3268 1653 1396 1152 247 229 12797 24049 147 --
NM_016653chr221211 955 1313 ----
NM_016654chr151487 ------
NM_016734chr961813 1659 1623 1512 1320 1259 12008 11443 --
NM_016848chr9--141 ----
NM_016950chr41463 1480 ----
NM_017540chr552884 2753 2083 1145 821 12859 1637 --
NM_017544chrX1393 ------
NM_017551chr1032579 2026 945 --11043 --
NM_017569chr132146 130 ------
NM_017575chr1721414 1299 1481 --1224
NM_017582chr141449 1343 1217 246 --11172 --
NM_017594chr933340 255 76 12445 1201 --
NM_017610chr1521796 146 ------
NM_017628chr484956 4268 4261 4226 4191 4044 2086 246 14708 ----
NM_017629chr121632 319 ------
NM_017633chr643884 3430 3069 2717 ------
NM_017635chr112493 467 ------
NM_017637chr998522 8516 7181 6792 6174 5883 3056 1588 27 ----17976
NM_017641chr1211167 --1449 --
NM_017644chr324115 866 14278 14254 --
NM_017657chr21607 ------
NM_017662chr921690 610 --11277 146
NM_017666chrX21651 191 11517 ----
NM_017667chr7----1520 --
NM_017709chr152841 1522 557 475 47 13310 13558 --
NM_017714chr201625 ------
NM_017719chr322059 176 ------
NM_017736chr1621225 283 ----11216
NM_017737chr12409 391 --182 --
NM_017738chr91110 ------
NM_017742chr1831796 1476 1344 ------
NM_017744chr152127 1974 1628 588 256 1398 ----
NM_017752chrX21788 55 ------
NM_017754chr674979 4867 4589 3430 1104 779 108 --1800 --
NM_017761chr131198 952 71 ------
NM_017772chr621527 192 2572 92 ----
NM_017784chr31171 ------
NM_017787chr1052779 2652 1905 998 499 ----12191
NM_017798chr201223 ------
NM_017801chr322606 156 12010 ----
NM_017813chr832149 1981 1793 --25046 991 --
NM_017822chr121315 ------
NM_017845chr41543 ------
NM_017848chrX23892 309 22891 1739 13985 --
NM_017866chr82288 235 1820 ----
NM_017902chr1075043 4728 1359 1320 1111 386 140 --25008 29 15300
NM_017913chr9----1166 --
NM_017919chr955456 3712 1742 1004 695 14620 1226 11473
NM_017921chr1722193 1767 21511 25 ----
NM_017943chr14--1726 ----
NM_017944chr1142987 2293 2268 1118 --22799 894 --
NM_017954chr7----21134 478 --
NM_017993chr13151 --1349 --
NM_018000chr22725 410 1659 1514 --
NM_018014chr22883 76 ------
NM_018028chr1921191 845 3949 864 230 ----
NM_018036chr1423900 1623 --13712 --
NM_018045chr122889 751 --1974 --
NM_018046chr52778 738 11336 11314 --
NM_018051chr71308 ------
NM_018084chr233204 942 526 ----12724
NM_018086chr221348 147 ------
NM_018094chrX2360 145 ------
NM_018121chr1033076 701 645 --12307 --
NM_018126chr4----164 --
NM_018178chr12540 49 ------
NM_018181chr18--1664 11410 --
NM_018182chr1742113 2078 1383 249 ------
NM_018200chr1542236 1993 1917 667 ------
NM_018206chr16162 ------
NM_018247chr612407 1700 ----
NM_018254chr131925 1890 740 ------
NM_018257chr2051949 1914 1860 661 609 12414 ----
NM_018270chr203777 372 180 ------
NM_018307chr172671 73 1867 ----
NM_018313chr342401 2029 1702 767 ------
NM_018315chr41364 ------
NM_018320chr114959 943 837 183 ------
NM_018325chr9----1168 --
NM_018362chr1123823 3632 23378 3300 ----
NM_018364chr133483 2655 1137 ----12860
NM_018369chr52186 27 ------
NM_018416chr1242160 1964 602 133 1462 ----
NM_018440chr888540 6746 6277 6139 5697 1113 282 213 16208 --17361
NM_018445chr15----1142 --
NM_018447chr3------129
NM_018469chr1741348 1031 448 139 ------
NM_018490chr1121564 1496 ------
NM_018527chr131165 ------
NM_018553chr1741742 1724 1656 633 ------
NM_018566chr144989 4636 1708 1085 ------
NM_018638chr1233759 491 247 ----13710
NM_018640chr12------12145
NM_018644chr1142127 465 245 154 12135 21924 857 --
NM_018652chr151177 ------
NM_018667chr1662352 2218 2133 1045 192 29 21833 1734 ----
NM_018682chr71747 ------
NM_018689chr1532708 799 97 22299 367 22048 822 --
NM_018695chr511694 ------
NM_018698chrX41485 330 152 130 ------
NM_018710chr81543 --1190 --
NM_018712chr1141544 490 427 413 ------
NM_018718chr732263 2041 1933 --1935 11914
NM_018719chr741262 1060 1018 252 ------
NM_018844chr731863 1565 1474 11620 ----
NM_018847chr921537 333 ------
NM_018912chr541442 1190 1151 524 --11285 --
NM_018913chr541442 1190 1151 524 --11285 --
NM_018914chr541442 1190 1151 524 --11285 --
NM_018915chr541442 1190 1151 524 --11285 --
NM_018916chr541442 1190 1151 524 --11285 --
NM_018917chr541442 1190 1151 524 --11285 --
NM_018918chr541442 1190 1151 524 --11285 --
NM_018919chr541442 1190 1151 524 --11285 --
NM_018920chr541442 1190 1151 524 --11285 --
NM_018921chr541442 1190 1151 524 --11285 --
NM_018922chr541442 1190 1151 524 --11285 --
NM_018923chr541442 1190 1151 524 --11285 --
NM_018924chr541442 1190 1151 524 --11285 --
NM_018925chr541442 1190 1151 524 --11285 --
NM_018926chr541442 1190 1151 524 --11285 --
NM_018927chr541442 1190 1151 524 --11285 --
NM_018928chr541442 1190 1151 524 --11285 --
NM_018929chr541442 1190 1151 524 --11285 --
NM_018963chr2111123 1337 ----
NM_018970chr752918 2449 736 660 195 ------
NM_018976chr12141 --22427 1979 --
NM_018979chr121124 21813 289 ----
NM_018993chr202372 272 ----1521
NM_018999chr1021551 1094 --11301 --
NM_019000chr521183 249 ------
NM_019001chr334012 3723 594 ----1495
NM_019009chr1182309 2234 1856 881 765 713 691 674 --42510 2189 1619 322 --
NM_019036chr641137 1044 1013 373 ------
NM_019058chr10----1577 --
NM_019072chr553639 2981 1533 1391 1064 --11368 21700 470
NM_019084chr1042316 1639 1037 994 --1821 --
NM_019089chr182829 2802 2686 2495 2332 1430 1149 1131 52871 2356 1323 1065 374 ----
NM_019091chr21327 ------
NM_019102chr7154 ------
NM_019102chr7154 ------
NM_019106chr2263422 2422 2185 2102 1096 945 12744 1708 --
NM_019114chr922348 2063 12324 ----
NM_019116chr1642861 2580 950 600 --23520 3233 156
NM_019556chrX----1321 --
NM_019593chr202191 179 --22316 819 --
NM_019600chr151750 1671 ----
NM_019610chr111379 ------
NM_019857chrX31764 1711 1669 ------
NM_019885chr21292 ------
NM_019891chr131241 823 416 ------
NM_020120chr221476 60 1615 11332 1654
NM_020131chr141454 1203 465 44 --11269 --
NM_020133chr686315 5963 4388 1208 1138 982 386 136 26201 4349 12285 --
NM_020141chr112339 ----11585
NM_020159chr441175 623 527 312 --11347 --
NM_020177chr553321 3274 2777 2507 1054 ------
NM_020179chr11--1364 ----
NM_020182chr2053160 2454 2442 1102 641 1766 ----
NM_020193chr11------1406
NM_020225chr41143 ------
NM_020228chr111743 ------
NM_020235chr3170 ------
NM_020240chr572434 2008 1705 1683 1041 487 98 ------
NM_020336chr2052956 2880 2407 1361 1097 --22495 1116 --
NM_020337chr422043 692 --11240 --
NM_020338chr1063689 2526 1312 1129 869 589 2745 728 ----
NM_020342chr222133 2090 ------
NM_020346chr1111542 ------
NM_020347chr311662 --11715 --
NM_020348chr1042464 1903 236 146 ------
NM_020362chr13850 773 36 --1193 --
NM_020381chr64737 357 330 318 ------
NM_020384chrX31538 212 101 1294 11903 --
NM_020390chr354217 3588 959 512 245 ------
NM_020405chr1763863 3525 2835 1650 963 574 1347 11622 --
NM_020429chr753107 2794 458 404 249 --12071 12745
NM_020431chr1452707 2434 2090 1914 43 11796 ----
NM_020432chr732072 455 104 ----1489
NM_020438chr93518 388 249 1338 --1536
NM_020443chr186896 6837 6532 6204 5941 4592 2754 1160 ----11842
NM_020455chr632321 2214 104 12377 ----
NM_020473chrX31853 1560 716 ----1728
NM_020475chr852249 1830 1793 382 113 21573 837 ----
NM_020476chr852249 1830 1793 382 113 21573 837 ----
NM_020477chr852249 1830 1793 382 113 21573 837 ----
NM_020478chr852312 1893 1856 445 176 21636 900 ----
NM_020480chr852249 1830 1793 382 113 21573 837 ----
NM_020526chr161392 1257 598 529 170 53 ------
NM_020532chr2173 ------
NM_020644chr112854 698 ------
NM_020645chr111253 ----1431
NM_020651chr2------11608
NM_020653chr17170 ------
NM_020689chr2031345 1226 316 ------
NM_020697chr831375 1043 267 11341 ----
NM_020699chr154623 3726 1984 1582 807 --14175 11178
NM_020703chr1--1530 ----
NM_020713chr2072927 2883 2348 1221 1114 781 648 1243 1357 --
NM_020717chrX74819 4685 3326 3088 1933 1843 998 34752 1387 171 ----
NM_020718chr1642404 1444 1249 1130 --1952 --
NM_020728chr752742 2607 2373 2018 547 12676 --11020
NM_020734chr1231049 816 162 --1234 --
NM_020742chrX42361 2337 952 587 ------
NM_020749chr831582 1514 735 ------
NM_020750chr641509 1443 420 110 ------
NM_020752chr1032552 2272 322 12429 22498 1796 --
NM_020766chrX2900 572 24119 1399 ----
NM_020768chr51501 --1586 23116 1224
NM_020769chrX2678 354 ------
NM_020772chr1758216 7074 5477 3268 2740 12014 --1603
NM_020774chr1855219 4720 4330 2133 1358 --11849 --
NM_020783chr1832387 289 123 ------
NM_020794chr121447 210 ------
NM_020796chr532835 975 21 ------
NM_020803chr442317 2182 1615 379 ----1640
NM_020806chr14----1262 --
NM_020814chr251193 1146 944 360 139 1929 11264 --
NM_020819chr61357 ------
NM_020825chr1643477 3256 3122 2814 11362 --13080
NM_020830chr223232 412 --12244 --
NM_020841chr1212991 ----1220
NM_020850chr1663053 3028 2971 2588 2208 1220 12129 22263 1002 --
NM_020853chr1222553 792 1873 --12763
NM_020861chr62862 382 ------
NM_020870chr4--1101 ----
NM_020873chr33864 186 104 ------
NM_020886chr1111019 ----1477
NM_020890chr31469 ------
NM_020899chr1732349 660 144 21598 871 ----
NM_020917chr1973826 3692 3472 3172 1564 707 487 ------
NM_020919chr21318 ------
NM_020920chr14--1366 ----
NM_020921chr1433133 1322 100 ------
NM_020926chrX126 ------
NM_020939chr631353 61 45 1276 1128 --
NM_020940chr1032629 1170 944 ------
NM_020948chr163287 1065 804 577 532 185 ------
NM_020956chr19184325 4319 3970 3601 3450 2881 1901 1886 1862 1823 1808 1745 1730 1706 1667 1652 1628 1360 34688 4562 3300 63579 3327 1497 1227 933 187 --
NM_020967chr2041152 930 356 317 ------
NM_020975chr1021965 1322 ------
NM_020987chr10270 41 --1441 --
NM_021033chr1343436 3078 2304 147 ------
NM_021061chr844067 4006 1643 845 13854 13801 --
NM_021069chr431672 750 36 ------
NM_021072chr522430 1921 ----11973
NM_021079chr1752405 2067 1254 1245 1005 --12796 --
NM_021097chr22972 381 1634 12121 --
NM_021111chr921302 452 ------
NM_021120chrX42500 1158 1115 1015 1766 ----
NM_021137chr1742200 1639 1510 21 ------
NM_021140chrX11129 ------
NM_021155chr1942590 1096 777 83 --11059 --
NM_021174chr84593 557 526 105 ------
NM_021198chr21207 --11018 --
NM_021202chr2062637 2526 2497 2271 1999 984 ------
NM_021238chr1231533 1400 283 ------
NM_021614chr51114 ------
NM_021629chr364928 4127 3346 3324 3191 1852 23258 1786 ----
NM_021643chr2--1617 ----
NM_021705chr611296 21400 211 ----
NM_021738chr101299 ------
NM_021809chr2062195 1806 1717 1587 394 148 11864 ----
NM_021813chr665807 5258 2138 2127 1584 582 13815 ----
NM_021814chr6----11582 --
NM_021911chr534458 548 335 ------
NM_021912chr1523738 492 ------
NM_021914chr1442374 2141 1594 1495 ------
NM_021943chr631736 405 208 1466 ----
NM_021956chr611367 --11242 1335
NM_021961chr1137374 6053 5170 12268 36424 2810 1282 11462
NM_021962chr17112377 2338 2323 2256 2201 2147 2141 1669 940 613 415 22250 915 1284 --
NM_021964chr366354 6282 5227 4552 4518 731 ------
NM_021965chr961349 1121 1069 467 373 293 11151 --11362
NM_021977chr623181 2575 1593 1242 --
NM_021988chr2011593 --1490 --
NM_022037chr21103 ------
NM_022048chr1574264 3971 3952 2405 2090 1312 165 36279 4404 1346 11186 --
NM_022073chr1421142 201 ----11614
NM_022118chr13130 ------
NM_022130chr521186 1060 ------
NM_022166chr16104476 4190 4105 2358 2056 2027 1897 1019 618 520 ------
NM_022169chr1121494 1091 ----1579
NM_022170chr741492 1361 1345 146 --11210 11099
NM_022173chr21103 ------
NM_022337chr11--188 ----
NM_022351chr823443 2886 ------
NM_022367chr11712 ------
NM_022442chr2011593 --1490 --
NM_022459chr1345259 4925 4296 1327 --21305 387 11744
NM_022465chr1242662 2084 2065 889 ------
NM_022473chr1583314 1411 1279 1106 891 434 404 122 11348 1795 --
NM_022474chr1422552 2025 11798 ----
NM_022475chr42534 164 ------
NM_022476chr163193 118 39 ----11125
NM_022484chr711361 ------
NM_022491chr1233132 2722 183 --23449 994 --
NM_022494chr101416 ----1333
NM_022648chr264203 3274 2992 2913 1820 951 33437 3384 2919 ----
NM_022658chr121139 ------
NM_022719chr2253039 1369 1299 1243 584 --11440 33530 2806 2609
NM_022735chr121813 1559 --11548 --
NM_022745chr132229 1118 978 12944 22789 919 --
NM_022749chr841145 1033 326 255 1394 1176 --
NM_022753chr142834 2730 965 509 ------
NM_022756chr131472 1249 1071 ------
NM_022763chr33946 452 139 1437 ----
NM_022784chr151223 ----1251
NM_022821chr11435 1112 ----
NM_022823chr22509 60 ------
NM_022841chr151410 ------
NM_022898chr1433130 3077 1497 13382 --14069
NM_022912chr232593 791 558 ------
NM_022917chr9164 11128 1444 1403
NM_022918chr11----11744 --
NM_023033chr12----1533 --
NM_023037chr13----1857 --
NM_023072chr191103 ------
NM_023076chr1622268 2236 22245 1023 12473 --
NM_023105chr872371 2076 1633 973 572 495 230 ------
NM_023106chr872371 2076 1633 973 572 495 230 ------
NM_023110chr872371 2076 1633 973 572 495 230 ------
NM_023111chr872371 2076 1633 973 572 495 230 ------
NM_024017chr1731302 1094 1065 11100 1522 1201
NM_024025chr82235 22 1122 ----
NM_024046chr331158 442 257 ------
NM_024293chr22585 250 2803 51 ----
NM_024345chr996048 5287 4477 2068 1677 1544 1422 1008 906 11611 ----
NM_024411chr20--129 ----
NM_024423chr1844192 2624 1500 245 ------
NM_024494chr1----1188 --
NM_024496chr141753 ------
NM_024524chr322177 81 --1855 --
NM_024539chrX----1403 --
NM_024546chr13--1130 ----
NM_024563chr52628 223 ----11268
NM_024567chr8----1115 --
NM_024574chr41421 ----1380
NM_024607chr883689 1651 1087 952 441 302 171 82 11019 ----
NM_024657chrX2613 259 ------
NM_024666chr152591 37 ------
NM_024674chr132897 2567 356 32835 2026 1087 ----
NM_024692chr211479 ------
NM_024699chr81285 --1920 --
NM_024713chr1521160 1115 ------
NM_024721chr81330 ------
NM_024744chr242285 950 477 151 ------
NM_024751chr431528 1293 480 --21994 566 --
NM_024755chr151106 ------
NM_024761chr953981 3918 3654 394 189 --1433 --
NM_024770chr276339 5159 2051 1916 1492 780 645 34179 1982 1632 ----
NM_024798chr1582607 2428 2342 2266 691 666 388 254 32471 783 323 12503 --
NM_024881chr1953142 2497 1186 1053 680 11120 --13202
NM_024887chr172035 1519 1312 713 632 438 140 ------
NM_024920chr411390 ------
NM_024930chr522373 1865 --12118 --
NM_024939chr1641482 1246 565 254 --1541 --
NM_024941chr5------11205
NM_024946chr1641815 1518 1325 153 11674 ----
NM_024947chr348258 7507 2011 693 ----18318
NM_024949chr464926 4623 4340 3911 1284 270 14281 ----
NM_024954chr101215 ------
NM_024963chr7125355 5013 4595 4487 4266 3917 3874 3709 1498 528 463 65 34662 3661 987 --14326
NM_024991chr1023046 2354 1734 ----
NM_025040chr1931888 1651 1563 1752 --1567
NM_025054chr844075 3018 1345 1055 ------
NM_025076chr2----1441 --
NM_025138chr1311271 ------
NM_025147chr21255 ------
NM_025160chr144065 3430 3186 1702 ------
NM_025164chr1132166 1377 736 ------
NM_025179chr153431 3233 1687 1049 512 31776 1601 245 14308 11586
NM_025180chr363414 2099 910 823 514 231 --12883 --
NM_025235chr1011567 ------
NM_025263chr661738 1561 1452 571 476 454 ------
NM_030594chr15151 --1188 --
NM_030621chr142437 339 --1939 --
NM_030625chr102487 33 ------
NM_030627chr554061 3859 1577 972 720 ------
NM_030640chr121224 ------
NM_030647chr755808 5675 5318 5065 1402 --24151 259 --
NM_030648chr4145277 4624 4563 2079 2061 1945 1823 1741 1582 1434 1213 958 904 712 ------
NM_030650chr264144 4007 3567 3527 2598 52 14079 13298 --
NM_030664chr1011729 ------
NM_030670chr1222125 1618 ------
NM_030671chr1222125 1618 ------
NM_030674chr1244242 3937 2061 781 14435 ----
NM_030759chr101760 ----1147
NM_030762chr122727 396 ------
NM_030763chrX1752 ------
NM_030786chr121680 104 --11435 --
NM_030806chr1139131 8676 8399 7642 7613 7092 6956 6781 6600 6283 2628 2415 228 --13302 18374
NM_030816chr133124 2963 948 ------
NM_030881chr2212161 --2673 181 --
NM_030884chr342276 1894 1813 281 22180 1953 1132 --
NM_030920chr121803 1513 --1702 --
NM_030934chr131433 1292 654 ------
NM_030939chr61476 ------
NM_030964chr543143 1135 848 111 ------
NM_030979chr131187 ------
NM_030981chr114799 764 444 216 --21153 180 --
NM_031262chr911173 ------
NM_031263chr911230 ------
NM_031267chr71471 ------
NM_031268chr1683985 3659 1642 1198 1166 1049 794 92 1868 11571 136
NM_031291chr42635 115 ------
NM_031309chr882204 1946 1914 1695 468 165 154 25 11631 11609 --
NM_031314chr1411804 ------
NM_031365chr2----139 --
NM_031366chr2----139 --
NM_031371chr111358 ------
NM_031371chr111358 ------
NM_031372chr421580 296 ------
NM_031412chr1231206 1197 1020 1313 --1214
NM_031417chr1992481 2402 2317 1830 877 347 181 167 51 ------
NM_031418chr112481 365 1233 169 --
NM_031419chr3141 ------
NM_031427chr1434270 1525 1266 25469 4203 ----
NM_031444chr2241572 679 176 54 --11935 1391
NM_031445chr232516 1254 121 22939 2545 12458 --
NM_031468chr767488 5463 2878 2589 1359 1019 47888 6509 6445 252 35992 2866 2825 --
NM_031492chr11------2445 86
NM_031845chr262994 2708 1043 1018 699 564 ------
NM_031847chr262994 2708 1043 1018 699 564 ------
NM_031882chr5127 ------
NM_031911chr422537 1712 12341 11068 --
NM_031936chr1192 1146 1210 --
NM_031940chr832165 2125 1872 11788 12061 --
NM_031989chr12------1322
NM_031992chr741492 1361 1345 146 --11210 11099
NM_032017chr182104 1908 1890 1789 1649 1483 745 703 --169 --
NM_032028chr51645 ------
NM_032042chr532312 702 237 12565 ----
NM_032052chr2231309 1299 36 ----1997
NM_032088chr541442 1190 1151 524 --11285 --
NM_032092chr541442 1190 1151 524 --11285 --
NM_032139chr19------134
NM_032144chr2--11479 ----
NM_032153chr312592 ------
NM_032160chr1843817 1091 1052 283 ------
NM_032182chr1021376 471 ------
NM_032192chr172665 220 --1105 1615
NM_032195chr211162 ------
NM_032199chr10--1333 ----
NM_032208chr233208 185 134 ------
NM_032217chr41440 ------
NM_032226chr92851 616 ------
NM_032228chr1133504 3171 198 ------
NM_032231chr15169 ------
NM_032239chr421173 485 ------
NM_032246chr15--1531 --1213
NM_032271chr1651323 1068 601 131 59 11195 1214 1524
NM_032281chr1953177 2904 2844 2803 2686 ------
NM_032283chr12637 372 --1292 31405 233 60
NM_032289chr521457 72 21777 1412 ----
NM_032320chr112638 283 ------
NM_032345chr12--185 ----
NM_032352chr1411318 ------
NM_032364chr121960 --132 --
NM_032373chr1044637 4027 3893 147 13962 ----
NM_032379chr11--1239 ----
NM_032403chr541442 1190 1151 524 --11285 --
NM_032433chr1931550 1416 1354 ------
NM_032438chr6----1570 --
NM_032439chr1031580 1337 456 ------
NM_032440chr1022172 839 ------
NM_032446chr513666 --2700 548 --
NM_032449chr131829 1111 325 12548 1734 --
NM_032458chrX12248 --12192 136
NM_032466chr811104 ------
NM_032491chr1211058 ------
NM_032505chr322420 724 ------
NM_032509chr822445 1613 1644 ----
NM_032521chr2013130 11072 --1750
NM_032532chr61538 ----1115
NM_032538chr63563 271 175 --21938 584 --
NM_032539chrX1658 1845 ----
NM_032547chr42558 122 ------
NM_032552chr961582 1509 1404 1390 407 397 ------
NM_032557chr42376 64 ------
NM_032575chr1631425 653 404 1128 2787 145 --
NM_032582chr1721389 21 ------
NM_032603chr22176 93 ------
NM_032622chr4177 ----1119
NM_032646chr1731184 405 336 21550 1304 --1308
NM_032711chr1774006 3844 3296 3000 1148 894 158 --12793 --
NM_032765chr5----1296 --
NM_032784chr6199 ------
NM_032786chr12150 2418 393 ----
NM_032810chr1011081 ------
NM_032846chr1421330 595 ------
NM_032859chr1343728 1590 1422 250 ------
NM_032873chr1131397 1081 997 12988 --11710
NM_032876chr1432063 889 698 --1654 --
NM_032943chr11--1239 ----
NM_032973chrY13107 ------
NM_032978chr1821152 788 ------
NM_032979chr1821152 788 ------
NM_032981chr1821152 788 ------
NM_032982chr71637 21728 765 12445 22577 236
NM_032999chr73999 888 864 ------
NM_033000chr73999 888 864 ------
NM_033001chr73999 888 864 ------
NM_033018chrX4351 299 279 258 ----1925
NM_033020chr133712 892 503 ------
NM_033036chr1151457 1335 1244 570 58 ------
NM_033055chr11802 ------
NM_033133chr1753219 2500 2340 1373 266 23359 2515 ----
NM_033138chr71749 ------
NM_033139chr71749 ------
NM_033140chr71749 ------
NM_033157chr71749 ------
NM_033181chr611446 ----11397
NM_033182chr161898 1300 644 219 91 53 1580 ----
NM_033211chr511718 1260 ----
NM_033224chr777289 6801 5211 5090 1430 851 723 ------
NM_033225chr822430 2031 12573 1168 --
NM_033228chr51423 ------
NM_033260chr6------1703
NM_033274chr522966 1414 ------
NM_033331chr943257 2545 2404 789 ----11257
NM_033360chr1263043 2878 1852 1124 980 307 ------
NM_033375chr1751252 1153 242 222 195 2455 173 ----
NM_033387chr931922 591 21 22410 1961 22519 2245 11887
NM_033419chr1741233 1024 613 574 ----11572
NM_033421chr2041617 327 248 166 21427 595 1739 --
NM_033426chr1432938 2349 395 1787 --12036
NM_033429chr1551114 1063 949 560 499 --11050 --
NM_033449chr541743 798 484 57 21390 420 1360 --
NM_033518chrX3273 118 51 ----1339
NM_033551chr532567 2318 1209 ----13304
NM_033624chr121233 ------
NM_033626chrX51582 1308 1192 229 46 21275 1159 --1238
NM_033632chr41364 ------
NM_033642chrX21039 98 ------
NM_044472chr11546 ------
NM_052840chr1511567 ------
NM_052845chr1282707 2643 1257 1129 929 923 783 402 12375 12989 --
NM_052864chr431536 1389 443 ------
NM_052869chr1731184 405 336 21550 1304 --1308
NM_052879chr1213589 195 --1302
NM_052880chr2221166 987 167 ----
NM_052885chr1274952 4946 4353 4187 4109 1499 844 1734 ----
NM_052886chr821832 523 ------
NM_052903chr151502 ------
NM_052906chr2274618 4106 3747 1712 808 303 75 33958 1922 1550 13701 --
NM_052928chr1761649 1634 684 371 208 72 21095 438 --1141
NM_052934chr14917 636 439 250 1673 1450 --
NM_052937chr831788 926 137 ------
NM_053002chr351039 1033 830 441 267 ------
NM_053016chr936671 3127 483 ------
NM_054016chr1--1557 ----
NM_054016chr1--1557 ----
NM_054016chr1--1557 ----
NM_054025chr1142127 465 245 154 12135 21924 857 --
NM_057089chr7----1139 --
NM_057175chr412247 ------
NM_057749chr811162 ------
NM_058170chr1------11035
NM_058172chr41515 ------
NM_058237chr142905 872 ------
NM_058241chr221638 579 ------
NM_058241chr221638 579 ------
NM_078469chr1021388 534 --1875 --
NM_078473chr832165 2125 1872 11788 12061 --
NM_078487chr932818 310 195 ----11185
NM_080546chr921632 604 ------
NM_080591chr9103081 2829 2586 944 851 458 342 280 244 67 ------
NM_080759chr1321789 1024 ------
NM_080760chr1321789 1024 ------
NM_080798chr102380 85 ------
NM_080799chr102380 85 ------
NM_080800chr102380 85 ------
NM_080801chr102380 85 ------
NM_080802chr102380 85 ------
NM_080803chr102380 85 ------
NM_080804chr102380 85 ------
NM_080805chr102380 85 ------
NM_080806chr102380 85 ------
NM_080807chr102380 85 ------
NM_080808chr102380 85 ------
NM_080809chr102380 85 ------
NM_080810chr102380 85 ------
NM_080811chr102380 85 ------
NM_080812chr102380 85 ------
NM_080813chr102380 85 ------
NM_080814chr102380 85 ------
NM_080815chr102380 85 ------
NM_080867chr1464967 4879 3916 3768 3597 1435 ----11786
NM_080872chr831553 439 407 ----22636 2579
NM_080927chr313278 ------
NM_130385chr1143181 2554 2312 74 12625 ----
NM_130391chr953619 2973 2386 1202 349 ------
NM_130392chr953619 2973 2386 1202 349 ------
NM_130393chr953619 2973 2386 1202 349 ------
NM_130435chr1022865 1984 ------
NM_130436chr2112303 --1604 --
NM_130438chr2112880 --11181 --
NM_130439chr10----11906 --
NM_130439chr10----11906 --
NM_130773chr22814 707 ------
NM_130797chr731701 1352 109 --11255 11413
NM_130811chr2021162 144 --1400 --
NM_130846chr121428 ------
NM_130901chr151115 ------
NM_133170chr2096928 6848 6780 5226 4989 2210 1761 1625 25 25500 4883 37949 6688 1326 --
NM_133264chr172974 251 --1777 11256
NM_133265chrX32553 1306 1184 ------
NM_133329chr241727 1514 1337 436 ------
NM_133330chr473199 2899 2377 2022 1256 775 731 1110 11163 --
NM_133331chr473199 2899 2377 2022 1256 775 731 1110 11163 --
NM_133334chr475362 4668 4081 3908 2190 2034 453 35772 5086 976 --11808
NM_133335chr473199 2899 2377 2022 1256 775 731 1110 11163 --
NM_133370chr433316 2907 2696 ------
NM_133372chr522009 161 ------
NM_133373chr17280 39 ----1311
NM_133468chr711630 32173 1828 405 ----
NM_133496chr153370 3108 1048 716 628 1883 ----
NM_133509chr1411140 197 ----
NM_133631chr3162 ------
NM_133634chr2171576 1527 1454 757 623 535 439 1445 1665 --
NM_133646chr265215 3941 3668 1933 1622 611 --23856 3746 13723
NM_133647chr1552722 1360 633 314 66 11429 13410 --
NM_134325chr12452 171 1208 ----
NM_138286chr1931636 1314 394 ------
NM_138292chr1143116 2514 1242 775 1297 ----
NM_138316chr101982 ------
NM_138385chr451311 1124 437 71 22 21305 136 --149
NM_138423chr1531824 1414 641 ------
NM_138426chr712365 ------
NM_138457chr652751 2699 1012 843 672 1825 23368 765 --
NM_138473chr1231760 1327 1113 ----13507
NM_138492chr5--11309 1346 1161
NM_138559chr22873 66 ------
NM_138569chr6169 ------
NM_138576chr1433130 3077 1497 13382 --14069
NM_138619chr1721023 37 --21315 238 --
NM_138638chr1442374 2141 1594 1495 ------
NM_138694chr622905 502 --22462 227 --
NM_138701chr7------138
NM_138713chr1646880 5738 5188 2250 25698 2318 ----
NM_138714chr1646880 5738 5188 2250 25698 2318 ----
NM_138717chr61543 --173 --
NM_138727chr152127 1974 1628 588 256 1398 ----
NM_138728chr152127 1974 1628 588 256 1398 ----
NM_138766chr5147 ------
NM_138811chr711114 ------
NM_138821chr5147 ------
NM_138822chr5147 ------
NM_138931chr31256 ------
NM_138967chr1541843 529 400 298 ------
NM_138971chr1133617 3010 1493 1639 ----
NM_138971chr1133617 3010 1493 1639 ----
NM_138972chr1133617 3010 1493 1639 ----
NM_138972chr1133617 3010 1493 1639 ----
NM_138973chr1133617 3010 1493 1639 ----
NM_138973chr1133617 3010 1493 1639 ----
NM_138980chr42600 498 ------
NM_138981chr42731 629 ------
NM_138982chr42600 498 ------
NM_139015chr1211686 ------
NM_139035chrX2736 217 ------
NM_139057chr1552073 1946 637 488 397 12347 --11086
NM_139068chr51157 ------
NM_139069chr51157 ------
NM_139070chr5126 ------
NM_139168chr51375 ------
NM_139321chr2053744 3383 3224 2715 2608 33637 932 580 23505 1271 11247
NM_144498chr203787 542 470 ------
NM_144571chr436889 6535 6034 --11162 1864
NM_144578chr1485198 5149 4217 2185 1901 1598 544 531 ------
NM_144579chr282521 2182 2004 1800 1094 721 461 41 ------
NM_144590chr1052952 2434 691 351 265 ------
NM_144599chr1555403 5164 4498 2001 1608 --15104 --
NM_144607chr1722565 1999 ------
NM_144636chr31703 ------
NM_144664chr1131931 820 239 ------
NM_144691chr193460 250 143 --1605 --
NM_144721chr422580 1698 22540 2521 1233 --
NM_144767chr1583931 3539 3455 3067 1659 1110 1025 462 21050 310 11001 --
NM_144949chr21131 ------
NM_144963chr82541 70 ------
NM_144967chrX3760 162 26 1138 ----
NM_144982chr123647 541 228 ------
NM_145013chr1141814 917 631 595 --22619 1933 --
NM_145049chr5165 ------
NM_145055chr1832377 1158 457 13550 1326 --
NM_145175chr221438 1394 ------
NM_145176chr632592 789 35 1525 ----
NM_145185chr1961715 1669 1590 566 294 35 1314 31601 1583 86 --
NM_145284chrX1903 12113 ----
NM_145287chr181174 ------
NM_145307chr1034672 1187 933 ----11449
NM_145349chr174856 448 140 25 41960 1605 1472 793 ----
NM_145351chr174940 632 517 361 32452 2097 1964 ----
NM_145690chr8----11464 --
NM_145735chr1332861 1935 380 ------
NM_145799chrX2332 314 --32580 1982 1196 --
NM_145891chr1631273 568 267 ------
NM_145892chr1631273 568 267 ------
NM_145893chr1631395 690 389 ------
NM_147147chr643425 1392 1342 1327 21549 776 ----
NM_147150chr913418 11078 13100 --
NM_147164chr91530 ------
NM_148170chr1165425 4988 4516 4225 889 645 --13486 1411
NM_148571chr1721542 139 ----1440
NM_148977chr101982 ------
NM_148978chr101982 ------
NM_152253chr2253972 3329 2832 695 557 --13222 --
NM_152261chr1242505 1946 744 42 --1353 --
NM_152263chr166102 4011 2342 961 892 764 14078 ----
NM_152272chr821004 428 21269 969 ----
NM_152277chr531482 725 195 ------
NM_152345chr174983 854 296 190 154 11131 --
NM_152360chr191147 ------
NM_152371chr151777 1641 1467 1427 566 1387 11403 --
NM_152409chr532536 1033 24 ------
NM_152410chr61371 ------
NM_152414chr811660 1522 11528 --
NM_152417chr841246 1049 826 376 ------
NM_152470chr1873780 3707 3142 3107 3076 3046 1286 23416 2566 13664 --
NM_152512chr221511 --1123 --
NM_152523chr21540 ------
NM_152588chr122610 556 --1731 --
NM_152608chr111605 1688 1145 --
NM_152622chr522860 120 ----1748
NM_152629chr962911 994 959 597 453 96 ------
NM_152641chr1212602 12833 ----
NM_152652chr16--1191 --1202
NM_152678chr341698 912 503 121 ------
NM_152682chr421572 1487 ------
NM_152695chrX31808 1441 773 ----1494
NM_152724chr1032324 2189 2111 --2785 169 --
NM_152733chr696144 6128 5858 5683 5040 4869 2383 1779 1565 46121 5251 4706 979 36298 1690 899 --
NM_152787chrX32662 864 22 1623 ----
NM_152835chr122669 2362 12313 ----
NM_152838chr2043479 3310 371 343 ------
NM_152860chr1221252 601 11296 ----
NM_152924chr1575384 5131 5055 4980 4940 4861 2724 ------
NM_152991chr112601 502 ------
NM_153013chr521863 377 ------
NM_153026chr123505 388 148 --1203 --
NM_153029chr1663955 2894 1168 810 788 764 11598 ----
NM_153035chr152995 2199 334 107 29 13064 ----
NM_153040chr15148 ------
NM_153184chr311921 ------
NM_153188chr524075 1213 ------
NM_153234chr522280 2135 ------
NM_153273chr352412 2140 1104 480 202 --22337 2160 --
NM_153321chr171829 ------
NM_153322chr171829 ------
NM_153347chr1132705 737 94 --12718 --
NM_153367chr1061472 1369 740 404 203 131 --11098 --
NM_153453chr62391 267 ------
NM_153487chr6134529 3639 3409 3195 3079 3017 2974 1829 1130 435 273 170 116 34086 3865 1835 11788 11741
NM_153499chr1242581 2446 2165 1208 1701 12823 12377
NM_153500chr1242581 2446 2165 1208 1701 12823 12377
NM_153607chr552902 1030 946 499 84 ------
NM_153620chr72725 606 2533 289 ----
NM_153633chr121146 ------
NM_153645chr2223263 2911 --11136 1743
NM_153686chr42887 40 ------
NM_153689chr23817 615 101 ------
NM_153756chr141848 1569 1235 220 --1273 --
NM_153810chr1054925 4128 1555 558 195 ----1416
NM_153812chr162237 1964 1939 346 209 193 11767 11498 --
NM_153828chr2173 ------
NM_170587chr81269 ------
NM_170600chr9142 ------
NM_170665chr1233416 3388 327 --12852 11673
NM_170674chr1521266 250 --156 --
NM_170675chr151942 ------
NM_170676chr151942 ------
NM_170677chr1521266 250 --156 --
NM_170706chr164335 3363 1736 1549 1019 47 11475 12980 --
NM_170719chr1311271 ------
NM_170775chr51114 ------
NM_170782chr1----1396 --
NM_171998chrX52072 1641 1587 1021 210 --1239 --
NM_171999chr181684 ------
NM_172020chr741834 717 665 131 ----165
NM_172058chr831654 1452 130 ------
NM_172059chr831654 1452 130 ------
NM_172060chr831654 1452 130 ------
NM_172071chr147476 6644 2418 481 --15816 --
NM_172128chr411618 ------
NM_172193chr1411343 ------
NM_172216chr1242483 2348 2067 1110 1603 12725 12279
NM_172226chr1242581 2446 2165 1208 1701 12823 12377
NM_172315chr1521266 250 --156 --
NM_172316chr1521266 250 --156 --
NM_172344chr241727 1514 1337 436 ------
NM_172375chr14------1873
NM_173039chr111235 ------
NM_173065chr1113118 2535 2507 1294 1034 991 694 384 372 61 43 33328 2576 2560 ----
NM_173075chr4--11707 11774 --
NM_173156chr121422 649 1680 ----
NM_173171chr211098 ------
NM_173172chr211406 ------
NM_173173chr211098 ------
NM_173199chr9------1419
NM_173214chr1646880 5738 5188 2250 25698 2318 ----
NM_173355chr2----1380 --
NM_173468chr445950 5875 5696 2140 --1174 --
NM_173470chrX52382 2359 652 638 521 ------
NM_173475chr1641613 1235 423 37 --11463 --
NM_173495chrX12324 ------
NM_173511chr242744 2418 1335 893 ----11098
NM_173517chr72320 178 ------
NM_173519chr822048 791 --1633 --
NM_173532chr14661 650 262 173 --1522 --
NM_173564chr71665 --3738 163 112 1841
NM_173582chr1145231 5097 1982 1372 25852 1659 16098 11306
NM_173591chr121896 ------
NM_173595chr1255008 4266 3488 1471 318 --24140 383 --
NM_173632chr1932636 1053 569 ------
NM_173642chr1108999 8187 8046 7110 5724 3352 3068 2703 2430 2422 12775 26362 5759 --
NM_173808chr134108 3493 1012 --1319 --
NM_173829chr585513 5494 5458 5135 4783 4711 1767 1134 ------
NM_174916chr1531583 1574 224 ------
NM_174934chr1162755 2246 1417 251 205 178 ------
NM_174938chr9141 ------
NM_175056chr32139 88 ------
NM_175063chr192411 67 ----145
NM_175575chr1711191 ------
NM_175607chr311518 ------
NM_175612chr311518 ------
NM_175630chr22279 168 --1776 --
NM_175768chr621571 93 --21446 185 1539
NM_175852chr153037 2890 2612 2489 49 32199 614 100 21994 1949 1657
NM_175854chr1342266 2179 754 139 --12287 --
NM_175859chrX31764 1711 1669 ------
NM_176792chr1041040 416 296 185 --11288 --
NM_176863chr1731974 1783 1699 11408 1395 --
NM_176871chr873092 2738 1113 514 421 378 58 22772 2486 22132 320 12590
NM_177398chr131266 592 88 11680 --21605 1584
NM_177399chr131266 592 88 11680 --21605 1584
NM_177414chr131655 379 211 ------
NM_177424chr13643 419 64 ------
NM_177438chr142437 339 --1939 --
NM_177559chr201943 ------
NM_177560chr201943 ------
NM_177925chr1242645 450 360 313 12542 ----
NM_177947chrX3527 475 94 ----11125
NM_177948chrX3527 475 94 ----11125
NM_177974chr1531824 1414 641 ------
NM_177999chr993621 3126 2881 2839 2719 2562 2542 1142 698 12959 23439 864 --
NM_178011chr102924 21 12516 ----
NM_178126chr1762007 1938 1726 644 407 280 --1852 --
NM_178151chrX26877 265 13055 ----
NM_178152chrX26877 265 13055 ----
NM_178153chrX26877 265 13055 ----
NM_178167chr163378 116 76 --168 --
NM_178313chr21749 ----11373
NM_178505chr103906 723 378 --13231 --
NM_178548chr11103 ------
NM_178566chr911510 --11781 --
NM_178582chr2051194 1123 1117 1029 32 11259 1254 --
NM_178585chr422979 1104 ------
NM_178812chr821582 1438 ------
NM_181054chr142904 439 ------
NM_181332chrX42361 2337 952 587 ------
NM_181349chr753107 2794 458 404 249 --12071 12745
NM_181351chr1111888 12383 ----
NM_181358chr133940 3592 1116 1419 ----
NM_181361chr31354 ------
NM_181443chr2052172 2156 1136 741 96 ------
NM_181453chr231527 393 240 ------
NM_181489chr3136372 6359 6292 5052 2568 2297 1456 1287 1083 955 902 722 49 15436 34974 4171 534 1175
NM_181504chr562729 1480 1418 969 615 573 ------
NM_181505chr172665 220 --1105 1615
NM_181521chr1676515 5058 4943 2101 1750 1701 76 --31782 1278 483 --
NM_181523chr562729 1480 1418 969 615 573 ------
NM_181524chr562729 1480 1418 969 615 573 ------
NM_181659chr2033053 915 332 ------
NM_181659chr2033053 915 332 ------
NM_181670chr122594 410 ----1538
NM_181672chrX21721 1425 ------
NM_181673chrX21721 1425 ------
NM_181782chr621883 1675 ------
NM_181789chr1532798 2700 605 ------
NM_181825chr221321 ------
NM_181836chr51557 ------
NM_181839chr821369 340 ------
NM_181846chr1952974 2347 1963 754 314 ----12932
NM_182314chrX21362 112 ------
NM_182485chr413056 ------
NM_182488chr132766 732 ------
NM_182515chr1966678 6634 4547 2448 1921 189 25237 864 ----
NM_182526chr1462707 2490 1241 1125 787 178 1505 12673 --
NM_182557chr1161842 1770 567 553 379 26 --11884 --
NM_182580chr152571 2559 1892 710 94 --32357 695 542 --
NM_182641chr173783 442 89 ------
NM_182645chr62391 267 ------
NM_182646chr413056 ------
NM_182666chr3173 ------
NM_182678chr21447 1359 ----
NM_182763chr132137 402 329 ----12705
NM_182765chr103867 378 369 ------
NM_182767chr1231973 1737 145 ----1241
NM_182796chr5--1278 ----
NM_182797chr201476 ------
NM_182798chr521086 265 ----11158
NM_182799chr521086 265 ----11158
NM_182801chr521086 265 ----11158
NM_182811chr2051156 1056 801 409 140 1294 --1784
NM_182907chr622352 53 ------
NM_182931chr71747 ------
NM_182948chr1--13120 ----
NM_182970chr2053820 3771 2859 1335 971 13746 33865 3209 672 --
NM_182972chr122804 744 ----11100
NM_183004chr1431210 731 406 ----13346
NM_183043chr131224 ------
NM_183044chr131224 ------
NM_183227chr621239 470 ----11298
NM_183238chr1212974 1956 --13717
NM_183397chr20105070 4868 4455 4110 4048 3556 3189 1846 1706 893 --14927 --
NM_183412chr161866 1268 612 187 59 21 1548 ----
NM_183413chr161866 1268 612 187 59 21 1548 ----
NM_183425chr2051525 1467 1367 1122 181 11136 21214 360 --
NM_194071chr741926 1887 1231 762 24430 832 12045 13845
NM_194247chr254280 3759 3140 1686 1613 ----157
NM_194278chr1453546 2820 2563 472 261 --11123 --
NM_194285chr1172842 2705 2624 1283 1257 459 250 1629 ----
NM_194286chr1284914 4549 2422 1803 1216 986 511 45 2823 335 25647 938 31103 625 181
NM_194298chr1031822 1400 462 1490 ----
NM_194301chr141751 ------
NM_194313chr951655 1280 1252 234 127 11616 2492 79 --
NM_194314chr135300 3842 3477 ------
NM_194317chr222460 214 --11829 --
NM_194434chr1821518 232 ----13904
NM_194452chr114959 943 837 183 ------
NM_194453chr114959 943 837 183 ------
NM_194463chrX----1403 --
NM_197941chr533039 2576 226 ------
NM_197962chr1235 24 ------
NM_197968chr13157 ------
NM_197977chr9------1848
NM_198056chr372167 1958 1675 1591 763 661 229 122 ----
NM_198086chr1432063 889 698 --1654 --
NM_198087chr162564 162 ------
NM_198088chr162564 162 ------
NM_198128chr1812130 --1947 --
NM_198148chr102948 763 ----1817
NM_198215chr10--1315 1527 --
NM_198236chr11185 --11006 --
NM_198268chr133940 3592 1116 1419 ----
NM_198269chr133940 3592 1116 1419 ----
NM_198270chrX----11396 --
NM_198275chr11177 ------
NM_198279chrX11065 ----170
NM_198281chr412375 1920 ----
NM_198321chr552884 2753 2083 1145 821 12859 1637 --
NM_198336chr721531 281 ------
NM_198392chr652007 1850 929 157 110 --1142 1290
NM_198400chr1542069 1974 1966 244 --1351 --
NM_198401chr811301 21224 308 ----
NM_198467chr71398 ------
NM_198490chr3133281 3122 1295 1182 1145 1130 1124 904 762 687 664 210 113 ------
NM_198504chr31376 ------
NM_198513chr821399 558 ----1453
NM_198530chr171477 ------
NM_198560chr332732 2640 623 22763 2360 1906 --
NM_198581chr287106 6617 6141 2029 962 421 294 121 ----11810
NM_198686chr1462147 2123 2106 451 214 58 ------
NM_198793chr333768 2961 2738 ------
NM_198859chr375073 1220 933 820 603 239 127 23608 381 --14114
NM_198889chr41440 ------
NM_198904chr521801 1736 ------
NM_198993chr1741491 1157 1139 61 ----11109
NM_198995chr18------1207
NM_199005chr92919 386 ------
NM_199072chr732702 508 422 ------
NM_199144chr2011593 --1490 --
NM_199160chr91707 127 11674 --
NM_199168chr1031322 439 164 ------
NM_199169chr2053160 2454 2442 1102 641 1766 ----
NM_199170chr2053160 2454 2442 1102 641 1766 ----
NM_199171chr2053160 2454 2442 1102 641 1766 ----
NM_199188chr1213589 195 --1302
NM_199190chr1213589 195 --1302
NM_199191chr2155 ------
NM_199194chr2155 ------
NM_199203chr2011593 --1490 --
NM_199205chr84593 557 526 105 ------
NM_199262chr1741992 1650 696 157 ------
NM_199320chr432128 567 51 ------
NM_199320chr432128 567 51 ------
NM_199324chr433267 1088 195 --11021 --
NM_199421chr1464967 4879 3916 3768 3597 1435 ----11786
NM_199424chr1651770 1712 1595 584 438 ------
NM_199436chr232419 2332 790 ------
NM_199437chr111743 ------
NM_199438chr111743 ------
NM_199439chr111743 ------
NM_199462chr194253 4068 3768 1871 1529 828 694 586 512 44187 3415 419 404 ----
NM_199478chrX3740 511 225 ------
NM_201266chr242697 2606 1903 574 ------
NM_201279chr242697 2606 1903 574 ------
NM_201428chr11194 ------
NM_201429chr11194 ------
NM_201436chr71215 1751 1618 --
NM_201437chr811410 --11251 --
NM_201516chr71271 1807 1674 --
NM_201517chr71215 1751 1618 --
NM_201568chr121422 649 1680 ----
NM_201569chr121422 649 1680 ----
NM_201595chr141108 ------
NM_201624chr13991 911 428 ------
NM_201999chr41780 ------
NM_203301chr1421605 330 ------
NM_203342chr133414 2756 388 --21187 523 --
NM_203343chr133414 2756 388 --21187 523 --
NM_203349chr1522010 577 ------
NM_203350chr12445 100 ------
NM_203351chr1772487 2318 548 364 210 165 25 --1994 --
NM_203372chr231379 598 240 11511 ----
NM_203394chr1212556 ----12183
NM_203403chr91314 ------
NM_203437chr21607 ------
NM_203446chr2112112 ------
NM_203459chr11681 ------
NM_203488chr141326 ------
NM_203504chr412544 ------
NM_203505chr412544 ------
NM_205846chr5--11309 1346 1161
NM_205848chr121796 71 ------
NM_205860chr133126 2915 2581 ----23138 973
NM_205861chr172035 1519 1312 713 632 438 140 ------
NM_206594chr131470 1167 616 ----22411 1315
NM_206595chr131470 1167 616 ----22411 1315
NM_206853chr634072 3788 2513 ------
NM_206854chr635333 5049 3774 ------
NM_206855chr646298 6014 4739 939 ------
NM_206909chr837630 7500 6451 12428 ----
NM_206921chr6----240 28 --
NM_206925chr1552372 2267 2247 849 348 --21666 123 --
NM_206927chr11--1239 ----
NM_206928chr11--1239 ----
NM_206929chr11--1239 ----
NM_206930chr11--1239 ----
NM_206943chr21653 ------
NM_207042chr13475 97 21 1105 ----
NM_207045chr13475 97 21 1105 ----
NM_207046chr13475 97 21 1105 ----
NM_207113chr73251 133 33 --1114 --
NM_207303chr1024097 932 ------
NM_207306chr1163765 3274 2953 1547 1366 1042 934 898 830 686 650 614 578 506 470 39 13752 14323 --
NM_207337chr12------129
NM_207351chr33455 240 98 3165 118 26 ----
NM_207371chr101642 --11486 --
NM_207372chr10------12470
NM_207380chr1573565 3388 3323 2377 1061 832 92 --22540 2269 23102 2690
NM_207520chr2173 ------
NM_207521chr2173 ------
NM_212460chr731712 1408 777 ------
NM_212474chr21947 ------
NM_212475chr21947 ------
NM_212476chr21947 ------
NM_212478chr21947 ------
NM_212482chr21947 ------
NM_213594chr1211058 ------