TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-223-3p
miRNA Sequence: UGUCAGUUUGUCAAAUACCCCA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr542017 1673 1335 89 --2541 371 11604
NM_000052chrX32247 1323 198 145 --1674
NM_000068chr1911168 ------
NM_000084chrX106794 6374 5519 4923 2110 1934 1306 1076 656 66 ------
NM_000092chr264143 3539 3440 1586 930 367 --2843 255 14287
NM_000109chrX42458 2356 746 646 21846 937 ----
NM_000112chr5124970 4879 4865 4751 4279 3829 3721 3443 3408 3374 1072 862 ----24181 3488
NM_000125chr6104158 3688 3603 3348 3316 1656 1355 1085 1021 286 13238 ----
NM_000139chr1152452 1990 872 826 763 2612 590 ----
NM_000141chr1041397 1177 935 263 11457 ----
NM_000163chr522034 380 --149 --
NM_000167chrX41557 1294 599 258 --11854 --
NM_000168chr753206 2148 990 983 123 --162 13022
NM_000176chr552913 1484 1225 1068 839 --22618 729 --
NM_000208chr1963058 3047 1629 1058 980 771 --1569 23762 3708
NM_000214chr2041656 703 365 93 1143 ----
NM_000217chr12185286 5274 5134 5084 4726 4554 1926 1908 1707 1635 1549 1417 807 708 694 538 401 324 --1260 --
NM_000240chrX41881 1634 702 231 2832 62 1722 11690
NM_000245chr752186 1655 1467 475 315 ------
NM_000248chr352219 860 636 382 244 ----1622
NM_000259chr1585981 5600 5415 1900 736 496 134 105 --15839 2516 26
NM_000267chr1752775 1026 522 337 286 12188 --12535
NM_000282chr132256 70 ------
NM_000305chr7189 1388 ----
NM_000308chr202332 266 ------
NM_000314chr1052479 2092 366 319 55 --13284 1872
NM_000319chr122855 390 --11250 --
NM_000328chrX2402 281 ------
NM_000332chr695847 5084 5010 4961 2088 1611 1448 904 320 36767 4402 686 12614 --
NM_000337chr576302 5880 4599 1588 1522 1203 62 35292 4995 370 14097 24497 556
NM_000338chr1521144 1019 21066 421 ----
NM_000368chr9114656 4006 3472 3442 1890 1659 1361 1142 1127 924 393 --24624 144 --
NM_000390chrX63158 1287 942 779 253 194 ----12563
NM_000393chr241943 1828 1696 201 --1280 1845
NM_000408chr263203 3192 598 591 351 72 1699 23226 2217 --
NM_000421chr171351 ------
NM_000430chr1793787 3603 3412 3335 3207 2717 2383 301 283 23650 3555 ----
NM_000439chr552580 2516 1684 1016 193 ------
NM_000441chr76727 574 414 388 321 63 11600 ----
NM_000448chr1142679 2579 175 37 --1168 --
NM_000461chr394243 3834 3551 3458 1643 1412 1216 1204 658 21435 1129 24092 1597 1925
NM_000462chr1531592 1451 1264 --11468 --
NM_000489chrX83027 1076 987 558 544 516 503 406 ------
NM_000492chr751275 1230 432 391 163 1174 11481 --
NM_000523chr231091 460 395 ------
NM_000533chrX61891 1555 806 606 353 292 --1102 --
NM_000536chr111410 1613 ----
NM_000551chr32435 52 1743 1152 --
NM_000555chrX157562 6817 6232 6036 5986 5719 4927 2876 2566 1919 1764 1371 1012 743 189 ----26311 5220
NM_000598chr731520 1219 340 --1121 --
NM_000599chr273400 3284 1608 1485 1103 701 139 --11843 --
NM_000610chr1172696 2444 1986 1871 953 767 92 --1661 --
NM_000617chr1242267 1659 1543 197 21696 1463 21739 862 2633 226
NM_000618chr12156514 6379 5976 5919 5802 5754 5232 5224 4274 2486 2086 1734 1470 1112 1097 14331 11520 --
NM_000618chr12156514 6379 5976 5919 5802 5754 5232 5224 4274 2486 2086 1734 1470 1112 1097 14331 11520 --
NM_000633chr1884651 4423 3634 1994 1094 1040 1022 842 --11456 13244
NM_000640chrX284 32 ------
NM_000663chr1643138 2864 1185 55 22401 365 1999 --
NM_000684chr101835 ------
NM_000685chr33836 133 107 1284 ----
NM_000685chr33836 133 107 1284 ----
NM_000719chr1265218 5037 4676 2301 1658 1624 14096 12615 11057
NM_000726chr221195 429 --21469 394 --
NM_000788chr431491 1133 393 ------
NM_000793chr14104869 4211 4142 3711 1935 1809 1736 1470 1157 66 11428 23631 3183 2698 301
NM_000801chr202834 141 ----1823
NM_000809chr4208601 8529 8512 8415 8323 8196 7255 6712 6694 6559 6516 6377 3341 2533 1878 1486 1423 1386 1155 517 48094 7880 6579 919 --12090
NM_000814chr1574176 3689 2986 2853 1541 1246 329 23157 631 24242 3726 --
NM_000826chr432085 639 158 11602 1584 --
NM_000827chr521994 156 22393 1661 --11738
NM_000829chr1162147 2086 1726 668 463 222 --1597 --
NM_000849chr182514 2113 842 729 366 216 178 111 23062 196 ----
NM_000860chr431641 481 26 --1606 --
NM_000864chr141028 936 717 203 ------
NM_000866chr331878 263 119 --11633 --
NM_000870chr541628 1585 1384 364 ------
NM_000872chr1031599 1280 229 11379 ----
NM_000875chr1576274 5058 2314 1998 1951 834 792 --15389 1231
NM_000876chr631387 539 392 ------
NM_000880chr82256 188 ----1374
NM_000891chr1742850 1148 573 123 13577 ----
NM_000899chr1224253 289 ----23074 196
NM_000910chr441488 1338 694 569 --2150 84 --
NM_000917chr101893 --192 --
NM_000921chr12138 ------
NM_000933chr2041369 1320 1253 142 ------
NM_000935chr33458 299 24 150 ----
NM_000950chrX73413 3219 3058 1322 483 450 89 1601 12830 --
NM_000959chr143931 2436 1177 92 33808 2857 1089 ----
NM_000971chr8164 ------
NM_000972chr9139 ------
NM_001001323chr12123085 2762 2397 2043 2033 666 634 467 342 336 297 121 12002 33028 2385 798 21955 503
NM_001001330chr103854 519 179 11006 --21203 1031
NM_001001389chr1172696 2444 1986 1871 953 767 92 --1661 --
NM_001001390chr1172696 2444 1986 1871 953 767 92 --1661 --
NM_001001391chr1172696 2444 1986 1871 953 767 92 --1661 --
NM_001001392chr1172742 2490 2032 1917 999 813 138 --1707 --
NM_001001394chr2--1283 ----
NM_001001395chr1252497 2178 1723 974 474 ----181
NM_001001396chr154155 3956 3695 2864 1225 ----12874
NM_001001419chr595101 4331 4156 3440 1475 1279 1238 548 266 --1699 --
NM_001001420chr595101 4331 4156 3440 1475 1279 1238 548 266 --1699 --
NM_001001433chr2052956 2842 2441 450 301 ------
NM_001001481chr823390 2198 ----1193
NM_001001483chr111278 ------
NM_001001484chr1031765 512 198 ------
NM_001001549chr762836 1917 837 507 266 148 11826 --22319 366
NM_001001550chr762836 1917 837 507 266 148 11826 --22319 366
NM_001001555chr762836 1917 837 507 266 148 11826 --22319 366
NM_001001664chr294050 3986 3266 3102 964 748 334 189 122 --31047 681 34 11132
NM_001001668chr1963931 3302 2732 1360 1284 433 21079 268 13197 --
NM_001001684chr1731564 69 28 1253 12241 --
NM_001001702chr511639 11819 ----
NM_001001852chr221749 ------
NM_001001890chr2123848 580 ------
NM_001001928chr22158301 8226 7312 6950 6773 6753 6569 6485 6382 5998 5890 5235 3247 769 334 11183 68232 8139 7258 6268 5410 2673 147
NM_001001994chrX1471 154 ----
NM_001001995chrX41412 723 634 456 1672 --1484
NM_001001996chrX1471 154 ----
NM_001002009chr73153 123 44 1572 ----
NM_001002010chr73153 123 44 1572 ----
NM_001002243chr23715 381 115 ------
NM_001002255chr61272 1239 ----
NM_001002843chr1561074 1027 925 442 399 308 1300 ----
NM_001002860chr1444676 3699 3103 95 34660 3563 1165 24426 1215 12866
NM_001002906chrY3555 385 74 ------
NM_001002909chr1721683 126 11604 ----
NM_001003407chr1084945 4653 4589 4502 3818 3539 937 332 138 14707 --
NM_001003408chr1084945 4653 4589 4502 3818 3539 937 332 138 14707 --
NM_001003652chr18138484 8438 8162 7777 7264 7061 7018 6382 5857 3200 3073 1253 265 11388 37832 7607 1369 --
NM_001003674chr18146576 6436 6250 5644 4625 4275 2803 2289 1895 1650 1498 1463 385 176 --16257 --
NM_001003675chr18146576 6436 6250 5644 4625 4275 2803 2289 1895 1650 1498 1463 385 176 --16257 --
NM_001003679chr132171 2059 744 ------
NM_001003688chr4------2750 87
NM_001003712chr1243513 2476 775 139 --13726 --
NM_001003760chr672999 2713 2402 1453 1074 734 109 ------
NM_001003792chr31317 ------
NM_001003793chr31317 ------
NM_001003805chr14187 ------
NM_001004065chr973359 1458 922 747 580 325 67 13372 ----
NM_001004304chr1262943 2662 870 586 337 297 12032 ----
NM_001004317chr654412 3790 3303 3106 382 14125 21380 92 --
NM_001004360chr261882 1532 1326 1270 336 24 ------
NM_001004419chr1294601 4178 3720 3540 2795 1384 1105 298 204 1812 1329 23319 123
NM_001005353chr141168 996 483 90 21064 817 --1133
NM_001005353chr141168 996 483 90 21064 817 --1133
NM_001005375chrY61814 1555 1226 403 367 325 ------
NM_001005386chr242142 1863 1543 635 11837 1983 --
NM_001005404chr17113917 3843 3417 3001 2991 2810 1654 1513 1490 1475 858 183 1490 --
NM_001005463chr1062504 2001 1593 544 216 119 1675 ----
NM_001005473chr5116263 6120 5887 5707 5362 4615 4383 2643 2159 817 422 15088 12444 --
NM_001005476chr2------1536
NM_001005609chrX73794 3599 3500 3238 2777 1238 259 ----1616
NM_001005732chr211443 --1595 --
NM_001005746chr221195 429 --21469 394 --
NM_001005747chr221195 429 --21469 394 --
NM_001005782chr22412 89 ----198
NM_001006600chr561876 843 733 500 413 314 12289 ----
NM_001006610chr161822 ----1390
NM_001006623chr282287 2095 1901 966 801 782 427 213 1985 12339 --
NM_001006657chr243231 2984 2278 327 13095 23090 2873 --
NM_001007023chr14104869 4211 4142 3711 1935 1809 1736 1470 1157 66 11428 23631 3183 2698 301
NM_001007024chr1773324 3305 3007 2997 2888 1766 163 1128 ----
NM_001007025chr1773324 3305 3007 2997 2888 1766 163 1128 ----
NM_001007027chr111222 ------
NM_001007033chr12269 38 ------
NM_001007097chr9124817 4711 4463 4436 4168 3911 3756 3525 3486 3393 365 294 14475 34288 3896 393 --
NM_001007099chr13673 259 84 ------
NM_001007100chr13673 259 84 ------
NM_001007102chr611251 ------
NM_001007214chr141927 1309 387 48 21522 361 ----
NM_001007237chr162182 2141 1876 1038 853 41 11096 1945 1418
NM_001007240chr161713 --1723 --
NM_001007466chr684666 4293 4254 4090 1864 590 247 214 14777 ----
NM_001007565chr32405 141 ------
NM_001008391chr112543 39 ------
NM_001008401chr1911409 ----21106 932
NM_001008408chr7106145 5719 5642 5405 4892 4614 1490 1482 865 527 24275 1986 --1177
NM_001008491chr22449 278 --2343 331 11458
NM_001008492chr22449 278 --2343 331 11458
NM_001008539chr874802 4591 4556 3769 3596 1482 1460 24990 4693 ----
NM_001008707chr1451749 1438 1272 487 275 11677 2616 475 --
NM_001008801chr1932123 2088 1826 ----11592
NM_001008897chr62386 193 ------
NM_001009554chr474387 4271 3878 900 809 722 215 13586 11052 --
NM_001009554chr474387 4271 3878 900 809 722 215 13586 11052 --
NM_001009814chr132182 72 ------
NM_001009881chr11257 ------
NM_001009882chr11257 ------
NM_001009960chr742752 2656 2640 2455 12282 ----
NM_001009993chr284579 4459 3996 1694 1324 1007 578 344 14095 33857 3540 175 --
NM_001010000chr1863137 2763 664 533 415 183 ------
NM_001010853chr652869 2771 2642 2450 2181 ----1412
NM_001010862chrX63326 3174 1024 960 381 297 --1215 2790 633
NM_001010888chrX44296 4156 3858 3422 14624 11312 --
NM_001010891chr586907 6415 5696 4202 2442 2179 1335 312 26623 1966 ----
NM_001010897chr131371 ------
NM_001010908chr101771 1681 ----
NM_001010942chr12----11140 --
NM_001011537chr321823 301 21963 1622 ----
NM_001011546chr202632 22 1774 ----
NM_001011657chrX4451 329 154 33 11168 11041 --
NM_001011666chr7126247 5797 5782 5515 4869 4398 2352 2333 1375 407 269 119 ------
NM_001011885chr1541741 515 486 418 --1695 --
NM_001012267chr921618 1387 ------
NM_001012393chr1183927 3636 2036 1902 1793 1614 1545 364 11577 23953 1633 --
NM_001012398chr164950 935 871 111 --162 --
NM_001012420chr1562909 2584 2168 853 558 192 22156 529 12193 --
NM_001012423chr1562909 2584 2168 853 558 192 22156 529 12193 --
NM_001012515chr1832235 1967 1909 ------
NM_001012751chr1041267 719 562 133 --1216 --
NM_001012754chr1351733 1452 660 604 283 --11823 --
NM_001012755chrX125107 4625 4584 3721 3083 1945 1910 1808 1750 1524 1149 382 11847 13464 11885
NM_001012756chr1952812 1041 493 437 431 --1550 12316
NM_001012977chrX11015 ------
NM_001013398chr731520 1219 340 --1121 --
NM_001013406chr711174 --11310 --
NM_001013415chr431378 1006 246 1385 --31268 1152 197
NM_001013620chr12158045 6309 6225 5932 5559 2954 2751 2629 2076 1952 1521 494 315 179 67 18126 15528 --
NM_001014286chr13161 ------
NM_001014380chr1365186 4079 2267 1687 1669 169 15604 ----
NM_001014797chr10128102 7675 6627 6294 6221 5510 5308 5298 5259 3196 2658 908 27573 699 11098 --
NM_001015045chr431599 795 368 --1172 21022 665
NM_001015508chr8160 2764 136 1152 --
NM_001015877chrX82696 2104 2036 598 576 307 234 27 11114 ----
NM_001015880chr1021200 191 --11700 1436
NM_001015892chr51141 155 ----
NM_001017368chr1732281 1897 1741 12247 22616 269 --
NM_001017369chr44986 868 798 781 1913 21074 855 --
NM_001017371chr221121 261 1113 --1446
NM_001017395chr373668 3519 3460 3064 3021 2940 2475 ------
NM_001017424chr12624 377 11922 11598 --
NM_001017425chr12624 377 11922 11598 --
NM_001017440chr7137407 6847 6690 6437 2997 2685 2281 2267 1980 1295 953 458 157 36386 3086 1706 11192 --
NM_001017928chr31217 ------
NM_001017962chr101893 --192 --
NM_001017999chr11208 ------
NM_001017999chr11208 ------
NM_001018000chr11208 ------
NM_001018000chr11208 ------
NM_001018001chr11208 ------
NM_001018009chr3152 21161 812 ----
NM_001018037chr931378 1265 236 ------
NM_001018067chr1115199 4704 3940 3373 3338 2129 1779 1518 467 405 135 --1710 --
NM_001018068chr1115199 4704 3940 3373 3338 2129 1779 1518 467 405 135 --1710 --
NM_001018069chr1115199 4704 3940 3373 3338 2129 1779 1518 467 405 135 --1710 --
NM_001018074chr552913 1484 1225 1068 839 --22618 729 --
NM_001018075chr552913 1484 1225 1068 839 --22618 729 --
NM_001018076chr552913 1484 1225 1068 839 --22618 729 --
NM_001018077chr552913 1484 1225 1068 839 --22618 729 --
NM_001018088chr151151 --165 --
NM_001018111chr794044 3885 3783 3702 3582 3046 997 868 844 ----12944
NM_001018161chr7189 1388 ----
NM_001020658chr1245 36 154 1218 1524
NM_001020658chr1245 36 154 1218 1524
NM_001023560chr63853 300 44 --1422 --
NM_001023567chr1532301 561 192 1532 11900 --
NM_001023570chr31342 ----122
NM_001023571chr3------122
NM_001024094chr552913 1484 1225 1068 839 --22618 729 --
NM_001024460chr631318 927 184 ----1385
NM_001024647chr12106319 5579 5019 2905 2480 1991 1510 835 559 41 --35133 827 157 --
NM_001024649chr552294 1930 568 555 472 12562 11175 --
NM_001024847chr332304 2199 2108 --187 --
NM_001024948chr142894 1217 217 130 13055 11175 12957
NM_001024956chr1195625 4281 4218 1544 936 849 833 646 562 ----13832
NM_001025076chr1096223 5537 4818 4544 2330 2083 2035 275 174 --16251 --
NM_001025077chr1097581 6895 6176 5902 4893 4587 1633 1532 1152 --27609 4791 --
NM_001025100chr1821387 339 13853 13567 22617 75
NM_001025105chr551441 1192 1177 528 217 --1153 --
NM_001025108chr21555 11620 13278 --
NM_001025203chr21151 ------
NM_001025204chr21151 ------
NM_001025595chr41160 1302 ----
NM_001029858chr653360 2715 2655 1080 24 11173 22478 607 --
NM_001029875chr562699 2516 2245 822 441 73 ----22107 242
NM_001029997chr191539 ----1213
NM_001030007chr1683444 3256 1418 1119 824 641 152 111 11149 ----
NM_001030055chr1423990 3026 11068 14534 --
NM_001031623chr661689 1675 1654 1549 1192 45 --1517 --
NM_001031679chr1223080 1080 --1178 11414
NM_001031684chr231398 572 343 --1611 11437
NM_001031690chr772428 1914 1088 631 204 93 87 --12704 --
NM_001031695chr22104857 4706 4432 4204 3952 2025 1973 1903 1785 836 34791 4568 1753 11759 11536
NM_001031716chr22922 843 ------
NM_001031723chr44424 172 153 110 ------
NM_001031732chr493665 3459 3298 2924 917 775 264 171 21 --23480 3328 2218 206
NM_001031740chr131265 579 418 --11200 21342 293
NM_001031743chr61188 ------
NM_001031804chr1674233 3390 3190 3130 1733 464 246 ------
NM_001032288chr2051484 1176 1102 294 278 ------
NM_001032380chr103519 418 123 21588 1534 1208 21766 233
NM_001032394chr61398 ------
NM_001032395chr61265 ------
NM_001032999chr20114549 4461 4412 3679 3617 3488 1822 1492 1244 478 64 13436 1274 --
NM_001033045chr233616 3466 1395 23887 3840 1201 --
NM_001033047chr422482 424 --22549 465 --
NM_001033059chr631460 516 245 ------
NM_001033081chr151886 1678 1667 529 410 1309 31622 602 257 --
NM_001033082chr151886 1678 1667 529 410 1309 31622 602 257 --
NM_001033117chr364446 4235 3760 3440 3202 142 14264 13361 --
NM_001033503chr51158 --1166 --
NM_001033557chr24524 274 258 150 1386 1898 --
NM_001033581chr12323 38 ------
NM_001033581chr12323 38 ------
NM_001033582chr12323 38 ------
NM_001033925chr1052051 2034 572 561 111 ------
NM_001034850chr551415 1126 655 588 89 1175 --1169
NM_001034954chr1051110 627 584 448 214 --12584 13095
NM_001034955chr1051110 627 584 448 214 --12584 13095
NM_001034956chr1051110 627 584 448 214 --12584 13095
NM_001034957chr1051110 627 584 448 214 --12584 13095
NM_001035003chr4--11069 ----
NM_001035004chr4--11069 ----
NM_001037131chr221347 1181 ----1381
NM_001037132chr742167 1721 392 180 11748 --1240
NM_001037133chr742167 1721 392 180 11748 --1240
NM_001037164chr71812 11796 21704 262 --
NM_001037165chr7127735 7620 6951 6843 6320 5974 5654 5625 3078 2319 1857 924 27509 6516 37588 3038 213 --
NM_001037174chr2--32080 1569 226 1102 --
NM_001037339chr171652 1482 1396 733 345 335 286 --11592 --
NM_001037340chr171652 1482 1396 733 345 335 286 --11592 --
NM_001037341chr171652 1482 1396 733 345 335 286 --11592 --
NM_001037341chr171652 1482 1396 733 345 335 286 --11592 --
NM_001037553chr21124954 4382 4346 4321 4125 3828 3771 3199 2001 1963 973 112 --14238 --
NM_001037954chr1163105 2977 2895 2535 2397 660 --1764 --
NM_001038493chr211453 ------
NM_001038702chr542349 2256 1805 957 ----12640
NM_001039199chr2054890 3756 3645 565 213 11080 ----
NM_001039479chr14122419 1860 1574 855 800 742 722 613 335 295 221 78 ------
NM_001039538chr233325 3048 211 12954 22513 179 --
NM_001039547chr3138053 7944 7603 6491 6335 4996 3120 2775 2589 2404 1029 927 464 13174 --1892
NM_001039580chr4124469 4458 4147 3903 3865 1958 1914 1777 1279 1198 1025 965 1127 34274 3347 465 13197
NM_001039585chr144188 2693 1434 349 34065 3114 1346 ----
NM_001039590chrX43134 3017 1596 1236 13992 12888 --
NM_001039591chrX43134 3017 1596 1236 13992 12888 --
NM_001039618chr11125243 5229 4987 4934 4362 4207 4060 2300 2146 1950 1246 1155 14485 ----
NM_001039709chr20114549 4461 4412 3679 3617 3488 1822 1492 1244 478 64 13436 1274 --
NM_001039762chr1041989 1796 1468 220 11452 ----
NM_001039840chrX125362 4692 4653 4503 4303 4204 3814 2399 1775 1146 1135 793 11970 ----
NM_001039937chr1363727 3639 3178 1325 892 268 13823 ----
NM_001040020chr751373 1178 537 298 21 11004 ----
NM_001040057chr731329 1098 322 ------
NM_001040101chr451560 600 546 468 341 185 ----
NM_001040142chr282116 1957 1856 1782 1673 540 187 172 --32475 969 104 1233
NM_001040143chr282116 1957 1856 1782 1673 540 187 172 --32475 969 104 1233
NM_001040152chr794516 4354 3809 3478 3140 1646 1537 229 207 24413 1311 14032 14016
NM_001040153chr131794 1404 ----
NM_001040172chr541628 1585 1384 364 ------
NM_001040173chr541628 1585 1384 364 ------
NM_001040181chr3--157 --11095
NM_001040182chr3--157 --11095
NM_001040183chr3--157 --11095
NM_001040199chr3--157 --11095
NM_001040200chr3--157 --11095
NM_001040284chr1644112 3786 2382 1809 1164 11735 --
NM_001040402chr463182 3143 2958 2503 2476 1966 ------
NM_001040429chr1393485 3438 3142 2855 2479 1327 1314 391 345 --22498 2378 11417
NM_001040440chr51131 ------
NM_001040441chr174976 4767 3567 2035 1387 105 47 --35473 4452 1233 --
NM_001040450chr1522874 362 1785 ----
NM_001040453chr1522874 362 1785 ----
NM_001040665chr774769 4399 4328 4309 4298 904 718 21219 645 2851 131 --
NM_001040666chr73471 101 30 ------
NM_001040708chr871143 1121 948 879 762 752 244 ------
NM_001040876chr461879 1602 1280 1179 761 325 1447 ----
NM_001042369chr1159 ------
NM_001042371chr1681824 1738 1536 618 454 398 317 44 ------
NM_001042383chr363378 3091 618 314 285 138 ----1148
NM_001042404chr131779 1632 263 ------
NM_001042406chr641210 1006 200 147 --1298 --
NM_001042413chr963787 1500 982 972 150 127 33458 3073 1577 ----
NM_001042453chrX41637 1524 1176 528 ------
NM_001042473chr1071812 1722 789 667 626 59 39 ------
NM_001042486chr20----1131 --
NM_001042492chr1752775 1026 522 337 286 12188 --12535
NM_001042494chr1583612 3374 3338 3072 1148 326 282 139 --22712 989 --
NM_001042495chr1583612 3374 3338 3072 1148 326 282 139 --22712 989 --
NM_001042496chr1583612 3374 3338 3072 1148 326 282 139 --22712 989 --
NM_001042497chr1583612 3374 3338 3072 1148 326 282 139 --22712 989 --
NM_001042510chr851791 856 794 510 472 ----22144 669
NM_001042511chr851791 856 794 510 472 ----22144 669
NM_001042533chr3133111 2900 2782 2695 2366 2158 2099 1285 1232 1078 946 396 289 ------
NM_001042537chrX42458 1852 613 525 ----11938
NM_001042550chr961940 1295 533 435 360 342 12058 ----
NM_001042555chr1264703 4686 4500 4474 1441 1137 1105 13316 --
NM_001042585chr15632 595 575 249 114 ------
NM_001042599chr2137798 7786 6642 5616 5204 3144 2586 2402 2279 2254 1026 520 182 56947 6381 5490 4965 987 22941 425 15499
NM_001042601chr372710 1065 937 455 420 329 270 ------
NM_001042603chr1284558 3791 3693 1174 562 394 353 277 --12125 --
NM_001042604chr354587 4560 3805 922 116 ----23689 1956
NM_001042635chr141134 ------
NM_001042681chr121742 250 2638 368 --11924
NM_001042682chr121742 250 2638 368 --11924
NM_001042682chr121742 250 2638 368 --11924
NM_001043351chr152306 2224 825 105 87 11825 177 --
NM_001044305chr631298 154 135 ----11174
NM_001044385chr262771 2641 2501 2455 1097 430 23826 1091 33915 2897 460 13627
NM_001046chr562742 2713 2253 472 231 60 --12098 --
NM_001068chr3----1111 --
NM_001079874chr142170 1378 1329 83 1181 ----
NM_001083620chr432083 638 158 11601 1583 --
NM_001083621chr153681 3617 3399 2907 1444 21465 1296 11677 14582
NM_001099678chr365598 4078 2025 1339 577 39 15915 12492 --
NM_001106chr3108601 8493 7486 6912 6474 3865 3471 1823 746 606 16139 ----
NM_001113490chrX43605 931 752 415 13665 13108 --
NM_001122631chr11--1462 ----
NM_001128chr1683444 3256 1418 1119 824 641 152 111 11149 ----
NM_001146chr832356 1651 236 --1796 --
NM_001151chr43268 258 250 ------
NM_001167chrX96571 6191 5025 4748 4546 2434 290 262 222 1620 167 --
NM_001173chr1423990 3026 11068 14534 --
NM_001177chr122557 118 1831 ----
NM_001198chr622337 2101 22058 1918 22324 1872 --
NM_001200chr201902 ------
NM_001201chr463423 3129 2421 991 893 153 --13207 --
NM_001204chr287259 6870 6588 5878 4898 3039 2392 1285 --22250 1589 17615
NM_001206chr943007 2666 1252 80 --12905 --
NM_001233chr711811 2446 149 --11720
NM_001241chr232378 2006 1602 31646 759 550 ----
NM_001241chr232378 2006 1602 31646 759 550 ----
NM_001256chr1742007 198 47 28 --22905 423 --
NM_001257chr16----21126 1067 --
NM_001259chr762393 2278 2255 347 274 25 --16067 --
NM_001270chr531129 1097 333 ------
NM_001271chr1582021 1224 970 886 800 772 400 129 --1271 --
NM_001273chr121570 ------
NM_001289chrX11201 155 ----
NM_001290chr41169 21068 238 ----
NM_001310chr1272832 2582 2313 1166 1029 451 443 22410 817 --12736
NM_001329chr1021357 161 11323 1103 --
NM_001331chr1142605 2408 2353 601 --3918 421 62 --
NM_001344chr14123 ------
NM_001351chr361529 1195 301 230 224 184 ------
NM_001356chrX42127 922 904 284 11894 ----
NM_001364chr1184238 3837 3475 1529 1431 1234 677 319 31151 611 551 14018 --
NM_001380chr10--11061 ----
NM_001387chr543013 1946 1153 837 22830 2456 --13157
NM_001396chr2132727 1984 132 12800 11803 --
NM_001399chrX73794 3599 3500 3238 2777 1238 259 ----1616
NM_001408chr141548 1534 1377 609 --1346 --
NM_001412chrX73014 2728 1264 1044 660 519 120 33187 2738 704 13690 1159
NM_001415chrX61967 1927 1606 1375 418 97 11802 ----
NM_001419chr1974638 3242 3026 1793 1724 1660 265 --13680 23555 3450
NM_001429chr221743 ------
NM_001430chr241789 1319 704 650 11957 1552 --
NM_001432chr4103952 3904 3894 3120 2839 2537 1504 1159 696 214 --12825 --
NM_001438chr122811 561 21227 121 1712 --
NM_001440chr842268 2015 538 229 1234 ----
NM_001449chrX31245 811 258 1471 ----
NM_001498chr631363 134 32 1914 2249 40 --
NM_001530chr1411008 ----1820
NM_001542chr162182 2141 1876 1038 853 41 11096 1945 1418
NM_001609chr1054524 4282 4201 1611 1097 --1776 13119
NM_001616chr242679 2512 624 45 11401 13067 1319
NM_001620chr114804 787 593 274 ------
NM_001627chr342437 1742 1476 51 2585 97 --1688
NM_001634chr631460 516 245 ------
NM_001650chr18103965 3951 3345 3114 2727 2643 1292 966 920 407 12608 11503 --
NM_001656chr581920 1705 1618 1545 754 691 367 195 ------
NM_001660chr32607 523 ------
NM_001663chr1472500 2486 2276 2176 1719 978 489 ------
NM_001677chr11226 --1275 1458
NM_001682chr1282799 2476 2111 380 348 181 56 50 --32742 2099 512 1217
NM_001684chr153872 3673 3412 2581 942 ----12591
NM_001695chr874241 4106 4003 3886 3821 2606 680 --11427 --
NM_001709chr114732 520 321 265 ----11827
NM_001729chr41328 ------
NM_001742chr721430 239 11263 1295 --
NM_001743chr21195 ------
NM_001744chr51548 ------
NM_001745chr53426 304 225 1194 ----
NM_001746chr552294 1930 568 555 472 12562 11175 --
NM_001753chr741619 1339 322 105 21818 1581 ----
NM_001754chr2123848 580 ------
NM_001755chr1641570 1519 144 116 ----11495
NM_001759chr1254740 4185 4055 2125 464 11165 --11497
NM_001781chr12125 ------
NM_001792chr1821085 302 ----151
NM_001797chr16------1292
NM_001799chr51240 ------
NM_001830chrX63851 2758 2530 1074 317 36 1685 13612 13541
NM_001845chr133960 274 163 ------
NM_001854chr121366 1285 ----11399
NM_001858chr685043 4687 4514 4275 4029 3435 1301 325 21508 706 14497 --
NM_001880chr21200 ------
NM_001891chr4----143 --
NM_001892chr551441 1192 1177 528 217 --1153 --
NM_001901chr65950 932 382 354 117 --149 --
NM_001918chr1128615 8067 7664 7452 7404 7031 5761 5716 3649 1990 1972 523 11045 2875 654 1275
NM_001933chr1441209 912 552 42 --11379 --
NM_001939chrX73699 3431 2974 2855 2435 1185 96 12479 11039 --
NM_001963chr4----1553 --
NM_001969chr1432608 2571 337 1565 32474 821 347 --
NM_001977chr441317 1093 574 251 ------
NM_001987chr1264220 3819 3576 3543 3347 1039 --11495 --
NM_001992chr521887 716 ----11467
NM_002009chr1532423 785 250 11077 1134 --
NM_002015chr1362495 2133 945 914 511 58 --1494 12743
NM_002017chr1151091 1061 517 477 92 ----11356
NM_002024chrX21798 1367 ------
NM_002025chrX118607 8527 8132 7487 3591 2382 2147 2061 1869 1183 60 --17832 1963
NM_002031chr62667 169 ------
NM_002035chr1833029 2617 1578 1583 --13910
NM_002061chr151665 485 430 226 54 ------
NM_002077chr981905 1808 1327 807 754 319 185 163 163 ----
NM_002092chr465042 1693 1576 1400 495 400 23533 3225 ----
NM_002094chr16----144 --
NM_002126chr1743290 2790 2549 291 43787 3020 1642 1481 23120 121 --
NM_002128chr1352201 722 662 370 88 ------
NM_002130chr531485 607 561 31663 189 132 ----
NM_002136chr121614 ----1505
NM_002140chr931055 937 74 ------
NM_002158chr243530 2641 952 540 ------
NM_002188chr52801 790 ------
NM_002203chr553740 3552 3316 1664 663 1877 1260 --
NM_002210chr243541 2668 2451 1129 12417 ----
NM_002214chr7155573 4505 4258 3896 3662 3615 2141 1776 1721 1491 887 792 297 179 33 22263 141 24291 4010 15612
NM_002223chr1293867 3836 3162 2558 1602 495 473 361 67 2623 375 ----
NM_002242chr231401 374 326 11514 ----
NM_002247chr10--11805 11549 11789
NM_002254chr242285 1733 738 417 12088 ----
NM_002264chr323717 2017 24720 1033 --1376
NM_002267chr1321830 624 31577 341 279 --22085 531
NM_002268chr331724 352 334 ------
NM_002270chr575478 5340 5146 4792 4384 1711 1177 15355 ----
NM_002271chr1321613 769 11926 1482 12383
NM_002285chr21555 11620 13278 --
NM_002293chr152306 2298 2028 1992 726 --1687 12561
NM_002310chr586339 6078 4988 4942 4063 2621 1244 663 --34883 4128 1180 --
NM_002313chr1084945 4653 4589 4502 3818 3539 937 332 138 14707 --
NM_002334chr1171934 1474 1281 786 753 729 357 ------
NM_002336chr12145050 4877 4859 4754 4310 4285 3863 3492 1702 1610 806 797 342 305 ------
NM_002349chr23536 431 223 11098 ----
NM_002356chr652343 2322 2122 1969 440 --12001 --
NM_002372chr51251 ------
NM_002374chr233325 3048 211 12954 22513 179 --
NM_002376chr14156 ------
NM_002380chr82774 364 ----1920
NM_002387chr5114584 4217 4193 4005 3765 3313 1897 1596 1200 852 166 11285 11377 --
NM_002397chr5--11988 11633 --
NM_002408chr145837 235 179 87 66 1684 ----
NM_002430chr2222510 1859 1569 ----
NM_002440chr11106 ------
NM_002444chrX11840 11411 1481 --
NM_002445chr831442 1134 326 --185 --
NM_002451chr943525 1124 647 574 ------
NM_002465chr12174 ------
NM_002481chr1107820 7722 7427 7068 5902 5175 2590 1516 481 223 25940 3106 32989 2832 570 --
NM_002505chr681405 1375 1282 452 445 176 59 24 1240 ----
NM_002519chr11155 178 --1504
NM_002522chr1753582 3085 1284 705 249 21577 1298 33364 3332 2569 --
NM_002524chr11866 2971 54 ----
NM_002545chr1183927 3636 2036 1902 1793 1614 1545 364 11577 23953 1633 --
NM_002547chrX73049 2684 1683 1219 792 425 400 11696 --12700
NM_002568chr82385 378 ------
NM_002577chr363540 2992 2616 765 303 223 14012 ----
NM_002583chr122405 44 ------
NM_002590chr133407 226 61 ------
NM_002595chr123358 282 64 1587 --11591
NM_002600chr171652 1482 1396 733 345 335 286 --11592 --
NM_002605chr1531014 754 479 ----11032
NM_002610chr293098 2840 2804 2677 1036 759 731 214 137 --1765 --
NM_002612chr721423 134 1352 --11526
NM_002613chr1665162 4640 4572 3894 1586 910 12153 13779 --
NM_002645chr1152935 2580 1162 601 471 12722 12526 12491
NM_002655chr864785 3460 1451 1081 969 162 ------
NM_002662chr321884 814 2728 638 11779 --
NM_002677chr862723 2660 2286 930 139 74 2372 67 --12455
NM_002706chr2----1181 --
NM_002709chr243247 2934 2760 669 ----21015 702
NM_002710chr121306 ------
NM_002715chr5--11137 ----
NM_002716chr1163414 3177 1046 677 227 71 22502 884 --13707
NM_002721chr9122 ----1335
NM_002737chr17106435 5999 5657 5412 4166 1807 1748 1407 1028 932 26517 578 15495 11609
NM_002744chr12323 38 ------
NM_002747chr1831698 630 623 11443 --1375
NM_002753chr41759 187 ----
NM_002760chrY86001 5849 5708 5086 1683 1334 483 57 ----1362
NM_002786chr11162 ------
NM_002822chr1221484 66 ----11371
NM_002825chr71257 ------
NM_002836chr20--2455 173 ----
NM_002857chr162716 2364 1787 848 333 150 --12221 12444
NM_002858chr161269 1230 1186 1143 1137 384 --11286 --
NM_002886chr385071 4269 4039 3993 3482 711 695 615 14294 13261 --
NM_002890chr5--1405 --1384
NM_002897chr2--1100 ----
NM_002938chr421830 408 --11397 --
NM_002940chr461879 1602 1280 1179 761 325 1447 ----
NM_002948chr341316 1201 1128 294 ------
NM_002968chr161739 --1265 --
NM_002971chr341195 1000 758 399 ------
NM_002977chr242475 2224 811 184 33445 891 828 ----
NM_002979chr13673 259 84 ------
NM_002998chr81354 22242 730 11373 --
NM_002999chr2051935 606 310 100 21 11523 11575 --
NM_003016chr1741826 1397 1288 460 --1341 --
NM_003017chr651350 1295 1020 358 247 1283 --1350
NM_003030chr371994 1973 1780 1658 1525 471 125 --1703 --
NM_003031chr161822 ----1390
NM_003034chr1297971 7769 6187 5776 1992 1192 1008 431 25 11558 46881 5352 3245 392 --
NM_003042chr321789 782 --11877 --
NM_003043chr3113978 3891 3186 3114 3086 2737 1354 807 684 675 376 --11499 --
NM_003045chr13104973 4337 4080 3210 1590 1171 1063 856 828 810 34956 3713 1807 23907 3456 --
NM_003046chr874802 4591 4556 3769 3596 1482 1460 24990 4693 ----
NM_003051chr151761 1628 1507 66 26 1521 --11466
NM_003079chr171256 --1801 --
NM_003099chr1586277 6267 5676 5608 4195 2585 1216 319 16374 15972 --
NM_003108chr276842 6397 5634 4425 1629 1362 569 16442 36637 762 668 11588
NM_003111chr221121 261 1113 --1446
NM_003112chr753131 2262 1978 1144 188 --22165 442 --
NM_003128chr232507 1920 795 --12652 1645
NM_003130chr731318 147 42 11166 11196 --
NM_003137chr631847 360 38 --11644 --
NM_003150chr1732131 1776 37 21535 469 --11961
NM_003161chr1742792 824 481 231 ----1292
NM_003187chr51141 155 ----
NM_003189chr132100 995 154 12700 --12865
NM_003199chr18115378 5051 4842 4739 3585 1636 1601 1308 877 735 292 14694 15192 --
NM_003203chr242292 2162 955 290 --11966 --
NM_003221chr663935 3793 2928 1333 411 171 1281 ----
NM_003222chr2041187 1081 372 235 ------
NM_003234chr312196 22163 1740 11819 --
NM_003242chr332304 2199 2108 --187 --
NM_003257chr1541377 514 204 37 ----1136
NM_003262chr354620 1850 622 606 21 --33902 3498 940 --
NM_003269chr641017 970 333 267 --11280 1140
NM_003270chrX2763 433 1109 1490 193
NM_003275chr961377 975 944 558 508 33 --1447 --
NM_003291chr134742 690 154 116 ------
NM_003292chr182215 2076 2033 1973 916 891 851 95 1491 ----
NM_003298chr396075 5760 5232 4968 4659 4041 2080 614 326 ----14188
NM_003309chr651623 1399 1228 337 110 ------
NM_003320chr1174461 3657 3563 3125 3093 2869 304 --1155 --
NM_003338chr103624 288 73 1775 --11213
NM_003339chr531283 551 285 ------
NM_003348chr1231696 1386 1169 11052 ----
NM_003349chr2051484 1176 1102 294 278 ------
NM_003352chr22412 89 ----198
NM_003367chr19----1543 1500
NM_003375chr101334 ------
NM_003385chr21789 ------
NM_003404chr2041765 1706 1586 271 1238 1643 --
NM_003410chrX32551 2169 1124 12741 --1217
NM_003413chrX41741 784 666 61 --1366 --
NM_003432chr52417 203 --151 --
NM_003435chr191584 165 --1687
NM_003463chr653401 3179 1246 1114 1030 --1252 --
NM_003470chr1621856 169 ------
NM_003473chr103960 250 164 148 ----
NM_003478chr1131315 1253 579 --1959 --
NM_003489chr2152724 2657 665 655 104 12595 ----
NM_003498chr1662756 1785 564 439 278 146 1101 12138 --
NM_003566chr1223192 1337 22403 2191 11168 13388
NM_003574chr18105313 5155 5012 4919 4350 3659 1711 1402 735 537 25503 4697 15370 --
NM_003580chr8131 ------
NM_003583chr1263859 3075 1559 1312 1271 289 --13472 --
NM_003590chr222516 1459 12834 11363 13366
NM_003603chr411743 --12031 --
NM_003615chr373753 3638 3108 2822 2631 1590 1170 --21404 523 13894
NM_003622chr1242671 2069 1917 659 ----12576
NM_003628chr2------1536
NM_003629chr142994 2825 786 570 22675 211 ----
NM_003631chr103859 757 682 --2419 81 --
NM_003633chr542584 2452 831 164 11691 ----
NM_003663chr333240 3204 2923 1885 --12272
NM_003664chr51508 ------
NM_003671chr9143572 3446 2578 2313 1434 1375 1132 975 763 755 357 218 43 24 --23367 701 --
NM_003677chr1272279 2011 1487 826 816 414 37 ------
NM_003679chr153283 2623 2542 357 125 ----12342
NM_003701chr132365 335 --1829 1844
NM_003714chr562552 2417 2307 1166 790 541 22831 2164 ----
NM_003722chr372407 2399 2262 962 435 420 293 1688 ----
NM_003749chr1362371 1898 1867 722 429 262 1647 ----
NM_003758chr1541652 1554 1215 464 ------
NM_003758chr1541652 1554 1215 464 ------
NM_003759chr483429 3422 2801 2754 2740 1507 681 531 --13190 1168
NM_003763chr2052956 2842 2441 450 301 ------
NM_003774chr12102582 1276 1136 1111 923 872 690 521 275 165 ----131
NM_003787chr1851681 382 375 363 338 ------
NM_003800chr632439 2243 83 --11695 --
NM_003816chr831210 155 41 --1436 --
NM_003822chr162781 2283 1200 1092 1066 437 --21016 344 --
NM_003829chr931079 1006 965 1170 ----
NM_003861chr1442819 2610 2530 739 11044 ----
NM_003873chr1042505 851 729 340 32144 693 264 ----
NM_003884chr341801 1762 1270 177 ------
NM_003885chr1752703 526 454 257 228 ----12060
NM_003887chr252239 1472 638 245 224 ------
NM_003899chr136942 903 311 278 202 178 1657 12603 --
NM_003909chr842947 2473 835 758 ------
NM_003913chr654344 4240 2876 1396 45 --24329 644 1592
NM_003934chr921082 520 11274 11111 --
NM_003939chr1054043 3566 2647 2558 2537 12988 1207 --
NM_003941chr752467 1852 829 688 488 1299 11975 --
NM_003966chr5117399 6994 6665 6472 5945 4727 3103 2138 1491 1354 178 27602 3011 --11007
NM_003971chr171410 ----1439
NM_003972chr101396 ------
NM_003994chr1224253 289 ----23074 196
NM_004006chrX42458 2356 746 646 21846 937 ----
NM_004007chrX42458 2356 746 646 21846 937 ----
NM_004009chrX42458 2356 746 646 21846 937 ----
NM_004010chrX42458 2356 746 646 21846 937 ----
NM_004011chrX42458 2356 746 646 21846 937 ----
NM_004012chrX42458 2356 746 646 21846 937 ----
NM_004013chrX42458 2356 746 646 21846 937 ----
NM_004014chrX42458 2356 746 646 21846 937 ----
NM_004015chrX42458 2356 746 646 21846 937 ----
NM_004016chrX42372 2270 660 560 21760 851 ----
NM_004017chrX42458 2356 746 646 21846 937 ----
NM_004018chrX42372 2270 660 560 21760 851 ----
NM_004020chrX42458 2356 746 646 21846 937 ----
NM_004021chrX42372 2270 660 560 21760 851 ----
NM_004022chrX42372 2270 660 560 21760 851 ----
NM_004023chrX42372 2270 660 560 21760 851 ----
NM_004028chr18103965 3951 3345 3114 2727 2643 1292 966 920 407 12608 11503 --
NM_004035chr1741407 1327 968 352 --44253 4110 1498 109 --
NM_004061chr51654 ------
NM_004080chr721397 29 ------
NM_004081chrY61814 1555 1226 403 367 325 ------
NM_004093chr1333252 2581 2555 11059 195 --
NM_004094chr1452562 2169 2125 2096 102 ------
NM_004100chr652597 1756 816 644 275 12643 1531 --
NM_004113chr341336 527 375 173 --1389 1479
NM_004124chr1453379 3204 2529 2399 1133 13065 12577 13486
NM_004133chr862727 2185 1717 780 374 271 --22472 886 --
NM_004136chr1583270 3045 2248 2073 995 496 153 33 12682 31078 904 653 --
NM_004161chr251530 1344 1200 578 153 11329 ----
NM_004170chr931709 1566 722 ------
NM_004171chr11159587 9555 9262 8695 8307 7606 7512 7372 7041 5990 5905 3563 3406 726 268 38027 7959 766 38843 6239 59 --
NM_004172chr521679 199 ------
NM_004225chr831530 1398 406 --11320 --
NM_004227chr752784 2704 2054 2001 236 --12928 --
NM_004229chrX32045 1725 1399 132 --1129
NM_004232chr1811015 ----1541
NM_004241chr103572 78 38 1142 ----
NM_004253chr9133 2906 69 ----
NM_004255chr15--136 ----
NM_004272chr561803 1450 759 570 554 108 --11424 --
NM_004274chr1443097 653 371 137 12519 --12596
NM_004282chr6167 1111 --1582
NM_004285chr156458 5047 4693 4393 4175 25347 1316 1412 --
NM_004287chr1762574 2279 1853 705 534 307 21914 1685 ----
NM_004291chr51389 ------
NM_004311chr1032632 407 235 --1174 --
NM_004319chr183190 3065 2973 2759 2635 1165 520 397 --12710 --
NM_004331chr842591 2528 2069 1861 --22410 1913 --
NM_004338chr18146576 6436 6250 5644 4625 4275 2803 2289 1895 1650 1498 1463 385 176 --16257 --
NM_004342chr752022 1867 1725 613 260 12228 12164 1602
NM_004354chr42786 606 1570 ----
NM_004362chr41472 ------
NM_004365chr51239 ------
NM_004379chr23399 295 45 ----21478 468
NM_004380chr1651958 1793 1766 1045 658 --2546 426 --
NM_004389chr21167 ----1803
NM_004404chr22449 278 --2343 331 11458
NM_004411chr72738 180 ------
NM_004412chr10105653 5625 5557 4626 3801 2118 2031 1657 1233 531 15775 14905 1242
NM_004434chr1451749 1438 1272 487 275 11677 2616 475 --
NM_004440chr631855 1417 54 ------
NM_004442chr121730 1074 11144 ----
NM_004457chr2------1143
NM_004458chrX5798 790 675 205 199 --22411 1926 --
NM_004480chr141582 ----1153
NM_004482chr21866 ------
NM_004501chr153804 2836 2733 1306 547 11212 33063 2518 1367 124
NM_004503chr12197 190 --1844
NM_004504chr252240 1129 696 577 87 ----11079
NM_004505chr1741855 1507 275 59 1452 ----
NM_004523chr1021466 1437 ------
NM_004525chr231508 1478 1425 --1363 --
NM_004537chr1231459 1334 1062 ------
NM_004540chr215804 615 273 231 81 1237 ----
NM_004571chr2133441 2987 465 --1717 13363
NM_004575chr451378 631 427 157 130 ------
NM_004576chr5192 ------
NM_004586chrX54287 3934 3846 1001 41 --1553 --
NM_004588chr11154016 3961 3522 3434 3333 3172 2816 2569 1613 1591 1519 1480 1343 778 562 34057 3084 414 13360 11605
NM_004595chrX189 --1407 --
NM_004598chr563117 2701 2648 2210 2168 2160 11187 ----
NM_004600chr111345 ------
NM_004615chrX1606 1810 --1151
NM_004622chr242135 316 148 30 12427 ----
NM_004637chr311362 ------
NM_004650chrX51800 1228 588 405 288 11304 ----
NM_004655chr171197 1370 ----
NM_004664chr122280 215 196 ----
NM_004670chr1021200 191 --11700 1436
NM_004677chrY3555 385 74 ------
NM_004684chr41276 ------
NM_004703chr1762031 1943 1808 779 511 86 --22056 1769 12219
NM_004709chrX31533 1457 1182 ------
NM_004713chr143638 604 313 ------
NM_004719chr1242601 2102 671 71 ------
NM_004726chrX95757 5613 5416 5223 1626 1461 1275 942 528 24529 4182 1194 --
NM_004730chr521474 1397 1620 1659 --
NM_004734chr1352792 2660 961 819 231 22966 1232 ----
NM_004736chr132221 2046 482 ----11828
NM_004741chr1041299 1113 967 582 11528 11587 11181
NM_004745chr855391 1805 1763 1718 716 25847 2219 26699 940 --
NM_004747chr1041527 1012 279 75 --11323 11564
NM_004748chr15103787 3630 3290 3280 2776 2587 1619 874 669 106 ------
NM_004768chr11397 --1915 --
NM_004774chr1742963 2241 2134 878 --11085 --
NM_004776chr2083133 3092 2932 2912 2515 680 229 192 ----11243
NM_004796chr1432191 1739 818 ------
NM_004801chr231557 1322 507 21468 1316 ----
NM_004808chr1053418 3347 2429 1299 108 ------
NM_004815chr134579 3802 953 44318 3790 3305 3299 ----
NM_004817chr91175 1786 ----
NM_004820chr82444 92 ------
NM_004827chr441562 448 278 164 21290 553 ----
NM_004834chr232632 74 27 ----1494
NM_004835chr33836 133 107 1284 ----
NM_004835chr33836 133 107 1284 ----
NM_004844chr3152 21161 812 ----
NM_004850chr231770 411 64 1117 --11245
NM_004857chr1434822 4793 2980 ------
NM_004859chr1742756 2634 2019 928 1452 ----
NM_004865chr64422 93 78 33 ------
NM_004866chr574943 4549 4236 3631 1288 1113 566 11623 ----
NM_004871chr1773324 3305 3007 2997 2888 1766 163 1128 ----
NM_004895chr11581 --1412 --
NM_004898chr4----21818 678 --
NM_004904chr7126247 5797 5782 5515 4869 4398 2352 2333 1375 407 269 119 ------
NM_004912chr711174 --11310 --
NM_004956chr723374 696 43068 2837 1415 1283 ----
NM_004967chr4--1370 ----
NM_004969chr101426 ------
NM_004985chr12104429 4378 4292 4126 3905 3843 3521 2936 799 239 11167 ----
NM_004992chrX128395 8000 7561 7389 7300 7281 7175 2094 1959 697 294 102 38406 6645 5269 23361 1038 1601
NM_004992chrX128395 8000 7561 7389 7300 7281 7175 2094 1959 697 294 102 38406 6645 5269 23361 1038 1601
NM_004993chr1431531 1324 1252 ----11429
NM_004999chr654480 3035 1619 814 379 33620 3398 1170 11340 11045
NM_005000chr7--184 2707 37 --
NM_005010chr742167 1721 392 180 11748 --1240
NM_005036chr22158301 8226 7312 6950 6773 6753 6569 6485 6382 5998 5890 5235 3247 769 334 11183 68232 8139 7258 6268 5410 2673 147
NM_005045chr71954 1268 ----
NM_005065chr14125377 5152 4708 4637 4565 4103 3352 1413 1315 1268 522 193 13749 2728 398 --
NM_005068chr651393 1349 496 307 200 --21209 526 --
NM_005076chr184193 4106 3174 1573 987 424 243 207 23687 792 13642 --
NM_005086chr1271549 1433 684 479 216 121 47 ----198
NM_005093chr20114549 4461 4412 3679 3617 3488 1822 1492 1244 478 64 13436 1274 --
NM_005095chr131407 188 169 ------
NM_005109chr352418 1672 995 847 438 ------
NM_005116chr2054332 920 833 727 485 14212 11168 --
NM_005121chr1763530 3453 3133 778 209 180 ------
NM_005126chr32538 232 1763 129 --
NM_005135chr1583612 3374 3338 3072 1148 326 282 139 --22712 989 --
NM_005156chr965324 4684 4632 4404 66 30 11321 24445 4092 13681
NM_005159chr1562257 2177 1916 1844 820 420 ----1635
NM_005160chr22116332 6078 5918 5707 5439 5260 5063 4218 1992 1775 1020 11174 1468 --
NM_005180chr102633 181 ------
NM_005197chr14116230 5599 5398 5114 4442 4229 2429 2108 2070 1093 490 1233 1881 --
NM_005202chr171936 1557 1546 1459 355 301 99 12300 12034 --
NM_005207chr2283103 2925 2434 2338 958 323 246 236 1128 ----
NM_005233chr322317 153 --1304 --
NM_005235chr2137798 7786 6642 5616 5204 3144 2586 2402 2279 2254 1026 520 182 56947 6381 5490 4965 987 22941 425 15499
NM_005238chr1173493 3390 3331 3244 2315 1028 940 12206 1389 --
NM_005241chr33382 221 140 ----1537
NM_005243chr22129 ------
NM_005249chr141616 ------
NM_005259chr2----21358 1328 1537
NM_005277chr421394 185 ------
NM_005278chrX1471 154 ----
NM_005295chr7------167
NM_005296chrX1909 1396 ----
NM_005302chr7----1139 --
NM_005311chr762836 1917 837 507 266 148 11826 --22319 366
NM_005327chr41742 --1700 --
NM_005339chr483999 2663 1641 1377 1150 539 481 140 33674 3506 1040 14263 2935 99
NM_005359chr1886434 5848 4884 4678 1299 1241 944 160 12068 12180 --
NM_005385chr332550 481 430 22474 843 ----
NM_005386chr202785 722 ------
NM_005397chr794044 3885 3783 3702 3582 3046 997 868 844 ----12944
NM_005402chr761649 1353 1255 613 507 288 1655 180 11781
NM_005406chr1831421 1083 436 ------
NM_005414chr3172 136 ----
NM_005415chr23773 611 213 196 ----
NM_005433chr1872651 2359 1861 783 658 240 120 12144 --12731
NM_005436chr1073595 3036 2933 2897 2876 1656 1366 1597 12501 --
NM_005465chr161978 1375 726 581 554 385 ----11684
NM_005475chr1272669 2561 2520 934 890 547 76 22446 351 ----
NM_005499chr19----1418 195
NM_005502chr932775 1310 115 1129 ----
NM_005504chr12136291 5183 5138 4934 4412 4178 2549 2324 1864 1287 956 663 480 26218 706 24147 2388 --
NM_005520chr52141 123 ------
NM_005544chr25874 819 748 308 188 ------
NM_005573chr5--1213 ----
NM_005578chr385099 5064 4732 4069 3844 1690 1428 1155 ------
NM_005587chr151842 --1794 --
NM_005595chr12792 281 ----1759
NM_005596chr9106315 5479 5016 4901 2220 1249 947 323 221 112 25597 1369 21966 415 --
NM_005599chr11604 ------
NM_005602chr321285 1243 --11049 --
NM_005611chr1641176 1081 888 94 ------
NM_005626chr13484 370 192 ------
NM_005638chrX41785 1682 1273 618 21173 87 ----
NM_005639chr1251619 1320 746 648 415 --1396 1499
NM_005665chr153893 1876 1308 343 194 34584 3742 1537 11236 --
NM_005667chr22316 174 ------
NM_005668chr594512 4211 3887 3697 3286 1726 1361 151 108 --21671 1561 --
NM_005669chr542389 2301 2105 2040 11837 ----
NM_005670chr631299 711 95 ------
NM_005722chr242142 1863 1543 635 11837 1983 --
NM_005738chr71812 11796 21704 262 --
NM_005739chr1562310 2294 808 587 241 90 --1386 --
NM_005746chr731684 1068 279 --22210 301 12388
NM_005759chr264309 3874 1700 1084 302 165 24214 3718 --11253
NM_005765chrX1177 ------
NM_005779chr583519 2894 2308 1287 1107 1082 862 617 --1535 --
NM_005802chr9--1318 ----
NM_005807chr11275 189 ----
NM_005813chr252620 2126 1767 244 175 2823 48 ----
NM_005819chr1103276 3024 2963 2193 1183 1169 1133 502 122 62 13446 --32676 690 150
NM_005828chr1795103 4856 4504 1992 1159 893 839 707 324 1824 24684 3303 --
NM_005836chr8293 55 ------
NM_005839chr1--1200 --1207
NM_005840chrX116819 6707 5326 5185 4923 2729 1857 1677 1275 1214 611 32112 946 295 21707 795 --
NM_005842chr13------1168
NM_005859chr531451 1304 329 ----21517 175
NM_005880chr1651495 1347 1205 1119 99 11462 1497 --
NM_005898chr1172847 2061 1287 904 636 341 43 ----1401
NM_005899chr171320 1264 ----
NM_005900chr4------2750 87
NM_005901chr18138484 8438 8162 7777 7264 7061 7018 6382 5857 3200 3073 1253 265 11388 37832 7607 1369 --
NM_005902chr1594419 3930 3177 2815 1402 1145 1036 616 123 ------
NM_005903chr595101 4331 4156 3440 1475 1279 1238 548 266 --1699 --
NM_005909chr5104069 3876 3739 3063 1494 1232 1208 1082 894 738 1715 1288 --
NM_005910chr17104117 3918 3758 3726 3293 3143 2602 1376 834 216 23539 1071 13324 --
NM_005911chr22337 289 --11336 --
NM_005920chr173259 3097 2484 2444 821 456 254 --23402 2554 --
NM_005930chr143601 97 37 ------
NM_005935chr474900 4490 4182 3783 1500 676 616 ------
NM_005937chr1773826 3709 3245 2982 541 169 163 11099 11257 --
NM_005941chr893814 3745 3553 2965 2932 2836 1085 497 123 11536 --21668 1296
NM_005955chr195513 4759 4711 4522 3937 3696 3459 2210 1414 1448 22149 1844 --
NM_005957chr1124912 4880 4832 4530 4244 3536 3105 3037 1103 1084 1051 507 43765 1357 948 582 21797 1710 --
NM_005996chr1211267 1988 ----
NM_006003chr191111 ------
NM_006007chr974261 4121 1137 683 617 136 23 1419 ----
NM_006011chr1553656 3357 2932 436 170 33785 3281 2657 ----
NM_006015chr111175 --162 --
NM_006016chr641863 921 854 382 --12306 --
NM_006022chr132911 42 1127 125 --
NM_006036chr221839 64 ------
NM_006047chr2031185 1004 481 13403 1591 12564
NM_006054chr1161655 1495 1337 1161 636 182 1192 ----
NM_006070chr32405 141 ------
NM_006080chr782945 2096 1881 600 589 409 131 56 ------
NM_006091chr1531807 1757 146 ------
NM_006094chr832048 887 822 --1130 --
NM_006095chr474412 3901 3536 1549 1093 794 242 --2464 328 --
NM_006113chr142170 1378 1329 83 1181 ----
NM_006136chr731058 944 327 ------
NM_006141chr1652798 2536 2107 1062 476 --32012 1762 674 11973
NM_006153chr3259 52 ----1125
NM_006154chr1542047 1883 766 446 --12082 --
NM_006155chr22449 278 --2343 331 11458
NM_006166chr1252574 2442 902 580 146 ----11930
NM_006195chr931369 422 396 --11299 --
NM_006197chr822237 167 ------
NM_006203chr595556 5271 4855 3774 3560 2215 2025 546 518 24719 1741 34406 777 128 1253
NM_006224chr1752468 2012 1566 805 416 --12161 11857
NM_006238chr692065 1999 1842 1664 1365 813 704 580 78 1747 1713 --
NM_006246chr141906 ------
NM_006251chr542748 1208 1109 981 23127 2818 ----
NM_006252chr157230 7094 6385 306 100 16736 11642 --
NM_006256chr132081 2028 560 --129 11985
NM_006265chr841418 1049 961 614 2586 460 1184 --
NM_006267chr251851 1807 1522 1168 741 --31690 1494 166 --
NM_006281chr831023 848 58 --1854 1167
NM_006281chr831023 848 58 --1854 1167
NM_006282chr2084607 4563 4551 4147 1737 1208 1154 624 ------
NM_006298chr632614 2487 653 --13430 12763
NM_006306chrX95810 5631 4409 4301 4277 1142 1119 686 229 15118 25459 3657 --
NM_006321chr342204 1450 728 567 1133 2573 210 --
NM_006322chr132866 69 ------
NM_006323chr41684 ------
NM_006352chr132103 1341 709 21970 1382 ----
NM_006359chrX42458 1852 613 525 ----11938
NM_006371chr384861 4791 4431 4200 4066 3602 3543 1083 ------
NM_006372chr61423 135 1178 --
NM_006379chr73612 314 142 21788 1651 --11914
NM_006393chr1044370 3608 588 524 21817 849 --13927
NM_006405chr14183 ------
NM_006407chr371421 1230 1182 1166 924 533 38 ------
NM_006434chr1051110 627 584 448 214 --12584 13095
NM_006451chr52817 442 --1667 --
NM_006469chr151332 570 462 417 258 11546 ----
NM_006475chr133639 211 93 ------
NM_006482chr1263859 3075 1559 1312 1271 289 --13472 --
NM_006504chr1031823 1039 913 22726 1187 --12017
NM_006510chr621055 840 --1887 --
NM_006520chrX31132 636 136 11388 ----
NM_006526chr2051699 1609 1586 760 615 --1294 --
NM_006534chr2063415 3363 3030 2414 711 295 --13272 --
NM_006538chr284102 4019 4003 3212 2681 875 812 445 --1604 --
NM_006540chr821196 1129 11001 31319 98 32 --
NM_006544chr14106028 5942 5336 4898 4868 1713 1447 991 984 608 1879 ----
NM_006546chr1795310 4625 4249 2308 1778 857 739 549 439 26063 1437 25975 1222 --
NM_006547chr752043 1802 1537 1490 77 ------
NM_006557chr9--11257 --11758
NM_006561chr1096223 5537 4818 4544 2330 2083 2035 275 174 --16251 --
NM_006572chr1773001 2835 2658 2449 2392 1253 316 --1266 --
NM_006575chr1411059 ------
NM_006595chr1131838 1628 427 --11686 --
NM_006599chr16128031 7857 7786 7638 6616 2889 2877 1266 915 618 530 230 28128 6414 16688 2793 123
NM_006602chr20----1122 1327
NM_006609chr243004 2973 2175 246 1352 ----
NM_006614chr373317 2693 2595 2544 2316 1059 444 --2831 397 --
NM_006620chr664611 3649 1429 1395 1043 97 --14423 1193
NM_006621chr111499 ------
NM_006624chr1031959 667 235 ----21791 1498
NM_006625chr141116 916 352 142 --11096 --
NM_006625chr141116 916 352 142 --11096 --
NM_006625chr141116 916 352 142 --11096 --
NM_006628chr1574318 4168 3171 1556 1515 1488 897 1106 ----
NM_006646chr1352974 2720 2287 2193 310 11048 ----
NM_006654chr1264703 4686 4500 4474 1441 1137 1105 13316 --
NM_006675chr122956 297 1330 ----
NM_006698chr2041363 529 409 170 156 ----
NM_006720chr1084945 4653 4589 4502 3818 3539 937 332 138 14707 --
NM_006722chr352219 860 636 382 244 ----1622
NM_006729chrX54761 3898 3468 581 294 11999 ----
NM_006731chr9115700 4890 4784 4367 4171 3936 2127 1421 739 560 356 --11826 12092
NM_006745chr44986 868 798 781 1913 21074 855 --
NM_006750chr1696986 6361 6121 5963 5484 1863 1458 905 696 16105 15490 12602
NM_006751chr21261 --1293 --
NM_006758chr21151 ------
NM_006766chr81981 21011 63 11751 --
NM_006775chr662886 2483 2042 282 115 75 ----12658
NM_006791chr151108 ------
NM_006793chr102572 33 --1543 --
NM_006808chr91138 ------
NM_006815chr121919 11100 11335 --
NM_006826chr21935 ------
NM_006827chr1433096 3062 483 13155 1127 --
NM_006828chr63625 597 148 ----1131
NM_006832chr145927 281 273 238 231 ------
NM_006851chr1242820 2468 1103 1095 --12647 11906
NM_006852chr1762686 2674 2309 1944 747 293 11793 ----
NM_006868chr18103199 2834 2785 2753 2514 2306 1942 1121 548 117 --22626 1233 --
NM_006870chr202632 22 1774 ----
NM_006873chr233558 2380 319 --23311 1315 12522
NM_006884chr371994 1973 1780 1658 1525 471 125 --1703 --
NM_006885chr1654202 4141 3791 3626 884 23421 3248 1816 1963
NM_006888chr1442161 920 128 48 ----12640
NM_006895chr231835 407 260 31557 1544 1357 ----
NM_006908chr751373 1345 1244 987 929 ----11427
NM_006915chrX1557 ------
NM_006918chr1195625 4281 4218 1544 936 849 833 646 562 ----13832
NM_006922chr232349 882 71 1196 1101 1226
NM_006924chr1734330 530 287 22902 882 21313 740 --
NM_006939chr143936 410 126 125 ----
NM_006940chr1231668 98 51 --21424 143 --
NM_006948chr2152362 1774 1518 931 236 ----11933
NM_006997chr101138 ------
NM_006999chr521817 1609 --11776 12045
NM_007005chr951525 1379 459 432 323 ------
NM_007007chr1284591 4537 4470 3939 3474 3194 3152 95 ------
NM_007011chr1585121 5110 4719 4500 2472 2406 2117 1817 11948 14204 14342
NM_007023chr22768 76 ------
NM_007027chr3148 ------
NM_007034chr1169 1656 ----
NM_007038chr21105986 5597 4691 2413 2361 1844 1287 254 51 35 --24267 1709 --
NM_007042chr362332 1953 517 272 197 76 --22595 1984 --
NM_007050chr20137314 6557 6135 6035 5844 5711 5532 4889 3205 1395 802 652 78 17710 ----
NM_007078chr1061945 679 460 413 116 24 21955 1210 ----
NM_007106chr1382791 2199 1916 1033 863 709 583 120 1567 ----
NM_007107chr332099 363 191 1823 ----
NM_007111chr133895 582 556 ------
NM_007114chr332802 2432 30 1562 12445 --
NM_007137chrX115365 4579 3717 3379 2029 1961 1426 1285 1103 1061 426 144 --15499
NM_007146chr1742914 2553 2547 2105 --12575 2779 229
NM_007173chr113258 184 165 1596 ----
NM_007195chr1813205 ----13499
NM_007203chr973359 1458 922 747 580 325 67 13372 ----
NM_007207chr13988 721 664 --1644 1208
NM_007212chr132061 1766 27 2701 71 ----
NM_007238chr20144510 4473 4302 4029 3666 3511 3062 1797 1713 1474 1195 694 143 102 13954 24188 234 --
NM_007245chr161317 ------
NM_007249chr13129311 9299 8735 8052 7225 3339 2753 2727 2625 1299 356 22 45850 5808 909 753 19414 22644 2487
NM_007292chr1741407 1327 968 352 --44253 4110 1498 109 --
NM_007294chr171276 ------
NM_007295chr171276 ------
NM_007296chr171276 ------
NM_007297chr171276 ------
NM_007298chr171276 ------
NM_007299chr171276 ------
NM_007300chr171276 ------
NM_007302chr171276 ------
NM_007303chr171276 ------
NM_007304chr171276 ------
NM_007305chr171276 ------
NM_007345chr1821504 299 --11991 1559
NM_007350chr1294306 4122 3912 3366 3092 1534 1469 1206 844 --1731 --
NM_007375chr121858 273 ----12534
NM_009585chr33836 133 107 1284 ----
NM_009585chr33836 133 107 1284 ----
NM_009588chr61555 ------
NM_012069chrX42468 1087 850 759 12591 ----
NM_012081chr533527 984 580 --22899 851 13516
NM_012090chr141125 1113 870 484 --11010 --
NM_012096chr363534 3393 2377 2322 1160 425 43703 3551 983 807 ----
NM_012097chr2--32080 1569 226 1102 --
NM_012102chr121742 250 2638 368 --11924
NM_012104chr1173152 2769 2666 2329 1130 970 558 1363 12840 --
NM_012104chr1173152 2769 2666 2329 1130 970 558 1363 12840 --
NM_012115chr6------131
NM_012141chr1363727 3639 3178 1325 892 268 13823 ----
NM_012156chr2063243 1124 294 286 123 95 1238 11070 11003
NM_012164chr9137562 6625 6348 4952 4666 2546 2135 1858 1801 1031 575 223 23 1188 11479 17367
NM_012175chr111900 ------
NM_012180chr41644 ----2593 272
NM_012193chr1173648 3525 2065 1974 1226 968 421 --31604 1548 1081 13503
NM_012199chr144133 3738 3511 1194 1994 23194 933 --
NM_012214chr2156334 6319 6067 5590 5555 5402 4772 4717 4245 4184 2106 1673 1486 668 642 23921 1821 --11112
NM_012219chr363243 2588 2449 2180 1248 862 11024 11158 --
NM_012234chr353568 3251 2678 2397 320 13668 --23508 785
NM_012250chr1131402 476 324 1513 --1997
NM_012252chr7115159 4940 4713 4354 4102 4070 3905 1537 1029 356 29 21684 1486 --21043 133
NM_012257chr73995 275 46 1120 ----
NM_012259chr62336 32 ----1214
NM_012281chr73591 457 261 --11868 12138
NM_012286chrX178 ------
NM_012290chr261698 1673 1666 1149 501 146 ------
NM_012294chr753833 3497 3362 3318 1228 1637 2745 674 --
NM_012297chr432634 228 148 1507 ----
NM_012301chr761912 830 464 440 434 395 11925 1195 --
NM_012304chr532494 2293 463 --22280 802 --
NM_012306chr1293573 3498 2765 2434 2235 1202 1125 242 189 1464 ----
NM_012307chr181861 1162 2136 95 --
NM_012309chr1164867 4833 4346 3870 3726 933 --24339 3560 --
NM_012316chr174564 4433 3972 3842 3773 1842 836 --11548 --
NM_012329chr1731396 1382 107 --1254 --
NM_012345chr1391933 1840 1484 1257 622 609 311 289 29 --21876 184 --
NM_012347chr632247 826 200 --1910 22509 1210
NM_012382chr543900 3436 3100 2777 --13070 --
NM_012398chr1922211 2198 12470 12715 1815
NM_012412chr77801 773 726 642 566 250 50 ------
NM_012416chr92916 871 ------
NM_012464chr482663 1984 1004 972 550 433 396 70 12624 12956 --
NM_012479chr732415 2273 226 1489 ----
NM_013230chrY31782 1550 575 1133 --1639
NM_013236chr2221164 171 1491 11215 --
NM_013238chr1361781 1614 1260 733 464 108 11367 1207 --
NM_013255chr7138371 7655 7512 6900 6844 6387 2523 2254 765 661 607 571 73 32350 1843 78 11292 56599 6394 2945 2852 1074
NM_013269chr1284528 4105 3647 3467 1311 1032 225 131 1739 1256 23246 50
NM_013277chr1231039 738 33 --1368 --
NM_013309chr1532064 1656 389 ------
NM_013357chr82741 59 ------
NM_013372chr1562954 2908 2459 2078 885 869 13173 --12848
NM_013386chr14532 289 75 32 ------
NM_013396chr214998 959 234 174 --1212 --
NM_013410chr141168 996 483 90 21064 817 --1133
NM_013411chr172724 2211 2041 1799 1789 551 450 12428 22349 857 --
NM_013437chr81373 --11371 --
NM_013438chr941400 1376 692 591 31733 1171 457 ----
NM_013444chrX1907 ------
NM_013448chr14191 ------
NM_013958chr8192 ------
NM_013959chr8192 ------
NM_013961chr8192 ------
NM_013962chr8192 ------
NM_013986chr22129 ------
NM_013989chr14104869 4211 4142 3711 1935 1809 1736 1470 1157 66 11428 23631 3183 2698 301
NM_013995chrX62514 2226 1900 803 746 700 11800 ----
NM_014011chr242286 2184 1599 973 ----11727
NM_014018chr8124 ------
NM_014021chr173177 3090 2607 2437 1055 691 273 11329 1318 --
NM_014035chr551022 527 375 345 187 1546 --1895
NM_014048chr16105262 4046 3938 3645 2110 1565 1360 1213 1161 923 43860 1667 1488 714 13404 13227
NM_014057chr921611 178 ----11020
NM_014109chr8173 ----1191
NM_014112chr8104829 4189 4181 4156 3821 3470 1335 1260 479 394 11078 ----
NM_014140chr2149 ------
NM_014141chr764360 3874 3662 672 201 160 34866 4461 609 13766 14184
NM_014153chr16253 41 1196 1600 --
NM_014154chr331380 1014 71 --1160 --
NM_014155chr11126976 6681 6664 6598 6409 5148 4832 2408 1750 611 518 449 56786 5443 2505 2345 913 37435 5388 431 --
NM_014166chr1351165 731 404 111 30 ----1392
NM_014191chr12----1872 --
NM_014217chr12624 377 11922 11598 --
NM_014243chr452116 1817 1470 858 186 1659 1314 --
NM_014265chr84770 659 286 51 1583 ----
NM_014268chr1821454 1172 ------
NM_014278chr42437 409 ------
NM_014294chr821022 942 ----11434
NM_014296chr371639 1577 1527 1429 1020 331 23 --1510 --
NM_014305chr132514 497 1179 ----
NM_014309chr22104847 4696 4422 4194 3942 2015 1963 1893 1775 826 34781 4558 1743 11749 11526
NM_014331chr4137724 7474 7220 7187 6704 6189 5407 3129 3108 2053 1273 344 337 36502 2040 488 11169 11260
NM_014361chr11----1361 1470
NM_014363chr1321115 174 ----11017
NM_014372chr131790 1677 679 1460 ----
NM_014382chr31111 ------
NM_014388chr184506 4396 4314 4023 1804 1103 555 402 45211 4657 1971 99 ----
NM_014392chr451560 600 546 468 341 185 ----
NM_014393chr811559 --1606 --
NM_014399chr721037 934 ------
NM_014405chr175756 595 324 206 198 --11637 1911
NM_014410chr18----1382 --
NM_014415chr331495 1064 195 ----11521
NM_014421chr432086 291 161 ----1717
NM_014423chr554521 3816 3626 963 295 35168 5120 1050 14884 --
NM_014447chr41160 1302 ----
NM_014487chr42258 231 ----1166
NM_014515chr121955 1305 186 --
NM_014608chr15----1148 --
NM_014612chr941485 990 952 280 ------
NM_014614chr231370 1123 215 --11462 --
NM_014615chr1683413 3134 1451 1399 1056 636 472 184 12859 --12607
NM_014616chr332889 727 380 ----12982
NM_014618chr9------1389
NM_014646chr1883298 2990 2979 2685 1176 977 212 76 ------
NM_014660chr741083 920 901 193 --11056 --
NM_014666chr521290 274 ------
NM_014671chr731502 1278 480 --11241 11515
NM_014676chr1245 36 154 1218 1524
NM_014683chr171109 11338 --11596
NM_014686chr1942532 1667 547 380 1903 1393 189
NM_014690chr772428 1914 1088 631 204 93 87 --12704 --
NM_014702chr693486 3316 3218 2429 2299 2253 1086 884 763 23285 2619 1515 11226
NM_014705chr731692 1620 1463 ------
NM_014707chr732162 556 143 --11411 --
NM_014709chr21586 1579 1624 --
NM_014711chr1611386 ------
NM_014719chr741063 359 165 55 1466 --134
NM_014720chr1021445 598 ------
NM_014721chr6106808 6794 6714 5983 5130 688 490 451 305 33 12769 ----
NM_014729chr852127 1953 1513 1401 479 1571 2566 486 --
NM_014730chr1284660 3978 3483 2099 1368 1141 980 267 25109 4738 15133 --
NM_014730chr1284660 3978 3483 2099 1368 1141 980 267 25109 4738 15133 --
NM_014733chr541632 1407 849 67 ----1497
NM_014735chrX11901 3855 652 300 1337 --
NM_014739chr653797 3253 948 785 477 --23931 3615 13031
NM_014743chr462121 1102 1082 857 659 430 --22348 114 --
NM_014746chr242985 2787 728 508 --22835 1258 --
NM_014751chr821749 538 1209 --1176
NM_014755chr233469 1317 867 12974 ----
NM_014765chr172385 1915 1871 1003 907 447 367 ----12413
NM_014766chr763842 3561 3308 3200 877 692 --33727 1249 1034 --
NM_014767chr1073476 3373 2572 2446 756 592 575 1235 --1365
NM_014782chrX169 ----2405 292
NM_014802chr124737 707 114 88 ------
NM_014803chr1042788 2618 1833 428 21053 342 ----
NM_014810chr143663 3619 3276 2470 --23703 3340 --
NM_014812chr131779 1632 263 ------
NM_014820chr361949 708 688 505 56 21 21885 1343 1295 --
NM_014829chr552312 2180 1787 461 135 12251 ----
NM_014830chr1253774 3127 1028 427 84 1331 1965 --
NM_014832chr1331731 340 96 1533 11967 --
NM_014836chr103519 418 123 21588 1534 1208 21766 233
NM_014839chr131861 1731 1716 12342 --22466 953
NM_014840chr1273031 3012 2382 1023 563 280 104 13057 13391 --
NM_014848chr1541874 1097 740 181 ----1516
NM_014850chr364446 4235 3760 3440 3202 142 14264 13361 --
NM_014870chr153681 3617 3399 2907 1444 21465 1296 11677 14582
NM_014871chr122148 59 --1249 --
NM_014872chr952227 1633 299 263 45 2916 579 ----
NM_014877chr1777390 7143 6982 4733 2700 1836 783 11557 15483 --
NM_014883chr431599 795 368 --1172 21022 665
NM_014888chr751373 1178 537 298 21 11004 ----
NM_014893chrY1110 11508 22188 527 --
NM_014902chr20----1131 --
NM_014903chr1262362 1969 576 308 279 252 22492 745 11703 --
NM_014904chr10104053 3891 3352 2685 1246 1194 561 357 272 209 ----11306
NM_014906chr1732858 2491 770 33809 1557 1104 --1540
NM_014912chr1032648 385 220 12177 11018 11283
NM_014914chr221347 1181 ----1381
NM_014920chr693638 2637 2489 2461 1527 1388 925 328 228 --161 --
NM_014924chr1452818 2652 2411 2401 795 ------
NM_014939chr1851523 1467 1455 1159 165 11065 ----
NM_014946chr222103 1047 22723 2062 12194 --
NM_014947chr142418 2363 492 301 12739 32659 649 480 13120
NM_014950chr1421564 206 ------
NM_014953chr1364286 2920 2694 1602 859 221 ------
NM_014961chr431681 309 232 ------
NM_014974chr1011577 ------
NM_014982chr1475363 4681 3692 2063 1198 202 119 25406 800 35088 1937 1222 --
NM_014989chr651917 1885 327 318 233 --11975 --
NM_015000chr1263045 2771 2464 1125 708 114 12997 12066 12043
NM_015008chr373668 3519 3460 3064 3021 2940 2475 ------
NM_015025chr252556 2420 2101 368 300 ----1220
NM_015026chr1274793 4762 1774 1523 1282 945 59 11804 1225 1490
NM_015032chr131193 ----1332
NM_015035chr2095494 5126 4984 2248 1645 1307 1024 832 29 1688 ----
NM_015039chr143632 1304 989 116 13163 11282 13710
NM_015040chr243051 2560 901 560 13355 1356 --
NM_015045chr1022037 1847 11919 11483 --
NM_015049chr283159 2546 2430 2189 1078 786 735 186 ------
NM_015051chr932918 2333 493 23341 1222 11114 13171
NM_015054chr122377 22 ------
NM_015059chr1593238 2687 1434 1329 641 530 394 164 50 ------
NM_015060chr7----1213 --
NM_015068chr773368 3206 2661 1558 1332 498 389 23265 163 22884 1037 12868
NM_015071chr576300 6293 4691 4514 1819 1130 107 24387 4379 11007 --
NM_015076chr674163 1748 1689 1522 708 667 173 23245 157 24553 427 --
NM_015082chr562562 2384 2215 759 446 417 12196 12039 12537
NM_015090chr1115761 5342 4962 4030 2181 2167 1930 1689 1663 1223 802 1839 26232 6168 --
NM_015092chr1674461 2916 1404 1142 565 419 107 --14064 13171
NM_015093chr631406 1285 103 ------
NM_015094chr22154632 4512 4438 4365 4191 4076 4019 3748 3296 3038 1745 953 704 599 514 21430 1199 11553 --
NM_015097chr342182 2009 1994 233 11605 --1637
NM_015100chr142074 1904 1632 509 11750 ----
NM_015115chr463182 3143 2958 2503 2476 1966 ------
NM_015144chr1693713 3308 3212 2619 2539 1490 1383 307 67 12832 ----
NM_015147chr273271 2275 2198 2127 819 410 48 1872 --12971
NM_015149chr141720 410 209 170 11401 ----
NM_015155chr1082994 2537 2155 2124 1240 809 394 227 1761 ----
NM_015161chr1651497 1290 1227 967 261 --21249 553 --
NM_015163chr143770 755 456 21403 365 ----
NM_015173chr421782 54 ----11175
NM_015176chr131230 571 544 1596 1178 --
NM_015191chr1162647 2444 2009 619 426 131 1279 --1739
NM_015192chr2032097 1210 844 1577 1751 11086
NM_015206chr1553136 2771 2587 531 279 23181 1396 ----
NM_015208chr1863616 3236 3165 1297 804 36 --13331 --
NM_015209chr11208 ------
NM_015215chr172551 2071 2024 1002 487 473 295 --22465 2237 --
NM_015235chr1042138 1865 1850 176 --174 --
NM_015236chr4----21521 611 --
NM_015251chr1632235 1814 310 11694 ----
NM_015252chr21681 ------
NM_015260chr1921615 1293 11624 ----
NM_015269chr11257 ------
NM_015271chr463257 3213 2731 1191 968 48 14105 ----
NM_015278chr673159 2662 2637 2266 952 464 155 --21239 280 --
NM_015285chr1821587 991 12344 ----
NM_015310chr8177723 7295 6786 6733 6553 6159 5841 5666 5596 5492 3341 3129 2663 2573 1139 473 387 --12911 27390 5115
NM_015313chr11104591 3843 3759 1800 1747 1453 1305 1161 1055 408 13108 ----
NM_015316chr1461364 1275 1241 336 216 188 ------
NM_015326chr182893 2663 2405 2399 2242 2049 1839 46 --22040 410 --
NM_015335chr1241041 825 677 369 --11674 --
NM_015336chr1232705 452 337 1321 --11020
NM_015355chr1751825 1363 466 418 290 ------
NM_015375chr1104605 3560 3469 3450 1701 1367 1245 254 181 111 ------
NM_015385chr1051110 627 584 448 214 --12584 13095
NM_015387chr261947 1819 770 750 467 27 ------
NM_015419chrX1947 1448 --136
NM_015431chr133633 1171 376 ------
NM_015436chr413278 1275 ----
NM_015446chr141319 1101 676 506 ------
NM_015455chr573602 3421 3208 810 778 668 530 13622 14025 --
NM_015458chr884768 4639 4567 3732 1971 1803 726 549 14252 11424 --
NM_015461chr18129 ------
NM_015483chr71220 ------
NM_015514chr143592 242 48 ------
NM_015542chr102423 71 ------
NM_015553chr675028 4555 4514 4501 1998 586 93 1864 ----
NM_015555chr661689 1675 1654 1549 1192 45 --1517 --
NM_015559chr1811025 ----31009 439 42
NM_015564chr543592 1114 898 634 --33504 3241 2782 12450
NM_015565chr2161879 916 649 585 415 406 ------
NM_015567chr134989 952 920 204 11159 2832 444 --
NM_015571chr652376 1629 1616 812 77 ------
NM_015575chr22703 423 13648 23643 797 --
NM_015576chr352786 2190 2017 791 155 ------
NM_015602chr141771 1709 1354 579 ----11120
NM_015640chr1115199 4704 3940 3373 3338 2129 1779 1518 467 405 135 --1710 --
NM_015646chr12----11140 --
NM_015693chr41272 ------
NM_015695chr61398 ----1573
NM_015713chr863089 2942 2803 2229 1128 962 12258 11203 --
NM_015878chr822152 1530 ------
NM_015879chr18188436 8339 7862 7832 7787 6682 6525 6443 5986 5791 5295 3451 3197 2760 2684 438 379 57 27911 1992 25685 2523 11999
NM_015885chr111665 ------
NM_015886chr865057 4336 4296 3891 2006 1844 --14962 --
NM_015888chr1----22478 608 1726
NM_015906chr154854 3895 3125 577 133 --1866 --
NM_015948chr62393 178 175 1418 --
NM_015962chr14101617 1432 1175 1159 1142 618 520 289 171 104 ------
NM_015981chr572536 2306 1958 1201 1113 561 271 12575 --22291 1066
NM_016009chr143848 1126 352 107 24678 3090 1131 --
NM_016018chr842699 2325 2269 116 22660 1856 1690 1565
NM_016040chr152336 2078 1090 891 231 22792 1724 --22605 643
NM_016045chr2051767 1557 1160 711 272 --21668 51 --
NM_016072chr1232399 1745 219 11625 ----
NM_016073chr152783 203 1113 ----
NM_016075chr1383077 2765 2510 1111 654 393 382 92 1598 1976 --
NM_016078chr1721070 43 ------
NM_016083chr693398 3337 1578 1244 1209 1029 829 497 228 12501 23533 1310 --
NM_016087chr741298 1223 542 476 1260 ----
NM_016096chr851791 856 794 510 472 ----22144 669
NM_016100chr202434 378 ------
NM_016103chr51158 --1166 --
NM_016107chr5--11116 --11351
NM_016120chrX51070 1022 779 115 31 1255 ----
NM_016125chr171422 161 ----
NM_016131chr242380 874 646 166 12089 ----
NM_016132chr1552632 2492 2136 778 718 ----1618
NM_016200chr71723 --149 1620
NM_016201chr351521 752 675 319 130 ----1302
NM_016206chr3108441 8213 8058 7262 6391 6023 5763 3475 2397 2300 33537 2128 521 ----
NM_016213chr15177 ------
NM_016217chr663609 3467 3250 2601 1232 873 1518 22249 655 --
NM_016224chr61810 1297 ----
NM_016231chr1751567 1415 1260 497 283 ------
NM_016248chr1343216 2634 1493 445 33133 861 641 13315 --
NM_016252chr22219 105 --1773 --
NM_016255chr652974 2734 2455 773 82 ------
NM_016257chr173101 2898 2852 2741 2221 1188 1089 --13462 13382
NM_016260chr287272 6634 5775 5405 4687 4633 2611 536 2719 344 --11742
NM_016275chr352807 706 694 430 344 22053 66 ----
NM_016279chr51101 --1330 --
NM_016289chr251585 1536 1524 904 533 1321 --11482
NM_016300chr32410 402 --177 --
NM_016322chr952007 1145 845 723 295 1732 ----
NM_016370chrX2143 36 ------
NM_016376chr1761607 1599 1416 628 605 382 13823 13405 13533
NM_016396chr1542904 2599 2317 1840 --12654 --
NM_016399chr123815 222 43 ------
NM_016403chr11--1512 ----
NM_016436chr2041868 1763 300 110 1776 21892 374 --
NM_016441chr211484 12043 21634 199 --
NM_016489chr73153 123 44 1572 ----
NM_016513chr693638 2637 2489 2461 1527 1388 925 328 228 --161 --
NM_016530chr1553628 3013 2509 826 641 14059 --13844
NM_016542chrX41637 1524 1176 528 ------
NM_016569chr1211267 1988 ----
NM_016591chr531058 797 59 --1814 --
NM_016598chr321282 332 ------
NM_016618chr2135 ------
NM_016621chr1164591 1402 955 798 500 170 21097 629 22803 1758 --
NM_016622chr252130 2034 1525 1332 673 22050 2003 ----
NM_016834chr17104117 3918 3758 3726 3293 3143 2602 1376 834 216 23539 1071 13324 --
NM_016835chr17104117 3918 3758 3726 3293 3143 2602 1376 834 216 23539 1071 13324 --
NM_016836chr2--1100 ----
NM_016839chr2--1100 ----
NM_016841chr17104117 3918 3758 3726 3293 3143 2602 1376 834 216 23539 1071 13324 --
NM_016953chr2156031 5989 5933 5003 4527 4077 4016 2004 1567 1343 1189 1180 845 575 325 15486 13774 --
NM_017415chr584588 4510 4312 3984 3394 3279 2980 400 14388 12815 --
NM_017420chr1463450 3180 2400 1223 1046 724 ------
NM_017423chr421674 57 3857 779 36 ----
NM_017435chr121675 ----1153
NM_017447chr2163462 3012 1541 1511 1488 901 13374 ----
NM_017449chr121730 1074 11144 ----
NM_017569chr13198 ------
NM_017577chr371686 1670 1339 445 386 300 259 --11091 --
NM_017594chr942502 2287 2227 245 --12557 --
NM_017599chr123682 503 494 --2251 148 --
NM_017610chr1532090 1937 855 ----11616
NM_017628chr485082 4091 3864 3379 1889 1330 910 820 24284 420 ----
NM_017633chr611095 ----13866
NM_017634chr81636 --1169 --
NM_017637chr997454 6763 6634 3616 2488 2402 1748 1624 1352 38664 6770 5981 37926 7781 6161 13087
NM_017643chr1792743 2448 1219 922 712 631 485 288 50 --12089 --
NM_017644chr353792 3255 532 183 34 13376 13736 --
NM_017650chr775664 5656 5236 5033 1664 896 884 25649 839 --12319
NM_017657chr23715 381 115 ------
NM_017658chr1464324 1300 1272 271 244 154 23715 2925 1961 --
NM_017661chr1561074 1027 925 442 399 308 1300 ----
NM_017694chr241587 1542 1301 417 --11736 12003
NM_017709chr184137 3878 2996 1293 1143 979 915 611 ----1953
NM_017719chr322432 630 12520 12466 --
NM_017736chr1632184 1094 1051 12897 1288 1527
NM_017747chr51146 ------
NM_017752chrX52090 1912 630 523 393 1656 ----
NM_017762chr1522421 464 11706 12248 --
NM_017778chr831420 1258 265 ------
NM_017779chr182760 2645 2566 2048 1696 935 295 185 ------
NM_017786chr81578 ------
NM_017801chr331872 1702 212 12016 --1760
NM_017811chr963009 2619 2411 2255 757 134 11094 12848 --
NM_017813chr8135591 4687 4349 4026 3571 1744 1590 1546 934 908 557 283 37 11857 11452 14090
NM_017824chr1032725 2267 1995 1422 ----
NM_017848chrX33122 1516 248 34351 1627 1522 ----
NM_017902chr1085711 5413 5035 1706 1699 1367 976 665 12079 11142 --
NM_017905chr131665 ------
NM_017910chr21347 --124 --
NM_017919chr985282 4665 4543 3861 1971 1057 281 113 --13822 --
NM_017925chr951931 1892 615 108 93 ------
NM_017944chr1172609 1942 1134 751 507 428 120 1449 1686 --
NM_017948chr91124 --157 2453 80
NM_017964chr2277 34 ------
NM_017978chr5192 ------
NM_017998chr971162 1154 1034 972 429 276 266 --1454 --
NM_018011chr13--1601 ----
NM_018017chr1082765 2392 2312 814 794 536 183 57 ------
NM_018027chr1092611 2428 2361 2319 940 858 827 265 56 12661 13130 --
NM_018036chr1464391 4325 3183 2899 1689 399 ------
NM_018047chr54891 747 641 108 1141 1358 --
NM_018056chr11153 ------
NM_018078chr42995 729 --11025 --
NM_018080chr151151 --165 --
NM_018085chr1157778 6630 6541 6504 6280 5276 4988 3216 3076 3045 3014 2359 2001 141 67 25867 5489 15078 11066
NM_018094chrX190 ----146
NM_018098chr32940 277 --21114 64 --
NM_018103chr1------1343
NM_018115chr4--1317 ----
NM_018126chr421040 92 ------
NM_018155chr333203 3018 708 1591 23437 1064 --
NM_018157chr1243030 715 260 118 --1567 11034
NM_018159chrX31730 1602 165 ------
NM_018178chr131938 1882 222 --11842 --
NM_018184chr31797 1412 11806 --
NM_018197chr203851 255 38 ------
NM_018222chr1161805 1185 745 427 185 147 --11516 --
NM_018227chr442103 410 340 234 13050 ----
NM_018243chr443718 1154 893 372 23637 3078 21623 1247 --
NM_018247chr642845 2733 2323 2254 1348 ----
NM_018254chr141725 726 378 66 11642 ----
NM_018257chr2031010 378 158 1509 --11713
NM_018263chr262634 2184 970 570 458 344 ------
NM_018279chr1282862 2832 1918 1878 1109 454 287 31 1813 11199 --
NM_018299chr823390 2198 ----1193
NM_018302chr462325 1902 1887 1669 1658 619 ------
NM_018312chr1131950 673 24 1196 ----
NM_018313chr352484 2365 1761 440 308 --22410 2217 --
NM_018315chr431378 1006 246 1385 --31268 1152 197
NM_018325chr941549 544 518 437 --11185 --
NM_018330chr1021636 28 --1594 --
NM_018334chr71337 --1199 1413
NM_018348chr163497 458 445 ------
NM_018361chr873779 3654 3503 2771 1239 578 151 12619 --13397
NM_018362chr1193916 3443 1371 1252 1237 1002 922 728 638 ----13939
NM_018364chr143022 2622 2610 985 13942 2829 70 --
NM_018373chr14106067 5121 3994 2555 2151 1821 866 719 620 198 1115 15759 14701
NM_018374chr7105097 4941 4538 4404 3846 3258 1218 1066 264 94 ------
NM_018383chr231812 1631 1594 11564 --1404
NM_018387chr92414 353 ------
NM_018388chrX61416 1376 1004 996 974 960 ------
NM_018403chr333432 3321 105 21369 435 ----
NM_018440chr8158555 8508 8349 8167 7836 7468 6458 6368 6084 3459 3421 2066 1990 1252 426 11749 ----
NM_018448chr121458 ----156
NM_018460chr2------1177
NM_018465chr9143 ------
NM_018471chr21214 --154 --
NM_018482chr841971 1956 934 579 21809 957 1357 --
NM_018489chr141986 1462 952 491 ------
NM_018557chr251734 1644 1370 425 176 ------
NM_018566chr174575 3864 2017 1829 896 560 512 44233 3806 648 265 2719 598 11590
NM_018569chr42241 165 ------
NM_018590chr1021146 227 ----2510 221
NM_018602chr1511719 ------
NM_018638chr1285505 4922 4407 4147 3827 499 163 31 11050 14912 --
NM_018640chr1252497 2178 1723 974 474 ----181
NM_018650chr121679 518 ----12001
NM_018685chr72774 78 --1172 --
NM_018695chr561876 843 733 500 413 314 12289 ----
NM_018697chr741645 928 569 80 32196 789 380 1308 --
NM_018710chr821266 1215 --11015 --
NM_018718chr71611 ----12286
NM_018834chr51247 184 ----
NM_018840chr201503 ------
NM_018841chr12940 186 ----1734
NM_018890chr751373 1345 1244 987 929 ----11427
NM_018945chr693001 2953 2773 2645 1463 1085 815 624 240 --13212 --
NM_018948chr131378 411 404 ------
NM_018953chr121810 ------
NM_018970chr7103077 2796 2779 2745 2569 2339 895 784 223 189 --23145 3028 --
NM_018976chr1242895 2541 1957 808 2954 421 --12558
NM_018979chr1262302 2163 2034 1857 1037 110 --11765 --
NM_018981chr221183 487 21173 929 ----
NM_019000chr551415 1126 655 588 89 1175 --1169
NM_019001chr354587 4560 3805 922 116 ----23689 1956
NM_019004chr772200 1891 946 630 511 336 201 2226 114 ----
NM_019006chr15----150 --
NM_019024chr21382 ------
NM_019028chr111278 ------
NM_019035chr441764 1739 709 580 ----184
NM_019036chr641210 1006 200 147 --1298 --
NM_019049chr11240 ------
NM_019050chr441431 467 158 99 --22296 109 --
NM_019058chr105515 111 90 82 49 1298 ----
NM_019066chr151301 153 ----
NM_019080chr1361414 1237 1133 363 316 135 ------
NM_019094chr1252840 2778 984 605 83 --23455 2656 --
NM_019114chr942302 2035 1666 546 1453 11589 --
NM_019116chr1662994 2501 2479 385 142 31 ------
NM_019117chrX62840 1373 912 300 225 52 ------
NM_019556chrX----21073 366 --
NM_019593chr20------12978
NM_019605chr11222 ------
NM_019857chrX61534 1312 1149 509 245 57 11342 11460 --
NM_019859chr1031630 1311 260 11410 ----
NM_019860chr1031678 1359 308 11458 ----
NM_019885chr262838 2295 2221 2077 1126 984 32317 779 679 12044 --
NM_019895chr3--157 --11095
NM_020116chr41616 ------
NM_020122chr2105916 5875 5670 5312 4003 3718 1101 858 291 278 15415 ----
NM_020126chr191592 ------
NM_020130chr831186 567 167 1921 ----
NM_020132chr21124954 4382 4346 4321 4125 3828 3771 3199 2001 1963 973 112 --14238 --
NM_020144chr741427 595 573 272 1518 ----
NM_020148chr1832988 2687 153 21060 512 1525 --
NM_020168chr1511380 ------
NM_020177chr562653 2338 2152 2140 1010 356 12494 ----
NM_020178chr17----155 --
NM_020198chr1731352 416 115 21623 637 ----
NM_020205chr173274 2179 2148 1333 1236 1005 830 --11162 --
NM_020228chr1131828 1605 290 22215 961 22447 181 --
NM_020240chr542349 2256 1805 957 ----12640
NM_020245chr684572 4199 4160 3996 1770 496 153 120 14683 ----
NM_020357chr341640 1088 1047 462 ------
NM_020390chr393920 3785 3302 1682 1486 1292 1276 939 155 --21775 428 --
NM_020420chrY61814 1555 1226 403 367 325 ------
NM_020424chr163688 326 123 ------
NM_020432chr752201 2136 1954 78 51 1841 1500 22163 249
NM_020440chr183205 3121 3021 2819 2298 2262 2190 1123 23002 474 ----
NM_020443chr1126906 6779 6133 6097 5372 4270 2538 1725 1311 1246 237 93 --12736 --
NM_020455chr61398 ------
NM_020463chr231081 92 62 ------
NM_020466chr694969 4479 4412 4024 3056 1755 1623 1163 526 11176 11525 --
NM_020474chr1861378 699 460 418 228 39 --1625 --
NM_020644chr112129 48 --3969 688 59 --
NM_020648chr18102888 2626 2208 2027 1785 1754 997 931 585 186 1686 11011 --
NM_020651chr221683 326 --11413 --
NM_020672chr1--1575 ----
NM_020673chr20156738 5799 5626 5536 5424 4941 2849 2788 2714 2192 1576 1568 1284 736 512 27577 5654 25949 2633 15368
NM_020686chr1643138 2864 1185 55 22401 365 1999 --
NM_020689chr2051622 1477 1143 326 277 --2306 295 11250
NM_020693chr11------196
NM_020699chr165280 4789 4567 2080 1857 1406 13747 ----
NM_020704chr722122 905 12203 ----
NM_020715chr1442250 1766 1435 742 1774 --22195 1639
NM_020717chrX64910 4473 3972 1553 1373 1170 23753 3310 1797 --
NM_020718chr16106452 6179 5817 5209 5159 4722 2111 1838 920 244 36197 5221 231 21972 395 --
NM_020726chr53228 75 64 2400 114 ----
NM_020727chr2183928 3415 3295 1315 1001 867 313 146 13383 ----
NM_020734chr1263075 2917 2833 1031 901 588 ------
NM_020739chr15103787 3630 3290 3280 2776 2587 1619 874 669 106 ------
NM_020760chr231971 1399 1360 11613 11772 1372
NM_020766chrX114107 4015 3966 3470 3172 3072 1034 1024 705 483 38 24088 3589 23957 3200 13485
NM_020768chr563181 1275 930 512 331 300 23140 2474 13033 --
NM_020771chr651568 1344 563 239 31 ------
NM_020772chr17188656 8298 7721 7510 6606 6569 5857 5699 3098 2398 2105 2080 2038 1363 876 766 433 185 27934 1905 17627 17345
NM_020774chr1866251 3781 1928 1787 1645 724 24044 683 35311 4959 757 24403 2451
NM_020779chr243231 2984 2278 327 13095 23090 2873 --
NM_020782chr1294393 4249 4164 3640 3265 1838 1124 811 169 24699 676 --14383
NM_020794chr12987 142 ------
NM_020796chr562589 2288 827 818 395 169 22569 2207 ----
NM_020801chr52815 568 21902 497 12155 1229
NM_020805chr181318 ----21670 1250
NM_020810chr1472824 2662 1343 1308 887 154 129 11093 12418 --
NM_020813chr1992877 2862 2386 2100 803 656 487 275 211 ------
NM_020834chr14----2520 493 --
NM_020841chr1243513 2476 775 139 --13726 --
NM_020854chr1831520 1313 207 --1467 --
NM_020856chr19------21443 1436
NM_020860chr41957 ------
NM_020861chr651312 1258 1018 981 313 11007 ----
NM_020868chr261882 1532 1326 1270 336 24 ------
NM_020871chrX32465 596 190 21676 281 ----
NM_020873chr31553 ------
NM_020899chr1732144 1969 283 --12494 --
NM_020909chr283793 3636 3431 3282 954 930 610 167 --11360 --
NM_020918chr1093680 2584 1086 967 737 659 544 452 366 31462 555 297 --1933
NM_020924chr91438 137 132 --
NM_020935chr264439 4248 3297 3023 1600 204 23834 1846 23550 1293 --
NM_020940chr1042288 2208 123 22 32762 1154 918 1913 --
NM_020948chr163508 3181 1442 1093 710 116 23404 2856 ----
NM_020964chr1884815 4490 4197 3714 1003 913 903 122 24585 1699 ----
NM_021003chr141739 --1168 --
NM_021005chr1531155 1110 1055 ------
NM_021007chr282116 1957 1856 1782 1673 540 187 172 --32475 969 104 1233
NM_021032chr341336 527 375 173 --1389 1479
NM_021033chr1363407 2934 2424 1084 564 133 12991 43394 2805 2349 501 --
NM_021061chr8103500 3429 3326 3293 3126 3019 2963 2930 2897 2745 ------
NM_021069chr411743 --12031 --
NM_021072chr562553 2235 1899 1622 645 45 11708 21641 371 --
NM_021079chr1783371 3195 2656 2609 645 571 409 120 --1792 --
NM_021097chr222081 1026 12966 --181
NM_021116chr7149008 8965 8952 8907 8546 6471 6114 3096 2993 2014 1758 616 597 402 17244 27323 1093 --
NM_021136chr14183 ------
NM_021143chr192484 111 ------
NM_021159chr451550 1353 495 404 125 --1641 --
NM_021183chrX72142 1822 948 672 418 317 102 --21699 686 1918
NM_021190chr131238 940 466 ----11024
NM_021194chr1194 ------
NM_021239chr1421187 390 ----1999
NM_021242chrX31021 270 116 ----1818
NM_021255chr1464046 3909 3371 3049 862 804 11487 --13161
NM_021629chr385094 4915 4621 4047 4007 3557 3409 1038 31360 660 527 ----
NM_021633chr111353 ------
NM_021637chrX31350 1184 1054 1182 ----
NM_021638chr485006 3501 3214 3105 1714 1503 340 126 --24655 3843 --
NM_021647chr474387 4271 3878 900 809 722 215 13586 11052 --
NM_021648chr642361 2015 632 538 --1396 22395 486
NM_021705chr681405 1375 1282 452 445 176 59 24 1240 ----
NM_021728chr143915 731 723 ------
NM_021813chr6125817 5799 5741 5485 4888 4870 4340 3844 3654 1720 1386 521 11524 14609 --
NM_021814chr6--11377 ----
NM_021821chr12178 ------
NM_021870chr42248 26 1167 ----
NM_021912chr1574176 3689 2986 2853 1541 1246 329 23157 631 24242 3726 --
NM_021914chr1462477 2063 1936 1558 337 250 12148 --22157 1964
NM_021940chr631298 154 135 ----11174
NM_021947chr1721238 171 4923 294 233 225 ----
NM_021961chr1196985 5710 5528 5479 4837 2472 2375 234 87 16492 14812 --
NM_021964chr3136661 5994 5942 5892 5530 5005 4335 2415 1967 1640 1490 568 123 26531 31 15756 21020 312
NM_021988chr2051484 1176 1102 294 278 ------
NM_021998chrX3944 531 350 ------
NM_022114chr164520 3919 3632 3438 3280 458 ------
NM_022130chr51500 ------
NM_022145chr52559 433 ------
NM_022154chr431142 957 76 21331 1205 ----
NM_022166chr1644697 1836 1663 387 13872 26044 5152 1418
NM_022351chr833554 3410 3318 --13325 --
NM_022442chr2051484 1176 1102 294 278 ------
NM_022456chr12106319 5579 5019 2905 2480 1991 1510 835 559 41 --35133 827 157 --
NM_022458chr753087 3040 2597 2145 590 --1405 --
NM_022459chr1386206 6183 5938 4115 2527 1597 1159 925 14953 12004 --
NM_022469chr163263 3249 2734 1131 1052 141 1500 12954 --
NM_022474chr1442322 2310 993 858 --1762 11952
NM_022475chr41293 ------
NM_022476chr164950 935 871 111 --162 --
NM_022482chr2091881 1705 1661 548 507 468 457 343 48 2617 221 --1992
NM_022484chr721330 1097 ------
NM_022497chr393811 3335 2428 1465 1399 1142 866 634 179 1602 ----
NM_022648chr234587 3432 1415 21636 1597 --11694
NM_022650chr5--1405 --1384
NM_022658chr1221100 71 ------
NM_022659chr82496 444 --1194 --
NM_022755chr962334 1968 774 666 451 151 ----12125
NM_022763chr3112980 2940 2924 2458 2271 2069 2031 1064 877 306 189 --12104 12482
NM_022771chr124677 394 263 126 --21048 879 --
NM_022776chr331024 422 109 ----11632
NM_022780chr22465 38 --2646 314 11470
NM_022802chr1021357 161 11323 1103 --
NM_022824chr531569 397 71 --11866 --
NM_022826chr231228 227 104 ------
NM_022841chr1592812 2527 2516 2322 2258 979 971 907 256 ------
NM_022845chr1641524 1473 98 70 ----11449
NM_022893chr211034 21235 1137 1936 1670
NM_022894chr22419 191 1329 ----
NM_022898chr1494316 3917 3239 1841 1484 1182 1150 677 64 24491 1529 11613 --
NM_022912chr262908 2690 2562 2543 2406 1095 ----12478
NM_022913chr51234 ------
NM_022918chr11--32149 1788 238 11540 --
NM_022970chr1041397 1177 935 263 11457 ----
NM_022977chrX5798 790 675 205 199 --22411 1926 --
NM_023929chr872541 2394 2230 2148 2080 934 623 --2654 380 12522
NM_024052chr1722870 33 ------
NM_024312chr1231635 657 159 3632 549 277 1216 --
NM_024324chr22----1209 --
NM_024345chr934553 1188 432 --12161 --
NM_024416chr921611 178 ----11020
NM_024496chr142853 669 ------
NM_024524chr322210 1174 ----11198
NM_024529chr1131 ------
NM_024539chrX21203 887 ------
NM_024546chr1321267 102 ------
NM_024551chr1262159 1866 1642 262 158 76 2868 682 1294 --
NM_024551chr1262159 1866 1642 262 158 76 2868 682 1294 --
NM_024567chr81509 ------
NM_024573chr64928 645 612 79 ------
NM_024576chr61168 ------
NM_024582chr42303 69 1995 1815 --
NM_024586chr11580 ------
NM_024594chr521907 582 ------
NM_024596chr8154997 4764 4478 4335 4078 3785 3423 2064 1927 1840 1509 1249 851 514 176 24221 2050 196 --
NM_024613chr811857 ------
NM_024617chr9------1619
NM_024626chr111494 --21632 498 1601
NM_024636chr772442 2184 2075 713 624 256 132 31953 420 168 32711 2620 163 --
NM_024665chr344526 4006 3091 3074 --11741 --
NM_024668chr5192 ------
NM_024700chr161108 1101 846 174 144 58 ------
NM_024704chr2011114 ------
NM_024715chr551719 1333 685 164 140 11661 ----
NM_024721chr822262 120 --1186 --
NM_024744chr252496 2174 967 803 100 --11681 1138
NM_024770chr2106538 5544 4510 4233 2695 2319 1032 897 871 823 1602 --1961
NM_024813chr12375 287 188 ----
NM_024814chr7----1257 --
NM_024817chr15105999 4683 4612 4599 1943 819 731 673 348 225 45535 4644 663 455 1694 11661
NM_024824chr1431253 1112 55 ----1309
NM_024834chr1081961 1781 1451 1432 1342 1276 313 184 ------
NM_024837chr1561455 1392 629 494 393 52 1411 1283 --
NM_024852chr1180 ----149
NM_024881chr1953408 2443 2337 995 458 23810 3239 --1417
NM_024915chr872580 2404 2222 1745 821 704 201 1185 ----
NM_024920chr491581 1239 1163 627 573 424 172 153 110 ------
NM_024930chr531078 527 455 ----132
NM_024939chr1661608 1579 1492 1134 1010 31 2331 268 ----
NM_024941chr531462 1408 482 ------
NM_024946chr1621345 1286 1244 21463 475 --
NM_024947chr3159387 8906 8625 8427 7622 6968 3725 3552 3521 2940 1571 1554 1150 618 559 68804 8191 7986 7268 1877 142 27652 3756 --
NM_024948chr101101 165 --1608
NM_024949chr453591 3282 1653 1558 62 --34875 1699 1201 --
NM_024953chr1262802 2415 1997 1876 367 25 --1167 12368
NM_024989chr257782 6719 6675 3135 3007 17639 1454 13153
NM_024991chr1051110 627 584 448 214 --12584 13095
NM_025040chr1931755 1599 1569 ------
NM_025054chr874118 4063 3224 2976 2816 2644 1472 23062 2821 ----
NM_025134chr1641702 595 342 100 --2576 33 --
NM_025146chr352574 2366 2288 2081 874 --1792 --
NM_025152chr1411288 21360 37 ----
NM_025154chr751522 1241 1199 365 319 --11384 --
NM_025160chr1104315 4071 3710 3159 2679 1422 1271 1143 1099 554 --23361 786 --
NM_025180chr363377 3091 618 314 285 138 ----1148
NM_025181chr22823 741 ------
NM_025191chr153527 2655 2576 2178 135 --1178 --
NM_025221chr4--11069 ----
NM_025222chr352775 2216 1181 920 68 ------
NM_025238chr1541538 312 283 215 --1492 --
NM_030583chr82774 364 ----1920
NM_030594chr1551066 935 507 413 80 1351 11228 --
NM_030621chr1483662 3510 3114 1580 1055 953 460 108 24090 3237 --1306
NM_030625chr1062453 2399 2269 1811 904 438 ------
NM_030627chr542696 1076 865 603 ----11487
NM_030647chr785817 5505 5417 4711 2509 2470 1975 241 11050 ----
NM_030648chr461857 1515 1158 1065 699 312 23797 1673 ----
NM_030650chr2103921 3394 3042 1376 1181 666 464 431 47 27 12771 ----
NM_030660chr1431531 1324 1252 ----11429
NM_030664chr1031765 512 198 ------
NM_030674chr12135800 5413 4928 4871 4739 2360 2197 1444 1421 1412 679 600 384 15353 13654 --
NM_030751chr1051231 674 662 332 34 11338 ----
NM_030751chr1051231 674 662 332 34 11338 ----
NM_030752chr62386 193 ------
NM_030755chr1473021 2157 1071 796 769 596 129 ------
NM_030761chr192306 2212 2052 964 819 643 355 270 219 ----12476
NM_030762chr122550 277 --1795 --
NM_030771chr11--1107 ----
NM_030784chr6--148 ----
NM_030791chr1461881 1724 1585 1449 492 186 148 ----
NM_030795chr81544 --1167 --
NM_030802chr171824 ------
NM_030806chr1127958 6789 6614 5759 3256 3096 2950 2722 1698 1197 468 391 69201 6424 6303 857 851 487 11602 --
NM_030885chr341693 928 610 132 11826 ----
NM_030893chr15632 595 575 249 114 ------
NM_030906chr111153 ------
NM_030918chr195464 4507 4268 3741 2171 1146 1037 993 576 14657 ----
NM_030920chr151845 1756 1525 361 209 1632 11671 --
NM_030934chr141165 664 410 136 --1363 --
NM_030964chr573731 3721 3097 2975 2290 448 103 --12662 --
NM_030978chr9--171 ----
NM_030979chr132410 403 ------
NM_031157chr121614 ----1505
NM_031216chr1822147 1814 21722 199 22237 2070 --
NM_031262chr92998 880 ------
NM_031263chr931055 937 74 ------
NM_031268chr1665162 4640 4572 3894 1586 910 12153 13779 --
NM_031412chr122480 170 ------
NM_031426chr982028 1104 997 970 872 675 533 378 1251 ----
NM_031427chr14115329 5193 5121 5103 4058 4005 3660 2201 2004 625 179 1733 --15155
NM_031435chr1253450 2717 2377 1107 674 ------
NM_031438chr511532 --1363 11578
NM_031439chr841807 1349 1338 288 ------
NM_031442chrX41067 687 523 205 22154 387 12830 --
NM_031461chr841547 847 736 405 ----12096
NM_031468chr7137407 6847 6690 6437 2997 2685 2281 2267 1980 1295 953 458 157 36386 3086 1706 11192 --
NM_031483chr2063056 2530 1273 1142 980 928 13076 22836 1377 --
NM_031844chr153804 2836 2733 1306 547 11212 33063 2518 1367 124
NM_031845chr233325 3048 211 12954 22513 179 --
NM_031847chr233325 3048 211 12954 22513 179 --
NM_031850chr33836 133 107 1284 ----
NM_031850chr33836 133 107 1284 ----
NM_031858chr171320 1264 ----
NM_031862chr171320 1264 ----
NM_031866chr103929 917 841 ------
NM_031882chr5180 ------
NM_031890chr2262487 2159 1863 877 818 430 --1408 --
NM_031911chr442709 2546 1121 1106 ----12794
NM_032012chr975246 5039 1334 1101 954 688 618 11828 ----
NM_032025chr331792 835 174 ------
NM_032042chr551931 1921 1793 840 423 22634 261 --12339
NM_032049chr33836 133 107 1284 ----
NM_032049chr33836 133 107 1284 ----
NM_032102chr1143022 2871 2795 2522 --22532 808 --
NM_032116chr1365186 4079 2267 1687 1669 169 15604 ----
NM_032121chrX42474 1834 711 43 12536 ----
NM_032160chr1854308 4198 2887 2684 988 22959 906 1622 --
NM_032177chr51159 190 ----
NM_032181chr2180 1699 ----
NM_032189chr1354506 4308 3964 3915 837 11226 24992 1612 14879
NM_032199chr1043094 1179 796 709 21061 391 41232 806 528 192 11374
NM_032221chr2041753 1701 1593 657 --11676 --
NM_032228chr1163320 3212 2639 1238 953 297 --13133 --
NM_032256chr125908 820 656 274 247 ------
NM_032288chr321823 301 21963 1622 ----
NM_032291chr131952 1889 568 11587 148 --
NM_032312chr2----1644 --
NM_032333chr102663 561 1189 1254 1760
NM_032352chr1421050 451 --1513 --
NM_032373chr1085623 5045 5039 4769 2156 1825 729 692 12192 12356 --
NM_032408chr7--11077 1384 --
NM_032410chr82802 339 ------
NM_032433chr19--11619 11336 --
NM_032438chr611251 ------
NM_032440chr1072087 1940 933 921 243 126 35 1564 ----
NM_032441chrX4451 329 154 33 11168 11041 --
NM_032446chr5133704 3489 3365 3195 2415 1534 1466 1299 1002 767 498 145 138 1153 11522 --
NM_032456chr41495 1535 ----
NM_032457chr483721 3331 3248 2986 1427 925 382 228 ------
NM_032458chrX93026 2434 2366 928 906 637 564 357 179 153 ----
NM_032539chrX2629 596 ------
NM_032557chr41370 ------
NM_032558chr921376 1088 11334 ----
NM_032560chr1431084 309 43 2857 108 ----
NM_032576chrY125 --1375 --
NM_032580chr173550 467 455 ------
NM_032582chr1731867 1574 1530 1463 --161
NM_032601chr2----131 --
NM_032632chr141100 ----2342 285
NM_032682chr332890 2592 740 11147 1307 --
NM_032704chr12192 ------
NM_032717chr43934 734 269 1913 ----
NM_032778chr3133111 2900 2782 2695 2366 2158 2099 1285 1232 1078 946 396 289 ------
NM_032802chr15----167 180
NM_032804chr1052442 2222 918 893 432 ------
NM_032813chr135933 708 388 306 112 --11148 --
NM_032827chr211149 ------
NM_032859chr1363428 2571 1400 846 589 518 13980 ----
NM_032869chr821808 439 11429 ----
NM_032870chr6----144 --
NM_032873chr1133429 1457 461 ------
NM_032906chr43807 690 314 ----1582
NM_032918chr1221035 424 --11279 11090
NM_032949chr133407 226 61 ------
NM_032961chr451197 1058 1021 890 112 ------
NM_032968chrX63732 2904 2745 1521 1476 321 --23694 1401 --
NM_032969chrX63732 2904 2745 1521 1476 321 --23694 1401 --
NM_032973chrY63724 2899 2740 1521 1476 321 --23686 1401 --
NM_033012chr132365 335 --1829 1844
NM_033014chr921611 178 ----11020
NM_033020chr154854 3895 3125 577 133 --1866 --
NM_033025chr191687 ------
NM_033030chr221538 1167 --134 --
NM_033044chr141125 1113 870 484 --11010 --
NM_033089chr2021473 448 ------
NM_033103chr1921166 47 11285 ----
NM_033132chr131656 ------
NM_033133chr1793348 2821 2768 2689 2310 1401 1322 837 397 11226 33470 247 151 --
NM_033136chr521903 1636 21400 1240 21734 406 --
NM_033137chr521903 1636 21400 1240 21734 406 --
NM_033138chr752022 1867 1725 613 260 12228 12164 1602
NM_033139chr752022 1867 1725 613 260 12228 12164 1602
NM_033140chr752022 1867 1725 613 260 12228 12164 1602
NM_033157chr752022 1867 1725 613 260 12228 12164 1602
NM_033181chr693398 3337 1578 1244 1209 1029 829 497 228 12501 23533 1310 --
NM_033211chr542048 1652 514 342 21773 549 ----
NM_033222chr921036 302 ------
NM_033224chr7147278 6460 6452 5704 5583 2988 2601 2251 1594 1372 1351 1328 1142 284 16088 37500 6943 1421 37970 6519 210
NM_033260chr62591 509 --1828 --
NM_033272chr22162 142 ------
NM_033285chr884358 4323 4140 1486 1252 1227 420 100 11534 ----
NM_033290chrX83672 3009 2987 2913 1480 752 645 66 23628 2980 22900 2429 --
NM_033305chr931378 1265 236 ------
NM_033326chr1152536 2277 2143 1703 446 12157 ----
NM_033331chr9143572 3446 2578 2313 1434 1375 1132 975 763 755 357 218 43 24 --23367 701 --
NM_033360chr12104550 4499 4413 4247 4026 3964 3642 3057 920 360 11288 ----
NM_033364chr331907 1900 507 21371 671 ----
NM_033394chr221341 206 ------
NM_033402chr82393 25 ------
NM_033407chr1--1441 ----
NM_033425chr1163105 2977 2895 2535 2397 660 --1764 --
NM_033427chr7184 ----1781
NM_033429chr1553018 2558 695 503 402 --1762 12679
NM_033480chr632247 826 200 --1910 22509 1210
NM_033481chr632247 826 200 --1910 22509 1210
NM_033495chrX3730 223 111 ------
NM_033505chr2146709 6651 5942 5874 5694 5375 4704 2565 2311 2232 2184 1764 1463 79 32135 1118 353 --11891
NM_033516chr91998 ----1279
NM_033632chr431378 1006 246 1385 --31268 1152 197
NM_033637chr1054043 3566 2647 2558 2537 12988 1207 --
NM_033656chr2185017 4482 3935 2297 2122 1879 1834 1695 2454 43 14474 --
NM_052832chr851927 1851 1147 556 335 12264 12413 11036
NM_052834chr1821587 991 12344 ----
NM_052876chr1912712 11813 ----
NM_052879chr1263637 1566 1071 1002 755 593 12953 11124 13750
NM_052885chr1271893 1716 1704 1301 625 117 40 --13650 13323
NM_052898chr831777 1613 1262 --1348 11899
NM_052907chr1243420 1629 994 433 11210 23262 1014 14066
NM_052910chr13--11653 11570 1293
NM_052917chr233198 2438 88 12355 ----
NM_052937chr812146 131 ----
NM_053016chr9167977 6770 6126 5956 5869 5474 3170 2571 1935 1239 790 658 644 602 330 93 ----12101
NM_053023chr1163085 2871 2830 2103 204 104 ------
NM_053024chr311027 --11336 --
NM_053025chr351229 566 443 267 259 ------
NM_053026chr351229 566 443 267 259 ------
NM_053027chr351229 566 443 267 259 ------
NM_053028chr351229 566 443 267 259 ------
NM_053031chr351229 566 443 267 259 ------
NM_053032chr351229 566 443 267 259 ------
NM_053043chr7106145 5719 5642 5405 4892 4614 1490 1482 865 527 24275 1986 --1177
NM_053053chr1155 1868 ----
NM_053279chr8112424 2207 2173 1965 990 825 790 338 203 120 69 1507 11016 --
NM_057168chr741298 1223 542 476 1260 ----
NM_057175chr492472 2333 1907 1702 909 671 554 457 227 --21834 1633 --
NM_057178chr1732281 1897 1741 12247 22616 269 --
NM_058172chr461803 1446 1340 1232 262 55 ------
NM_058240chr1441264 1147 224 160 11542 --1419
NM_058241chr232278 1906 1502 31546 659 450 ----
NM_058241chr232278 1906 1502 31546 659 450 ----
NM_080415chr173946 735 381 1116 2828 672 --
NM_080546chr91443 132 ----
NM_080599chr102423 71 ------
NM_080629chr121366 1285 ----11399
NM_080630chr121366 1285 ----11399
NM_080651chr81237 ------
NM_080738chr171756 1664 1645 1570 1349 762 640 1789 ----
NM_080840chr20--2455 173 ----
NM_080841chr20--2455 173 ----
NM_080867chr1455072 4871 3691 536 500 11402 24728 1422 --
NM_080872chr843988 3854 3760 387 ----23274 426
NM_130386chr181229 ----1134
NM_130434chr1541049 458 83 36 ------
NM_130435chr1031823 1039 913 22726 1187 --12017
NM_130436chr2132727 1984 132 12800 11803 --
NM_130438chr2143304 2561 709 486 33377 2069 425 12380 --
NM_130830chr383681 2829 2632 1557 1479 999 928 575 --1217 --
NM_130838chr1531592 1451 1264 --11468 --
NM_130839chr1531592 1451 1264 --11468 --
NM_130902chr4189 ------
NM_133170chr20137314 6557 6135 6035 5844 5711 5532 4889 3205 1395 802 652 78 17710 ----
NM_133264chr1753293 1391 1123 960 681 1202 --13345
NM_133265chrX43605 931 752 415 13665 13108 --
NM_133334chr475931 5750 4613 4578 2442 2312 1630 --14321 11516
NM_133370chr493665 3459 3298 2924 917 775 264 171 21 --23480 3328 2218 206
NM_133445chr942714 2550 1128 104 32582 1417 1183 ----
NM_133468chr772442 2397 2304 2113 1030 1023 601 ------
NM_133477chr413265 ------
NM_133494chr1138 ------
NM_133647chr1583612 3374 3338 3072 1148 326 282 139 --22712 989 --
NM_134442chr23399 295 45 ----21478 468
NM_138270chrX83027 1076 987 558 544 516 503 406 ------
NM_138288chr1432001 1630 1527 --11982 --
NM_138316chr1041374 1176 1136 353 ------
NM_138333chr942639 1856 1843 298 22587 2537 1374 --
NM_138348chr545682 5459 2205 469 21379 548 25465 358 --
NM_138350chr111456 --21341 490 --
NM_138357chr1031322 1162 532 1690 --1612
NM_138410chr31577 ------
NM_138444chr1344026 3939 3853 1593 1810 --13374
NM_138459chr673629 3390 2805 1251 467 455 295 ------
NM_138473chr1244706 3225 1529 894 14850 --13160
NM_138494chr742752 2656 2640 2455 12282 ----
NM_138576chr1494316 3917 3239 1841 1484 1182 1150 677 64 24491 1529 11613 --
NM_138621chr284102 4019 4003 3212 2681 875 812 445 --1604 --
NM_138638chr1462477 2063 1936 1558 337 250 12148 --22157 1964
NM_138689chr111223 --1197 --
NM_138694chr673056 1050 787 647 350 308 175 11326 22943 2414 --
NM_138713chr16128031 7857 7786 7638 6616 2889 2877 1266 915 618 530 230 28128 6414 16688 2793 123
NM_138714chr16128031 7857 7786 7638 6616 2889 2877 1266 915 618 530 230 28128 6414 16688 2793 123
NM_138720chr6------158
NM_138731chr1443468 1039 179 137 --21494 467 --
NM_138735chr231539 1304 507 21450 1298 ----
NM_138959chr1166833 6544 6174 5825 2733 2669 2455 2420 2256 2234 1859 1326 1283 199 127 106 ----1117
NM_138970chr1432191 1739 818 ------
NM_138971chr1173152 2769 2666 2329 1130 970 558 1363 12840 --
NM_138971chr1173152 2769 2666 2329 1130 970 558 1363 12840 --
NM_138972chr1173152 2769 2666 2329 1130 970 558 1363 12840 --
NM_138972chr1173152 2769 2666 2329 1130 970 558 1363 12840 --
NM_138973chr1173152 2769 2666 2329 1130 970 558 1363 12840 --
NM_138973chr1173152 2769 2666 2329 1130 970 558 1363 12840 --
NM_138981chr41759 187 ----
NM_139126chr63171 141 21 ------
NM_139135chr111175 --162 --
NM_139167chr8--1196 ----
NM_139168chr521564 301 1248 --1634
NM_139207chr1232133 2008 1736 ----1135
NM_139276chr1732131 1776 37 21535 469 --11961
NM_139283chr1232328 207 97 12028 12281 --
NM_139286chr9179 --1214 --
NM_139321chr2073872 3858 3701 3516 3020 638 248 11394 ----
NM_139323chr2041765 1706 1586 271 1238 1643 --
NM_144571chr486810 6725 5859 5412 5099 2040 413 277 --1464 --
NM_144578chr1444536 4522 3546 723 24624 3981 --22000 1000
NM_144595chr131794 1404 ----
NM_144599chr1563967 3765 2170 2016 1809 1437 1625 21180 107 15088
NM_144600chr16--21579 1087 ----
NM_144664chr112191 142 ----22302 856
NM_144710chr21264 1133 --11291
NM_144721chr462758 2219 2078 1741 1078 530 22311 855 12427 --
NM_144726chr551231 1055 880 401 341 21220 827 --1113
NM_144728chr13988 721 664 --1644 1208
NM_144729chr13988 721 664 --1644 1208
NM_144949chr242286 2184 1599 973 ----11727
NM_144963chr852617 2051 1984 1768 703 22696 632 ----
NM_144967chrX3999 932 310 ------
NM_144968chrX2913 28 ----2974 143
NM_144973chr1285210 4845 4727 4532 3827 3237 1847 664 21193 1180 35296 3519 1155 --
NM_145049chr541025 818 698 249 ------
NM_145062chr61148 ------
NM_145117chr1173327 3284 3128 3066 2760 2459 523 ------
NM_145203chr132712 216 --1152 --
NM_145234chrX2889 869 ------
NM_145235chr101125 ------
NM_145259chr2106573 6398 6061 5945 5709 5223 4794 4427 2571 1588 ----32038 1832 721
NM_145284chrX32452 2053 326 ------
NM_145307chr1053957 3876 1487 781 497 24522 4126 23902 3457 --
NM_145686chr232632 74 27 ----1494
NM_145687chr232632 74 27 ----1494
NM_145698chr1071812 1722 789 667 626 59 39 ------
NM_145753chr321407 208 2386 380 3646 539 405 --
NM_145861chr171756 1664 1645 1570 1349 762 640 1789 ----
NM_147150chr973359 1458 922 747 580 325 67 13372 ----
NM_147175chrX62164 2048 1896 1774 1650 1540 --21401 521 11920
NM_147181chr4--11069 ----
NM_147182chr4--11069 ----
NM_147183chr4--11069 ----
NM_147188chr1541452 509 440 194 --1235 1568
NM_148174chr822152 1530 ------
NM_148904chr11580 ------
NM_148905chr11580 ------
NM_148906chr11580 ------
NM_148907chr11580 ------
NM_148908chr11580 ------
NM_148909chr11580 ------
NM_148955chr1586277 6267 5676 5608 4195 2585 1216 319 16374 15972 --
NM_148957chr1372404 2115 2039 2021 385 184 75 --31680 530 130 --
NM_148976chr11162 ------
NM_148977chr1041374 1176 1136 353 ------
NM_148978chr1041374 1176 1136 353 ------
NM_152261chr1231735 245 136 --12520 --
NM_152271chr81471 ------
NM_152275chr232329 851 798 2749 377 ----
NM_152280chr183347 2231 2165 1309 1165 1028 947 632 --13009 23048 1017
NM_152284chr8------1679
NM_152332chr1452736 2485 1877 644 493 --11002 12912
NM_152334chr153798 124 100 1518 --1153
NM_152375chr152307 2130 2093 1625 598 --1809 12531
NM_152388chr262771 2641 2501 2455 1097 430 23826 1091 33915 2897 460 13627
NM_152407chr593291 3082 2990 2853 2522 2270 2068 1069 754 11213 ----
NM_152409chr541354 1334 597 328 1164 33487 3011 399 --
NM_152414chr841093 1081 1026 133 ------
NM_152422chr941529 1470 1203 245 --21422 1157 --
NM_152424chrX21021 512 14667 ----
NM_152446chr143937 346 325 1135 ----
NM_152455chr1532185 2011 228 11774 22280 939 --
NM_152520chr241037 436 197 166 ------
NM_152522chr22722 90 1389 ----
NM_152527chr221824 388 ----2886 112
NM_152529chr233616 3466 1395 23887 3840 1201 --
NM_152546chr531070 914 356 ------
NM_152549chr51131 ------
NM_152556chr711724 ----12203
NM_152557chr71422 --1129 11537
NM_152577chrX125 --1135 --
NM_152581chrX41464 413 339 193 --21176 419 --
NM_152588chr1221650 1498 ------
NM_152589chr12------1190
NM_152594chr1532097 1641 858 ----11721
NM_152608chr131979 1844 465 ------
NM_152622chr563447 3202 3181 2806 1149 391 ------
NM_152624chr5107400 6685 6284 5258 4768 2359 1180 967 653 436 46972 5899 4512 954 1912 1864
NM_152629chr963787 1500 982 972 150 127 33458 3073 1577 ----
NM_152638chr122457 53 11249 3218 77 38 --
NM_152641chr1232787 811 289 12061 12459 --
NM_152678chr352419 1003 451 425 399 22533 55 12121 --
NM_152695chrX31882 626 536 --12152 137
NM_152699chr383678 3521 3493 3346 1479 970 962 348 11133 1586 --
NM_152701chr74646 526 387 300 11758 ----
NM_152729chr63592 483 104 --1604 --
NM_152736chr63853 300 44 --1422 --
NM_152754chr763360 3296 3228 2932 2589 641 --12665 --
NM_152756chr573400 3041 2698 1553 1343 159 83 12749 ----
NM_152758chr862711 2314 2067 1222 1182 293 ------
NM_152774chr762536 2322 2062 1807 394 356 12728 12154 --
NM_152787chrX103775 3712 3448 3351 2924 2917 2786 1253 1048 234 12476 ----
NM_152789chr731329 1098 322 ------
NM_152793chr784314 3631 2053 1899 1484 1163 318 277 --24248 3818 14666
NM_152826chr1586277 6267 5676 5608 4195 2585 1216 319 16374 15972 --
NM_152835chr132970 2486 1076 --11816 --
NM_152838chr2031185 1004 481 13403 1591 12564
NM_152857chr61411 ------
NM_152858chr61411 ------
NM_152924chr1585121 5110 4719 4500 2472 2406 2117 1817 11948 14204 14342
NM_152989chr1231668 98 51 --21424 143 --
NM_152996chr171769 1693 722 458 393 256 250 ------
NM_152999chr774769 4399 4328 4309 4298 904 718 21219 645 2851 131 --
NM_153020chr631509 463 87 ------
NM_153029chr1674041 3414 2970 1660 1525 1122 752 1334 13616 --
NM_153038chr21729 --1321 --
NM_153042chr631769 170 112 11472 ----
NM_153182chr3133111 2900 2782 2695 2366 2158 2099 1285 1232 1078 946 396 289 ------
NM_153188chr575478 5340 5146 4792 4384 1711 1177 15355 ----
NM_153207chr1243544 2619 919 251 22734 61 --13862
NM_153226chr1031201 444 336 ------
NM_153251chr132190 67 ------
NM_153255chr62889 283 1868 ----
NM_153261chr1631398 1084 524 11036 1452 1120
NM_153262chr152508 894 849 415 210 43220 2961 2646 162 12065 --
NM_153267chr92776 157 ------
NM_153332chr862721 2379 1073 793 247 32 22327 1114 ----
NM_153343chr462376 2364 2033 1830 1731 950 ------
NM_153365chr412750 22701 2402 1811 --
NM_153371chr1331813 1734 343 199 1817 11952
NM_153456chr13146292 5657 5574 5168 5161 2124 1754 1463 1342 1263 599 390 80 51 25897 3968 21890 881 --
NM_153607chr562375 2312 2102 630 357 225 1215 --1932
NM_153649chr152306 2224 825 105 87 11825 177 --
NM_153686chr442259 2097 836 74 --12132 --
NM_153687chr1221264 47 11627 ----
NM_153689chr242375 1955 1900 902 --1335 --
NM_153693chr12197 190 --1844
NM_153810chr1085033 5012 4323 3830 3486 1822 1502 1284 ------
NM_153825chr461663 1130 573 518 376 95 ------
NM_170607chr171211 ------
NM_170662chr3172 --1554 1232
NM_170665chr1294034 3929 3798 3714 3457 3152 3003 1737 103 1205 ----
NM_170672chr221809 1207 --1171 11480
NM_170706chr143632 1304 989 116 13163 11282 13710
NM_170731chr114732 520 321 265 ----11827
NM_170732chr114732 520 321 265 ----11827
NM_170733chr114732 520 321 265 ----11827
NM_170734chr114732 520 321 265 ----11827
NM_170735chr114732 520 321 265 ----11827
NM_171825chr572536 2306 1958 1201 1113 561 271 12575 --22291 1066
NM_171998chrX2191 43 1201 21872 81 --
NM_172069chr211919 --22227 1849 --
NM_172070chr232187 637 589 ----11724
NM_172071chr196838 6819 5805 5269 4627 2396 1068 774 529 1918 47328 4809 1860 1040 --
NM_172103chr652597 1756 816 644 275 12643 1531 --
NM_172105chr652597 1756 816 644 275 12643 1531 --
NM_172337chr143915 731 723 ------
NM_172373chr134553 470 65 40 ------
NM_173054chr71954 1268 ----
NM_173075chr441611 661 516 42 --1733 1569
NM_173082chr631280 1070 595 ------
NM_173083chr151331 1154 302 260 170 ------
NM_173172chr221371 339 ----1279
NM_173214chr16128031 7857 7786 7638 6616 2889 2877 1266 915 618 530 230 28128 6414 16688 2793 123
NM_173354chr2162125 1479 868 795 218 32 --11801 --
NM_173355chr21789 11001 2922 415 --
NM_173359chr3--1582 11803 --
NM_173454chr1531014 754 479 ----11032
NM_173468chr4105945 5902 5177 4998 4952 4862 3907 1175 1138 429 --24868 2317 --
NM_173470chrX32596 2003 733 --1847 12327
NM_173495chrX42236 1693 619 383 ----1582
NM_173510chr2242299 1162 679 166 --1718 --
NM_173519chr851684 1352 825 287 34 11773 3659 645 77 --
NM_173552chr321728 45 1127 21855 1812 --
NM_173582chr1145066 3925 1151 963 34865 4151 2356 45472 4382 1938 150 14424
NM_173602chr1272986 1307 1065 850 682 492 97 --22801 1190 --
NM_173642chr1179127 9069 8200 7955 6732 6631 6587 6242 3250 2604 2086 1247 638 280 266 232 217 27920 6917 12521 37438 7150 1864
NM_173644chr20----11863 1425
NM_173683chr811137 --21469 1260 --
NM_173808chr174473 4329 4082 3934 3336 3246 3187 1779 1568 --
NM_173822chr23696 324 43 1847 ----
NM_173854chr132376 1586 607 ----22402 2383
NM_174916chr1542295 2024 1868 1689 1402 11734 1388
NM_174938chr91118 ------
NM_175056chr331906 473 40 1231 11682 --
NM_175061chr752134 1503 637 450 287 --11790 --
NM_175566chr11----1361 1470
NM_175605chr13--1233 ----
NM_175610chr1541377 514 204 37 ----1136
NM_175623chr12106319 5579 5019 2905 2480 1991 1510 835 559 41 --35133 827 157 --
NM_175624chr12106414 5674 5114 3000 2575 2086 1605 930 654 136 --35228 922 252 --
NM_175625chr12106414 5674 5114 3000 2575 2086 1605 930 654 136 --35228 922 252 --
NM_175767chr521821 1620 1339 11888 191
NM_175856chr53619 587 198 ------
NM_175859chrX61534 1312 1149 509 245 57 11342 11460 --
NM_175861chr1275568 5142 5044 4991 3914 2054 1966 34374 4071 2301 23812 1308 --
NM_175873chr51457 ------
NM_175907chr1842447 2108 1126 1118 --22873 2176 --
NM_176081chr10105653 5625 5557 4626 3801 2118 2031 1657 1233 531 15775 14905 1242
NM_176083chr10105653 5625 5557 4626 3801 2118 2031 1657 1233 531 15775 14905 1242
NM_176814chr7------1374
NM_177422chr1180 ----149
NM_177438chr1483662 3510 3114 1580 1055 953 460 108 24090 3237 --1306
NM_177452chr1442455 2100 801 783 11877 ----
NM_177925chr1232883 2425 502 12669 --11156
NM_177949chrX169 ----2405 292
NM_177952chr141739 --1168 --
NM_177966chr351943 1498 266 246 21 11237 ----
NM_177969chr2----1181 --
NM_177972chr1174461 3657 3563 3125 3093 2869 304 --1155 --
NM_177985chr2--32080 1569 226 1102 --
NM_177995chr941529 1470 1203 245 --21422 1157 --
NM_177996chr2063243 1124 294 286 123 95 1238 11070 11003
NM_178010chr1231668 98 51 --21424 143 --
NM_178011chr1063246 3015 2851 2826 2326 346 ------
NM_178151chrX157562 6817 6232 6036 5986 5719 4927 2876 2566 1919 1764 1371 1012 743 189 ----26311 5220
NM_178152chrX157562 6817 6232 6036 5986 5719 4927 2876 2566 1919 1764 1371 1012 743 189 ----26311 5220
NM_178153chrX157562 6817 6232 6036 5986 5719 4927 2876 2566 1919 1764 1371 1012 743 189 ----26311 5220
NM_178154chr141582 ----1153
NM_178155chr141582 ----1153
NM_178156chr141582 ----1153
NM_178157chr141582 ----1153
NM_178313chr23716 655 265 11696 1161 --
NM_178496chr321564 1441 1444 --11113
NM_178505chr1043070 2224 161 139 11370 12484 --
NM_178554chr363533 3178 1306 1231 641 200 --2631 620 --
NM_178584chr21264 1133 --11291
NM_178812chr821488 1380 --11618 11173
NM_178823chr64241 227 181 142 1644 ----
NM_178842chr1532117 2084 1875 ------
NM_180989chr1362502 2346 1669 964 493 158 12244 ----
NM_181054chr1421154 146 --152 1966
NM_181077chr1532294 561 192 1532 11898 --
NM_181358chr133470 1127 627 1937 --33745 3119 1441
NM_181457chr221027 410 --1908 --
NM_181458chr221160 543 --21041 30 --
NM_181459chr22926 309 --1807 --
NM_181460chr22973 356 --1854 --
NM_181481chr18146576 6436 6250 5644 4625 4275 2803 2289 1895 1650 1498 1463 385 176 --16257 --
NM_181482chr18146576 6436 6250 5644 4625 4275 2803 2289 1895 1650 1498 1463 385 176 --16257 --
NM_181483chr18146576 6436 6250 5644 4625 4275 2803 2289 1895 1650 1498 1463 385 176 --16257 --
NM_181504chr554084 3667 3428 368 92 ------
NM_181521chr16106683 6340 5680 5515 2809 2778 2722 2528 1693 535 35189 4771 1421 26992 5602 --
NM_181523chr554084 3667 3428 368 92 ------
NM_181524chr554084 3667 3428 368 92 ------
NM_181527chr202434 378 ------
NM_181528chr202489 433 ------
NM_181659chr2063415 3363 3030 2414 711 295 --13272 --
NM_181659chr2063415 3363 3030 2414 711 295 --13272 --
NM_181670chr1221393 143 ----11374
NM_181672chrX11490 1506 11742 11514
NM_181673chrX11490 1506 11742 11514
NM_181674chr5192 ------
NM_181675chr5192 ------
NM_181676chr5192 ------
NM_181677chr5192 ------
NM_181678chr5192 ------
NM_181689chr202785 722 ------
NM_181704chr2131238 551 148 ----11094
NM_181706chr1122002 1528 ------
NM_181773chr221259 ------
NM_181838chr531283 551 285 ------
NM_181872chr9------1259
NM_182398chr141124 ------
NM_182484chr2131238 551 148 ----11094
NM_182485chr473746 3350 3115 2913 2284 1424 647 174 ----
NM_182488chr133691 647 74 1156 --1894
NM_182493chr1643751 3527 694 326 --11489 1430
NM_182503chr6114846 4787 4238 3712 3617 1944 1714 863 315 212 60 1405 14163 --
NM_182643chr832048 887 822 --1130 --
NM_182646chr473746 3350 3115 2913 2284 1424 647 174 ----
NM_182648chr14191 ------
NM_182664chr171806 1526 946 730 696 442 92 11490 1379 --
NM_182703chr1541492 1408 1193 93 ------
NM_182757chr631215 1060 200 11330 12390 22893 2880
NM_182758chr1593727 3277 1348 1168 1071 815 743 191 25 --23346 1579 --
NM_182767chr1221452 621 1492 ----
NM_182789chr52817 442 --1667 --
NM_182797chr2041389 1340 1273 162 ------
NM_182830chr1432135 114 107 144 11642 --
NM_182898chr7126247 5797 5782 5515 4869 4398 2352 2333 1375 407 269 119 ------
NM_182899chr7126247 5797 5782 5515 4869 4398 2352 2333 1375 407 269 119 ------
NM_182907chr622337 2101 22058 1918 22324 1872 --
NM_182936chr1441264 1147 224 160 11542 --1419
NM_182943chr33458 299 24 150 ----
NM_182964chr1173327 3284 3128 3066 2760 2459 523 ------
NM_183002chr1441264 1147 224 160 11542 --1419
NM_183004chr1432608 2571 337 1565 32474 821 347 --
NM_183006chr20----1131 --
NM_183323chr52817 442 --1667 --
NM_183353chrX51070 1022 779 115 31 1255 ----
NM_183376chr1582419 2143 1937 1000 382 299 221 120 12216 ----
NM_183395chr11581 --1412 --
NM_183397chr20144734 4697 4526 4253 3890 3735 3286 2021 1937 1698 1419 918 367 326 14178 24412 458 --
NM_183422chr132911 42 1127 125 --
NM_194247chr264221 4174 4109 3602 2861 546 1608 34053 3350 1147 --
NM_194282chr41212 ----13087
NM_194283chr563315 1385 967 896 545 56 --1212 --
NM_194286chr12105721 5378 4932 4535 4518 4445 4165 3834 1294 322 24626 753 11407 --
NM_194291chr862820 2546 2342 2193 2059 301 ------
NM_194314chr195318 5284 4332 3966 1644 1212 734 640 484 21913 425 11868 --
NM_194434chr18105313 5155 5012 4919 4350 3659 1711 1402 735 537 25503 4697 15370 --
NM_194454chr711174 --11310 --
NM_194455chr711174 --11310 --
NM_194456chr711174 --11310 --
NM_194463chrX21203 887 ------
NM_197941chr552654 2457 1017 773 660 ----1144
NM_197970chr221538 1167 --134 --
NM_198066chr1443011 1197 849 110 ------
NM_198081chr662893 2294 1160 805 638 307 1818 1469 --
NM_198158chr352219 860 636 382 244 ----1622
NM_198159chr352219 860 636 382 244 ----1622
NM_198177chr352219 860 636 382 244 ----1622
NM_198178chr352219 860 636 382 244 ----1622
NM_198181chr1572674 2649 2352 2295 2209 1912 894 11900 ----
NM_198204chr171211 ------
NM_198205chr171211 ------
NM_198212chr711773 2408 111 --11682
NM_198225chr103519 418 123 21588 1534 1208 21766 233
NM_198268chr133470 1127 627 1937 --33745 3119 1441
NM_198269chr133470 1127 627 1937 --33745 3119 1441
NM_198270chrX62940 2762 2566 1320 1278 667 12525 ----
NM_198400chr1542047 1883 766 446 --12082 --
NM_198450chrX21939 1753 ----192
NM_198467chr7------1529
NM_198468chr673660 3557 806 599 573 361 166 --24475 4274 --
NM_198503chr152360 1856 828 497 436 ----1940
NM_198513chr861321 689 426 406 117 71 1197 ----
NM_198514chr10------1135
NM_198544chr13449 349 141 1489 --1506
NM_198549chr142379 271 229 93 1973 --11288
NM_198569chr61265 ------
NM_198580chr1951530 1346 1276 145 137 --1971 --
NM_198581chr2106168 5349 3012 2749 2612 2305 1730 1203 1095 68 --2433 208 27403 1758
NM_198595chr485006 3501 3214 3105 1714 1503 340 126 --24655 3843 --
NM_198794chr1411059 ------
NM_198829chr751373 1345 1244 987 929 ----11427
NM_198859chr365137 4694 4085 3520 1882 1235 14506 43826 3665 3627 2030 --
NM_198901chr731318 147 42 11166 11196 --
NM_198935chr2033263 838 175 22776 1292 22693 447 12077
NM_198965chr121394 ------
NM_198966chr121394 ------
NM_199000chr722096 379 ------
NM_199040chr1252840 2778 984 605 83 --23455 2656 --
NM_199072chr743219 2861 2766 30 23019 2431 --12854
NM_199132chr1932123 2088 1826 ----11592
NM_199144chr2051484 1176 1102 294 278 ------
NM_199167chr18----1382 --
NM_199188chr1263637 1566 1071 1002 755 593 12953 11124 13750
NM_199189chr51247 184 ----
NM_199190chr1263637 1566 1071 1002 755 593 12953 11124 13750
NM_199203chr2051484 1176 1102 294 278 ------
NM_199320chr472743 1781 1144 1119 803 606 254 ------
NM_199320chr472743 1781 1144 1119 803 606 254 ------
NM_199324chr463118 2946 2581 2503 1504 490 22756 880 12289 --
NM_199355chr1641219 704 392 86 1537 --1632
NM_199421chr1455072 4871 3691 536 500 11402 24728 1422 --
NM_199426chr203851 255 38 ------
NM_199436chr222103 1047 22723 2062 12194 --
NM_199437chr1131828 1605 290 22215 961 22447 181 --
NM_199438chr1131828 1605 290 22215 961 22447 181 --
NM_199439chr1131828 1605 290 22215 961 22447 181 --
NM_199454chr164520 3919 3632 3438 3280 458 ------
NM_199461chr1043631 3608 422 267 --1435 12580
NM_199462chr1104605 3560 3469 3450 1701 1367 1245 254 181 111 ------
NM_199464chr132555 121 157 1565 --
NM_199478chrX61891 1555 806 606 353 292 --1102 --
NM_199482chr261947 1819 770 750 467 27 ------
NM_199483chr201331 ------
NM_201280chr631379 1308 275 1149 --11576
NM_201428chr1161655 1495 1337 1161 636 182 1192 ----
NM_201429chr1161655 1495 1337 1161 636 182 1192 ----
NM_201430chr1161581 1421 1263 1087 562 108 1118 ----
NM_201436chr77801 773 726 642 566 250 50 ------
NM_201516chr77857 829 782 698 622 306 106 ------
NM_201517chr77801 773 726 642 566 250 50 ------
NM_201591chr421394 185 ------
NM_201592chr421394 185 ------
NM_201613chr122673 82 1248 1233 --
NM_201629chr91175 1786 ----
NM_203327chr2054332 920 833 727 485 14212 11168 --
NM_203354chr143601 97 37 ------
NM_203355chr143601 97 37 ------
NM_203356chr143601 97 37 ------
NM_203364chr112876 242 --1822 1970
NM_203372chr2------1143
NM_203390chr841617 1581 1323 405 ------
NM_203391chrX41557 1294 599 258 --11854 --
NM_203394chr1252381 2216 2207 1014 233 --22684 1770 --
NM_203406chr572793 2453 2102 1977 1845 1800 995 --22416 66 --
NM_203437chr23715 381 115 ------
NM_203446chr2131006 285 57 1918 11996 11151
NM_203451chr1331819 511 376 ----1393
NM_203453chr941217 372 283 169 --11927 --
NM_203458chr1153655 2976 2912 2681 1534 1376 1230 916 845 809 549 299 254 173 46 1357 --153
NM_203463chr254200 4133 4121 1954 1736 --1878 1213
NM_203464chr141168 996 483 90 21064 817 --1133
NM_203504chr432634 228 148 1507 ----
NM_203505chr432634 228 148 1507 ----
NM_205768chr132103 1341 709 21970 1382 ----
NM_205860chr162781 2283 1200 1092 1066 437 --21016 344 --
NM_206594chr122811 561 21227 121 1712 --
NM_206595chr122811 561 21227 121 1712 --
NM_206819chr12184 ------
NM_206820chr12184 ------
NM_206821chr12184 ------
NM_206832chr171246 ------
NM_206839chr151108 ------
NM_206852chr14183 ------
NM_206853chr6104142 4006 3826 3376 2845 1267 1200 285 220 24 1968 12873 --
NM_206854chr6115403 5267 5087 4637 4106 3459 1546 1481 1285 1010 242 --14134 --
NM_206855chr6166368 6232 6052 5602 5071 4424 4153 4039 2511 2446 2250 1975 1207 966 906 188 13924 15099 --
NM_206857chr14183 ------
NM_206860chr101138 ------
NM_206861chr101138 ------
NM_206862chr101138 ------
NM_206876chr243247 2934 2760 669 ----21015 702
NM_206907chr542748 1208 1109 981 23127 2818 ----
NM_206909chr8177723 7295 6786 6733 6553 6159 5841 5666 5596 5492 3341 3129 2663 2573 1139 473 387 --12911 27390 5115
NM_206933chr152711 2392 2108 367 306 1851 ----
NM_207009chr1051023 992 930 777 25 133 ----
NM_207043chr141730 1453 329 285 21672 190 1512 --
NM_207044chr141730 1453 329 285 21672 190 1512 --
NM_207047chr141730 1453 329 285 21672 190 1512 --
NM_207171chr142074 1904 1632 509 11750 ----
NM_207291chr19----1543 1500
NM_207303chr1073439 2892 1583 1410 1251 1052 705 12999 13611 --
NM_207325chr1921685 1500 1782 --21641 1471
NM_207361chr13106183 5227 5129 4197 4068 2033 1247 1189 877 458 25015 1670 24443 548 --
NM_207387chr1751751 1677 1301 1128 46 --11854 --
NM_207406chr445810 4166 993 865 12414 24777 884 14700
NM_207445chr1541811 1328 850 172 1133 11724 1792
NM_207517chr1541474 1285 725 554 11579 --11917
NM_207577chr1152854 2583 2527 1796 185 22370 660 12454 1473
NM_207647chr952464 2433 2347 562 466 1847 22032 214 --
NM_207660chr1431253 1112 55 ----1309
NM_207661chr1431253 1112 55 ----1309
NM_207662chr1431253 1112 55 ----1309
NM_212460chr71812 11796 21704 262 --
NM_212558chr974244 4170 1409 1086 584 390 316 1894 31662 376 105 --
NM_212559chrX3850 839 60 ------
NM_213589chr255061 4914 4609 1267 226 2765 559 23741 1131 11342
NM_213654chr331380 1014 71 --1160 --
NM_213662chr1742225 1870 131 102 21629 563 --12055