TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-224-5p
miRNA Sequence: CAAGUCACUAGUGGUUCCGUU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000024chr51184 ------
NM_000038chr551929 1887 1671 1647 463 ------
NM_000045chr6----1395 --
NM_000051chr1142619 2268 1150 994 1149 ----
NM_000052chrX33281 2591 454 --1303 --
NM_000067chr84555 463 275 195 --180 --
NM_000084chrX106664 6122 5879 4409 2362 2135 1735 1204 813 658 ----16930
NM_000092chr274604 2873 2846 2813 1647 478 257 23900 3571 ----
NM_000109chrX41745 749 557 28 ------
NM_000112chr585318 5121 3947 3548 3449 1596 400 113 --11579 --
NM_000125chr694164 3152 1626 1049 797 694 570 432 121 33319 3306 2684 1449 12750
NM_000129chr621221 414 31472 1163 93 --11203
NM_000167chrX2643 104 ----1153
NM_000170chr9131 ------
NM_000176chr563693 3011 2528 1443 1227 1041 1438 --11237
NM_000188chr101238 ------
NM_000194chrX1374 ------
NM_000202chrX52793 1485 1452 827 83 ------
NM_000210chr241515 449 297 287 1455 ----
NM_000214chr2031198 1151 469 3636 135 96 ----
NM_000216chrX54060 3793 3361 3073 2579 33783 3500 635 43696 3493 509 124 --
NM_000217chr1263894 3710 1552 1161 797 79 34199 1639 263 14773 --
NM_000218chr1111090 --2941 906 --
NM_000222chr441773 251 157 52 --11941 11917
NM_000237chr851776 1697 1544 1490 186 ------
NM_000240chrX42157 724 369 348 21674 124 --21759 735
NM_000245chr732142 1618 300 ------
NM_000248chr352696 2222 923 879 330 --1352 --
NM_000252chrX31205 993 52 ----1539
NM_000259chr1545841 4415 1055 847 12095 14121 1951
NM_000267chr1752733 2596 2371 1354 717 --1553 --
NM_000271chr181170 --1498 --
NM_000280chr112709 56 ------
NM_000282chr131205 ------
NM_000313chr31853 ------
NM_000319chr12160 11204 ----
NM_000321chr1341322 1225 159 65 ------
NM_000325chr41168 ------
NM_000330chrX62104 1894 516 412 166 36 ------
NM_000332chr6126004 5757 5716 5074 4424 2845 2301 2228 2103 1881 906 29 12595 ----
NM_000333chr3----1754 --
NM_000337chr5126316 5798 5651 4601 4131 2215 1998 1479 1083 886 498 51 45743 1591 1495 858 25077 2238 --
NM_000338chr1551102 1087 1021 947 301 1275 ----
NM_000345chr44806 800 282 139 --2345 240 --
NM_000387chr31568 ------
NM_000390chrX63273 3160 2636 944 226 196 ------
NM_000399chr1041182 1089 482 471 ----11026
NM_000406chr442518 2239 830 537 --12926 --
NM_000408chr233434 2711 2219 12300 --12457
NM_000430chr1753574 3186 3015 1441 375 11006 1817 --
NM_000448chr1173101 3030 2896 2193 1296 1260 485 12207 ----
NM_000462chr1541492 1436 1266 516 ------
NM_000474chr71226 ------
NM_000489chrX41078 989 542 475 22214 73 13293 --
NM_000516chr20----1132 --
NM_000523chr22195 181 1348 ----
NM_000533chrX31320 253 152 11803 ----
NM_000555chrX137903 7516 7039 6882 6627 6513 6039 5518 5483 5253 2769 2132 1605 26253 4864 45705 5281 1018 171 --
NM_000575chr231098 751 386 ------
NM_000594chr61693 ------
NM_000598chr73993 342 123 ----1351
NM_000610chr1162925 2699 2637 2412 711 290 12763 11087 --
NM_000618chr1286494 6029 4696 4564 4464 4071 1604 1592 14730 25529 180 --
NM_000618chr1286494 6029 4696 4564 4464 4071 1604 1592 14730 25529 180 --
NM_000627chr21625 ------
NM_000633chr1875080 3712 3504 1397 1143 449 334 --1902 --
NM_000635chr191395 ------
NM_000663chr1652344 1237 929 709 186 12243 1121 --
NM_000724chr1041871 797 788 417 --11558 --
NM_000786chr7131 1138 ----
NM_000793chr1473779 3320 3255 3107 1938 1267 910 23638 97 14249 --
NM_000806chr511872 ------
NM_000807chr4--1245 ----
NM_000813chr555343 1736 1364 465 237 24043 1864 2536 222 --
NM_000814chr1584081 3924 3600 2905 2851 951 614 556 ------
NM_000826chr442586 586 170 156 1476 1981 --
NM_000838chr642303 2028 1922 942 ------
NM_000840chr71451 ------
NM_000859chr561646 1497 1247 1139 538 429 --21586 1571 --
NM_000860chr431446 1162 251 ------
NM_000868chrX22102 1724 11859 ----
NM_000875chr1596830 6107 5464 4664 4654 2589 2312 2299 412 15920 24470 1390 --
NM_000876chr651390 1360 1351 1253 394 ----11024
NM_000891chr172576 541 1306 ----
NM_000895chr122106 21 --1128 --
NM_000899chr1274093 3690 3363 1361 597 542 145 ------
NM_000901chr441696 671 649 287 22230 2172 ----
NM_000902chr332217 116 106 ------
NM_000909chr431291 961 325 --11110 --
NM_000917chr102896 739 ------
NM_000926chr1188463 7881 5821 3468 2497 2373 1367 1223 38039 7957 6125 17554 --
NM_000933chr2041662 1624 1322 145 ------
NM_000944chr442290 1776 1640 207 --1816 --
NM_000949chr51320 1930 2198 38 --
NM_000950chrX53460 3396 3003 2916 485 192 22702 1056 --
NM_000956chr141340 1276 ----
NM_000961chr2043951 3904 3378 3132 --13449 --
NM_000962chr992931 2909 2884 2798 439 398 384 295 167 ------
NM_000964chr171541 ------
NM_000965chr3--1303 ----
NM_000969chr1122 ------
NM_000983chr151629 317 303 294 163 --21407 229 --
NM_001001389chr1162925 2699 2637 2412 711 290 12763 11087 --
NM_001001390chr1162925 2699 2637 2412 711 290 12763 11087 --
NM_001001391chr1162925 2699 2637 2412 711 290 12763 11087 --
NM_001001392chr1162971 2745 2683 2458 757 336 12809 11133 --
NM_001001419chr585040 3396 1959 1759 1309 1282 1240 188 24825 3795 44882 3978 906 638 --
NM_001001420chr585040 3396 1959 1759 1309 1282 1240 188 24825 3795 44882 3978 906 638 --
NM_001001433chr2053131 3027 2443 2096 1290 22927 1059 --1782
NM_001001436chr161550 ------
NM_001001484chr1052479 2451 1664 622 607 1259 ----
NM_001001502chr51504 ------
NM_001001520chr19----1153 --
NM_001001521chr21117 --1311 --
NM_001001549chr752673 2366 2297 319 283 --12386 --
NM_001001550chr752673 2366 2297 319 283 --12386 --
NM_001001555chr752673 2366 2297 319 283 --12386 --
NM_001001556chr1541182 1132 1022 266 --11288 --
NM_001001557chr821874 483 --21668 331 --
NM_001001664chr253989 3490 2839 228 36 23452 1461 ----
NM_001001668chr1963403 3367 2707 1311 573 220 ----1468
NM_001001684chr1782388 2243 1598 1580 280 249 43 34 12296 ----
NM_001001890chr2153247 2728 1676 1567 1190 2384 341 ----
NM_001001928chr2286947 6572 6059 5412 3312 1952 264 214 18248 17159 1318
NM_001001974chr1062126 1899 1645 957 748 382 --1299 1556
NM_001001995chrX41174 531 517 347 ------
NM_001002243chr22717 118 ------
NM_001002269chr91494 ------
NM_001002838chrX31417 1265 253 ------
NM_001002843chr1511077 --1966 --
NM_001002860chr14124715 4678 4428 4261 4010 3748 3726 3124 1858 839 327 116 --24512 3089 13831
NM_001003407chr1064806 4056 3165 1805 1289 503 1651 2860 478 13293
NM_001003408chr1064806 4056 3165 1805 1289 503 1651 2860 478 13293
NM_001003652chr1898323 7545 6652 5668 2794 2204 1384 1107 905 56053 5993 3076 3046 931 28576 6140 17631
NM_001003679chr152197 281 274 267 224 2628 157 ----
NM_001003681chr2221731 359 ----1547
NM_001003712chr1242840 1226 141 43 ------
NM_001003760chr642627 1137 539 149 13038 1382 --
NM_001003895chrY2251 146 ------
NM_001004065chr963946 3782 3378 2713 1401 229 12594 ----
NM_001004196chr34950 307 226 29 ------
NM_001004317chr654212 4144 3792 3108 1766 --1820 14051
NM_001004319chr11110 ------
NM_001004342chr175484 5269 4716 4531 4520 640 598 --11536 --
NM_001004419chr121499 --13993 --
NM_001004720chr21904 ------
NM_001004722chr221073 775 ------
NM_001005335chr19----1252 --
NM_001005366chr121391 ------
NM_001005367chr19--1324 ----
NM_001005375chrY61638 1569 1470 1391 431 405 1535 11368 --
NM_001005386chr251995 1865 1545 672 610 ----1760
NM_001005404chr1764452 3498 2942 492 219 79 --11096 --
NM_001005473chr556400 4285 1832 1188 158 11757 1600 --
NM_001005476chr2177 ------
NM_001005502chr1294566 4210 3998 3990 3592 3173 1294 1096 421 ------
NM_001005609chrX73602 2435 1273 1052 433 172 146 1263 ----
NM_001005739chr2177 ------
NM_001005782chr25905 682 356 324 177 --1379 --
NM_001006600chr582070 1879 1851 1606 845 755 477 346 ------
NM_001006610chr161825 ------
NM_001006612chrX1375 ------
NM_001006613chrX1375 ------
NM_001006614chrX1375 ------
NM_001006636chr21943 --1868 --
NM_001006657chr222986 921 1976 22321 782 --
NM_001007023chr1473779 3320 3255 3107 1938 1267 910 23638 97 14249 --
NM_001007067chr841050 442 292 238 ------
NM_001007068chr841050 442 292 238 ------
NM_001007069chr841050 442 292 238 ------
NM_001007070chr841050 442 292 238 ------
NM_001007072chr15----187 --
NM_001007075chr41834 ------
NM_001007097chr984597 4290 3862 3636 3528 547 525 189 44035 1973 368 92 1485 --
NM_001007102chr61594 --21132 1054 --
NM_001007189chr52168 44 ------
NM_001007246chr2121241 594 1550 1400 --
NM_001007257chr131339 342 220 ----11173
NM_001007277chr1111018 --1767 --
NM_001007278chr13145250 4917 4840 4555 4135 4071 3637 3551 3369 1730 1040 981 465 327 34768 3225 1802 ----
NM_001007466chr675174 4517 4452 3443 1164 799 79 1583 1812 24493 616
NM_001007471chr9----1152 1766
NM_001007553chr121242 997 1838 ----
NM_001007559chr1841998 268 201 131 --12098 --
NM_001007794chr11253 ------
NM_001008225chr7180 1741 ----
NM_001008239chr1832801 1407 590 22429 1295 23254 274 --
NM_001008392chr373569 3284 3162 3063 935 719 601 ------
NM_001008401chr19----11455 --
NM_001008408chr7136098 5994 5635 5604 5065 4894 4829 4127 4096 2293 2009 1533 517 14489 46365 4011 1883 1017 1334
NM_001008495chr832169 1772 744 11809 11963 --
NM_001008539chr894918 4558 4394 4185 4077 3549 1846 1413 462 ----1968
NM_001008540chr21461 1156 1378 --
NM_001008541chr1042086 1551 1531 281 ------
NM_001008541chr1042086 1551 1531 281 ------
NM_001008564chr1341875 1710 1589 522 --12018 --
NM_001008567chr9--1114 ----
NM_001008660chr1131464 634 248 1221 ----
NM_001008707chr1441270 712 618 477 11752 175 --
NM_001008723chr101469 ------
NM_001008738chr562668 2652 2503 2236 1904 168 1361 1692 --
NM_001008860chr15131 ------
NM_001008892chr15131 ------
NM_001008894chr15131 ------
NM_001008895chr1331197 589 131 ------
NM_001008925chr452742 2417 2385 1217 572 ------
NM_001009185chr52574 110 ----1675
NM_001009567chr10177 ------
NM_001009881chr11602 1148 ----
NM_001009882chr11602 1148 ----
NM_001009899chr375415 4937 4863 4590 4575 1430 413 34667 4228 3961 ----
NM_001010846chr173062 2989 1852 1818 1774 1644 462 21417 534 2695 137 --
NM_001010867chr196488 6439 5582 4991 4377 1809 1742 804 278 --22084 761 --
NM_001010888chrX93860 3484 3424 3197 3082 1106 1098 514 209 --13505 --
NM_001010891chr576513 6435 5318 5295 4580 4184 2737 22259 362 1422 --
NM_001010897chr131374 ------
NM_001011513chr473926 3273 1473 1151 999 537 166 13434 ----
NM_001011537chr31254 22393 1781 ----
NM_001011546chr20--1236 ----
NM_001011551chrX1396 1445 ----
NM_001011666chr752354 2151 2028 658 121 21648 853 ----
NM_001011708chr24892 697 221 51 --1339 --
NM_001011713chr1431470 1013 501 ------
NM_001011885chr1541493 1377 1319 697 2489 372 ----
NM_001012329chr182377 677 636 545 427 328 220 57 1201 ----
NM_001012337chr3143 ------
NM_001012393chr11115177 5071 4992 3929 3810 1731 1477 1392 779 768 453 64872 3876 1636 853 785 402 ----
NM_001012398chr1621008 983 ------
NM_001012410chr32432 408 ------
NM_001012423chr1522587 1145 --32001 1871 184 --
NM_001012425chr1----1129 --
NM_001012751chr1021505 721 1751 ----
NM_001012754chr1352170 2033 1825 1736 786 ------
NM_001012755chrX54748 4627 1285 1138 541 34859 4161 1812 ----
NM_001012968chrX62767 2337 2226 2012 1081 954 --12631 --
NM_001012979chrX125 ------
NM_001013031chr1033216 2676 1377 13551 ----
NM_001013398chr73993 342 123 ----1351
NM_001013399chr621124 784 11110 1128 --
NM_001013406chr731176 693 101 21487 1155 ----
NM_001013620chr12108384 7919 6285 5173 2508 2107 2035 1324 1088 914 47029 6229 1671 943 36332 2007 1842 17677
NM_001014336chr12186 ------
NM_001014380chr13105708 4092 3929 2031 1828 1657 1066 1013 997 396 1507 --14838
NM_001014434chr11748 --1635 --
NM_001014797chr1087104 3119 3113 2904 2775 2423 2131 325 15377 67316 5247 2249 1861 1568 193 18027
NM_001014972chr22174 52 ------
NM_001015508chr81481 ------
NM_001015877chrX63127 3040 2064 2033 1953 495 13121 ----
NM_001017395chr383396 3210 2895 2543 2477 1429 527 234 22735 1114 1318 --
NM_001017396chr221955 869 ----1799
NM_001017405chr41826 --1331 --
NM_001017440chr7168011 7671 7607 7520 7172 6559 6037 5360 3297 3082 2901 1345 824 677 504 460 --32984 2764 2327 --
NM_001017926chr851859 1426 1405 703 412 2496 56 11438 --
NM_001017928chr31107 ------
NM_001017961chr11220 ------
NM_001017962chr102896 739 ------
NM_001017995chr584809 3842 2968 1144 1029 423 378 45 13765 31111 463 127 --
NM_001017999chr122082 904 22210 2142 ----
NM_001017999chr122082 904 22210 2142 ----
NM_001018000chr122082 904 22210 2142 ----
NM_001018000chr122082 904 22210 2142 ----
NM_001018001chr122082 904 22210 2142 ----
NM_001018037chr941403 192 96 39 ------
NM_001018053chr141867 1484 702 321 11524 1243 --
NM_001018067chr184487 3678 3548 3514 1890 960 899 487 34768 3395 713 --15036
NM_001018068chr184487 3678 3548 3514 1890 960 899 487 34768 3395 713 --15036
NM_001018069chr184487 3678 3548 3514 1890 960 899 487 34768 3395 713 --15036
NM_001018074chr563693 3011 2528 1443 1227 1041 1438 --11237
NM_001018075chr563693 3011 2528 1443 1227 1041 1438 --11237
NM_001018076chr563693 3011 2528 1443 1227 1041 1438 --11237
NM_001018077chr563693 3011 2528 1443 1227 1041 1438 --11237
NM_001018091chr1522494 951 22965 1825 1272 --
NM_001018111chr743118 1039 1008 475 12614 23389 338 --
NM_001018115chr3--1616 ----
NM_001020658chr111315 ------
NM_001020658chr111315 ------
NM_001020825chr521168 486 ------
NM_001024094chr563693 3011 2528 1443 1227 1041 1438 --11237
NM_001024372chr872191 1885 1805 1602 593 267 192 --21993 1628 --
NM_001024455chrX42137 2127 943 741 ------
NM_001024463chr152145 27 1870 ----
NM_001024647chr12127289 6773 6342 6325 2756 2741 2100 1947 1923 1410 445 144 11736 15093 --
NM_001024649chr572966 2493 2425 2331 2135 1104 1002 1334 3794 725 29 --
NM_001024809chr171541 ------
NM_001024934chr62583 141 2680 633 --1192
NM_001024935chr62583 141 2680 633 --1192
NM_001024936chr62583 141 2680 633 --1192
NM_001024937chr171114 ------
NM_001024948chr153450 2835 2649 2307 778 1294 1358 --
NM_001024956chr1132346 835 493 25667 692 15400 --
NM_001025076chr10126253 6225 6133 5339 4093 2401 2135 1490 1472 976 572 493 26234 4131 15288 --
NM_001025077chr10147611 7583 7491 6697 5451 4977 4908 4896 2848 2830 2334 1930 1851 1123 27592 5489 36646 4865 1346 --
NM_001025079chr363378 2911 2663 912 384 150 14109 23795 415 --
NM_001025105chr551321 1280 1195 1115 508 ------
NM_001025107chr172585 2476 2461 2448 1723 600 322 2999 966 --12695
NM_001025107chr172585 2476 2461 2448 1723 600 322 2999 966 --12695
NM_001025108chr231129 902 894 14212 34035 2626 384 14108
NM_001025356chr1252416 2368 2045 938 475 11112 22433 1169 --
NM_001025366chr611618 ------
NM_001025366chr611618 ------
NM_001025367chr611618 ------
NM_001025367chr611618 ------
NM_001025368chr611618 ------
NM_001025368chr611618 ------
NM_001025369chr611634 ------
NM_001025369chr611634 ------
NM_001025370chr611618 ------
NM_001025370chr611618 ------
NM_001025580chrX44189 1190 544 219 --23626 3549 12836
NM_001025595chr451527 1479 1152 378 111 ------
NM_001025596chr112366 359 ------
NM_001025780chr921015 130 ------
NM_001029858chr641083 715 296 195 33164 2248 1075 1770 --
NM_001029863chr622616 2488 1419 ----
NM_001029874chr121312 ------
NM_001029875chr552977 2835 1906 294 157 ------
NM_001029998chr421358 427 1417 ----
NM_001030007chr1694054 4025 3584 3337 1597 1444 1083 814 67 --13005 --
NM_001030047chr1921108 362 ------
NM_001030055chr14124154 3726 3571 3470 3389 1444 1414 1210 1148 657 599 395 1340 23457 2981 --
NM_001031681chr1752345 1620 1602 720 194 ----1333
NM_001031685chr12914 733 ------
NM_001031710chr73851 767 291 ------
NM_001031711chr541860 572 547 403 ------
NM_001031712chr61304 144 ----
NM_001031732chr483364 3149 2794 2779 2764 2617 1329 681 ------
NM_001031735chr191220 ------
NM_001031804chr1694404 3961 3626 3332 3018 1430 1103 1039 234 23133 3090 22690 813 --
NM_001031812chr52509 59 ------
NM_001032282chr83532 361 156 1898 --11282
NM_001032288chr2011608 ------
NM_001032296chr1382766 2700 2595 2356 1966 1097 1040 749 12004 1610 --
NM_001032380chr1031946 1456 439 ------
NM_001032393chrX1221 --1729 --
NM_001032394chr652769 2158 2146 1838 381 ------
NM_001032395chr652636 2025 2013 1705 248 ------
NM_001032730chr11484 ------
NM_001032999chr2063852 3614 1944 720 654 241 21135 277 15088 --
NM_001033059chr631814 1641 644 ------
NM_001033081chr141896 1880 1624 240 11835 ----
NM_001033082chr141896 1880 1624 240 11835 ----
NM_001033087chr2063127 2878 2497 779 719 585 --1300 --
NM_001033117chr3104667 4618 4238 4137 3405 3252 1821 1187 287 39 11694 169 --
NM_001033557chr241285 1223 227 62 ------
NM_001033569chr17122 ------
NM_001033570chr17122 ------
NM_001033571chr17122 ------
NM_001033572chr17122 ------
NM_001033581chr1135 ------
NM_001033581chr1135 ------
NM_001033582chr1135 ------
NM_001033756chr611552 ------
NM_001033756chr611552 ------
NM_001033925chr1021706 212 12163 1510 --
NM_001034841chr1695094 4859 4474 3956 3439 2130 1750 956 122 --45266 4834 3802 298 35238 1717 143
NM_001034845chr42514 26 11006 ----
NM_001034850chr511478 11097 ----
NM_001035chr1192 ------
NM_001035003chr41922 11133 1323 --
NM_001035004chr41922 11133 1323 --
NM_001035511chr151928 1669 1384 187 104 1329 1253 --
NM_001035512chr152035 1776 1491 294 211 1436 1360 --
NM_001035513chr152035 1776 1491 294 211 1436 1360 --
NM_001037132chr732217 491 226 --12269 --
NM_001037133chr732217 491 226 --12269 --
NM_001037163chr73751 356 56 ------
NM_001037164chr741642 1426 534 51 12073 ----
NM_001037165chr7148633 7805 6949 6223 5976 5656 2479 2432 2228 2197 2123 1669 1620 905 --48794 8161 7494 3195 --
NM_001037172chr311187 --11285 1418
NM_001037174chr222132 222 3782 504 105 ----
NM_001037332chr542518 2219 2202 1829 ------
NM_001037333chr542518 2219 2202 1829 ------
NM_001037334chr1862087 1756 1526 668 567 490 ------
NM_001037339chr151705 1484 333 263 190 --11417 --
NM_001037340chr151705 1484 333 263 190 --11417 --
NM_001037341chr151705 1484 333 263 190 --11417 --
NM_001037341chr151705 1484 333 263 190 --11417 --
NM_001037553chr2184348 3406 3358 3235 3146 1374 975 117 12061 ----
NM_001037582chr431177 715 52 ----11767
NM_001037738chr51211 ------
NM_001038493chr251588 1380 1094 1037 960 ------
NM_001039091chrX3256 46 39 --1377 --
NM_001039199chr2064905 4105 3476 3272 1126 742 24532 3071 14613 --
NM_001039538chr263684 3289 3187 2722 213 186 ------
NM_001039547chr3157731 7388 6887 6864 6624 5491 5310 5216 3122 2907 2778 2428 2069 1289 709 1336 ----
NM_001039577chr1104305 3627 3432 3114 3054 2752 1555 1439 360 224 ------
NM_001039590chrX53200 2890 2676 1113 661 23359 1461 12801 --
NM_001039591chrX53200 2890 2676 1113 661 23359 1461 12801 --
NM_001039618chr1195752 5222 4989 4514 4237 3888 3790 953 191 35368 4557 4365 34033 375 228 --
NM_001039693chr243941 3566 982 948 23970 230 1928 --
NM_001039709chr2063852 3614 1944 720 654 241 21135 277 15088 --
NM_001039762chr1042246 1491 554 380 ------
NM_001039802chr11226 ------
NM_001039846chr191220 ------
NM_001039937chr1373567 3390 3111 2935 2634 1081 767 ------
NM_001040092chr81336 1171 ----
NM_001040110chr721407 183 ------
NM_001040152chr7104876 4034 3886 3676 2009 1967 1601 1561 1217 326 13813 ----
NM_001040153chr131797 ------
NM_001040202chr421699 504 11691 1456 --
NM_001040214chr652358 2176 1946 1544 932 22368 920 11935 --
NM_001040272chr922105 1899 ------
NM_001040284chr16125280 4909 4860 4154 4093 2226 1620 1361 1059 918 664 312 2708 113 14671 15741
NM_001040402chr453129 2677 2386 815 248 --1928 --
NM_001040429chr1353505 2920 2793 2500 170 42466 1030 394 52 --22749 384
NM_001040441chr195439 5019 4466 1645 1253 791 227 107 49 --11106 --
NM_001040450chr1552862 1045 793 708 98 1366 ----
NM_001040453chr1552862 1045 793 708 98 1366 ----
NM_001040613chr841241 1092 983 558 ----1509
NM_001040624chr841746 1711 348 246 ----12561
NM_001040625chr841746 1711 348 246 ----12561
NM_001040626chr841746 1711 348 246 ----12561
NM_001040627chr841746 1711 348 246 ----12561
NM_001040628chr841746 1711 348 246 ----12561
NM_001040629chr841746 1711 348 246 ----12561
NM_001040630chr841746 1711 348 246 ----12561
NM_001040653chr372589 2552 1768 1675 912 596 254 ----12688
NM_001040665chr794772 4397 3348 1882 1836 1540 747 561 61 34992 3771 134 ----
NM_001040666chr72474 99 1694 ----
NM_001040708chr821154 1051 11038 ----
NM_001040712chr943443 2942 1132 1106 2996 500 33333 2903 389 --
NM_001042355chr1654814 1255 1202 639 492 15325 33851 1692 671 --
NM_001042383chr362956 2926 2847 1304 1245 1092 22572 288 ----
NM_001042388chr182663 209 1956 ----
NM_001042403chr1221001 686 1979 --134
NM_001042404chr11254 ----1569
NM_001042412chr1654814 1255 1202 639 492 15325 33851 1692 671 --
NM_001042424chr442459 2248 846 825 --42503 2211 1092 949 --
NM_001042440chr531279 808 455 11271 2113 63 --
NM_001042441chr531279 808 455 11271 2113 63 --
NM_001042442chr531279 808 455 11271 2113 63 --
NM_001042443chr531279 808 455 11271 2113 63 --
NM_001042444chr531279 808 455 11271 2113 63 --
NM_001042445chr531279 808 455 11271 2113 63 --
NM_001042446chr531279 808 455 11271 2113 63 --
NM_001042479chrX72025 1890 1663 1464 1437 602 538 ------
NM_001042480chrX72025 1890 1663 1464 1437 602 538 ------
NM_001042492chr1752733 2596 2371 1354 717 --1553 --
NM_001042493chr621924 707 --11414 --
NM_001042510chr821734 198 2533 311 ----
NM_001042511chr821734 198 2533 311 ----
NM_001042533chr352568 2294 2211 901 307 12638 1889 --
NM_001042537chrX42460 2205 655 47 1758 126 --
NM_001042543chr431139 581 355 --1245 --
NM_001042550chr911678 41622 1540 527 364 1213 --
NM_001042555chr1264607 3447 490 482 334 279 --14242 --
NM_001042599chr2167490 7397 7351 7326 7276 6766 5644 5618 5407 5206 2943 2923 2660 2493 1369 703 12675 ----
NM_001042601chr352203 1134 658 499 430 --22521 797 --
NM_001042603chr1294783 4635 4587 2127 2014 1057 739 291 141 25392 1719 35308 1012 341 --
NM_001042604chr394899 4676 4563 4398 3808 3602 1507 1399 1293 ------
NM_001042635chr141137 ------
NM_001042681chr162024 1962 655 523 310 289 --12605 --
NM_001042682chr162024 1962 655 523 310 289 --12605 --
NM_001042682chr162024 1962 655 523 310 289 --12605 --
NM_001042749chrX61943 1851 1709 1692 1259 258 ------
NM_001042750chrX61943 1851 1709 1692 1259 258 ------
NM_001042751chrX61943 1851 1709 1692 1259 258 ------
NM_001043351chr122129 541 1828 1394 --
NM_001044305chr631626 538 231 ------
NM_001044385chr233138 3034 469 22504 463 ----
NM_001044722chr52509 59 ------
NM_001044723chr52509 59 ------
NM_001046chr522100 214 --22608 104 --
NM_001048183chr173471 3362 3338 2916 1178 738 643 --23395 1316 --
NM_001071775chr1341741 1521 1335 386 11624 --1169
NM_001076chr41192 ------
NM_001076chr41192 ------
NM_001077628chr11695 --1702 --
NM_001079874chr162163 1575 779 745 528 193 ------
NM_001083620chr442584 585 170 156 1475 1980 --
NM_001085487chr1173 ------
NM_001099678chr386265 5664 5203 5088 4747 1818 1494 1412 22090 1914 --11963
NM_001100108chr1146588 6485 6064 5424 5088 3327 3129 2600 2137 1065 1047 876 763 394 37818 5199 1377 13026 --
NM_001106chr3139088 8345 8125 6944 6031 3197 2910 2691 2374 2048 1546 1177 129 39387 9101 829 21967 1387 --
NM_001109977chr41122 ------
NM_001111chr172585 2476 2461 2448 1723 600 322 2999 966 --12695
NM_001123chr101318 ------
NM_001128chr1694054 4025 3584 3337 1597 1444 1083 814 67 --13005 --
NM_001146chr83691 586 213 12345 21913 1730 --
NM_001148chr432053 2047 57 22235 839 ----
NM_001149chr101137 ------
NM_001160chr1212786 ----12161
NM_001167chrX106025 5790 5716 4599 4165 2577 1137 1037 173 69 2920 293 25910 563 --
NM_001173chr14124154 3726 3571 3470 3389 1444 1414 1210 1148 657 599 395 1340 23457 2981 --
NM_001186chr2183091 2624 2302 821 404 187 163 152 --11271 --
NM_001189chr4129 ------
NM_001198chr652339 1874 883 537 42 --2975 73 --
NM_001201chr413425 13322 ----
NM_001204chr2157464 7059 6452 6210 5876 5587 5391 5228 5170 4836 2825 1594 1434 753 670 66591 5882 5146 2852 2576 1718 27068 1163 11826
NM_001206chr942837 2459 446 143 --12282 --
NM_001219chr72627 367 11953 --11706
NM_001220chr7----1147 --
NM_001241chr262436 2223 951 510 456 424 ------
NM_001241chr262436 2223 951 510 456 424 ------
NM_001248chr34956 805 144 79 1896 ----
NM_001256chr1752388 2177 2009 971 38 12908 1503 --
NM_001259chr753943 560 386 296 191 --14959 153
NM_001270chr531099 739 81 --1325 --
NM_001271chr1532584 2072 450 22901 2466 33181 1309 441 --
NM_001278chr101159 ------
NM_001284chr51449 --2218 188 --
NM_001289chrX21468 495 ------
NM_001304chr17103472 3386 3380 3356 3244 3214 2770 2521 576 524 1212 33173 1106 340 --
NM_001310chr1232800 531 27 ------
NM_001315chr662175 1539 1469 545 525 382 --22016 219 --
NM_001329chr1011480 11624 1402 1208
NM_001338chr21------11249
NM_001351chr331611 436 303 --11365 --
NM_001356chrX62460 1843 962 616 282 116 --12268 --
NM_001358chr43427 309 152 ------
NM_001364chr1174020 3821 3361 3215 1414 1038 452 21497 323 ----
NM_001385chr81147 --1386 --
NM_001386chr842274 2128 1644 192 11896 12213 --
NM_001387chr523184 209 ------
NM_001389chr211215 ------
NM_001390chr1843595 1398 1011 485 --1691 --
NM_001396chr2162173 1981 1033 737 694 135 ------
NM_001399chrX73602 2435 1273 1052 433 172 146 1263 ----
NM_001400chr151376 1320 1017 960 259 ------
NM_001412chrX93647 2807 2626 2315 1385 717 521 505 123 13693 22535 828 --
NM_001415chrX51969 1683 1659 1347 100 11675 11591 --
NM_001417chr1221882 284 ------
NM_001418chr111723 ------
NM_001418chr111723 ------
NM_001419chr1964578 4183 3839 3024 1197 1056 13412 24088 1378 14779
NM_001423chr1221774 1619 ------
NM_001429chr2231082 856 709 ------
NM_001438chr193278 3137 3077 2492 2481 2263 1356 1256 962 ------
NM_001448chrX2231 149 --3546 276 78 --
NM_001463chr21725 ------
NM_001483chr731061 944 911 --1673 --
NM_001497chr962681 2498 2081 771 676 137 1962 ----
NM_001527chr694536 4349 4155 3358 1403 391 298 131 84 1858 11673 --
NM_001533chr19----1252 --
NM_001546chr621396 1021 ------
NM_001554chr11595 ------
NM_001604chr112709 56 ------
NM_001609chr1073702 3199 3015 1173 905 488 368 14185 ----
NM_001612chr111228 ------
NM_001616chr243476 2779 2343 772 22148 945 ----
NM_001619chr111205 --21057 104 --
NM_001634chr631814 1641 644 ------
NM_001650chr1834098 3766 1011 13127 11490 --
NM_001655chr1152043 1736 1644 1410 869 ------
NM_001656chr521768 1548 --11313 --
NM_001660chr31698 ------
NM_001663chr1462519 2309 1931 351 285 219 1438 1964 --
NM_001682chr1242821 2744 2284 1039 --12721 --
NM_001690chr31722 --127 --
NM_001701chr91239 ----11368
NM_001717chr1531227 488 119 11519 2340 257 --
NM_001718chr631363 1241 956 ------
NM_001731chr12149 ------
NM_001742chr721433 433 ----11407
NM_001744chr52164 97 ------
NM_001745chr51228 1165 ----
NM_001746chr572966 2493 2425 2331 2135 1104 1002 1334 3794 725 29 --
NM_001750chr531279 808 455 11271 2113 63 --
NM_001753chr771705 1698 1556 1499 1464 1424 33 ------
NM_001754chr2153247 2728 1676 1567 1190 2384 341 ----
NM_001759chr1244523 4267 4188 670 13902 --15239
NM_001777chr363378 2911 2663 912 384 150 14109 23795 415 --
NM_001791chr11226 ------
NM_001792chr181304 ------
NM_001798chr1231067 963 873 ------
NM_001801chr5----1220 --
NM_001806chr1932904 1022 295 22043 638 42347 503 434 35 --
NM_001839chr11543 ------
NM_001843chr121216 ------
NM_001858chr663625 1762 659 375 235 189 13295 11589 24314 316
NM_001859chr994016 4009 3585 2965 2912 2731 2470 332 67 --11181 13507
NM_001873chr41574 1103 ----
NM_001874chr1294566 4210 3998 3990 3592 3173 1294 1096 421 ------
NM_001880chr21202 --145 1283
NM_001881chr10--1430 ----
NM_001882chr52491 66 ------
NM_001884chr51155 ------
NM_001892chr551321 1280 1195 1115 508 ------
NM_001895chr202973 173 ------
NM_001901chr63938 872 79 --1263 --
NM_001902chr1----1396 --
NM_001903chr52818 806 ------
NM_001904chr31345 ------
NM_001933chr1451381 1174 554 361 307 ------
NM_001938chr131714 1419 737 --21906 1882 --
NM_001942chr1811375 31414 1400 820 --180
NM_001944chr1832275 1981 434 12264 --1339
NM_001945chr5----163 --
NM_001946chr121780 ------
NM_001949chr663272 2958 2811 2174 766 330 12405 13023 --
NM_001951chr81538 ----1205
NM_001954chr61726 ------
NM_001963chr44747 692 555 503 1575 ----
NM_001964chr551133 866 802 270 213 11143 ----
NM_001968chr41110 --1746 --
NM_001969chr1483106 2610 1586 1489 1076 876 823 295 32477 331 99 1953 11461
NM_001973chr11326 --1116 --
NM_001977chr421113 388 ------
NM_001980chr1232047 1784 1778 --11534 --
NM_001987chr1274102 3798 3154 2645 1373 1167 251 --13726 --
NM_001993chr121133 692 2986 913 ----
NM_001995chr421089 121 ------
NM_001999chr51584 ------
NM_002006chr4135768 4798 4509 4334 3888 1929 1841 1692 1390 1329 788 725 695 ------
NM_002009chr1542657 2604 853 716 ------
NM_002010chr131164 1224 ----
NM_002015chr1333291 2497 748 12586 ----
NM_002024chrX21532 1479 ------
NM_002025chrX128846 8635 8025 6963 6917 2948 2380 2149 2077 2067 1646 1394 27089 6366 49103 8418 2321 1059 --
NM_002026chr22810 266 ------
NM_002037chr61123 --1348 --
NM_002040chr2152925 2260 1950 846 124 2637 366 ----
NM_002044chr1541182 1132 1022 266 --11288 --
NM_002063chrX41027 888 488 375 --21107 869 --
NM_002069chr761304 671 577 361 299 250 ------
NM_002072chr951012 980 357 255 162 ------
NM_002076chr1292764 2402 2247 729 478 207 156 118 58 13222 --1825
NM_002092chr483925 3529 1914 1642 1077 833 737 117 31697 1493 253 13835 1443
NM_002106chr4167 ------
NM_002128chr1312210 21872 1756 ----
NM_002130chr531467 1439 128 11513 ----
NM_002136chr122581 182 ------
NM_002137chr7--1495 ----
NM_002140chr92920 475 ------
NM_002146chr171426 ------
NM_002158chr232895 1509 1487 13287 ----
NM_002160chr9----1180 --
NM_002166chr22684 649 ------
NM_002167chr11128 1380 1435 --
NM_002182chr332762 146 138 1582 1949 --
NM_002187chr531238 845 103 --11084 --
NM_002196chr20--1759 ----
NM_002196chr20--1759 ----
NM_002203chr553420 2828 1413 1328 998 14011 ----
NM_002205chr12--1750 ----
NM_002210chr243581 3524 3286 2424 63562 2671 1393 1132 331 284 1204 12294
NM_002214chr755470 4374 1946 181 164 --15036 11660
NM_002222chr331283 1077 265 --11295 11316
NM_002232chr121016 509 1544 ----
NM_002239chr21808 2273 38 ----
NM_002241chr141193 930 751 554 12174 2567 374 1272
NM_002245chr11635 ------
NM_002247chr101409 21974 376 1619 --
NM_002253chr421190 104 ------
NM_002264chr354652 3909 3818 1029 306 11754 1515 --
NM_002267chr1331797 513 202 ------
NM_002269chr6--1312 ----
NM_002270chr554807 4616 3899 3509 2188 --55159 4965 4831 3628 1254 --
NM_002285chr231129 902 894 14212 34035 2626 384 14108
NM_002310chr586274 5600 5131 4334 1996 1637 1306 189 35004 4914 4266 24586 2650 22370 897
NM_002313chr1064806 4056 3165 1805 1289 503 1651 2860 478 13293
NM_002336chr12115074 4879 4389 4215 4048 4011 3982 3231 1975 837 786 13772 24041 3465 --
NM_002349chr231526 1292 283 ------
NM_002355chr122504 136 --11303 --
NM_002356chr662696 2618 2554 809 707 109 22347 1117 ----
NM_002372chr54621 541 120 37 ------
NM_002374chr263684 3289 3187 2722 213 186 ------
NM_002382chr1421202 976 ------
NM_002395chr611280 ------
NM_002399chr151432 ------
NM_002438chr10177 ------
NM_002444chrX41482 1426 624 297 ------
NM_002445chr85615 144 120 106 87 ------
NM_002449chr531112 479 461 --1901 --
NM_002451chr942745 2667 2468 1051 1176 --12455
NM_002467chr81414 ------
NM_002486chr962220 1664 1608 714 557 201 1453 ----
NM_002494chr4140 ------
NM_002499chr1562443 1841 963 537 336 23 --12251 --
NM_002500chr25997 945 471 274 55 --1449 --
NM_002504chr91270 ------
NM_002515chr1411871 11684 ----
NM_002516chr191319 ------
NM_002524chr1169 --21099 402 1751
NM_002540chr93637 616 454 --1680 --
NM_002544chr17182 ------
NM_002545chr11115177 5071 4992 3929 3810 1731 1477 1392 779 768 453 64872 3876 1636 853 785 402 ----
NM_002556chr1152131 1523 860 168 77 --11819 --
NM_002569chr1511555 --11474 --
NM_002577chr344033 3884 305 178 --3871 841 624 --
NM_002587chr5----1172 --
NM_002592chr20----1244 --
NM_002594chr2051673 698 552 368 231 ------
NM_002595chr1221917 1409 --1383 --
NM_002600chr151705 1484 333 263 190 --11417 --
NM_002601chr2186 ------
NM_002613chr16105258 3992 3339 3288 2004 1875 1629 1548 912 599 --33805 3687 2063 15292
NM_002628chr321128 207 11187 ----
NM_002635chr121183 1406 ----
NM_002641chrX31998 1909 1296 1654 11753 --
NM_002645chr1141213 837 670 658 --13120 --
NM_002646chr132076 672 129 12121 ----
NM_002655chr845332 4691 1314 351 ----25012 4575
NM_002657chr2063787 3577 3123 823 774 643 ------
NM_002658chr10----1923 --
NM_002670chr321548 363 11347 ----
NM_002687chr1441185 1083 987 473 ----11070
NM_002697chr1288 50 ------
NM_002703chr451653 1606 1224 607 451 --1583 11945
NM_002709chr293382 2749 2401 1417 1388 1180 832 815 709 13549 22419 632 --
NM_002710chr1221064 765 1137 ----
NM_002715chr51508 11294 ----
NM_002716chr1173421 3301 3057 2290 1412 638 372 12564 --1149
NM_002718chr362683 2381 1937 1842 318 100 2546 459 ----
NM_002719chr1462347 2235 2202 1961 1872 450 --22336 177 --
NM_002734chr1731965 1803 1470 ----11433
NM_002736chr741646 593 371 227 --21395 100 2825 154
NM_002738chr1641011 858 408 105 1929 ----
NM_002744chr1135 ------
NM_002745chr2233864 1562 1319 24307 102 23748 157 --
NM_002750chr10----1232 --
NM_002752chr5--1534 ----
NM_002763chr1183 ------
NM_002765chrX3256 46 39 --1377 --
NM_002822chr1231636 552 175 ------
NM_002837chr1254519 4385 952 810 277 --22958 48 --
NM_002839chr943443 2942 1132 1106 2996 500 33333 2903 389 --
NM_002843chr1163190 3179 1344 1132 972 297 ------
NM_002845chr181656 ------
NM_002851chr72269 95 ------
NM_002865chr83236 216 101 ------
NM_002868chr1242059 1831 716 595 22453 893 ----
NM_002874chr952305 1581 662 432 76 1357 ----
NM_002886chr384781 4535 4217 3263 2011 1012 250 220 ----21527 71
NM_002892chr1411593 11499 11369 --
NM_002894chr18184 ------
NM_002902chr151661 ------
NM_002906chr1141862 1758 1749 728 1844 ----
NM_002941chr351552 1344 630 491 271 ------
NM_002959chr174004 3985 3722 1495 1133 982 66 13918 1604 --
NM_002970chrX1352 ------
NM_002971chr32361 354 ------
NM_002973chr121119 ------
NM_002977chr263057 2838 505 426 247 137 --22997 2374 145
NM_002993chr41698 1680 ----
NM_002994chr42725 347 ------
NM_002998chr831990 1691 1640 11491 1519 --
NM_002999chr2051937 1758 1233 102 23 11578 1556 11720
NM_003000chr1--125 ----
NM_003001chr152035 1776 1491 294 211 1436 1360 --
NM_003010chr1721779 290 ------
NM_003013chr42672 630 --1322 --
NM_003016chr1741535 1342 1290 343 ------
NM_003027chr152171 112 ------
NM_003031chr161825 ------
NM_003034chr12128155 7973 7934 7136 7017 5305 2592 1920 1392 433 164 59 36884 5355 395 1562 --
NM_003043chr373952 3902 3883 3010 2993 1501 198 1619 ----
NM_003046chr894918 4558 4394 4185 4077 3549 1846 1413 462 ----1968
NM_003051chr111509 11679 ----
NM_003068chr8--11036 ----
NM_003069chrX2623 266 ------
NM_003081chr2031176 463 226 ------
NM_003085chr51504 ------
NM_003099chr1555362 4262 2596 1681 906 --14007 35742 4457 2063
NM_003100chr51431 ------
NM_003101chr161625 1089 1023 623 487 54 1410 ----
NM_003108chr286227 6029 5664 2657 1753 1047 384 326 35483 5439 765 47171 4869 819 575 24731 4698
NM_003112chr753167 2176 1242 477 117 ------
NM_003128chr252689 2476 2056 1117 114 ------
NM_003131chr652120 1670 1614 1606 702 --11796 --
NM_003144chr642224 1579 655 345 --2778 596 --
NM_003149chr321700 542 11310 ----
NM_003155chr832492 2115 92 11071 12538 --
NM_003161chr1783586 3358 2814 2756 2367 2229 1432 687 22519 1353 --11286
NM_003162chr22918 883 ------
NM_003178chr322245 227 --1288 --
NM_003182chr72480 446 ------
NM_003182chr72480 446 ------
NM_003184chr81955 2382 152 ----
NM_003188chr63842 724 268 --1219 --
NM_003189chr173339 2555 2068 2061 1046 706 168 --13130 --
NM_003199chr18115644 5471 4430 4388 3902 2217 1638 1332 1315 1138 675 35025 4015 1371 --11146
NM_003203chr262295 2251 1845 1526 958 733 11969 ----
NM_003211chr1261749 1319 1166 601 427 268 ------
NM_003221chr651561 1361 1336 301 92 24193 3796 ----
NM_003257chr1531375 298 201 1542 1254 --
NM_003262chr3104928 4347 4171 3539 1482 1436 1269 1164 608 320 1993 ----
NM_003269chr611282 11191 ----
NM_003272chr11107 1719 ----
NM_003274chr2142852 2450 1882 61 11048 12877 --
NM_003286chr202771 232 ------
NM_003292chr122271 2248 --12186 --
NM_003298chr365603 4843 4817 1637 637 517 --35304 4233 2412 16214
NM_003300chr141322 ------
NM_003320chr1194463 3680 2887 1423 1249 677 655 635 626 --13954 --
NM_003338chr102649 115 1665 --11374
NM_003339chr521258 71 1288 11391 --
NM_003340chr42499 72 11022 --21408 1312
NM_003342chr1762712 1141 1066 847 656 643 23286 603 22864 2652 --
NM_003344chr731231 610 166 ------
NM_003349chr2011608 ------
NM_003350chr81963 --1690 --
NM_003352chr25905 682 356 324 177 --1379 --
NM_003359chr4----125 --
NM_003374chr51670 --1339 --
NM_003376chr611618 ------
NM_003376chr611618 ------
NM_003379chr61410 ------
NM_003385chr22792 316 1638 ----
NM_003387chr262296 2036 1957 765 758 281 11828 --12631
NM_003390chr1131103 1000 957 ------
NM_003392chr344173 835 745 64 12747 --11491
NM_003394chr12174 ------
NM_003403chr14155 ----1666
NM_003404chr2041439 1318 282 223 21709 646 ----
NM_003405chr221739 ------
NM_003407chr191527 ------
NM_003409chr181379 1986 --1404
NM_003410chrX52354 627 588 566 140 32173 815 102 ----
NM_003411chrY41851 1701 1285 242 ------
NM_003412chr342615 2453 2292 1017 12979 ----
NM_003413chrX31580 1443 395 11272 ----
NM_003439chr773555 2773 2502 2254 1298 1176 953 --11352 --
NM_003463chr63588 557 287 182 23359 971 --
NM_003467chr21461 1156 1378 --
NM_003468chr293926 3732 3472 2946 2816 2656 1147 802 459 --13826 --
NM_003471chr3--32210 1817 800 11807 --
NM_003472chr621150 946 152 ----
NM_003478chr1123055 276 ------
NM_003482chr12----11910 --
NM_003483chr1252771 2344 2152 2086 577 --22462 2001 --
NM_003489chr2162965 2726 1329 1112 842 81 22399 1106 22778 2435 --
NM_003496chr7----1855 --
NM_003498chr1662759 2207 1085 1043 892 379 ------
NM_003566chr1253357 2896 2383 2122 967 11171 ----
NM_003574chr1875372 5310 4620 4481 4027 3662 1140 45276 1778 909 388 1865 --
NM_003576chr1382766 2700 2595 2356 1966 1097 1040 749 12004 1610 --
NM_003581chr21904 ------
NM_003583chr1253681 3169 3078 2577 907 21563 1196 23646 2529 --
NM_003589chr1331197 589 131 ------
NM_003590chr263543 3372 3251 2567 1098 624 123 ----
NM_003597chr212322 --22189 1551 --
NM_003603chr482033 2018 1989 1808 1665 1400 572 354 --1621 --
NM_003607chr174025 3859 2658 1706 1370 430 230 1630 13290 --
NM_003615chr353826 2503 1406 745 106 13584 33658 1036 669 --
NM_003618chr21409 11022 --11255
NM_003622chr1252163 2072 661 399 349 ------
NM_003628chr2177 ------
NM_003630chr61738 ------
NM_003631chr102876 421 184 ----
NM_003633chr552418 2026 1712 768 357 11042 1625 --
NM_003651chr121541 1463 ----
NM_003659chr22989 818 ------
NM_003663chr353428 3228 3152 2615 1367 13070 11350 --
NM_003671chr933395 2786 703 22351 482 ----
NM_003672chr1--31478 662 413 1546 --
NM_003677chr124857 668 535 416 --21871 833 --
NM_003713chr131396 620 115 --1466 --
NM_003718chr7--1420 ----
NM_003722chr371995 1707 1009 466 295 187 114 12265 --1726
NM_003725chr121436 174 ----
NM_003743chr251790 917 900 541 303 ------
NM_003750chr102882 345 ------
NM_003758chr1521458 267 --21434 1071 --
NM_003758chr1521458 267 --21434 1071 --
NM_003759chr433699 3537 533 23567 3193 34240 2861 1006 --
NM_003762chr121416 1308 ------
NM_003763chr2053131 3027 2443 2096 1290 22927 1059 --1782
NM_003772chr1111026 3471 356 63 ----
NM_003774chr1243333 2584 2078 722 1349 ----
NM_003787chr1821428 64 ------
NM_003818chr2011011 --1994 179
NM_003819chr11244 ------
NM_003822chr122445 2200 12950 31963 1126 851 --
NM_003825chr1511379 1492 11023 --
NM_003831chr1841691 1373 481 40 --2275 77 --
NM_003845chr12----142 --
NM_003861chr1472798 2776 2112 1882 1827 236 193 12810 ----
NM_003872chr253024 2975 2599 388 211 1544 12057 --
NM_003877chr1231021 834 820 1919 ----
NM_003884chr331272 744 450 ------
NM_003887chr2------12270
NM_003902chr11750 ------
NM_003908chr202292 45 1912 ----
NM_003909chr882475 2257 2158 1048 992 741 526 206 22370 1919 ----
NM_003910chr7----1147 --
NM_003913chr664243 3297 3106 1652 338 318 14332 11146 --
NM_003922chr15156 ------
NM_003930chr742462 2362 1623 271 --1356 --
NM_003931chr62583 141 2680 633 --1192
NM_003934chr911015 1994 1372 --
NM_003939chr1034062 4054 2524 ----1338
NM_003941chr731977 1023 242 --11740 --
NM_003947chr311051 --11174 --
NM_003948chr452407 2364 1880 1810 640 21992 754 ----
NM_003955chr171395 ------
NM_003966chr5107257 6356 5295 2996 2937 2900 2198 1102 744 21 --36288 6225 1635 --
NM_003994chr1274093 3690 3363 1361 597 542 145 ------
NM_004006chrX41745 749 557 28 ------
NM_004007chrX41745 749 557 28 ------
NM_004009chrX41745 749 557 28 ------
NM_004010chrX41745 749 557 28 ------
NM_004011chrX41745 749 557 28 ------
NM_004012chrX41745 749 557 28 ------
NM_004013chrX41745 749 557 28 ------
NM_004014chrX41745 749 557 28 ------
NM_004015chrX41745 749 557 28 ------
NM_004017chrX41745 749 557 28 ------
NM_004019chrX2326 306 ------
NM_004020chrX41745 749 557 28 ------
NM_004028chr1834098 3766 1011 13127 11490 --
NM_004035chr1784998 3259 1973 1719 1045 918 284 246 45059 4147 1262 453 ----
NM_004067chr751346 1271 1103 262 86 ------
NM_004071chr2------1197
NM_004080chr751511 1017 473 372 360 11472 ----
NM_004081chrY61638 1569 1470 1391 431 405 1535 11368 --
NM_004085chrX1528 ------
NM_004087chr341541 1318 549 93 ----1386
NM_004093chr1332856 2477 1111 ------
NM_004096chr102293 58 --1850 --
NM_004099chr921968 271 ----1183
NM_004100chr641826 533 403 64 --31931 1770 517 --
NM_004109chr112382 69 1755 ----
NM_004113chr33708 449 126 ------
NM_004115chr13------255 27
NM_004124chr1432579 803 258 13382 ----
NM_004136chr1563077 3008 998 906 736 172 12205 11279 --
NM_004152chr191372 ------
NM_004162chr3190 11223 ----
NM_004170chr91110 ------
NM_004171chr1139157 7334 6784 28629 7486 49212 8259 1783 1701 --
NM_004211chr111136 ------
NM_004215chr84556 364 172 106 ------
NM_004229chrX--11394 22218 2167 --
NM_004232chr1843797 2520 1139 1018 --2908 322 --
NM_004242chr6127 --1368 --
NM_004252chr175523 461 160 131 24 ------
NM_004274chr1442842 2700 2122 139 11277 ----
NM_004277chr6--1125 ----
NM_004281chr103488 433 403 ------
NM_004285chr176461 6179 5763 5411 1858 1704 972 14178 11411 --
NM_004295chr1751171 1118 913 475 394 21162 523 ----
NM_004297chr91230 1300 142 --
NM_004311chr1072936 2808 2506 2080 1139 894 730 --1474 --
NM_004323chr922022 81 --22373 168 --
NM_004331chr852603 2488 2084 1863 1783 --12000 --
NM_004337chr852082 1739 1471 836 76 1166 ----
NM_004342chr722024 615 190 ----
NM_004354chr4----1582 --
NM_004369chr2--1120 ----
NM_004384chr52509 59 ------
NM_004389chr21751 ------
NM_004392chr1332122 1799 178 --1512 --
NM_004396chr17----1244 --
NM_004397chr1154164 2859 1343 1095 357 ------
NM_004419chr10----146 --
NM_004428chr11726 ------
NM_004432chr94954 943 721 535 22325 2041 1961 --
NM_004434chr1441270 712 618 477 11752 175 --
NM_004437chr162598 1249 1204 1096 1012 775 --1878 --
NM_004440chr631460 1372 1258 --1399 --
NM_004454chr362226 804 749 692 677 399 ------
NM_004457chr2--1310 1281 --
NM_004458chrX32041 1015 955 --42249 2098 1835 1810 --
NM_004464chr441451 744 315 144 23381 1552 --13012
NM_004494chr131307 1131 1035 ------
NM_004496chr1411267 11290 ----
NM_004498chr15----1310 --
NM_004499chr51480 ------
NM_004501chr183358 3187 3065 2520 1606 989 759 144 --1275 --
NM_004504chr232242 2176 976 12647 1733 --
NM_004505chr1711857 --11734 --
NM_004514chr1752346 846 693 582 202 --13030 --
NM_004520chr52734 600 ----1245
NM_004529chr9----174 --
NM_004535chr20----21777 93 1240
NM_004537chr1231228 1065 350 ------
NM_004540chr214855 774 603 297 ------
NM_004549chr1141552 1354 507 486 --11494 --
NM_004566chr1032456 805 475 ----12450
NM_004583chr171129 ------
NM_004586chrX64511 4285 3644 3399 1494 1248 13978 14264 11448
NM_004598chr552212 2171 552 510 167 1249 --1300
NM_004602chr2011465 --11090 --
NM_004612chr933422 3010 2972 14666 --1394
NM_004621chr111167 21259 65 ----
NM_004630chr1121071 107 ------
NM_004637chr32919 404 --11088 --
NM_004640chr61156 ------
NM_004642chr12--1243 ----
NM_004655chr1751280 1131 389 299 171 ------
NM_004660chrY62331 2125 2116 612 280 115 --1313 12175
NM_004663chr1541573 1555 203 142 ------
NM_004673chr11567 --11139 --
NM_004680chrY2251 146 ------
NM_004705chr111708 1767 ----
NM_004709chrX31413 711 70 11303 1340 1248
NM_004719chr1262793 2323 1077 764 415 92 1689 ----
NM_004725chr102283 248 ------
NM_004726chrX74345 3802 2168 1629 1449 1112 1074 --25649 3850 --
NM_004730chr521476 321 ------
NM_004734chr1332807 515 293 --23169 1040 --
NM_004741chr1031297 1219 334 --2416 346 --
NM_004742chr351548 1175 678 611 84 ------
NM_004744chr453207 2760 726 664 129 ----11177
NM_004745chr8146760 6680 5926 5635 5186 4814 4621 2471 2362 2097 1606 1566 942 274 26005 2531 21198 891 --
NM_004755chr1421071 124 1417 ----
NM_004768chr1----21035 61 --
NM_004774chr1752667 880 557 126 99 12504 1928 --
NM_004776chr20103335 2652 2636 2407 2085 1186 1178 889 847 231 ------
NM_004792chr21154 ------
NM_004795chr1361734 1411 1239 640 221 111 --1454 1134
NM_004797chr323500 2750 12565 11369 --
NM_004798chr2063640 3359 2899 2404 1190 1143 ------
NM_004800chr13172 --1204 --
NM_004820chr8--196 ----
NM_004821chr51193 ------
NM_004834chr242723 2576 2526 1074 --13193 1997
NM_004850chr221284 1099 ----11523
NM_004856chr152376 49 --1389 --
NM_004857chr1474594 4588 4078 3839 3086 3041 646 --1486 --
NM_004859chr1742636 1916 567 307 --22964 2716 23015 1138
NM_004863chr14105311 5016 4671 3684 3516 3368 1571 1527 645 223 --45244 3662 3302 925 --
NM_004866chr564787 4109 3584 1376 637 463 24499 1605 1937 --
NM_004867chrX2590 57 1541 ----
NM_004874chr83422 127 57 ------
NM_004879chr111896 --1645 --
NM_004887chr51931 ------
NM_004888chr91291 --1826 --
NM_004891chr2121 128 ----
NM_004897chr103825 773 48 --2908 306 --
NM_004904chr752354 2151 2028 658 121 21648 853 ----
NM_004912chr731176 693 101 21487 1155 ----
NM_004924chr1911028 ------
NM_004929chr831484 337 135 --21233 509 --
NM_004932chr541645 1338 1270 51 ------
NM_004937chr1772710 1985 1967 1676 1655 1085 559 ----1698
NM_004938chr911050 ------
NM_004947chr352573 2211 2049 766 612 --1204 12420
NM_004956chr774404 4369 3730 3173 1456 598 335 13378 ----
NM_004958chr12211 97 1310 ----
NM_004966chr101808 11013 ----
NM_004976chr11104492 3638 3620 3327 2075 1605 1406 1349 686 540 --1365 --
NM_004985chr1253789 3676 3078 2882 1556 ----11522
NM_004992chrX77279 6816 5527 2232 1040 562 532 --22786 151 1887
NM_004992chrX77279 6816 5527 2232 1040 562 532 --22786 151 1887
NM_004993chr1421475 55 --21145 409 --
NM_004996chr1611324 11726 ----
NM_004999chr643842 1550 1486 1121 1895 21289 857 1809
NM_005010chr732217 491 226 --12269 --
NM_005011chr721407 183 ------
NM_005016chr12----1147 --
NM_005023chr521274 127 11465 --1504
NM_005026chr121430 155 --1566 --
NM_005027chr191422 ------
NM_005028chr1061893 1583 772 208 178 147 --152 --
NM_005036chr2286947 6572 6059 5412 3312 1952 264 214 18248 17159 1318
NM_005045chr72762 112 1768 1812 1182
NM_005056chr1295027 4879 4831 1301 983 535 385 65 23 25636 1963 35552 1256 585 --
NM_005065chr1475233 4320 3641 3625 1515 1021 611 21013 72 1242 --
NM_005068chr63528 332 255 ----11440
NM_005076chr184108 3317 2674 1575 1448 818 810 105 --12599 --
NM_005093chr2063852 3614 1944 720 654 241 21135 277 15088 --
NM_005095chr14540 534 132 102 ------
NM_005116chr2084484 4330 3923 3865 3052 1375 559 338 11325 13192 --
NM_005121chr1753771 2591 1179 372 143 12496 ----
NM_005124chr64867 307 258 209 --1959 --
NM_005126chr3--11727 --11834
NM_005134chr182663 209 1956 ----
NM_005141chr41167 --1121 --
NM_005151chr1862087 1756 1526 668 567 490 ------
NM_005153chr163622 226 83 ------
NM_005156chr985183 4447 3508 3424 1981 1572 1317 595 13291 11459 --
NM_005160chr22115501 4911 4830 4767 2156 1773 1022 707 470 394 257 16377 16260 --
NM_005168chr2--1378 1220 --
NM_005180chr102635 94 2535 43 ----
NM_005186chr11----1591 --
NM_005188chr11117806 7681 7322 7024 6543 2747 2655 2329 1894 1043 406 1555 57605 7098 2543 1339 94 --
NM_005190chr621124 784 11110 1128 --
NM_005197chr1464445 2285 1855 696 329 71 15248 34544 4370 1204 --
NM_005201chr34424 418 402 193 11017 ----
NM_005230chr12--1417 ----
NM_005231chr1111373 ------
NM_005233chr342571 2319 1873 39 22395 689 1352 --
NM_005235chr2167490 7397 7351 7326 7276 6766 5644 5618 5407 5206 2943 2923 2660 2493 1369 703 12675 ----
NM_005238chr1173544 2917 2909 2838 1069 1030 803 1274 22190 1363 --
NM_005241chr33942 256 223 1148 ----
NM_005242chr521427 1208 21486 1087 11452 --
NM_005249chr142803 251 ------
NM_005254chr1551115 912 882 307 25 ------
NM_005256chr111772 ------
NM_005257chr1851209 1047 572 542 109 11320 ----
NM_005264chr103875 862 362 ------
NM_005277chr441794 1396 402 308 ----1123
NM_005281chr111014 ------
NM_005302chr74411 376 141 40 --1346 --
NM_005311chr752673 2366 2297 319 283 --12386 --
NM_005324chr1741988 343 269 150 --21969 66 --
NM_005327chr41150 ------
NM_005339chr464265 3111 2891 1515 973 463 23404 2800 13534 --
NM_005359chr1866502 2041 1813 1335 1043 377 --46468 5934 1200 1053 36237 1915 1782
NM_005375chr6149 1292 ----
NM_005378chr2148 ------
NM_005382chr8157 ------
NM_005386chr201641 ------
NM_005387chr112524 272 1686 ----
NM_005388chr931439 1430 85 --11734 1188
NM_005391chrX137 ------
NM_005392chr931798 502 310 ------
NM_005397chr743118 1039 1008 475 12614 23389 338 --
NM_005410chr54633 554 213 137 ------
NM_005412chr121526 --1416 --
NM_005413chr2--1448 ----
NM_005426chr12914 733 ------
NM_005433chr1831989 1101 762 1707 ----
NM_005436chr1093846 3008 2503 838 815 699 646 487 329 23697 99 33430 2972 1256 --
NM_005437chr103523 210 62 ------
NM_005439chr122527 214 ------
NM_005455chr131757 1313 557 ------
NM_005458chr942260 2140 1950 373 1618 11527 --
NM_005487chr2221731 359 ----1547
NM_005493chr63643 161 73 ------
NM_005497chr1795778 5138 4236 3817 1460 1111 913 461 68 14014 23765 2318 15482
NM_005502chr962730 2255 2039 977 620 25 --11076 --
NM_005503chr151153 ----11055
NM_005504chr12126478 6330 6264 6080 5443 5185 4647 4490 1447 820 276 143 --15684 25988 4744
NM_005509chr511256 ------
NM_005517chr12281 39 1945 11042 --
NM_005520chr5--1698 1721 1226
NM_005537chr132263 149 ------
NM_005539chr1031271 1184 1141 ------
NM_005542chr72505 302 1180 21821 1319 --
NM_005544chr21950 ------
NM_005546chr552047 1964 1880 1629 844 ------
NM_005562chr12400 380 11524 ----
NM_005565chr51384 ------
NM_005570chr1821217 132 11208 ----
NM_005578chr3105097 4895 4746 4460 3879 1803 1789 849 437 326 ------
NM_005587chr152796 402 ------
NM_005596chr976343 5552 5018 4385 2318 588 417 46335 5345 2561 2300 14504 12572
NM_005602chr321224 1072 --1902 --
NM_005604chr641890 994 825 798 ----11930
NM_005610chr11276 --124 164
NM_005622chr16--1120 ----
NM_005625chr841050 442 292 238 ------
NM_005626chr12542 72 ------
NM_005637chr1841998 268 201 131 --12098 --
NM_005638chrX3702 620 66 ------
NM_005639chr1231465 763 719 11354 ----
NM_005647chrX83255 3052 2607 2520 2261 1140 1083 97 22404 976 ----
NM_005650chr2211154 ------
NM_005655chr83532 361 156 1898 --11282
NM_005669chr532060 1639 618 21903 948 ----
NM_005685chr71110 ------
NM_005719chr12----1183 --
NM_005721chr23908 187 103 ------
NM_005722chr251995 1865 1545 672 610 ----1760
NM_005733chr51204 ------
NM_005734chr112758 686 ----1231
NM_005737chr272552 2444 2186 1984 1829 1783 732 1206 --22680 184
NM_005738chr741642 1426 534 51 12073 ----
NM_005742chr22640 602 ------
NM_005746chr742222 1902 772 441 1941 --1415
NM_005749chr171259 ------
NM_005751chr71498 --131 --
NM_005754chr51819 ------
NM_005756chrX31452 356 201 11480 ----
NM_005759chr254262 3714 1121 701 525 14561 11474 --
NM_005765chrX1250 ------
NM_005767chr132271 219 2334 277 ----
NM_005786chr18--21303 1086 ----
NM_005796chr161348 ------
NM_005797chr113311 83 28 11398 ----
NM_005798chr13145250 4917 4840 4555 4135 4071 3637 3551 3369 1730 1040 981 465 327 34768 3225 1802 ----
NM_005802chr92762 132 ------
NM_005808chr373569 3284 3162 3063 935 719 601 ------
NM_005822chr661948 1869 1691 888 765 409 ------
NM_005828chr1774971 4415 3919 1815 1435 1374 868 ------
NM_005832chr321418 1202 ------
NM_005839chr14919 902 641 354 ------
NM_005840chrX67489 5008 4671 2898 1709 1622 26257 5974 --16761
NM_005842chr131530 ------
NM_005857chr131104 450 156 --11415 --
NM_005859chr541144 595 468 192 ------
NM_005862chr31105 ------
NM_005863chr1031419 953 306 ------
NM_005868chr792476 2029 1994 1652 704 681 502 233 44 21787 687 ----
NM_005880chr162293 52 ------
NM_005882chr41826 --1331 --
NM_005888chr121183 1406 ----
NM_005898chr1152409 1185 1062 800 343 --1323 --
NM_005899chr1721221 237 --11315 --
NM_005901chr1898323 7545 6652 5668 2794 2204 1384 1107 905 56053 5993 3076 3046 931 28576 6140 17631
NM_005902chr1544107 3951 3278 3187 --24160 3589 1260
NM_005903chr585040 3396 1959 1759 1309 1282 1240 188 24825 3795 44882 3978 906 638 --
NM_005909chr553853 2938 1309 1216 290 --23839 954 --
NM_005910chr1774005 3881 3467 3326 3159 2545 967 14110 ----
NM_005924chr7--2958 147 ----
NM_005930chr14178 1151 ----
NM_005935chr494968 4487 4248 3527 1880 1252 690 464 438 --24146 580 --
NM_005941chr853409 2935 2569 1685 1428 11171 11504 --
NM_005944chr34950 307 226 29 ------
NM_005955chr155129 4126 4112 2151 1846 --22195 1099 21122 855
NM_005962chr1042086 1551 1531 281 ------
NM_005962chr1042086 1551 1531 281 ------
NM_005964chr1721478 1027 ------
NM_005966chr232362 2228 584 1822 ----
NM_005977chr13178 ------
NM_005989chr731634 1092 157 --1485 --
NM_006007chr934307 3609 3020 11298 13053 --
NM_006012chr19----1169 --
NM_006016chr672164 1680 1479 1461 700 223 33 22309 925 ----
NM_006033chr1852213 2146 1750 1601 582 ------
NM_006036chr242491 2438 2268 1764 ------
NM_006037chr284217 4058 3695 3468 1532 1291 708 635 ------
NM_006038chr2052161 2108 702 558 451 --11631 --
NM_006039chr1711061 ------
NM_006047chr2093451 2757 2693 2386 1313 877 684 228 47 12791 12943 --
NM_006048chr12379 369 ----1821
NM_006055chr282938 2709 2090 918 886 453 381 115 13204 ----
NM_006060chr763565 2980 2698 1782 714 171 ----11141
NM_006089chrX1345 11236 ----
NM_006090chr11253 ------
NM_006095chr463515 3001 1072 796 775 632 23662 3427 11562 1653
NM_006106chr1142878 1234 595 500 1445 12969 --
NM_006113chr162163 1575 779 745 528 193 ------
NM_006135chr1--1352 11001 176
NM_006139chr242562 2303 838 142 --1260 --
NM_006141chr1672800 2721 2580 2421 1034 233 149 --11723 --
NM_006148chr1752963 2932 2626 1875 115 --1638 --
NM_006152chr12133 ------
NM_006154chr1552963 2838 2427 652 262 2301 62 12119 --
NM_006157chr11157 1398 ----
NM_006159chr12----188 --
NM_006162chr1821104 90 ------
NM_006166chr1252444 2213 805 187 163 ------
NM_006167chr81299 --22376 686 --
NM_006178chr1731450 1284 250 21118 422 31414 1097 655 --
NM_006183chr12235 29 --1133 --
NM_006186chr211238 ------
NM_006195chr921330 424 ------
NM_006196chr2176 ------
NM_006203chr5124408 3868 3838 3799 1929 1836 1547 960 816 788 779 298 --25140 4231 --
NM_006206chr421978 710 --12530 --
NM_006207chr81213 ------
NM_006209chr81336 1171 ----
NM_006212chr154968 4621 3579 1520 565 35317 4106 1418 --13289
NM_006224chr1732118 1698 550 22414 383 1701 1374
NM_006232chr31219 ------
NM_006237chr1332255 1912 160 ------
NM_006241chr372399 2023 1830 1618 484 385 51 21701 90 ----
NM_006251chr573004 2850 2664 2437 1162 595 262 23356 149 22712 410 --
NM_006252chr186754 6387 5731 5668 5250 4873 4821 1620 26598 5960 15680 --
NM_006258chr1021431 550 11526 ----
NM_006265chr841429 1115 320 247 ------
NM_006267chr231784 1692 1548 11466 11731 --
NM_006275chr2072452 2324 1893 730 440 221 129 ------
NM_006277chr2--1590 ----
NM_006282chr2054565 4188 988 626 61 14554 --11884
NM_006283chr864208 3674 3661 3641 1879 378 --23513 1775 1287
NM_006287chr242448 1962 622 65 11905 ----
NM_006307chrX1244 ------
NM_006315chr464074 3933 3886 1581 868 672 23676 555 1945 --
NM_006333chr21483 1435 ----
NM_006345chr43994 893 374 --1530 --
NM_006353chr64879 374 97 37 --1981 --
NM_006359chrX42460 2205 655 47 1758 126 --
NM_006366chr63969 231 195 --21273 212 --
NM_006367chr13849 750 712 --11030 --
NM_006371chr3124992 4651 4313 4121 4064 4006 3382 3281 1495 849 651 438 21555 743 34634 2091 915 --
NM_006372chr61180 ------
NM_006375chrX21575 361 11440 2562 372 168
NM_006379chr73282 175 113 --1383 12140
NM_006380chr1773237 2919 1436 1247 812 650 377 ------
NM_006390chr1221772 1350 --21665 638 --
NM_006393chr1094539 4390 4125 3850 1539 1362 1102 1046 845 --21750 1377 --
NM_006403chr621736 1505 1518 ----
NM_006420chr2022837 381 --42782 2376 2257 578 --
NM_006421chr8188 ------
NM_006431chr12--1195 ----
NM_006451chr51720 ----152
NM_006457chr473926 3273 1473 1151 999 537 166 13434 ----
NM_006459chr101489 ------
NM_006464chr2114298 4008 3278 3010 1869 1788 1574 818 686 110 74 --34228 3803 280 --
NM_006482chr1253681 3169 3078 2577 907 21563 1196 23646 2529 --
NM_006489chr1411871 11684 ----
NM_006496chr121715 221 --11618 --
NM_006504chr1032560 2513 594 ------
NM_006517chrX41727 1681 873 608 --1515 --
NM_006526chr2041747 777 553 119 12095 ----
NM_006529chr431130 572 346 --1236 --
NM_006534chr2083404 2988 2337 1132 1083 826 638 496 33382 3275 3150 ----
NM_006537chr151207 ----1141
NM_006544chr1444475 3843 2267 2083 11113 15074 14987
NM_006546chr1775977 2614 2577 2533 2015 1714 699 12569 14421 --
NM_006547chr751883 1863 1804 1758 1493 21659 350 ----
NM_006549chr1262488 2256 2127 1942 452 345 1840 1315 --
NM_006557chr911619 ------
NM_006559chr14972 410 173 51 ------
NM_006560chr112366 359 ------
NM_006561chr10126253 6225 6133 5339 4093 2401 2135 1490 1472 976 572 493 26234 4131 15288 --
NM_006565chr1651087 1023 904 826 91 ----1166
NM_006572chr1762559 2535 881 233 182 164 13104 ----
NM_006574chr31283 --1254 --
NM_006582chr1136 ------
NM_006593chr2----1165 --
NM_006595chr1131435 429 280 --11851 --
NM_006599chr1698100 6333 5751 2891 2879 2432 917 643 419 46620 5161 1269 585 37769 1488 459 17322
NM_006603chrX61943 1851 1709 1692 1259 258 ------
NM_006609chr211147 ------
NM_006614chr393554 3536 2999 2695 2546 2417 2324 399 312 --1407 --
NM_006620chr644587 4262 1574 1393 21123 714 33753 3640 1107 --
NM_006621chr141991 555 260 101 ------
NM_006625chr11933 21099 900 --11152
NM_006625chr11933 21099 900 --11152
NM_006625chr11933 21099 900 --11152
NM_006628chr15104320 3416 3359 3311 2915 1821 1032 591 383 314 13742 --23424 1679
NM_006633chr51643 1248 1111 1575
NM_006642chr12283 230 132 ----
NM_006654chr1264607 3447 490 482 334 279 --14242 --
NM_006667chrX31148 432 82 1420 ----
NM_006675chr1263384 2996 2930 620 603 580 12425 ----
NM_006682chr7--22566 677 ----
NM_006698chr2021197 987 ------
NM_006703chr62524 363 ------
NM_006708chr62950 51 --21129 530 --
NM_006717chr932143 2107 1157 --12830 12313
NM_006720chr1064806 4056 3165 1805 1289 503 1651 2860 478 13293
NM_006721chr101318 ------
NM_006722chr352696 2222 923 879 330 --1352 --
NM_006729chrX95624 4861 4837 3694 1876 1836 1494 1389 470 ----24707 716
NM_006750chr16137118 6457 5746 5482 5173 4945 2301 2062 1460 1316 1206 694 661 1230 ----
NM_006751chr241035 766 681 328 ------
NM_006756chr821015 532 ------
NM_006759chr21117 --1311 --
NM_006763chr11605 --1798 --
NM_006764chr31406 ------
NM_006766chr822125 1753 --32543 2299 1039 --
NM_006772chr61516 --1396 --
NM_006775chr632497 2232 1058 12202 1501 --
NM_006777chrX62883 2798 2632 821 659 625 12957 ----
NM_006808chr92141 75 ------
NM_006815chr1221096 500 11338 11273 --
NM_006818chr11330 --1953 --
NM_006820chr144270 3943 3081 1004 ------
NM_006826chr241032 889 320 167 ------
NM_006832chr142892 875 3789 284 276 --1381
NM_006838chr1241602 1481 1304 567 3756 721 269 ----
NM_006851chr1242825 443 298 52 --12239 --
NM_006852chr1732386 497 257 12799 ----
NM_006854chr761579 1418 1335 1284 590 132 ------
NM_006870chr20--1236 ----
NM_006873chr2103483 3429 3182 2837 2770 2539 468 316 299 93 11318 ----
NM_006885chr1663260 3073 2955 1336 818 463 11627 1181 --
NM_006888chr1463142 2808 2627 2230 774 749 11286 ----
NM_006908chr7--11503 1592 --
NM_006910chr162349 143 126 ----
NM_006913chr62299 291 1361 ----
NM_006914chr91962 1593 --1540
NM_006915chrX22278 912 --22564 847 --
NM_006916chr22247 129 --1440 --
NM_006918chr1132346 835 493 25667 692 15400 --
NM_006920chr231793 445 175 --1305 --
NM_006924chr1734040 3005 878 14116 ----
NM_006939chr141412 --1812 --
NM_006940chr1211429 --21290 385 --
NM_006947chr431185 351 280 ------
NM_006948chr211191 12365 ----
NM_006951chr102315 74 ------
NM_006979chr63535 486 476 ------
NM_006981chr912784 ------
NM_006996chr151259 258 229 112 68 ------
NM_006997chr102407 141 ------
NM_006999chr532079 1391 496 ------
NM_007005chr9--1436 11183 --
NM_007007chr1274750 3477 1806 1703 653 633 88 33746 3571 1362 24550 719 1231
NM_007011chr15116571 6533 6284 5821 5394 2529 2523 2426 2198 1885 1706 --1508 --
NM_007017chr52807 642 --1607 --
NM_007033chr13747 471 134 --1855 --
NM_007038chr2175291 5242 4975 3701 1847 1511 1338 11102 56065 5390 4806 4680 3758 --
NM_007040chr1931016 792 332 ------
NM_007043chr1232033 1304 231 ------
NM_007054chr552980 2869 1179 1066 202 ------
NM_007106chr1341036 591 558 191 ------
NM_007107chr341496 675 511 26 22372 729 1894 --
NM_007111chr133763 592 558 ------
NM_007114chr362646 1210 785 754 722 511 33264 3057 592 --22903 996
NM_007125chrY21298 264 ----21276 1072
NM_007126chr9--1451 ----
NM_007129chr131112 ------
NM_007137chrX33865 1258 792 11107 45042 4968 4526 812 13981
NM_007146chr1752839 2366 1917 711 403 ------
NM_007158chr121242 997 1838 ----
NM_007159chr331493 1316 374 11757 2650 191 --
NM_007166chr1131464 634 248 1221 ----
NM_007172chr2233030 2697 665 22338 2320 22027 280 --
NM_007173chr1162261 1904 1898 320 260 167 ------
NM_007175chr853148 3101 2808 353 216 31410 1016 289 2993 719 --
NM_007178chr122427 340 ------
NM_007184chr31538 ------
NM_007195chr1833207 2554 491 ----12481
NM_007203chr963946 3782 3378 2713 1401 229 12594 ----
NM_007212chr131800 1760 407 ------
NM_007222chr851859 1426 1405 703 412 2496 56 11438 --
NM_007231chrX21721 866 --42133 917 123 40 --
NM_007241chr171236 ------
NM_007249chr13188757 8642 8162 7048 6538 6139 3573 3354 3171 3137 3111 3008 2021 2002 1776 1656 1380 1231 38447 6769 3767 19126 --
NM_007271chr611831 1631 11693 1566
NM_007276chr7--168 ----
NM_007281chr4138 ------
NM_007282chr3163 ----1853
NM_007287chr332217 116 106 ------
NM_007288chr332217 116 106 ------
NM_007289chr332217 116 106 ------
NM_007292chr1784998 3259 1973 1719 1045 918 284 246 45059 4147 1262 453 ----
NM_007315chr231497 1267 54 ------
NM_007331chr42755 487 11957 --12478
NM_007345chr1851895 1455 923 889 268 11633 1325 --
NM_007347chr1582214 2077 1952 1234 844 777 429 141 1257 ----
NM_007358chr1111728 1651 1402 1335 1310 621 548 339 332 77 38 11895 ----
NM_007372chr173843 796 787 --1852 --
NM_009588chr61558 ------
NM_012081chr542835 1203 582 320 22902 1257 ----
NM_012082chr81399 ------
NM_012089chr1----11423 --
NM_012090chr131211 1092 382 --1522 --
NM_012096chr313761 1162 23515 3429 --
NM_012097chr222132 222 3782 504 105 ----
NM_012102chr162024 1962 655 523 310 289 --12605 --
NM_012105chr211168 ------
NM_012110chr41251 ------
NM_012115chr62196 145 ------
NM_012120chr642740 2670 958 68 12676 ----
NM_012129chr782194 2102 1811 1804 1788 942 907 796 --1545 --
NM_012137chr162896 2761 2498 2248 668 259 ------
NM_012141chr1373567 3390 3111 2935 2634 1081 767 ------
NM_012153chr1172472 2425 2383 2062 1763 599 429 1385 22335 258 --
NM_012154chr81120 ------
NM_012157chr31383 --1880 --
NM_012158chr1311147 11342 21487 1395 --
NM_012164chr9116766 5928 5880 5495 5236 5161 2308 2190 1576 225 29 27565 4955 25868 840 15080
NM_012174chr121771 ------
NM_012177chr6----185 --
NM_012180chr43627 565 509 1711 ----
NM_012193chr11104951 4573 4028 3831 3569 1964 1083 935 814 178 24607 869 15147 --
NM_012197chr931227 346 74 --183 --
NM_012199chr174410 3320 2948 1368 1143 935 311 14136 14681 --
NM_012215chr1041819 1782 1294 470 --11481 --
NM_012223chr211004 ------
NM_012234chr353294 2953 2368 1200 222 ------
NM_012242chr101183 ------
NM_012247chr101393 --1885 --
NM_012248chr162565 133 --1693 --
NM_012249chr233592 3018 328 11154 12995 --
NM_012250chr1121290 1236 ------
NM_012252chr775129 4943 4693 3817 3641 1515 993 34284 3273 91 ----
NM_012255chr201330 ------
NM_012257chr72998 940 1143 ----
NM_012259chr611079 ------
NM_012262chr1165065 5047 4911 4868 4640 4632 4209 3925 3721 3424 3286 2021 1994 1211 816 584 ----13394
NM_012281chr721870 227 12161 --12236
NM_012286chrX----1513 --
NM_012287chr363742 3657 3378 335 306 117 1527 ----
NM_012293chr231708 713 331 --11526 12034
NM_012294chr733227 820 676 ------
NM_012296chr1113260 --1219 13600
NM_012300chr582511 2440 2175 1774 1707 1571 512 59 --11757 11930
NM_012308chr1132567 2123 1027 ----11892
NM_012309chr1194942 4519 4411 3205 3178 3061 3053 1743 509 --14544 11812
NM_012316chr155512 5363 4938 4435 932 14202 21750 373 --
NM_012325chr2021484 1369 ------
NM_012328chr72367 99 --1422 --
NM_012329chr1731445 307 109 --11403 --
NM_012330chr1021395 1385 ------
NM_012338chr72500 252 1360 ----
NM_012339chr10----1550 --
NM_012382chr5104354 4293 4275 3632 3338 2938 2910 771 612 594 1193 1382 11079
NM_012388chr1563138 2615 2067 995 402 375 --1814 1653
NM_012399chr2211493 --11564 --
NM_012416chr91874 ------
NM_012428chr151689 1896 ----
NM_012433chr22209 61 ------
NM_012434chr641493 1227 530 273 --11403 11533
NM_012446chr51179 ------
NM_012464chr41435 11988 1507 --
NM_012479chr742640 2403 1747 759 11993 ----
NM_012482chr11179 --1156 --
NM_013229chr1212786 ----12161
NM_013230chrY41785 353 279 168 --1294 --
NM_013231chr14104259 4232 3869 3470 2946 1389 1078 742 662 533 23690 1008 1313 --
NM_013233chr21960 ------
NM_013236chr2231217 443 334 1798 ----
NM_013261chr433567 2428 2420 --13735 --
NM_013269chr121426 --13920 --
NM_013277chr1231030 370 279 1315 ----
NM_013281chr2021257 318 ------
NM_013293chr7----1574 --
NM_013309chr1532422 2096 241 31893 773 703 ----
NM_013322chr711384 21449 275 ----
NM_013328chr1125 ------
NM_013341chr24892 697 221 51 --1339 --
NM_013372chr1553321 2818 826 512 324 22193 86 12784 --
NM_013374chr322171 402 ------
NM_013377chr122105 30 ------
NM_013396chr211237 ------
NM_013436chr2--1183 ----
NM_013437chr821409 291 --31272 1069 113 --
NM_013438chr911427 --1410 --
NM_013444chrX21123 1031 --1367 --
NM_013446chr711123 ------
NM_013450chr21104 ----1210
NM_013937chr631159 754 411 ------
NM_013943chr142740 2469 2164 906 1918 12215 --
NM_013989chr1473779 3320 3255 3107 1938 1267 910 23638 97 14249 --
NM_013993chr61726 ------
NM_013994chr61726 ------
NM_013996chr72480 446 ------
NM_013996chr72480 446 ------
NM_013997chr72480 446 ------
NM_013997chr72480 446 ------
NM_013998chr72480 446 ------
NM_013998chr72480 446 ------
NM_014011chr231751 822 365 11602 1750 12488
NM_014033chr1272294 2151 1783 1656 922 705 540 ------
NM_014043chr32429 248 ------
NM_014048chr1654148 3647 3238 1580 761 12049 34033 808 608 --
NM_014089chr1341875 1710 1589 522 --12018 --
NM_014106chr1562823 2064 804 469 390 211 1426 ----
NM_014109chr81510 11032 ----
NM_014112chr865324 5283 3872 2138 1982 1338 --1790 --
NM_014117chr1672436 2318 2142 1005 563 439 187 ------
NM_014141chr775137 4699 3768 2078 1168 896 710 14646 14398 --
NM_014153chr162643 214 ------
NM_014154chr361063 596 437 383 57 30 21478 1170 --1366
NM_014155chr11147540 7136 7007 6959 6769 6670 6662 6197 5992 5040 1975 1304 830 433 1526 22075 283 --
NM_014159chr31183 1584 ----
NM_014178chr142463 22 ------
NM_014181chr282259 1919 1904 958 934 854 447 251 1885 22578 258 --
NM_014211chr551576 1484 1126 296 110 --21666 1338 21172 1107
NM_014212chr12--1280 ----
NM_014243chr441684 1531 1315 316 ------
NM_014250chr2221731 359 ----1547
NM_014253chrX42351 2191 858 609 ------
NM_014263chr1021494 296 ------
NM_014264chr42215 52 --168 --
NM_014283chr131410 1117 427 ----11294
NM_014286chr942481 856 598 569 --22582 2357 13016
NM_014294chr82281 110 ------
NM_014319chr1271542 1277 1226 570 441 259 59 ----11669
NM_014323chr22----2666 373 --
NM_014325chr1211564 22081 1878 1258 1203
NM_014330chr19182 ------
NM_014331chr477157 6361 5565 5427 5409 2987 2414 35679 2590 2130 36526 2953 2484 11360
NM_014333chr1121086 681 22313 1822 ----
NM_014342chr11171 --1300 --
NM_014344chr111792 ------
NM_014350chr5123 4374 145 61 35 ----
NM_014352chr1131543 1375 178 ------
NM_014368chr911801 ------
NM_014372chr122086 22 ----11370
NM_014376chr542518 2219 2202 1829 ------
NM_014382chr361790 1730 1647 599 222 214 1205 11616 --
NM_014390chr7----1426 --
NM_014393chr842305 1562 854 411 22330 1962 21846 1815 --
NM_014415chr371492 1406 1185 1146 530 389 80 1539 --1431
NM_014417chr191938 ------
NM_014421chr442088 833 783 523 --21625 307 --
NM_014423chr5105164 5140 4501 3719 3412 2121 2112 734 670 29 23847 1608 15279 --
NM_014432chr631580 1379 162 ------
NM_014445chr352125 2020 1975 1718 116 32436 1916 707 ----
NM_014447chr451526 1478 1151 378 111 ------
NM_014454chr61177 2965 367 ----
NM_014463chr31147 ------
NM_014487chr42604 260 1529 ----
NM_014494chr1652217 2123 1973 1638 1573 32408 847 565 31901 1546 661 --
NM_014497chr22174 52 ------
NM_014520chr174491 429 128 82 ----1386
NM_014570chr222274 137 --1192 --
NM_014572chr1331660 620 571 --1627 11413
NM_014575chr31138 ------
NM_014577chr223722 666 88 ------
NM_014588chr203698 295 102 --1717 --
NM_014606chr42969 491 1416 182 --
NM_014607chr21607 148 31788 1631 717 --
NM_014612chr94984 600 454 410 ------
NM_014614chr241464 910 180 73 --11051 --
NM_014616chr343401 2604 1407 1202 --12253 --
NM_014629chr821347 545 11261 21308 48 --
NM_014630chr1553689 2465 1229 1178 227 ------
NM_014636chr943925 1628 797 25 13216 11290 --
NM_014644chr11987 ------
NM_014647chr1651910 1472 846 564 117 --2630 575 --
NM_014659chr152145 27 1870 ----
NM_014660chr7--11059 165 --
NM_014666chr52527 377 11084 ----
NM_014669chr161153 ------
NM_014672chr141138 ------
NM_014673chr8--1309 ----
NM_014676chr111315 ------
NM_014679chr1111214 --1307 --
NM_014680chr17--1588 ----
NM_014682chr832043 555 519 ------
NM_014701chr1532934 2805 901 23198 1152 22529 1298 --
NM_014702chr663500 3271 3237 756 380 174 12538 22899 2421 --
NM_014705chr721909 1622 ------
NM_014707chr761957 1794 383 331 68 40 ------
NM_014711chr1611585 2840 487 21312 383 --
NM_014712chr161623 ------
NM_014717chr191619 ------
NM_014720chr1031147 464 226 11542 31560 557 236 11533
NM_014729chr872166 2000 1933 1865 643 506 385 --1621 --
NM_014730chr1285186 4937 3375 1139 753 729 703 220 --34388 4302 1827 --
NM_014730chr1285186 4937 3375 1139 753 729 703 220 --34388 4302 1827 --
NM_014733chr53847 337 105 11905 ----
NM_014735chrX2401 339 ------
NM_014737chr2054091 3778 3393 1637 222 24217 2709 ----
NM_014739chr694192 3933 3617 2874 1684 1129 921 475 62 24147 3644 11534 --
NM_014743chr442350 2326 1953 496 --32161 646 458 --
NM_014746chr294307 4188 3985 1634 1507 1260 792 343 47 12989 34412 2811 145 --
NM_014751chr82758 252 ------
NM_014752chr112628 484 --152 --
NM_014764chr1221099 1038 ------
NM_014765chr152550 1917 1670 1659 939 2892 301 ----
NM_014774chr143222 2994 2709 208 22347 526 12427 --
NM_014781chr841322 944 155 45 ----1303
NM_014782chrX2343 43 ------
NM_014787chr172479 2209 1063 755 663 617 598 12328 1445 --
NM_014791chr92251 79 ------
NM_014802chr1261059 730 709 409 283 127 1788 ----
NM_014803chr1062958 2588 2450 1049 673 318 1236 32559 916 656 --
NM_014810chr122935 2478 43706 1239 923 296 ----
NM_014812chr11254 ----1569
NM_014819chr541641 460 339 312 12012 11651 12229
NM_014820chr381839 1734 779 461 397 305 297 166 ------
NM_014822chr4194 ------
NM_014826chr174025 3859 2658 1706 1370 430 230 1630 13290 --
NM_014829chr542314 1864 834 114 11790 ----
NM_014832chr1341969 1734 1594 706 --12019 --
NM_014836chr1031946 1456 439 ------
NM_014848chr1562696 2219 2031 971 179 121 ------
NM_014850chr3104667 4618 4238 4137 3405 3252 1821 1187 287 39 11694 169 --
NM_014862chr15114223 3868 3420 3250 3050 3001 2668 1559 1350 653 405 --12984 --
NM_014873chr154907 4790 4417 4267 676 13420 --11044
NM_014877chr1797181 7094 6005 5322 5301 5057 4994 2060 898 26706 2536 27550 1738 --
NM_014878chr9133 ------
NM_014892chr61159 --2545 493 --
NM_014893chrY3947 280 112 ----12375
NM_014897chr17113106 2891 2564 2398 2089 2052 1243 965 939 710 249 ------
NM_014900chr22294 253 1473 1136 1328
NM_014904chr1051275 1248 986 596 367 24056 1198 ----
NM_014905chr241901 1850 1561 514 1286 21883 409 --
NM_014906chr1723685 2571 --1970 --
NM_014912chr1083525 3061 1207 624 573 341 277 222 12287 1784 --
NM_014913chr182524 206 1383 ----
NM_014916chr71584 ------
NM_014918chr152374 227 ------
NM_014920chr663641 3046 569 489 331 181 ------
NM_014923chr1342001 1731 1445 787 ----11870
NM_014924chr1462404 2091 1116 535 422 299 22884 2655 ----
NM_014926chr321130 1090 1409 1448 --
NM_014932chr32643 69 --21508 1298 --
NM_014937chr1041334 1236 845 30 1497 1444 --
NM_014942chr632641 2614 1646 --1737 12166
NM_014946chr232833 1916 457 22586 2440 ----
NM_014947chr152933 2420 2371 1077 304 --32347 2216 245 --
NM_014982chr1474955 4425 4286 3794 3282 1589 418 31900 1225 457 13772 --
NM_014988chr422601 2491 12271 --12464
NM_014991chr432969 2104 398 ------
NM_014997chr752007 1103 987 857 603 22782 2556 1646 --
NM_015000chr1232610 2239 778 32775 2594 2069 1321 --
NM_015008chr383396 3210 2895 2543 2477 1429 527 234 22735 1114 1318 --
NM_015020chr163777 764 376 11028 13568 --
NM_015025chr262377 1091 796 432 344 140 12567 1585 --
NM_015026chr12104833 4548 4366 4269 1284 1005 947 833 776 768 14082 --1282
NM_015032chr1362786 2716 2106 680 363 289 ------
NM_015040chr262187 2166 2140 1249 1082 130 43054 2792 554 494 12806 --
NM_015042chr1594310 4130 3930 3799 1678 1596 1464 1405 1137 23812 53 23884 2966 --
NM_015044chr16103158 3143 3019 2706 2612 2322 2212 960 948 611 1141 ----
NM_015045chr1031752 1417 145 22040 1851 ----
NM_015047chr13411 362 337 ------
NM_015049chr243256 2883 2688 82 1486 ----
NM_015052chr751271 1025 1007 114 98 ------
NM_015054chr122380 140 ------
NM_015056chr2142438 257 169 90 ----11700
NM_015061chr91856 ------
NM_015068chr7103728 2886 2738 2528 1473 861 819 453 413 69 22665 1150 ----
NM_015069chr163553 465 123 ----1618
NM_015070chr1321457 579 11502 --11551
NM_015071chr5116546 6530 6473 6345 4839 4661 4127 2431 1504 1310 105 --11703 --
NM_015072chr141604 ------
NM_015073chr1922011 1890 ------
NM_015074chr1144630 4507 4228 3853 3812 3535 1768 1392 1086 756 745 353 86 73 13769 11858 2494 109
NM_015076chr664555 4471 2838 1349 1234 1107 2430 176 1236 --
NM_015077chr1754398 1886 1610 816 658 --23774 33 --
NM_015082chr522564 520 1204 ----
NM_015087chr1322603 724 2619 418 ----
NM_015090chr166234 4669 4479 2336 863 232 --11795 --
NM_015092chr1644549 2979 1525 861 1931 24500 343 --
NM_015093chr621554 1229 --1669 11825
NM_015097chr311459 11926 --11988
NM_015101chr172201 2166 2143 2134 2068 741 503 --22442 1999 --
NM_015107chrX61776 843 837 831 825 652 ----12469
NM_015110chr942250 2205 1782 931 ------
NM_015115chr453129 2677 2386 815 248 --1928 --
NM_015125chr191499 ------
NM_015130chr431338 1161 116 ------
NM_015132chr741725 764 442 208 --11869 --
NM_015137chr842029 886 794 30 --31950 989 475 --
NM_015138chr1562820 2523 2436 2145 1018 748 175 ----
NM_015143chr4--11346 --1533
NM_015144chr1673894 3399 2946 2816 907 464 231 --33424 3144 838 --
NM_015149chr13881 526 67 ------
NM_015151chr211360 ------
NM_015155chr1041315 687 317 249 --22730 2558 --
NM_015156chr1431615 1130 267 2619 602 13132 --
NM_015163chr1422014 723 11826 11921 1354
NM_015172chr11550 ------
NM_015185chrX3392 275 261 --12884 --
NM_015187chr41280 ------
NM_015191chr1142649 1998 1894 855 ----11808
NM_015192chr2022837 603 12208 1525 --
NM_015200chr44803 706 676 643 ------
NM_015206chr1573822 3177 2512 1203 1001 837 823 --1430 --
NM_015208chr1833815 3652 2490 --13507 2861 762
NM_015209chr122082 904 22210 2142 ----
NM_015216chr511243 11132 11043 --
NM_015236chr41596 --11312 --
NM_015245chr632616 2571 941 --2920 253 --
NM_015247chr1654814 1255 1202 639 492 15325 33851 1692 671 --
NM_015251chr1632368 2070 99 32310 2104 557 --1744
NM_015252chr21272 182 ----
NM_015256chr52574 110 ----1675
NM_015263chr151347 ------
NM_015265chr272199 834 663 641 599 561 114 --11040 --
NM_015269chr11602 1148 ----
NM_015271chr443741 3115 2784 993 2254 163 32755 1625 1352 --
NM_015277chr1821391 752 1380 11247 --
NM_015278chr652848 1358 1241 954 891 23152 743 ----
NM_015285chr1842336 535 340 23 --12389 --
NM_015286chr1582461 2035 1883 1834 1811 1639 529 310 ------
NM_015291chr163469 2692 2162 780 675 551 --23151 1410 --
NM_015294chr1731114 807 24 ----1853
NM_015296chr131124 ------
NM_015308chr113597 290 197 ------
NM_015310chr8137741 7293 6479 6099 5616 5594 5298 2976 2575 1933 1504 195 177 --42121 1421 1171 249 --
NM_015313chr11134710 4257 4061 3991 3013 2934 1642 1455 1302 1267 639 351 23 14539 13968 --
NM_015323chr631666 589 222 ------
NM_015326chr132839 2704 1895 --12423 --
NM_015335chr1251676 550 297 181 130 --2639 229 --
NM_015336chr121511 ------
NM_015344chr852088 1755 1708 293 215 --11787 --
NM_015347chr1242242 2121 2001 735 1768 ----
NM_015349chr652810 2683 2469 2054 190 ------
NM_015355chr1762005 1760 1561 1459 1365 127 --11426 --
NM_015365chrX44189 1190 544 219 --23626 3549 12836
NM_015375chr184819 3950 3906 3226 1678 704 388 274 13913 ----
NM_015387chr241899 1817 1618 1525 11872 --1785
NM_015393chr453665 3480 2491 1339 216 11462 11274 --
NM_015397chr971927 1806 1354 1259 304 237 67 11192 ----
NM_015432chr162527 87 ----1632
NM_015435chr82929 69 ------
NM_015443chr171600 --21184 445 --
NM_015446chr141327 1321 447 161 1230 ----
NM_015455chr533210 617 109 23009 482 11073 --
NM_015458chr854890 4569 2095 1915 1039 24923 1612 14626 13919
NM_015460chr372064 1687 1628 1608 1478 319 252 --11961 --
NM_015461chr182658 32 1310 ----
NM_015462chr171250 ------
NM_015472chr31350 1433 ----
NM_015472chr31350 1433 ----
NM_015483chr71877 ------
NM_015485chr11344 ------
NM_015488chr2--11805 ----
NM_015514chr142595 460 ------
NM_015516chr11--11447 ----
NM_015525chr62387 285 --1189 --
NM_015535chr264125 4086 3370 3352 275 183 ------
NM_015542chr101400 ------
NM_015548chr61876 ------
NM_015553chr675207 5079 4136 3825 3543 2011 471 14351 24929 1619 --
NM_015554chr1562854 2620 2202 2013 1906 384 --11962 --
NM_015564chr53764 674 640 23507 749 ----
NM_015565chr2122270 1649 1419 --12086
NM_015569chr154534 4024 3227 1694 1466 --22996 524 --
NM_015570chr721366 257 ------
NM_015571chr6146 --199 --
NM_015575chr2113479 3286 2986 2676 2590 2449 1464 1187 799 492 264 12710 2690 295 --
NM_015576chr342795 2537 2503 189 ------
NM_015578chr192801 63 ------
NM_015589chr141139 ------
NM_015602chr131785 1480 341 11614 ----
NM_015607chr11205 ------
NM_015626chr172297 71 1411 ----
NM_015633chr1261186 786 467 291 280 241 ------
NM_015634chr101417 1551 1220 --
NM_015640chr184487 3678 3548 3514 1890 960 899 487 34768 3395 713 --15036
NM_015641chr73965 958 202 21072 1043 ----
NM_015670chr171176 ------
NM_015678chr1341405 1228 1147 553 ------
NM_015695chr621448 1348 11705 12020 --
NM_015716chr171114 ------
NM_015840chr172585 2476 2461 2448 1723 600 322 2999 966 --12695
NM_015841chr172585 2476 2461 2448 1723 600 322 2999 966 --12695
NM_015866chr131339 342 220 ----11173
NM_015878chr862226 2178 2136 1852 1591 1511 1276 21421 424 --
NM_015879chr18148504 8179 7991 6452 6042 5988 5635 5620 5302 3400 2750 1399 1116 672 15366 16098 17811
NM_015885chr11--2843 747 1710 --
NM_015888chr162672 2452 1237 971 590 164 73380 3305 2863 2575 2358 478 417 2743 468 --
NM_015891chr64811 499 216 208 2631 92 ----
NM_015902chr8------1273
NM_015905chr72141 101 ------
NM_015906chr184245 3579 3356 3228 3038 1864 1830 247 11849 13735 --
NM_015912chr822520 765 1322 --1610
NM_015926chr3--1292 ----
NM_015938chr32330 222 ----1961
NM_015939chr201655 ----1451
NM_015984chr11494 --1541 --
NM_015990chr41834 ------
NM_015994chr14381 73 42 1543 ----
NM_015995chr1585434 5136 4909 4038 4018 3990 3737 3605 --21957 1077 --
NM_016002chr12665 184 --1192 --
NM_016009chr154475 3671 3368 546 36 --13259 --
NM_016021chr632905 2062 29 --23046 512 --
NM_016022chr121087 205 --11094 --
NM_016025chr1651973 1484 805 564 507 ----11451
NM_016037chr11276 ------
NM_016041chr171281 ------
NM_016045chr2061655 1484 617 523 339 220 --1144 1677
NM_016048chr53889 723 374 ------
NM_016061chr241604 1030 491 427 --11428 --
NM_016075chr1342323 1023 1014 587 ------
NM_016076chr132785 2571 703 13221 12022 --
NM_016083chr673400 3036 1567 854 831 226 122 22960 2743 ----
NM_016090chr111424 ------
NM_016096chr821734 198 2533 311 ----
NM_016120chrX2419 217 ------
NM_016126chr1127 ------
NM_016131chr231833 168 156 12044 ----
NM_016132chr1533442 2711 2634 1485 22954 421 --
NM_016133chr21180 1224 ----
NM_016141chr32741 249 1594 1775 --
NM_016144chr51770 2595 124 1100 --
NM_016151chr161328 ------
NM_016152chr3--1303 ----
NM_016178chr1170 ------
NM_016206chr3129048 8439 7307 7264 6199 5727 3109 2722 1992 1233 781 299 35810 5767 1244 13098 1973
NM_016217chr662772 2536 2337 1266 1065 777 1793 12791 --
NM_016224chr652171 2161 1522 858 46 --21722 837 --
NM_016227chr131410 1117 427 ----11294
NM_016248chr1393911 3114 2821 2803 2528 1457 549 454 350 ------
NM_016252chr22775 677 ------
NM_016255chr662659 2330 733 231 127 21 189 12918 --
NM_016257chr153464 2947 2349 1091 270 --12672 --
NM_016258chr13645 256 104 --1268 --
NM_016260chr287274 5963 5539 5408 2472 1687 334 232 --26282 5751 15509
NM_016271chr1841476 851 700 391 11509 ----
NM_016272chr2231789 897 642 --1307 21004 221
NM_016275chr352810 2268 608 359 62 1831 --12043
NM_016281chr121265 ------
NM_016282chr951782 1706 706 666 133 ------
NM_016289chr221835 640 1936 12226 --
NM_016297chr263488 3045 2433 695 659 81 ------
NM_016298chr333318 2899 211 23260 782 22973 2563 --
NM_016303chrX1375 ------
NM_016315chr221907 352 --11596 11293
NM_016322chr953048 2343 2005 963 312 1281 12864 --
NM_016328chr71110 ------
NM_016356chr682735 2575 2139 2077 930 665 614 501 21801 1157 ----
NM_016376chr1783706 3590 1198 878 823 454 435 261 24277 2649 14148 11637
NM_016395chr1581897 1800 1728 1368 780 491 429 21 ------
NM_016396chr1562971 2772 2371 1842 985 927 22147 933 ----
NM_016424chr1741972 1461 1382 1291 --11818 --
NM_016427chr18----1160 --
NM_016436chr2072160 1765 1710 636 578 376 113 --11957 --
NM_016441chr2--12224 1110 --
NM_016470chr20--2455 439 1368 --
NM_016507chr1762056 1961 1031 534 499 378 13073 ----
NM_016513chr663641 3046 569 489 331 181 ------
NM_016516chr2177 ------
NM_016530chr1543823 2636 2597 887 33979 3282 758 ----
NM_016531chr433794 2736 29 --12702 --
NM_016545chr13897 821 587 1165 ----
NM_016559chr341325 994 484 44 --21186 947 --
NM_016577chr3104476 4404 3942 3548 3481 3261 2739 1205 1196 1131 11310 121 --
NM_016578chr112207 111 1465 ----
NM_016587chr7--168 ----
NM_016588chr63863 168 97 ------
NM_016598chr311309 --11428 --
NM_016603chr5----1782 --
NM_016604chr541017 938 813 304 ------
NM_016607chrX31642 1415 1367 1316 ----
NM_016620chr121198 1072 ------
NM_016621chr1133473 3205 544 14092 44488 3992 1378 864 --
NM_016622chr222132 1684 1235 1494 --
NM_016623chr82527 76 ------
NM_016626chr1831315 530 90 ------
NM_016627chr17122 ------
NM_016628chr104714 603 305 173 ------
NM_016631chr211737 --1955 --
NM_016640chr5199 1198 ----
NM_016654chr1551115 912 882 307 25 ------
NM_016834chr1774005 3881 3467 3326 3159 2545 967 14110 ----
NM_016835chr1774005 3881 3467 3326 3159 2545 967 14110 ----
NM_016841chr1774005 3881 3467 3326 3159 2545 967 14110 ----
NM_016931chr111275 ------
NM_017415chr584444 4099 3385 1134 1113 134 77 53 --1588 --
NM_017420chr1453521 3511 1439 833 586 --1567 --
NM_017423chr43694 415 352 12103 1157 --
NM_017447chr2151554 1424 826 753 249 --24111 2926 --
NM_017452chr2011465 --11090 --
NM_017453chr2011465 --11090 --
NM_017454chr2011465 --11090 --
NM_017455chr151689 1896 ----
NM_017489chr821154 465 ------
NM_017548chr31837 --1649 --
NM_017553chr1541092 1049 532 75 --1427 --
NM_017583chr11178 ------
NM_017589chr11----1108 --
NM_017599chr1222053 331 --11309 --
NM_017610chr1532092 2070 174 180 ----
NM_017617chr921602 1492 1337 ----
NM_017629chr141540 1332 494 94 ------
NM_017633chr613615 12651 12967 --
NM_017634chr831284 190 171 ------
NM_017637chr9138732 8215 7824 7035 7024 6802 6405 3550 2704 1101 777 246 137 23359 3322 ----
NM_017640chr63936 694 253 --1806 --
NM_017641chr121253 --11124 1395
NM_017643chr1732760 2736 1181 2347 54 ----
NM_017644chr354353 1523 1458 1449 397 --1587 --
NM_017650chr776012 5708 5208 4659 4252 2377 899 15037 11622 --
NM_017655chr15592 547 338 287 159 21623 398 ----
NM_017657chr22717 118 ------
NM_017658chr14104392 4043 3523 1545 1530 1432 1064 1030 376 320 13980 23211 1875 11138
NM_017661chr1511077 --1966 --
NM_017666chrX41938 703 641 271 ------
NM_017680chr9--3681 363 136 ----
NM_017691chr152401 26 ------
NM_017693chr1331604 1375 1301 1515 2346 176 --
NM_017704chr114958 848 802 147 --1214 --
NM_017709chr163337 3166 2775 1618 1334 92 --21426 1089 21547 512
NM_017719chr332497 2468 1877 ------
NM_017737chr162159 1544 1358 467 371 133 ------
NM_017738chr92260 54 ------
NM_017742chr1821292 1241 11827 ----
NM_017748chr173832 643 87 --1178 --
NM_017752chrX31851 1628 1341 --12141 --
NM_017754chr664074 3601 3453 1364 881 700 14224 24543 1043 --
NM_017762chr1562427 2386 2250 2090 658 511 12507 ----
NM_017768chr1197 2759 284 ----
NM_017769chr1443121 2921 2836 850 22058 555 12657 --
NM_017770chr633012 2246 47 --12457 --
NM_017772chr621281 381 ------
NM_017778chr831041 186 105 --11238 --
NM_017779chr132712 2654 1060 12569 1890 --
NM_017798chr204469 452 134 38 ------
NM_017801chr321641 375 1878 --11936
NM_017810chr162184 89 ----2567 210
NM_017811chr923076 2993 12050 ----
NM_017813chr8115766 4787 4631 4249 4134 2255 2210 1329 622 560 378 11905 ----
NM_017824chr1052575 2190 2171 1707 844 --1187 12645
NM_017831chr1854738 3535 3460 3418 916 11262 --1548
NM_017848chrX74145 3355 3337 1852 1593 1434 59 13812 24319 3770 --
NM_017856chrX72025 1890 1663 1464 1437 602 538 ------
NM_017866chr82768 85 ----136
NM_017873chr972814 2770 1245 886 850 692 662 12828 ----
NM_017896chr2032159 717 538 --2813 568 --
NM_017902chr1094649 3875 2293 2184 2176 2099 1871 1458 34 15615 24074 820 --
NM_017915chr1231122 995 901 2855 98 ----
NM_017922chr142233 132 ------
NM_017934chr61114 ------
NM_017938chrX41740 1609 878 91 --138 --
NM_017944chr1121945 1151 ------
NM_017958chr283002 2955 2197 2059 760 651 374 59 1697 12382 --
NM_017987chr1042070 1932 1872 754 22004 701 --11826
NM_017988chr123762 320 79 159 1797 --
NM_017994chr762760 2320 2242 1112 877 150 --12025 1488
NM_017998chr941256 1105 456 34 --11022 --
NM_018011chr132641 420 ------
NM_018015chrX2798 268 --11005 --
NM_018017chr101693 --12647 --
NM_018025chr192173 61 ------
NM_018026chr11----11455 --
NM_018027chr1043152 2885 2073 1227 --22231 362 --
NM_018063chr101424 --151 --
NM_018078chr43998 680 218 ------
NM_018084chr232790 1261 982 --13349 --
NM_018086chr23636 284 190 --1643 --
NM_018092chr1621095 385 2673 118 11244 --
NM_018098chr31140 2756 67 1210 --
NM_018099chr12165 ------
NM_018105chr82888 23 --1349 11006
NM_018112chr93970 236 202 1793 ----
NM_018116chr13672 548 143 ------
NM_018120chr81330 ------
NM_018126chr441525 1512 1144 449 11002 ----
NM_018133chr311374 1251 ----
NM_018155chr373439 3205 3060 2512 1387 738 690 33098 1067 297 12601 1779
NM_018159chrX21312 656 11458 1463 --
NM_018164chr121195 ------
NM_018171chr123920 635 94 ------
NM_018178chr1144 11845 2546 127 --
NM_018191chr1352009 1637 1553 550 84 ------
NM_018196chrX--1248 ----
NM_018200chr1542487 2209 689 584 --22078 682 --
NM_018206chr161754 ------
NM_018211chr111406 1280 ----
NM_018214chr621215 995 --1205 --
NM_018222chr1151629 1421 1343 487 279 ------
NM_018228chr141280 1263 ----
NM_018230chr11384 1487 2188 167 --
NM_018237chr10193 ------
NM_018243chr453383 2584 1546 1355 240 ------
NM_018247chr642431 577 416 164 1951 1299 --
NM_018252chr14706 526 478 263 ------
NM_018254chr132331 1975 429 32048 1729 381 ----
NM_018257chr202973 187 --42215 1959 1791 1653 --
NM_018287chr103375 106 97 ------
NM_018293chr322636 517 2523 177 ----
NM_018302chr472193 1960 1931 1683 943 630 84 1498 12455 --
NM_018312chr1141727 1498 804 770 --31905 1863 528 --
NM_018313chr332531 335 193 22413 889 1773 22285 967
NM_018330chr1021564 472 --1610 --
NM_018332chr1631342 981 305 ------
NM_018348chr1641030 499 383 33 ------
NM_018351chr1254341 3465 1285 438 28 14631 23988 3976 --
NM_018361chr884052 3897 3285 1566 956 698 581 555 --12650 --
NM_018362chr1164040 3405 2763 1491 1235 1005 33615 641 374 1816 162
NM_018364chr154140 2683 2576 1584 546 173 13851 --
NM_018371chr851609 1529 1132 1125 62 1336 ----
NM_018374chr774943 4917 4303 2016 750 577 229 23511 1221 11882 --
NM_018375chr1461930 1831 722 523 422 343 11654 ----
NM_018387chr91142 ------
NM_018388chrX1540 21362 342 2937 296 --
NM_018394chr351597 1565 1517 386 216 1629 ----
NM_018398chr31134 ------
NM_018399chr6--1202 ----
NM_018403chr393900 3890 3815 3708 2713 2689 1529 1119 1015 23150 1181 ----
NM_018427chr1611492 ------
NM_018429chr552669 1792 841 140 117 ------
NM_018434chr5130 ------
NM_018436chr2------187
NM_018439chr1832552 647 365 1427 2669 480 --
NM_018440chr8148169 7846 6650 6149 5461 2488 2189 2166 1937 1925 1584 1434 1142 428 38197 3424 1158 11799 --
NM_018444chr83558 436 151 --12068 --
NM_018445chr153219 112 87 ------
NM_018448chr123900 461 145 ------
NM_018451chr132584 38 ----1866
NM_018452chr6_random42989 512 87 48 13765 12770 13752
NM_018460chr21138 ------
NM_018469chr1741319 1210 281 216 11280 ----
NM_018471chr21169 ----1385
NM_018472chrX--1119 ----
NM_018475chr42195 114 ------
NM_018490chr1131491 713 243 --21445 387 --
NM_018553chr1721221 711 ------
NM_018557chr211373 21738 1557 ----
NM_018566chr175111 5090 4890 3938 3867 1172 600 24140 4102 35141 5062 3410 --
NM_018569chr451557 1123 1101 480 71 1335 ----
NM_018638chr1244760 3995 3830 320 21518 1433 ----
NM_018660chr863132 2931 2881 1141 658 482 --32755 2569 2394 --
NM_018674chr21684 ------
NM_018682chr72510 253 ------
NM_018685chr73437 219 174 ------
NM_018695chr582070 1879 1851 1606 845 755 477 346 ------
NM_018703chr162349 143 126 ----
NM_018704chr131939 667 418 --21683 288 --
NM_018710chr811224 ------
NM_018713chr1--1828 ----
NM_018715chr131488 784 713 22013 246 12226 --
NM_018834chr54766 732 249 25 ------
NM_018841chr183441 2928 2740 2589 1402 1301 996 232 23013 189 ----
NM_018846chr73851 767 291 ------
NM_018847chr961678 1616 1424 152 130 78 ------
NM_018890chr7--11503 1592 --
NM_018948chr151380 1125 900 494 179 ------
NM_018953chr121525 ------
NM_018970chr753038 2934 2158 1234 693 13148 12466 --
NM_018979chr1212321 12096 ----
NM_018993chr2061445 1392 1362 397 377 121 1287 31139 1001 577 --
NM_018999chr1054848 3777 3492 1661 136 --24590 4054 --
NM_019000chr511478 11097 ----
NM_019001chr394899 4676 4563 4398 3808 3602 1507 1399 1293 ------
NM_019002chr23103 77 52 ------
NM_019004chr732292 2202 1621 --1378 --
NM_019012chr123315 247 23 ------
NM_019024chr21164 --1178 --
NM_019035chr441773 1723 1415 174 ------
NM_019042chr721201 811 --11093 --
NM_019044chr284691 3801 3199 1413 1180 685 115 33 13328 1204 --
NM_019050chr422298 578 1632 ----
NM_019063chr221434 314 --2123 46 --
NM_019071chr7--1313 ----
NM_019072chr584119 3771 2723 1594 1427 1281 1054 957 1820 ----
NM_019080chr1331417 1098 365 1421 ----
NM_019083chr161444 1147 1109 400 358 271 1435 1482 --
NM_019084chr102879 354 1927 ----
NM_019094chr1232906 2857 2658 23377 768 12546 --
NM_019098chr841749 588 335 47 --1159 11478
NM_019555chr3--11180 ----
NM_019556chrX1110 ------
NM_019557chr11325 --1202 --
NM_019558chr2----1281 --
NM_019595chr2--1590 ----
NM_019597chrX1221 --1729 --
NM_019862chr1611324 11726 ----
NM_019891chr151227 1151 1124 92 40 ------
NM_019892chr9142 ------
NM_019898chr1611324 11726 ----
NM_019899chr1611324 11726 ----
NM_019900chr1611324 11726 ----
NM_020069chr111228 ------
NM_020116chr421745 157 ----11738
NM_020122chr266042 4713 4682 4169 623 86 --14364 --
NM_020127chr161716 1651 1396 408 269 89 --1681 --
NM_020132chr2184348 3406 3358 3235 3146 1374 975 117 12061 ----
NM_020135chr6------1391
NM_020139chr421916 1604 ------
NM_020141chr152158 1913 1688 508 438 ----1692
NM_020148chr1873117 2306 1979 1110 625 527 422 22700 2555 1258 --
NM_020150chr1032158 1622 332 --1859 --
NM_020156chr71532 ------
NM_020159chr421396 275 ------
NM_020177chr532923 2450 929 22347 2156 ----
NM_020178chr174984 889 828 350 ------
NM_020184chr212026 --1937 12220
NM_020189chr81141 ------
NM_020199chr5146 11080 11063 --
NM_020204chr11748 --1635 --
NM_020205chr162449 1068 1007 969 484 227 --22384 2258 --
NM_020228chr1142375 2289 2057 582 ------
NM_020245chr665080 4423 4358 3349 1070 705 1489 1718 24399 522
NM_020248chr182377 677 636 545 427 328 220 57 1201 ----
NM_020307chr31106 ------
NM_020336chr2043658 3577 1054 820 ----12459
NM_020337chr452407 2311 967 583 82 ------
NM_020338chr1043410 830 438 238 11420 13545 --
NM_020341chr2011671 ------
NM_020342chr282482 2463 2372 989 886 767 648 320 22011 1677 1101 22454 1837
NM_020346chr1131547 54 39 ----1227
NM_020357chr31224 11479 ----
NM_020363chrY61638 1569 1470 1391 431 405 1535 11368 --
NM_020379chr13691 348 308 1750 ----
NM_020390chr354048 3989 1788 1295 544 14827 1284 11437
NM_020403chr1331720 405 339 11437 ----
NM_020420chrY61638 1569 1470 1391 431 405 1535 11368 --
NM_020425chr621924 707 --11414 --
NM_020429chr773078 964 752 397 372 264 175 12963 ----
NM_020432chr7--12018 ----
NM_020443chr1106453 5971 5170 4989 2691 1427 1117 967 288 252 ------
NM_020452chr141957 1934 1560 482 --1547 --
NM_020455chr652769 2158 2146 1838 381 ------
NM_020473chrX31998 1909 1296 1654 11753 --
NM_020474chr1811342 11247 --21963 1928
NM_020640chr352265 1782 1605 665 306 12252 ----
NM_020644chr115971 330 150 98 24 --1236 --
NM_020645chr113624 596 478 --193 --
NM_020647chr842210 1789 1520 353 12054 1211 --
NM_020649chr17----167 --
NM_020651chr231720 1686 1372 ------
NM_020654chr331464 1345 345 --11519 --
NM_020661chr1251954 1826 1810 522 303 ----12076
NM_020666chr52951 273 --1315 --
NM_020673chr20167667 6430 5870 5801 5695 5023 4714 2956 2320 2288 2280 2136 1899 1860 524 236 --15958 --
NM_020676chr31897 ------
NM_020686chr1652344 1237 929 709 186 12243 1121 --
NM_020699chr165227 4646 4575 1999 1877 1849 ------
NM_020717chrX64695 4475 1172 995 866 799 --21921 1127 --
NM_020718chr1676454 5157 4910 1831 645 469 319 14365 36324 4640 4350 12336
NM_020726chr51237 ------
NM_020727chr2143563 3459 926 234 33370 851 458 ----
NM_020734chr1243077 2937 1204 903 --11039 --
NM_020742chrX22052 1012 1131 12447 --
NM_020747chr52766 31 ------
NM_020748chr171597 ------
NM_020752chr1032763 1993 705 --32242 1917 768 --
NM_020766chrX94411 3777 3472 3202 3179 786 212 141 99 --23684 2882 --
NM_020768chr522712 477 --23164 3099 --
NM_020771chr631501 1371 517 ------
NM_020772chr17137633 7385 6679 6275 6042 2965 2641 1978 1592 738 587 431 312 26020 818 17046 16636
NM_020774chr1885569 5406 4567 1031 858 679 605 249 --24451 2289 --
NM_020778chr1564452 4408 1807 1780 490 171 14232 ----
NM_020779chr222986 921 1976 22321 782 --
NM_020782chr1284771 4486 4266 3980 3623 1515 347 213 24352 900 --34560 3897 3318
NM_020783chr1842309 1620 649 349 ------
NM_020801chr572436 1948 1789 1766 929 314 300 12614 ----
NM_020803chr452192 1832 885 681 135 --1517 --
NM_020804chr612659 ------
NM_020805chr18--1130 ----
NM_020810chr1473530 3423 3130 2901 2420 843 294 ------
NM_020830chr261223 986 783 601 502 404 ------
NM_020841chr1242840 1226 141 43 ------
NM_020854chr1841528 1290 579 176 ------
NM_020856chr1951549 1390 1014 632 77 ------
NM_020858chr15--1907 31899 827 29 --
NM_020860chr42987 183 ----1729
NM_020861chr621090 344 ------
NM_020870chr452012 739 648 371 127 1236 ----
NM_020871chrX42455 2237 1745 505 --151 12265
NM_020872chr331161 493 75 1430 11222 --
NM_020873chr32821 98 ------
NM_020909chr254123 3318 1605 596 126 1450 ----
NM_020918chr1073613 3180 2592 2496 2310 1141 1022 --11287 --
NM_020921chr1433224 2551 1074 43467 2568 1095 631 13090 13082
NM_020922chrX31417 1265 253 ------
NM_020925chr111253 ----11152
NM_020935chr284491 4101 2880 2837 1166 1131 614 463 11172 14516 --
NM_020940chr1052025 949 872 317 194 --1683 --
NM_020946chr911155 1709 ----
NM_020948chr163511 3377 1348 540 87 46 ----12478
NM_020952chr9----1152 1766
NM_020958chr142329 246 ------
NM_020973chr42237 126 ------
NM_020975chr1022042 594 --1184 --
NM_020977chr432053 2047 57 22235 839 ----
NM_020987chr101137 ------
NM_021003chr142268 170 1861 1214 --
NM_021005chr1511010 ------
NM_021032chr33708 449 126 ------
NM_021033chr1373339 2905 2553 2191 1020 671 142 ------
NM_021038chr363358 3012 2946 2443 1137 632 12148 11262 --
NM_021069chr482033 2018 1989 1808 1665 1400 572 354 --1621 --
NM_021079chr1793261 2327 2300 2173 1199 1137 1002 573 285 2795 503 ----
NM_021088chr221955 869 ----1799
NM_021097chr272203 2079 1909 999 778 336 280 13000 ----
NM_021106chr9--1502 ----
NM_021109chrX1361 ------
NM_021109chrX1361 ------
NM_021136chr14--1612 ----
NM_021153chr181123 ------
NM_021156chr2041091 1022 857 743 ------
NM_021165chr11829 ------
NM_021183chrX42162 2021 1712 320 11999 22202 1959 11660
NM_021194chr12296 28 ------
NM_021204chr41946 ------
NM_021227chr41362 ------
NM_021238chr1251849 1388 1284 373 179 ------
NM_021239chr141290 ------
NM_021242chrX1633 11025 ----
NM_021252chr1011662 21420 258 21867 1542 --
NM_021622chr1062126 1899 1645 957 748 382 --1299 1556
NM_021629chr375049 4893 4561 4208 3599 3201 1185 25018 3824 15074 24021 1729
NM_021631chr8167 ------
NM_021724chr171252 ------
NM_021728chr142684 245 --132 --
NM_021804chrX1209 --132 --
NM_021813chr685624 4846 4156 3775 1957 1727 1388 253 14788 11219 --
NM_021814chr64606 366 305 115 1526 1558 --
NM_021815chr253035 2742 2517 473 217 ------
NM_021819chr15----1142 --
NM_021821chr123810 234 208 130 1290 --
NM_021911chr555343 1736 1364 465 237 24043 1864 2536 222 --
NM_021912chr1584081 3924 3600 2905 2851 951 614 556 ------
NM_021914chr1432136 1613 169 ------
NM_021935chr34257 152 141 64 11041 ----
NM_021940chr631626 538 231 ------
NM_021942chr42866 334 --1292 --
NM_021951chr93822 773 182 ------
NM_021954chr1312405 13262 ----
NM_021960chr152593 2581 946 564 27 11079 ----
NM_021961chr1167178 6531 5925 5677 1833 1038 26846 1391 12064 --
NM_021964chr384832 4298 4010 2229 1466 951 770 548 22418 466 24219 4158 --
NM_021977chr663793 3717 3600 2474 1034 820 ------
NM_021988chr2011608 ------
NM_021999chr13175 ------
NM_022044chr221105 ------
NM_022048chr1595529 5350 4789 4569 4083 3942 2415 1875 742 --24635 1225 21888 1765
NM_022051chr12524 205 --1173 --
NM_022072chr3--1203 ----
NM_022073chr142654 352 ------
NM_022087chr71451 ------
NM_022093chr11995 ------
NM_022114chr184481 3993 3630 3342 3282 1103 525 413 --1929 --
NM_022121chr621128 912 ------
NM_022143chr721097 997 --11090 --
NM_022166chr1645921 4013 1838 226 25409 1234 45472 2457 1483 315 --
NM_022340chr343645 3385 2675 1360 --22536 1238 --
NM_022351chr81834 --1431 --
NM_022371chr11770 ------
NM_022442chr2011608 ------
NM_022456chr12127289 6773 6342 6325 2756 2741 2100 1947 1923 1410 445 144 11736 15093 --
NM_022458chr753090 2599 2410 1107 407 1570 23200 3158 --
NM_022459chr13105764 5558 5385 4721 2548 1119 928 676 336 67 12530 34872 4461 4127 1242
NM_022469chr173188 3159 2518 2098 1089 894 496 12957 11027 --
NM_022470chr331014 987 822 ------
NM_022473chr15104309 4159 3717 3632 3078 2725 1289 608 566 351 23592 3268 24028 3152 --
NM_022474chr1482672 2102 2034 1126 729 412 375 205 2861 765 ----
NM_022475chr41234 --1100 --
NM_022476chr1621008 983 ------
NM_022483chr551847 1664 1505 1202 272 ----11188
NM_022484chr711429 --11321 1568
NM_022488chr3142 ------
NM_022495chr14171 1482 ----
NM_022552chr22352 204 ------
NM_022566chr15----2564 504 --
NM_022572chr2--11805 ----
NM_022652chr121780 ------
NM_022716chr153185 3025 1973 803 419 --12859 13069
NM_022719chr2253781 2723 1382 667 410 --12955 --
NM_022726chr631760 1125 667 --1256 --
NM_022728chr71217 ------
NM_022739chr1721164 269 ------
NM_022750chr75683 547 272 206 156 --1494 --
NM_022763chr331944 1005 328 2914 98 ----
NM_022768chr12265 37 ----1117
NM_022771chr1231050 1020 727 1694 ----
NM_022780chr2----1281 --
NM_022781chr972685 2567 2427 1324 1122 1087 205 --42903 986 921 85 1141
NM_022802chr1011480 11624 1402 1208
NM_022824chr541868 1571 1371 191 11262 1613 --
NM_022826chr221230 1158 1943 ----
NM_022828chr551444 607 326 183 64 ------
NM_022836chr131619 1484 534 ------
NM_022841chr1532518 977 691 12261 11753 --
NM_022843chr1321083 43 ----11204
NM_022893chr213071 11278 --1118
NM_022894chr22669 82 1568 ----
NM_022898chr1474111 3301 1415 1039 734 500 71 24686 4468 14420 11904
NM_022900chr721088 1022 --1286 --
NM_022915chr2--1555 ----
NM_022918chr1132033 234 27 ------
NM_022977chrX32041 1015 955 --42249 2098 1835 1810 --
NM_023000chr1411593 11499 11369 --
NM_023001chr1411593 11499 11369 --
NM_023034chr81180 ------
NM_023076chr1652585 2568 970 651 351 --11829 12082
NM_023079chr1721786 709 1381 ----
NM_023923chr173471 3362 3338 2916 1178 738 643 --23395 1316 --
NM_023929chr852309 2089 1773 966 656 22674 770 ----
NM_023940chr42884 803 1982 1814 1350
NM_024019chr421110 171 2699 204 ----
NM_024034chr203646 186 53 ------
NM_024052chr1742988 2873 2086 1136 1898 ----
NM_024060chr111300 ------
NM_024090chr4--1157 ----
NM_024094chr84884 683 277 88 1262 ----
NM_024297chr17144 ------
NM_024315chr71114 ------
NM_024345chr944904 1996 1554 361 32112 882 44 ----
NM_024415chr5158 ------
NM_024482chr1136 ------
NM_024511chr473308 2193 1312 923 894 417 188 ----22794 906
NM_024524chr343031 2588 2085 426 12348 155 --
NM_024525chr11210 --1634 --
NM_024529chr141125 758 446 347 1167 ----
NM_024563chr51726 11597 --11725
NM_024582chr41285 --1292 --
NM_024590chr431855 1223 791 11847 ----
NM_024604chr12134 ----1151
NM_024613chr861859 1662 704 469 453 34 ------
NM_024624chr221553 1305 1630 ----
NM_024646chr173424 3285 2746 1559 1382 379 48 --2846 177 --
NM_024659chr21943 --1868 --
NM_024665chr3114601 4302 3653 3450 3104 3093 1772 1543 1347 1267 695 24009 1744 --1812
NM_024674chr163141 2443 2336 2189 1021 935 --1603 --
NM_024680chr11170 ------
NM_024700chr131110 736 355 ------
NM_024713chr15----11553 11027
NM_024721chr82904 319 --1480 --
NM_024744chr252219 1847 1683 1650 927 --139 --
NM_024757chr92466 304 1730 1864 --
NM_024761chr9115164 5077 4935 4554 1503 1464 1130 1008 923 415 133 14680 1660 --
NM_024770chr266666 5962 4600 4512 2250 262 --15019 --
NM_024780chr163737 200 61 1831 ----
NM_024811chr112415 234 --11927 --
NM_024812chr872085 1779 1699 1496 487 161 86 --21887 1522 --
NM_024817chr15125855 5586 4746 4558 3826 3780 3668 2300 2279 2025 1015 641 --14507 --
NM_024835chr171118 ----187
NM_024881chr1973036 2334 1063 903 872 399 33 ------
NM_024920chr431322 1281 300 --11402 --
NM_024945chr911055 2874 783 ----
NM_024947chr397654 6517 3554 3367 2943 2835 2544 2078 1736 26077 351 11343 16901
NM_024949chr484814 4100 3922 3643 3494 3290 3280 831 13829 ----
NM_024953chr1262323 2053 1999 1942 916 89 ----12738
NM_024971chr9----1152 1766
NM_024993chr221294 465 ------
NM_025054chr892978 968 741 721 643 593 337 234 154 --12846 --
NM_025065chr12340 103 1199 ----
NM_025073chr184087 3784 3445 3078 3046 930 483 420 43320 3143 258 102 13463 24575 3833
NM_025074chr463086 3043 3024 2684 979 518 ------
NM_025109chr17--1452 ----
NM_025126chr121741 ------
NM_025133chr21441 ------
NM_025134chr1642099 1671 698 35 1345 1767 --
NM_025145chr10170 ------
NM_025146chr321043 561 ----22141 815
NM_025160chr133536 1488 60 23631 767 1711 --
NM_025180chr362956 2926 2847 1304 1245 1092 22572 288 ----
NM_025181chr2--1817 ----
NM_025184chrX1324 133 ----
NM_025191chr153016 1383 896 816 585 ------
NM_025195chr851899 1602 447 192 172 1495 1163 --
NM_025221chr41922 11133 1323 --
NM_025238chr1541290 1174 1116 494 2286 169 ----
NM_025244chr2154 ------
NM_025248chr1773080 2138 2039 2015 1982 1250 593 1881 31061 962 582 --
NM_025250chr712950 --12101 12825
NM_030579chr1663292 2902 1357 1228 659 458 2580 440 11452 --
NM_030621chr1444022 3850 3765 2631 23444 2990 --11235
NM_030625chr1052587 2512 1913 1813 167 --12548 --
NM_030627chr533636 2838 1045 21657 1116 13112 13351
NM_030629chr1621957 512 ------
NM_030647chr7106242 5983 5820 4853 4667 2479 2382 1809 1388 1101 13905 66159 4674 4355 2012 1469 839 --
NM_030648chr495402 4644 4221 2130 2026 2004 1642 1442 510 --14815 13740
NM_030650chr244020 3835 2808 2589 11418 1902 --
NM_030660chr1421475 55 --21145 409 --
NM_030664chr1052479 2451 1664 622 607 1259 ----
NM_030674chr1265202 4635 4511 1510 588 581 --1298 15746
NM_030751chr1031678 1234 99 11531 ----
NM_030751chr1031678 1234 99 11531 ----
NM_030755chr1441074 922 649 33 2599 185 186 --
NM_030777chr2042225 1867 997 246 21853 1590 137 --
NM_030780chr821295 296 ------
NM_030789chr201293 --1267 --
NM_030791chr1421774 1451 1541 ----
NM_030806chr1119311 9108 6299 2476 2215 2060 1904 1775 953 674 591 22838 633 11478 --
NM_030816chr133432 2516 1122 11426 33618 2294 289 --
NM_030885chr352331 2155 1793 1657 320 --12290 --
NM_030918chr175006 4082 4030 3608 1668 498 147 25468 3558 --15321
NM_030922chr15131 ------
NM_030959chr6366 39 23 ------
NM_030960chr6----1303 --
NM_030964chr543185 2664 2344 1017 13734 ----
NM_031157chr122581 182 ------
NM_031216chr1842072 1432 1414 486 21817 781 ----
NM_031243chr7--1495 ----
NM_031262chr92863 418 ------
NM_031263chr92920 475 ------
NM_031266chr51480 ------
NM_031267chr7--1420 ----
NM_031268chr16105258 3992 3339 3288 2004 1875 1629 1548 912 599 --33805 3687 2063 15292
NM_031296chr471958 1924 1676 948 885 705 679 12043 ----
NM_031372chr451129 1109 567 358 280 ------
NM_031418chr1132723 413 189 42241 868 456 374 ----
NM_031422chr18--1119 1577 1534
NM_031427chr14115901 5811 4373 4144 3788 2330 2230 1535 1455 1393 912 34546 3663 2155 35969 2126 1340 11108
NM_031431chr1331594 1538 220 21610 1600 ----
NM_031435chr1221141 565 23045 2720 22198 454 --
NM_031438chr52453 384 --11519 --
NM_031442chrX13178 1124 33232 3137 2340 --
NM_031453chr1042454 628 137 115 ------
NM_031461chr832272 1682 849 11550 ----
NM_031468chr7168011 7671 7607 7520 7172 6559 6037 5360 3297 3082 2901 1345 824 677 504 460 --32984 2764 2327 --
NM_031469chr653801 3581 3373 2811 152 --13083 --
NM_031479chr1241133 709 255 69 2889 181 ----
NM_031483chr2053058 751 706 635 501 --2956 159 --
NM_031844chr183358 3187 3065 2520 1606 989 759 144 --1275 --
NM_031845chr263684 3289 3187 2722 213 186 ------
NM_031847chr263684 3289 3187 2722 213 186 ------
NM_031858chr1721221 237 --11315 --
NM_031862chr1721221 237 --11315 --
NM_031892chrX2904 380 --1845 1219
NM_031904chr1121798 775 --21628 149 12144
NM_031911chr422595 949 11109 ----
NM_031914chr143991 818 162 --1725 --
NM_031922chr61439 ------
NM_031954chr1242620 2417 2204 1089 --1562 --
NM_031989chr12----1147 --
NM_032012chr975065 3291 1583 1432 817 283 248 14923 23974 23 1571
NM_032021chr1121040 840 ------
NM_032027chr1139 ------
NM_032041chr841746 1711 348 246 ----12561
NM_032042chr532630 842 735 ------
NM_032047chr32796 659 ------
NM_032050chr22----2666 373 --
NM_032105chr1157680 7582 6998 5871 5802 5342 5326 5265 3124 2967 2193 1584 806 705 661 26325 5113 46203 6014 5038 1064 15128
NM_032116chr13105708 4092 3929 2031 1828 1657 1066 1013 997 396 1507 --14838
NM_032121chrX32462 1092 350 --12661 1121
NM_032124chr1811056 ------
NM_032128chr41400 1648 --1749
NM_032132chr11544 ------
NM_032138chr132585 380 ------
NM_032147chr1221001 686 1979 --134
NM_032151chr531903 1500 192 21577 512 1611 --
NM_032153chr362720 2676 2642 2382 2307 1070 ----12570
NM_032160chr1874063 4008 3712 3490 2993 953 624 23535 1016 ----
NM_032181chr21292 --2796 106 --
NM_032186chr121198 1072 ------
NM_032199chr1053647 3612 3065 2428 162 33098 1160 73 12881 12924
NM_032208chr273482 2664 2450 2276 1136 872 778 ------
NM_032221chr201124 --132 --
NM_032228chr1123227 2429 32491 1320 233 22227 1187 --
NM_032229chr13138 ------
NM_032231chr15----197 --
NM_032233chr142850 745 --1630 --
NM_032239chr421291 547 ------
NM_032288chr31254 22393 1781 ----
NM_032295chr721501 56 --189 --
NM_032300chr1221106 471 ------
NM_032303chr921638 424 ------
NM_032312chr21646 1725 ----
NM_032352chr141206 ------
NM_032364chr12--171 ----
NM_032424chr1141560 1404 1347 1303 ------
NM_032434chr22645 424 1358 21169 114 --
NM_032438chr61594 --21132 1054 --
NM_032440chr1032758 539 128 11141 ----
NM_032445chr1552270 2202 773 237 73 --12423 --
NM_032446chr521344 1000 21350 253 1208 --
NM_032457chr472553 1382 884 767 638 407 392 12989 11399 --
NM_032458chrX73457 3370 2394 2363 2283 825 182 13451 ----
NM_032466chr821206 415 1441 11231 --
NM_032468chr821206 415 1441 11231 --
NM_032471chr61806 31117 1002 391 ----
NM_032491chr122344 304 --1906 --
NM_032499chr1531558 1307 621 --1348 --
NM_032505chr342599 2066 716 652 --2842 367 --
NM_032521chr2063090 2650 2040 782 505 469 12125 ----
NM_032523chr21482 ------
NM_032539chrX1154 --1783 --
NM_032557chr41992 ------
NM_032560chr1431112 912 133 11098 ----
NM_032576chrY173 ------
NM_032594chr144967 750 314 23 ------
NM_032622chr431568 1215 283 1312 ----
NM_032631chr19----1153 --
NM_032682chr333626 2936 190 ------
NM_032737chr1952743 2682 2244 634 70 --21851 962 --
NM_032778chr352568 2294 2211 901 307 12638 1889 --
NM_032802chr15269 35 ------
NM_032804chr1062440 2136 1912 816 561 237 ----11689
NM_032810chr101545 ------
NM_032813chr132187 114 11012 ----
NM_032818chr982472 1859 1846 1696 868 474 190 104 --12484 --
NM_032833chr132592 581 484 1235 1212 --
NM_032838chr192438 338 1505 ----
NM_032859chr1353045 2791 1150 958 219 --11468 --
NM_032869chr832019 208 117 --21888 1783 --
NM_032870chr6129 ------
NM_032873chr1154366 3959 3625 3209 1315 14564 22874 796 --
NM_032884chr1159 --1282 --
NM_032892chr151297 ------
NM_032918chr1241295 1281 1017 810 1959 ----
NM_032961chr43947 459 36 ----11130
NM_032968chrX83974 3868 2980 2883 2784 986 479 323 23566 2912 ----
NM_032969chrX83974 3868 2980 2883 2784 986 479 323 23566 2912 ----
NM_032973chrY93966 3860 2975 2878 2779 1457 986 479 323 23562 2907 ----
NM_032975chr1843595 1398 1011 485 --1691 --
NM_032980chr1843595 1398 1011 485 --1691 --
NM_033020chr184245 3579 3356 3228 3038 1864 1830 247 11849 13735 --
NM_033030chr231598 1385 36 ------
NM_033044chr131211 1092 382 --1522 --
NM_033055chr111155 ------
NM_033067chr11689 ------
NM_033083chr382871 2717 2416 2159 2147 872 641 106 12727 1175 --
NM_033088chr13693 622 557 ------
NM_033103chr1931172 1000 307 ------
NM_033132chr1332001 770 97 --1716 --
NM_033138chr722024 615 190 ----
NM_033139chr722024 615 190 ----
NM_033140chr722024 615 190 ----
NM_033143chr441782 1075 646 475 13712 --13343
NM_033157chr722024 615 190 ----
NM_033181chr673400 3036 1567 854 831 226 122 22960 2743 ----
NM_033211chr52430 344 --11420 --
NM_033224chr7137502 6945 5928 5525 5506 5100 3163 2581 1849 1519 1423 1302 1081 17033 27246 6651 --
NM_033225chr853062 2391 2264 99 59 ------
NM_033227chr5178 ------
NM_033260chr6--1831 1730 --
NM_033276chr122277 129 ------
NM_033285chr842948 1489 1229 652 --44068 1684 1106 877 --
NM_033290chrX63656 3539 1009 801 621 597 12617 12889 --
NM_033305chr941403 192 96 39 ------
NM_033326chr1152546 2339 2279 161 90 ------
NM_033331chr933395 2786 703 22351 482 ----
NM_033360chr1253910 3797 3199 3003 1677 ----11643
NM_033389chr1794487 4220 3803 3628 3089 1610 1462 1450 1341 21832 1240 123 --
NM_033396chr111334 ------
NM_033427chr71879 ------
NM_033429chr1531251 207 161 1409 31228 1019 310 12341
NM_033496chr101238 ------
NM_033497chr101238 ------
NM_033498chr101238 ------
NM_033500chr101238 ------
NM_033505chr296470 6399 5798 5728 2087 1244 1092 533 287 1809 22421 1592 --
NM_033512chr872555 2004 1093 1070 947 783 549 11901 22236 385 --
NM_033515chr621358 1348 ------
NM_033631chr193808 3097 2747 1544 1382 1084 817 798 141 23002 614 ----
NM_033637chr1034062 4054 2524 ----1338
NM_033644chr582511 2440 2175 1774 1707 1571 512 59 --11757 11930
NM_033645chr582511 2440 2175 1774 1707 1571 512 59 --11757 11930
NM_033655chr951059 869 696 103 85 ------
NM_033656chr2144782 1389 692 136 15770 11125 11729
NM_052811chr13145250 4917 4840 4555 4135 4071 3637 3551 3369 1730 1040 981 465 327 34768 3225 1802 ----
NM_052818chr1382111 2080 2073 1901 1832 1789 1720 508 ------
NM_052827chr1231067 963 873 ------
NM_052828chr661426 1364 1323 492 386 69 --21613 200 --
NM_052834chr1842336 535 340 23 --12389 --
NM_052845chr1262544 2384 1104 1022 817 278 2843 615 --1463
NM_052879chr1293881 2700 2585 821 708 584 509 455 58 23317 3090 ----
NM_052885chr1294342 3652 3184 1920 1896 1679 1616 167 119 21947 1275 2291 67 1471
NM_052905chr22314 231 11177 ----
NM_052907chr1274201 2709 1554 1188 451 352 103 2577 89 14255 14145
NM_052910chr131493 11564 12135 --
NM_052913chr63733 202 173 --1439 --
NM_052918chr1023415 2875 13750 ----
NM_052925chr191696 ------
NM_052927chr522261 1481 ------
NM_052936chrX2915 820 ----1903
NM_052937chr842148 2008 1660 850 12665 21822 235 --
NM_053002chr33890 427 192 ------
NM_053016chr976320 6020 5135 4990 2785 1703 584 27668 2175 15371 16596
NM_053024chr321450 529 11509 ----
NM_053025chr32653 270 11573 ----
NM_053026chr32653 270 11573 ----
NM_053027chr32653 270 11573 ----
NM_053028chr32653 270 11573 ----
NM_053031chr32653 270 11573 ----
NM_053032chr32653 270 11573 ----
NM_053043chr7136098 5994 5635 5604 5065 4894 4829 4127 4096 2293 2009 1533 517 14489 46365 4011 1883 1017 1334
NM_053064chr1452728 2342 2277 2122 729 1191 ----
NM_054027chr552020 1390 831 447 239 1131 21958 1792 --
NM_057164chr2--1120 ----
NM_057165chr2--1120 ----
NM_057166chr2--1120 ----
NM_057167chr2--1120 ----
NM_057749chr84881 510 139 96 ------
NM_058170chr121511 259 21540 28 141 1326
NM_058172chr421467 58 1233 ----
NM_058237chr143659 79 53 ------
NM_058241chr262336 2123 851 410 356 324 --1907 --
NM_058241chr262336 2123 851 410 356 324 --1907 --
NM_058243chr19349 30 24 ------
NM_080425chr20----1132 --
NM_080426chr20----1132 --
NM_080491chr1113260 --1219 13600
NM_080546chr941689 843 787 752 --1231 --
NM_080591chr992931 2909 2884 2798 439 398 384 295 167 ------
NM_080599chr101400 ------
NM_080669chr1744910 3174 1731 977 24183 1259 23588 1276 --
NM_080672chr20--1467 ----
NM_080676chr2063127 2878 2497 779 719 585 --1300 --
NM_080737chrX41417 1330 1085 548 ------
NM_080743chr662474 2466 2313 1797 355 200 12017 ----
NM_080759chr1332122 1799 178 --1512 --
NM_080760chr1332122 1799 178 --1512 --
NM_080764chr2272788 2501 2244 2003 1152 746 128 1220 ----
NM_080836chr2023272 1903 --44803 4482 1037 29 --
NM_080867chr1494873 4618 4288 3299 3280 3215 3201 1424 538 11187 11151 --
NM_080927chr373094 2573 815 566 445 402 129 12630 ----
NM_080928chr73623 255 46 1156 --124
NM_100264chr104714 603 305 173 ------
NM_100486chr104714 603 305 173 ------
NM_130385chr1172390 1957 1225 1172 873 474 290 --1173 --
NM_130391chr943443 2942 1132 1106 2996 500 33333 2903 389 --
NM_130392chr943443 2942 1132 1106 2996 500 33333 2903 389 --
NM_130393chr943443 2942 1132 1106 2996 500 33333 2903 389 --
NM_130395chr6------1391
NM_130434chr151395 ------
NM_130435chr1032560 2513 594 ------
NM_130436chr2162173 1981 1033 737 694 135 ------
NM_130438chr2172750 2558 1314 1271 712 579 343 ------
NM_130439chr1042086 1551 1531 281 ------
NM_130439chr1042086 1551 1531 281 ------
NM_130795chr9--1502 ----
NM_130798chr1511379 1492 11023 --
NM_130808chr3----1133 --
NM_130809chr553164 2110 1928 406 396 --12459 --
NM_130811chr2031176 463 226 ------
NM_130830chr373236 979 515 473 438 147 101 --1692 --
NM_130838chr1541492 1436 1266 516 ------
NM_130839chr1541492 1436 1266 516 ------
NM_133259chr2140 1679 2789 626 --
NM_133265chrX43486 2325 1018 279 12937 ----
NM_133330chr442459 2248 846 825 --42503 2211 1092 949 --
NM_133331chr442459 2248 846 825 --42503 2211 1092 949 --
NM_133334chr476146 6127 5987 5237 4956 2143 1921 ----15168
NM_133335chr442459 2248 846 825 --42503 2211 1092 949 --
NM_133367chr651300 530 378 90 75 12821 13489 --
NM_133370chr483364 3149 2794 2779 2764 2617 1329 681 ------
NM_133372chr562668 2652 2503 2236 1904 168 1361 1692 --
NM_133493chr664570 4376 4142 3486 3397 55 24654 1241 ----
NM_133496chr184179 3833 3624 3003 1698 1592 1406 247 11253 ----
NM_133510chr14----142 --
NM_133631chr351552 1344 630 491 271 ------
NM_133638chr521081 195 2370 182 ----
NM_133646chr275470 5134 3798 1906 870 336 298 13430 34576 4256 1959 --
NM_134265chr172297 71 1411 ----
NM_134427chr9--1502 ----
NM_134428chr91351 ------
NM_138270chrX41078 989 542 475 22214 73 13293 --
NM_138290chr72346 306 ------
NM_138292chr1142619 2268 1150 994 1149 ----
NM_138300chr161743 1116 287 261 127 98 --2639 59 --
NM_138316chr101436 1411 1367 --
NM_138333chr972641 2160 1989 1892 1858 1736 284 1355 ----
NM_138357chr1011344 ------
NM_138386chr4174 ------
NM_138390chr21328 --11480 1511
NM_138395chr231057 368 322 1964 ----
NM_138423chr15172 11500 ----
NM_138455chr8----1137 --
NM_138459chr662491 1254 685 614 57 26 1458 ----
NM_138473chr1254227 4197 3436 1516 592 13322 ----
NM_138554chr952510 2358 2168 1838 529 ------
NM_138555chr152376 49 --1389 --
NM_138565chr1111373 ------
NM_138576chr1474111 3301 1415 1039 734 500 71 24686 4468 14420 11904
NM_138638chr1432136 1613 169 ------
NM_138694chr653630 2795 752 538 279 1311 ----
NM_138713chr1698100 6333 5751 2891 2879 2432 917 643 419 46620 5161 1269 585 37769 1488 459 17322
NM_138714chr1698100 6333 5751 2891 2879 2432 917 643 419 46620 5161 1269 585 37769 1488 459 17322
NM_138729chr1186 ------
NM_138730chr6152 --1393 --
NM_138731chr1463470 3379 1575 864 624 181 33587 3414 1497 13615 --
NM_138782chr532368 2123 598 --2700 25 --
NM_138959chr1126322 6096 6081 4777 2258 2244 1634 1286 944 656 212 197 --1589 16185
NM_138962chr17--1349 1342 --
NM_138966chr181466 ------
NM_138991chr211168 ------
NM_138992chr211365 ------
NM_139012chr662175 1539 1469 545 525 382 --22016 219 --
NM_139015chr1231567 1229 125 --21618 570 1544
NM_139035chrX2623 266 ------
NM_139046chr10----1232 --
NM_139047chr10----198 --
NM_139049chr10----198 --
NM_139068chr5--1665 ----
NM_139069chr5--1665 ----
NM_139070chr5--1534 ----
NM_139131chr112524 272 1686 ----
NM_139167chr81192 ----1163
NM_139168chr541685 523 244 139 ------
NM_139207chr1231902 1739 1418 ----1441
NM_139286chr91221 ------
NM_139312chr1021494 296 ------
NM_139318chr141270 ------
NM_139321chr2043861 3514 1369 922 23362 224 ----
NM_139323chr2041439 1318 282 223 21709 646 ----
NM_144488chr9--1502 ----
NM_144489chr9--1502 ----
NM_144563chr23736 572 322 ------
NM_144563chr23736 572 322 ------
NM_144578chr1474562 4538 4034 3404 2098 1877 1317 --45129 4690 4614 222 --
NM_144582chr292612 2445 2361 2259 2072 1666 739 389 110 --1432 --
NM_144595chr131797 ------
NM_144599chr1531197 634 62 23768 1224 35236 2007 854 --
NM_144600chr1631206 321 189 1624 ----
NM_144604chr162548 93 ------
NM_144609chr1731140 994 552 ------
NM_144632chr252347 2235 2157 1982 1708 1342 1883 --
NM_144642chr331310 1116 1087 1524 ----
NM_144710chr231218 266 78 ------
NM_144726chr5175 --11181 --
NM_144732chr1931016 792 332 ------
NM_144778chr1342216 2087 2081 667 --11029 --
NM_144949chr231751 822 365 11602 1750 12488
NM_144963chr862473 2435 2244 2081 1836 705 2799 600 1847 --
NM_144967chrX41042 404 395 277 ------
NM_145037chr321025 308 31122 207 141 ----
NM_145052chrX3877 411 53 ------
NM_145055chr1832801 1407 590 22429 1295 23254 274 --
NM_145062chr6130 ------
NM_145112chr1421202 976 ------
NM_145113chr1421474 1248 ------
NM_145117chr1162486 2461 2274 920 753 80 --12598 --
NM_145165chr1441847 1156 744 434 --1659 --
NM_145176chr623010 1117 ----12283
NM_145206chr1032961 1075 960 1574 22102 1153 --
NM_145239chr1611179 ------
NM_145251chr1421497 1417 --11203 --
NM_145259chr296445 6400 6063 5499 5260 5109 1750 1575 181 25819 5792 24785 2205 --
NM_145284chrX51764 709 644 245 226 12455 ----
NM_145307chr1063754 3729 2995 1778 1527 182 --2755 200 1104
NM_145330chr2----151 --
NM_145331chr63842 724 268 --1219 --
NM_145332chr63990 872 629 --1367 --
NM_145333chr63990 872 629 --1367 --
NM_145644chr21374 ------
NM_145686chr242723 2576 2526 1074 --13193 1997
NM_145687chr242723 2576 2526 1074 --13193 1997
NM_145725chr141322 ------
NM_145726chr141322 ------
NM_145728chr1582461 2035 1883 1834 1811 1639 529 310 ------
NM_145735chr1332705 1095 306 --2905 746 --
NM_145739chr21482 ------
NM_145753chr361688 1566 1480 648 546 407 ------
NM_145793chr103875 862 362 ------
NM_145808chr732782 2100 409 --1549 --
NM_145909chr62299 240 11251 --1151
NM_147127chr4148 ------
NM_147150chr963946 3782 3378 2713 1401 229 12594 ----
NM_147156chr10--1119 1611 --
NM_147171chr71498 --131 --
NM_147175chrX62166 2114 2012 1538 597 485 ------
NM_147181chr41922 11133 1323 --
NM_147182chr41922 11133 1323 --
NM_147183chr41922 11133 1323 --
NM_147185chr71498 --131 --
NM_147188chr152963 511 ------
NM_147233chr251790 917 900 541 303 ------
NM_148174chr862226 2178 2136 1852 1591 1511 1276 21421 424 --
NM_148571chr1752039 2016 734 218 171 --11409 1300
NM_148955chr1555362 4262 2596 1681 906 --14007 35742 4457 2063
NM_148977chr101436 1411 1367 --
NM_148978chr101436 1411 1367 --
NM_152240chr331014 987 822 ------
NM_152263chr184845 4791 4737 4730 4670 4021 773 551 2869 303 --16096
NM_152265chr13577 498 163 ------
NM_152267chr2242153 2091 684 75 12402 12396 1729
NM_152275chr242180 727 713 34 --12118 --
NM_152280chr183171 3017 3011 2983 2327 1098 730 327 ------
NM_152282chr311187 --11285 1418
NM_152291chr42967 45 ------
NM_152332chr1462605 2589 2085 1879 1064 58 12023 ----
NM_152342chr163520 375 162 --1556 --
NM_152388chr233138 3034 469 22504 463 ----
NM_152407chr553084 2992 920 455 128 22856 154 12615 --
NM_152409chr51916 1601 13282 --
NM_152414chr811302 1545 ----
NM_152417chr831187 543 355 129 ----
NM_152423chrX1441 21587 1189 ----
NM_152424chrX64291 4271 3784 3741 928 321 13533 34256 2904 1769 --
NM_152437chr1282295 2199 1775 1619 720 598 180 144 32021 1878 482 ----
NM_152447chr14--1310 ----
NM_152462chr172607 85 --2640 136 --
NM_152510chr22--1768 --1882
NM_152556chr731873 712 202 ------
NM_152589chr12--157 ----
NM_152594chr1531491 670 396 ------
NM_152609chr121205 1125 11061 ----
NM_152610chr1192 ------
NM_152622chr573449 3423 3312 2816 2437 2227 1379 1146 ----
NM_152624chr5137402 7166 6489 6112 5488 5255 4757 4639 2137 2042 1489 362 263 26287 2648 46532 5385 1638 664 12230
NM_152638chr1221170 40 ------
NM_152640chr12125 ------
NM_152641chr1232950 2841 2467 12621 1848 --
NM_152653chr32739 224 1639 ----
NM_152660chr12967 357 ------
NM_152667chr2031290 1061 584 2388 119 ----
NM_152678chr342529 2123 1901 787 --22551 298 --
NM_152682chr421268 604 --11093 --
NM_152692chrX1396 1445 ----
NM_152695chrX32209 1957 207 --1192 --
NM_152733chr696324 5648 4573 2610 1472 1421 1113 748 465 --66526 4270 1431 1134 1104 26 1914
NM_152734chr685386 4517 3576 1040 911 733 586 198 11714 ----
NM_152737chr642015 1715 1594 138 --11308 --
NM_152748chr71207 --1367 --
NM_152753chr642078 1794 1585 469 1508 ----
NM_152754chr763677 3298 2934 1510 1194 872 33613 2373 602 ----
NM_152756chr534258 381 161 24138 3866 14273 --
NM_152758chr832457 1225 1185 ------
NM_152765chr841863 1777 890 529 --31960 366 232 --
NM_152787chrX83640 2926 2466 1345 828 697 684 130 --1610 --
NM_152793chr763856 3649 1845 1769 744 274 --11570 --
NM_152826chr1555362 4262 2596 1681 906 --14007 35742 4457 2063
NM_152829chr73965 958 202 21072 1043 ----
NM_152835chr142929 1098 785 70 12457 ----
NM_152838chr2093451 2757 2693 2386 1313 877 684 228 47 12791 12943 --
NM_152890chr111039 ------
NM_152902chr121493 235 11291 1378 --
NM_152924chr15116571 6533 6284 5821 5394 2529 2523 2426 2198 1885 1706 --1508 --
NM_152989chr1211429 --21290 385 --
NM_152996chr161676 732 403 390 373 149 ------
NM_152999chr794772 4397 3348 1882 1836 1540 747 561 61 34992 3771 134 ----
NM_153015chr8----1767 --
NM_153020chr621383 1259 190 ----
NM_153026chr12----1172 --
NM_153035chr142830 2588 2466 2233 ------
NM_153047chr61123 --1348 --
NM_153048chr61123 --1348 --
NM_153181chr181466 ------
NM_153182chr352568 2294 2211 901 307 12638 1889 --
NM_153184chr311894 1739 ----
NM_153188chr554807 4616 3899 3509 2188 --55159 4965 4831 3628 1254 --
NM_153207chr1242777 689 532 451 --1353 --
NM_153211chr18------1278
NM_153223chr551490 1454 1386 1080 227 11522 ----
NM_153240chr331004 359 169 ----1117
NM_153251chr13--1193 --1212
NM_153262chr132494 846 274 12310 22258 339 --
NM_153267chr92778 116 ------
NM_153331chr3159 ------
NM_153332chr862644 2347 2136 2078 948 468 --12939 --
NM_153347chr1112479 12519 11766 11724
NM_153348chr121771 ------
NM_153365chr431803 1067 813 ------
NM_153367chr1033429 2740 1490 ------
NM_153371chr1351925 1908 1815 1760 819 ------
NM_153426chr41168 ------
NM_153427chr41168 ------
NM_153456chr1395244 4942 4279 2138 1735 1699 370 117 53 14368 12257 1537
NM_153498chr101212 ------
NM_153607chr533213 2466 1249 ------
NM_153616chr15--1907 31899 827 29 --
NM_153617chr15--1907 31899 827 29 --
NM_153618chr15--1907 31899 827 29 --
NM_153634chr1221573 1493 --11397 11046
NM_153645chr2233030 2697 665 22338 2320 22027 280 --
NM_153646chr1432565 2188 486 --11816 --
NM_153647chr1432565 2188 486 --11816 --
NM_153648chr1432565 2188 486 --11816 --
NM_153649chr122129 541 1828 1394 --
NM_153686chr452219 2095 2003 1825 756 --1102 1323
NM_153687chr1231597 1267 62 ------
NM_153689chr251839 1790 1681 715 337 ------
NM_153713chr1174 ------
NM_153759chr22352 204 ------
NM_153810chr1095035 4646 4569 4413 4085 3942 3762 3709 1514 14542 23135 210 --
NM_153816chr62363 171 ------
NM_153827chr171114 ------
NM_170606chr751332 633 544 140 111 ------
NM_170663chr171114 ------
NM_170665chr1284525 3801 3281 2904 1829 1487 1369 598 --11521 1886
NM_170674chr151432 ------
NM_170675chr151108 ------
NM_170676chr151108 ------
NM_170677chr151432 ------
NM_170710chr472739 2638 2358 1164 864 736 27 11237 ----
NM_170750chrX1877 ------
NM_170774chr2054091 3778 3393 1637 222 24217 2709 ----
NM_171999chr18----1569 --
NM_172037chr811405 --2477 344 --
NM_172070chr2--1487 --1345
NM_172071chr1127416 7103 6841 6569 6241 5017 2620 2035 2017 1718 1324 978 47391 6019 5075 2721 15678 --
NM_172078chr7----1147 --
NM_172079chr7----1147 --
NM_172080chr7----1147 --
NM_172081chr7----1147 --
NM_172082chr7----1147 --
NM_172083chr7----1147 --
NM_172084chr7----1147 --
NM_172103chr641826 533 403 64 --31931 1770 517 --
NM_172105chr641826 533 403 64 --31931 1770 517 --
NM_172127chr41530 --42133 1988 1462 1316 --
NM_172128chr41486 --42089 1944 1418 1272 --
NM_172159chr3--32210 1817 800 11807 --
NM_172160chr3--32210 1817 800 11807 --
NM_172201chr21------1183
NM_172216chr1262488 2256 2127 1942 452 345 1840 1315 --
NM_172315chr151432 ------
NM_172316chr151432 ------
NM_172337chr142684 245 --132 --
NM_172387chr1821057 43 ------
NM_172388chr1821104 90 ------
NM_172389chr1821104 90 ------
NM_173054chr72762 112 1768 1812 1182
NM_173060chr531279 808 455 11271 2113 63 --
NM_173061chr531279 808 455 11271 2113 63 --
NM_173063chr531279 808 455 11271 2113 63 --
NM_173075chr411141 ------
NM_173078chrX2426 64 ------
NM_173083chr1--1444 ----
NM_173163chr16----1460 --
NM_173165chr16----1341 --
NM_173171chr211238 ------
NM_173172chr211546 --1132 --
NM_173173chr211238 ------
NM_173177chr21483 1435 ----
NM_173198chr912784 ------
NM_173200chr912784 ------
NM_173214chr1698100 6333 5751 2891 2879 2432 917 643 419 46620 5161 1269 585 37769 1488 459 17322
NM_173359chr351805 1232 1218 276 245 --21616 572 --
NM_173460chr201175 ------
NM_173468chr4115429 5064 5000 4439 4252 3861 2335 1976 1356 1249 732 15280 21911 531 --
NM_173469chr15--11082 ----
NM_173470chrX92726 2599 2312 2212 2019 2005 499 381 311 --52782 2771 2469 783 542 1467
NM_173472chr33248 214 56 ------
NM_173475chr161670 ------
NM_173487chr44728 660 352 194 --1818 --
NM_173491chr531186 1066 238 ----1252
NM_173495chrX32439 1715 774 12317 ----
NM_173508chr11375 ------
NM_173510chr2262837 2023 720 584 444 168 12536 1128 1292
NM_173511chr253443 3217 2857 1149 385 1849 11361 1693
NM_173517chr71130 ------
NM_173519chr841848 1279 796 140 ------
NM_173531chr1933224 2668 80 --11563 12531
NM_173552chr352111 2067 1857 366 317 ------
NM_173557chr181278 ------
NM_173567chr11187 ------
NM_173576chr1032115 2019 627 ------
NM_173626chr172187 63 --1540 --
NM_173631chr19157 --21180 1126 1474
NM_173642chr1159185 8591 8569 8251 6333 5956 5600 3550 2663 2300 1809 1684 605 398 300 26289 146 47353 7302 2045 85 15623
NM_173647chr24996 774 132 41 ------
NM_173683chr8----1533 --
NM_173797chr521288 1057 21102 185 ----
NM_173808chr144498 1007 868 367 23480 1736 21749 268 --
NM_173825chr352869 2470 1196 1119 589 --12599 --
NM_173829chr575917 5243 5236 3894 1886 876 320 24315 4201 25858 758 --
NM_173851chr863936 3840 3698 3395 1503 452 --21429 508 --
NM_174890chr10--1226 ----
NM_174900chr441240 1002 442 374 --11182 --
NM_174909chr51818 1360 1348 --
NM_174911chr853701 2898 2599 1395 1364 --33241 2751 1098 1521
NM_174916chr1552273 1736 1691 1461 590 ----11968
NM_174934chr1183542 3409 3220 2459 2430 2223 1394 337 --22671 431 --
NM_174938chr9----147 --
NM_175038chr121216 ------
NM_175056chr331835 1645 56 ------
NM_175061chr73385 173 50 1657 ----
NM_175085chr214728 614 509 231 ------
NM_175610chr1531375 298 201 1542 1254 --
NM_175623chr12127289 6773 6342 6325 2756 2741 2100 1947 1923 1410 445 144 11736 15093 --
NM_175624chr12127384 6868 6437 6420 2851 2836 2195 2042 2018 1505 540 239 11831 15188 --
NM_175625chr12127384 6868 6437 6420 2851 2836 2195 2042 2018 1505 540 239 11831 15188 --
NM_175629chr22352 204 ------
NM_175748chr1442009 282 193 170 ------
NM_175854chr13--1649 12675 --
NM_175856chr51285 1707 ----
NM_175884chr731276 1265 914 ------
NM_175902chr172304 298 ------
NM_175907chr1842770 2438 620 557 ------
NM_175929chr13------255 27
NM_176812chr203608 495 489 ------
NM_176814chr72927 456 --1397 --
NM_176871chr893268 3100 2299 1068 1036 639 150 118 107 --12067 --
NM_177401chr19----11844 --
NM_177414chr131396 620 115 --1466 --
NM_177424chr121753 199 1823 ----
NM_177438chr1444022 3850 3765 2631 23444 2990 --11235
NM_177478chr5----1130 --
NM_177553chr111772 ------
NM_177559chr202973 173 ------
NM_177560chr202973 173 ------
NM_177947chrX31642 1415 1367 1316 ----
NM_177948chrX31642 1415 1367 1316 ----
NM_177949chrX2343 43 ------
NM_177952chr142268 170 1861 1214 --
NM_177968chr211427 11412 2792 463 --
NM_177972chr1194463 3680 2887 1423 1249 677 655 635 626 --13954 --
NM_177974chr15172 11500 ----
NM_177985chr222132 222 3782 504 105 ----
NM_177990chr2011671 ------
NM_177999chr983377 3333 1449 1413 1255 1225 543 196 13391 ----
NM_178010chr1211429 --21290 385 --
NM_178011chr1032385 2335 2088 1220 ----
NM_178033chr11544 ------
NM_178120chr241410 1202 916 859 ------
NM_178123chr2------1378
NM_178140chr531834 1753 446 32591 2177 151 158 --
NM_178151chrX137903 7516 7039 6882 6627 6513 6039 5518 5483 5253 2769 2132 1605 26253 4864 45705 5281 1018 171 --
NM_178152chrX137903 7516 7039 6882 6627 6513 6039 5518 5483 5253 2769 2132 1605 26253 4864 45705 5281 1018 171 --
NM_178153chrX137903 7516 7039 6882 6627 6513 6039 5518 5483 5253 2769 2132 1605 26253 4864 45705 5281 1018 171 --
NM_178270chrX2915 820 ----1903
NM_178313chr262138 1860 1597 849 63 55 12013 ----
NM_178423chr72954 212 11213 ----
NM_178424chr51544 --1114 --
NM_178425chr72954 212 11213 ----
NM_178439chr22524 126 ------
NM_178554chr393586 3544 2866 1308 736 418 219 198 192 --12688 --
NM_178565chr851341 1178 1075 679 178 --21269 225 --
NM_178566chr92735 277 --1577 --
NM_178581chr201293 --1267 --
NM_178584chr231218 266 78 ------
NM_178585chr432969 2104 398 ------
NM_178586chr1462347 2235 2202 1961 1872 450 --22336 177 --
NM_178812chr821620 1318 31306 1110 625 ----
NM_178815chr1031711 1042 268 12215 ----
NM_178818chr1652313 2251 2043 859 175 --1102 --
NM_180989chr1332487 2369 429 12419 171 --
NM_181077chr1532002 1551 183 ------
NM_181265chr472739 2638 2358 1164 864 736 27 11237 ----
NM_181332chrX22052 1012 1131 12447 --
NM_181349chr773078 964 752 397 372 264 175 12963 ----
NM_181354chr821167 341 11381 11223 --
NM_181358chr163726 3539 2834 1344 408 342 --33188 3078 1023 --
NM_181361chr321418 1202 ------
NM_181458chr21148 ------
NM_181492chr2211092 ------
NM_181504chr583295 3246 2905 2824 2642 1473 1413 988 11348 ----
NM_181521chr1697094 7032 6824 5925 5640 4956 1665 836 90 --14883 12181
NM_181523chr583295 3246 2905 2824 2642 1473 1413 988 11348 ----
NM_181524chr583295 3246 2905 2824 2642 1473 1413 988 11348 ----
NM_181552chr71862 ------
NM_181643chr171589 1331 1305 1040 493 484 193 11298 1254 --
NM_181659chr2083404 2988 2337 1132 1083 826 638 496 33382 3275 3150 ----
NM_181659chr2083404 2988 2337 1132 1083 826 638 496 33382 3275 3150 ----
NM_181672chrX32090 794 327 1616 ----
NM_181673chrX32090 794 327 1616 ----
NM_181689chr201641 ------
NM_181698chr101487 ------
NM_181705chr541850 1450 796 757 11165 25673 5401 24822 1408
NM_181714chr631311 769 113 ------
NM_181723chr861671 1453 619 418 293 235 11583 11974 --
NM_181782chr6--1620 ----
NM_181783chr1272009 1748 1742 1317 754 490 56 --11787 --
NM_181784chr242492 404 381 319 ------
NM_181794chr61806 31117 1002 391 ----
NM_181795chr61806 31117 1002 391 ----
NM_181836chr531751 861 534 12007 --11045
NM_181838chr521258 71 1288 11391 --
NM_181861chr1212786 ----12161
NM_181868chr1212786 ----12161
NM_181869chr1232871 40 24 ----12246
NM_181886chr42499 72 11022 --21408 1312
NM_181887chr42499 72 11022 --21408 1312
NM_181888chr42499 72 11022 --21408 1312
NM_181889chr42499 72 11022 --21408 1312
NM_181890chr42499 72 11022 --21408 1312
NM_181891chr42499 72 11022 --21408 1312
NM_181892chr42546 119 11069 --21455 1359
NM_181893chr42499 72 11022 --21408 1312
NM_181897chr362683 2381 1937 1842 318 100 2546 459 ----
NM_182314chrX21575 361 11440 2562 372 168
NM_182485chr443484 1371 520 499 1553 1895 153
NM_182493chr16105248 5136 4679 3342 2121 1127 1064 411 164 90 14840 14873 --
NM_182501chr282840 2480 2279 1303 939 891 672 595 --23246 1126 --
NM_182503chr6125409 5390 5227 5097 4435 4419 4240 3398 1533 1408 1209 317 25526 5069 24325 472 --
NM_182509chr14--11377 ----
NM_182511chr184526 489 274 134 --11056 11072
NM_182540chrX2863 831 ------
NM_182547chr7----1271 --
NM_182607chrX11727 --1255 --
NM_182644chr33795 659 323 ------
NM_182646chr443484 1371 520 499 1553 1895 153
NM_182649chr20----1244 --
NM_182685chr11726 ------
NM_182697chr731231 610 166 ------
NM_182700chr721437 218 11966 1621 1158
NM_182734chr2023084 850 12455 1772 --
NM_182757chr662999 2392 2187 1058 765 407 --2956 575 11416
NM_182758chr1573642 3348 2747 2472 1486 1436 455 1896 23148 156 --
NM_182762chr766176 6129 6112 6012 4492 1403 25165 813 25118 2438 14936
NM_182767chr123619 478 115 11456 ----
NM_182789chr51720 ----152
NM_182797chr2041682 1644 1342 165 ------
NM_182798chr531073 328 317 ------
NM_182799chr531073 328 317 ------
NM_182801chr531073 328 317 ------
NM_182847chr21684 ------
NM_182894chr1421572 146 11813 11767 --
NM_182896chr381652 1629 1421 1380 741 560 440 362 1396 ----
NM_182898chr752354 2151 2028 658 121 21648 853 ----
NM_182899chr752354 2151 2028 658 121 21648 853 ----
NM_182907chr652339 1874 883 537 42 --2975 73 --
NM_182911chr2154 ------
NM_182931chr72510 253 ------
NM_182964chr1162486 2461 2274 920 753 80 --12598 --
NM_182970chr2064320 3002 1601 623 252 223 11582 13174 13702
NM_182972chr11135 --1282 --
NM_183004chr1483106 2610 1586 1489 1076 876 823 295 32477 331 99 1953 11461
NM_183043chr13178 ------
NM_183044chr13178 ------
NM_183049chr41356 ------
NM_183244chr20--1467 ----
NM_183246chr20--1467 ----
NM_183323chr51720 ----152
NM_183353chrX2419 217 ------
NM_183376chr1561939 1900 1823 773 496 401 --12193 --
NM_183380chr61876 ------
NM_183381chr3163 ----1853
NM_183383chr3163 ----1853
NM_183384chr3163 ----1853
NM_183416chr121381 62 ------
NM_183419chr82929 69 ------
NM_194247chr274359 4055 4035 3150 2959 785 548 14530 --14503
NM_194271chr121741 ------
NM_194281chr18161 ------
NM_194282chr483054 2623 2207 2077 1178 752 342 65 ------
NM_194283chr593855 3779 3643 3559 2827 1387 1074 214 184 1597 13282 --
NM_194285chr11123226 2715 2335 2308 2134 2101 1048 938 756 722 625 360 11217 2550 473 --
NM_194291chr883040 2604 2591 2283 752 698 595 303 12463 32251 1980 152 --
NM_194314chr175295 3689 2124 1895 1870 1204 916 34116 2192 1344 23600 217 --
NM_194317chr272576 2312 2159 2045 944 747 702 12625 11014 --
NM_194328chr972685 2567 2427 1324 1122 1087 205 --42903 986 921 85 1141
NM_194329chr972685 2567 2427 1324 1122 1087 205 --42903 986 921 85 1141
NM_194330chr972685 2567 2427 1324 1122 1087 205 --42903 986 921 85 1141
NM_194332chr972685 2567 2427 1324 1122 1087 205 --42903 986 921 85 1141
NM_194434chr1875372 5310 4620 4481 4027 3662 1140 45276 1778 909 388 1865 --
NM_194449chr181326 2376 214 ----
NM_194454chr731176 693 101 21487 1155 ----
NM_194455chr731176 693 101 21487 1155 ----
NM_194456chr731176 693 101 21487 1155 ----
NM_197941chr542857 2758 2163 406 ------
NM_197970chr231598 1385 36 ------
NM_198077chr11210 --1204 --
NM_198081chr662996 2315 1163 1056 1017 471 --32719 1868 237 --
NM_198098chr721879 1610 ------
NM_198120chr84556 364 172 106 ------
NM_198128chr1841476 851 700 391 11509 ----
NM_198158chr352696 2222 923 879 330 --1352 --
NM_198159chr352696 2222 923 879 330 --1352 --
NM_198177chr352696 2222 923 879 330 --1352 --
NM_198178chr352696 2222 923 879 330 --1352 --
NM_198181chr1532651 2599 2355 --12202 --
NM_198215chr101385 ------
NM_198217chr132263 149 ------
NM_198218chr132263 149 ------
NM_198219chr132263 149 ------
NM_198225chr1031946 1456 439 ------
NM_198243chr152938 95 ------
NM_198268chr163726 3539 2834 1344 408 342 --33188 3078 1023 --
NM_198269chr163726 3539 2834 1344 408 342 --33188 3078 1023 --
NM_198270chrX103521 3044 2812 2568 2494 2460 2402 2275 839 631 1242 1795 --
NM_198281chr4103192 2895 2533 2445 2299 2280 2202 1255 1189 767 --21262 1033 --
NM_198320chr1294566 4210 3998 3990 3592 3173 1294 1096 421 ------
NM_198336chr72417 214 192 21733 1231 --
NM_198353chr4192 ------
NM_198390chr1621957 512 ------
NM_198391chr2021257 318 ------
NM_198395chr51819 ------
NM_198400chr1552963 2838 2427 652 262 2301 62 12119 --
NM_198401chr871714 1553 1345 608 277 227 46 1528 11415 --
NM_198404chr131760 ------
NM_198428chr71525 1814 1568 --
NM_198467chr7------1443
NM_198489chr11--1122 ----
NM_198513chr821509 185 ------
NM_198569chr652636 2025 2013 1705 248 ------
NM_198576chr12758 73 ------
NM_198581chr2127214 6624 6170 5876 4941 3015 2383 1941 1834 888 837 39 11701 12691 --
NM_198700chr112366 359 ------
NM_198715chr176320 5764 2412 2291 994 653 250 15560 --14556
NM_198793chr363374 2907 2659 908 380 146 14105 23791 411 --
NM_198829chr7--11503 1592 --
NM_198844chr1731065 904 51 --1955 --
NM_198859chr374766 3828 1918 1884 906 649 640 14814 --199
NM_198892chr4----1128 --
NM_198935chr2043012 2445 820 697 ------
NM_198956chr721437 218 11966 1621 1158
NM_198965chr122397 361 ------
NM_198966chr122397 361 ------
NM_198992chr1231010 383 154 11072 1898 --
NM_199003chr831172 307 242 ----11290
NM_199039chr41834 ------
NM_199040chr1232906 2857 2658 23377 768 12546 --
NM_199053chr42888 356 --1314 --
NM_199072chr742815 2650 2373 1117 --13027 1434
NM_199144chr2011608 ------
NM_199160chr911742 ------
NM_199168chr1051395 979 966 597 391 ----1449
NM_199188chr1293881 2700 2585 821 708 584 509 455 58 23317 3090 ----
NM_199189chr54766 732 249 25 ------
NM_199190chr1293881 2700 2585 821 708 584 509 455 58 23317 3090 ----
NM_199203chr2011608 ------
NM_199229chr241735 613 247 129 --1440 --
NM_199321chr1731065 904 51 --1955 --
NM_199324chr462948 2897 2291 349 320 233 --21444 1060 --
NM_199421chr1494873 4618 4288 3299 3280 3215 3201 1424 538 11187 11151 --
NM_199436chr232833 1916 457 22586 2440 ----
NM_199437chr1142375 2289 2057 582 ------
NM_199438chr1142375 2289 2057 582 ------
NM_199439chr1142375 2289 2057 582 ------
NM_199454chr184481 3993 3630 3342 3282 1103 525 413 --1929 --
NM_199462chr184819 3950 3906 3226 1678 704 388 274 13913 ----
NM_199478chrX31320 253 152 11803 ----
NM_199482chr241899 1817 1618 1525 11872 --1785
NM_201266chr253024 2975 2599 388 211 1544 12057 --
NM_201269chr121198 1072 ------
NM_201279chr253024 2975 2599 388 211 1544 12057 --
NM_201434chr171129 ------
NM_201437chr821015 532 ------
NM_201545chr121080 44 --11128 --
NM_201548chr21991 ------
NM_201570chr1041871 797 788 417 --11558 --
NM_201571chr1041871 797 788 417 --11558 --
NM_201572chr1041871 797 788 417 --11558 --
NM_201590chr1041871 797 788 417 --11558 --
NM_201591chr441794 1396 402 308 ----1123
NM_201592chr441794 1396 402 308 ----1123
NM_201593chr1041871 797 788 417 --11558 --
NM_201596chr1041871 797 788 417 --11558 --
NM_201597chr1041871 797 788 417 --11558 --
NM_201613chr121878 1572 ----
NM_201995chr111642 ------
NM_201998chr111707 ------
NM_203291chr18184 ------
NM_203292chr18177 ------
NM_203298chr10--1159 ----
NM_203301chr141452 ------
NM_203327chr2084484 4330 3923 3865 3052 1375 559 338 11325 13192 --
NM_203341chr121090 994 ------
NM_203342chr162598 1249 1204 1096 1012 775 --1878 --
NM_203343chr162598 1249 1204 1096 1012 775 --1878 --
NM_203349chr1541733 1631 758 495 ------
NM_203350chr131652 1208 452 ------
NM_203354chr14178 1151 ----
NM_203355chr14178 1151 ----
NM_203356chr14178 1151 ----
NM_203364chr112878 802 1165 ----
NM_203371chr1131357 712 217 11621 1179 --
NM_203372chr2--1310 1281 --
NM_203382chr531114 140 127 1586 11561 11576
NM_203390chr831619 564 403 11584 11523 11811
NM_203391chrX2643 104 ----1153
NM_203394chr1252699 2686 2069 946 154 1237 12142 --
NM_203403chr93802 221 120 2400 177 181 --
NM_203406chr542657 2001 1809 1803 1998 ----
NM_203434chr91272 ------
NM_203437chr22717 118 ------
NM_203458chr173746 3597 3165 1388 1320 208 157 ----11245
NM_203487chr1331720 405 339 11437 ----
NM_203499chr173843 796 787 --1852 --
NM_205842chr2--1183 ----
NM_205858chr15----133 --
NM_205860chr122445 2200 12950 31963 1126 851 --
NM_206594chr193278 3137 3077 2492 2481 2263 1356 1256 962 ------
NM_206595chr193278 3137 3077 2492 2481 2263 1356 1256 962 ------
NM_206852chr14--1612 ----
NM_206853chr653196 1577 1469 760 451 23403 1060 13741 1108
NM_206854chr684457 3325 2021 1712 1244 693 624 161 24664 213 15002 11369
NM_206855chr695422 4290 4138 2209 1658 1589 1126 968 50 25629 1178 15967 12334
NM_206857chr14--1612 ----
NM_206860chr102407 141 ------
NM_206861chr102407 141 ------
NM_206862chr102407 141 ------
NM_206866chr2183091 2624 2302 821 404 187 163 152 --11271 --
NM_206876chr293382 2749 2401 1417 1388 1180 832 815 709 13549 22419 632 --
NM_206907chr573004 2850 2664 2437 1162 595 262 23356 149 22712 410 --
NM_206909chr8137741 7293 6479 6099 5616 5594 5298 2976 2575 1933 1504 195 177 --42121 1421 1171 249 --
NM_206943chr21625 ------
NM_206944chr9----1152 1766
NM_206945chr9----1152 1766
NM_206946chr9----1152 1766
NM_206947chr9----1152 1766
NM_207009chr10--1119 ----
NM_207015chr352346 724 690 479 103 21568 384 ----
NM_207043chr132135 514 117 --1298 --
NM_207044chr132135 514 117 --1298 --
NM_207047chr132135 514 117 --1298 --
NM_207113chr721650 205 11015 1238 --
NM_207292chr363358 3012 2946 2443 1137 632 12148 11262 --
NM_207293chr363358 3012 2946 2443 1137 632 12148 11262 --
NM_207294chr363358 3012 2946 2443 1137 632 12148 11262 --
NM_207295chr363358 3012 2946 2443 1137 632 12148 11262 --
NM_207296chr363358 3012 2946 2443 1137 632 12148 11262 --
NM_207297chr363383 3037 2971 2468 1162 657 12173 11287 --
NM_207304chr1342103 1974 1968 554 --1916 --
NM_207325chr1921361 427 11284 21884 1728 1372
NM_207344chr1231380 1296 465 ------
NM_207359chr321884 225 --11386 --
NM_207372chr1032372 2144 1756 11921 11936 --
NM_207406chr4116502 5988 5927 5908 4888 4356 4014 863 574 460 231 ------
NM_207418chr1_random--1127 ----
NM_207429chr1152398 2247 1679 488 389 ------
NM_207445chr1572059 1356 1300 829 732 272 118 31814 1591 523 ----
NM_207481chr221044 212 --183 --
NM_207491chr431325 1212 586 163 11119 1422
NM_207517chr1551618 1491 1288 727 390 ------
NM_207577chr1162640 2456 2388 2124 872 152 ----11012
NM_207647chr92863 777 ------
NM_212460chr741642 1426 534 51 12073 ----
NM_212471chr1731965 1803 1470 ----11433
NM_212472chr1731965 1803 1470 ----11433
NM_212474chr22810 266 ------
NM_212475chr22810 266 ------
NM_212476chr22810 266 ------
NM_212478chr22810 266 ------
NM_212482chr22810 266 ------
NM_212558chr934061 3672 21 11665 --14158
NM_213589chr263859 2231 2005 1285 885 861 25519 3744 23657 2150 --
NM_213590chr13145250 4917 4840 4555 4135 4071 3637 3551 3369 1730 1040 981 465 327 34768 3225 1802 ----
NM_213594chr122344 304 --1906 --
NM_213611chr121183 1406 ----
NM_213654chr361063 596 437 383 57 30 21478 1170 --1366