TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-2277-3p
miRNA Sequence: UGACAGCGCCCUGCCUGGCUC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000020chr1241891 1705 881 188 --12403 --
NM_000021chr1421107 294 21037 1025 ----
NM_000038chr51734 1344 ----
NM_000084chrX66476 5391 4906 2212 1129 121 ------
NM_000090chr21173 ------
NM_000092chr234191 3582 3103 23918 1241 ----
NM_000108chr761746 1535 1429 1204 577 274 ------
NM_000110chr15772 463 336 272 24 ------
NM_000112chr525504 382 34442 4323 3589 ----
NM_000138chr151398 11938 ----
NM_000141chr1031309 528 89 ------
NM_000142chr441459 1193 623 232 ------
NM_000168chr762986 2280 944 798 373 77 ------
NM_000176chr533847 2750 603 ----12601
NM_000188chr101177 ------
NM_000208chr1953924 3852 3619 3608 3365 ------
NM_000210chr241708 659 605 78 ------
NM_000212chr1721695 870 ------
NM_000214chr2011711 ------
NM_000217chr1234931 1849 147 13516 ----
NM_000222chr422106 1553 11712 ----
NM_000232chr432678 321 120 ------
NM_000248chr312965 1701 ----
NM_000252chrX21523 1401 ------
NM_000259chr1596363 6325 4858 4484 4150 2495 2393 379 192 34684 2503 2266 ----
NM_000264chr91588 ------
NM_000266chrX2674 271 1340 ----
NM_000267chr1713247 11247 ----
NM_000276chrX22078 383 ------
NM_000280chr11--1106 ----
NM_000282chr131218 ------
NM_000296chr1631010 871 634 ----172
NM_000304chr172965 147 ------
NM_000314chr1043122 2754 1021 182 21169 959 --1639
NM_000321chr1321342 276 ------
NM_000322chr631363 468 285 21666 1656 ----
NM_000332chr656326 6185 2386 2186 406 24565 795 ----
NM_000333chr32949 146 ------
NM_000345chr431042 322 226 ------
NM_000346chr1711656 ------
NM_000362chr2223439 1115 21078 148 ----
NM_000368chr944806 4023 3482 486 ------
NM_000408chr243415 2614 2592 173 13073 ----
NM_000411chr2132202 2067 155 ------
NM_000428chr1442493 2332 2218 2118 ------
NM_000430chr1732540 2481 1232 12860 1204 --
NM_000442chr1721193 204 11184 ----
NM_000451chrX22068 792 ------
NM_000458chr171876 176 ----
NM_000459chr92325 117 ------
NM_000461chr323963 500 --14061 --
NM_000462chr151565 ------
NM_000476chr911443 --11178 --
NM_000489chrX32718 2583 2489 ------
NM_000492chr721167 1018 ------
NM_000495chrX1407 ------
NM_000503chr831842 1830 190 1129 ----
NM_000523chr2146 ------
NM_000533chrX--1739 ----
NM_000555chrX107741 7709 7306 7016 6219 1644 1587 795 538 357 21106 559 ----
NM_000578chr231750 1286 139 ------
NM_000594chr62677 605 ------
NM_000599chr234552 4199 634 14151 ----
NM_000602chr711243 ------
NM_000610chr1122894 707 ------
NM_000615chr1122830 2175 ------
NM_000618chr1256098 5152 1379 449 220 ------
NM_000618chr1256098 5152 1379 449 220 ------
NM_000627chr2--1266 ----
NM_000633chr1843715 2076 1781 103 ------
NM_000673chr4--131 ----
NM_000681chr1031169 1027 476 11152 ----
NM_000684chr1011063 ------
NM_000685chr3--1831 ----
NM_000685chr3--1831 ----
NM_000687chr20134 ------
NM_000719chr1276237 6057 4266 4239 2531 1959 1199 --1403 16421
NM_000724chr1021656 134 ------
NM_000801chr2021022 843 ------
NM_000812chr42365 84 ------
NM_000813chr554083 1912 1071 390 263 13703 ----
NM_000814chr1532893 729 649 34059 3737 2909 ----
NM_000816chr51205 ------
NM_000818chr102523 22 ------
NM_000824chr4--1590 ----
NM_000826chr442448 2312 1810 113 145 ----
NM_000829chr1122204 743 ------
NM_000831chr176273 2442 1424 1323 1062 924 534 25435 1911 ----
NM_000838chr632779 1914 1830 11803 ----
NM_000841chr62334 89 ------
NM_000842chr111569 ------
NM_000844chr31866 ------
NM_000859chr521123 216 ------
NM_000865chr61186 ------
NM_000868chrX32568 1690 101 ------
NM_000872chr1021317 334 ------
NM_000875chr1534912 726 415 45447 4906 4734 564 ----
NM_000891chr1713609 13191 ----
NM_000898chrX3667 641 170 ------
NM_000899chr1223270 1697 ------
NM_000901chr42701 164 ------
NM_000908chr51292 ------
NM_000922chr112880 748 11003 ----
NM_000933chr2021206 74 ------
NM_000945chr2----11492 --
NM_000949chr5--1220 ----
NM_000950chrX22919 433 ------
NM_000958chr511185 1305 ----
NM_000962chr92722 470 ------
NM_000966chr1231055 1016 25 ------
NM_001001132chr2121247 1134 --11298 --
NM_001001323chr123831 684 192 22725 693 ----
NM_001001331chr31180 ------
NM_001001344chrX22312 2255 ------
NM_001001389chr1122894 707 ------
NM_001001390chr1122894 707 ------
NM_001001391chr1122894 707 ------
NM_001001392chr1122940 753 ------
NM_001001394chr21470 ------
NM_001001395chr1212598 12550 ----
NM_001001483chr111320 ------
NM_001001484chr102655 414 12269 ----
NM_001001549chr731066 1056 183 ------
NM_001001550chr731066 1056 183 ------
NM_001001551chr9----1343 --
NM_001001555chr731066 1056 183 ------
NM_001001664chr2--23849 3237 ----
NM_001001787chr12414 61 ------
NM_001001971chr101126 ------
NM_001001974chr1021978 483 ------
NM_001002026chr331633 617 434 ------
NM_001002032chr172645 25 ------
NM_001002033chr172745 125 --123 --
NM_001002233chr822018 441 ------
NM_001002295chr101254 ------
NM_001002838chrX11345 ------
NM_001002843chr1521271 79 ------
NM_001002860chr1454294 4072 3948 3049 2978 24368 709 13919 --
NM_001002909chr1732241 459 409 1393 ----
NM_001003406chr2263187 2997 2928 2773 1071 1054 12265 ----
NM_001003407chr1085024 1733 1248 1007 968 782 316 284 ----11816
NM_001003408chr1085024 1733 1248 1007 968 782 316 284 ----11816
NM_001003652chr1873058 2590 2346 2239 1578 1359 347 37689 7653 6231 ----
NM_001003674chr18127052 7007 6060 5473 5295 4992 4957 4645 4539 1924 1889 644 36451 5782 2097 ----
NM_001003675chr18127052 7007 6060 5473 5295 4992 4957 4645 4539 1924 1889 644 36451 5782 2097 ----
NM_001003688chr41765 ------
NM_001003694chr32556 441 ------
NM_001003712chr1221611 782 23049 2516 ----
NM_001003792chr31174 ------
NM_001003793chr31174 ------
NM_001003940chr1533203 2624 310 12439 ----
NM_001003942chr1533203 2624 310 12439 ----
NM_001003943chr1533207 2628 314 12443 ----
NM_001004065chr943437 2944 2876 1392 ------
NM_001004303chr11667 ------
NM_001004303chr11667 ------
NM_001004317chr621808 1682 13880 ----
NM_001004342chr155893 5858 5685 1806 409 --11748 --
NM_001004354chr92748 51 ------
NM_001004360chr221949 1300 ------
NM_001004419chr1253505 1584 1556 1503 517 ------
NM_001004431chr171210 ------
NM_001005353chr13381 313 68 ------
NM_001005353chr13381 313 68 ------
NM_001005386chr21711 12150 ----
NM_001005404chr1743885 3736 3183 790 12986 1173 --
NM_001005417chr11545 ------
NM_001005609chrX31244 658 80 1299 ----
NM_001005611chrX1117 ------
NM_001005732chr212663 601 ------
NM_001005733chr212620 558 ------
NM_001005849chr17--1489 ----
NM_001005861chr31903 ------
NM_001005920chr163958 795 384 ------
NM_001006600chr522448 1908 ------
NM_001006610chr16--1140 ----
NM_001006617chr91935 ------
NM_001006618chr9159 124 ----
NM_001006619chr91935 ------
NM_001006620chr91935 ------
NM_001006621chr91935 ------
NM_001006623chr22382 105 12389 ----
NM_001006636chr21961 ------
NM_001006641chr92358 98 11763 ----
NM_001006642chr92358 98 11763 ----
NM_001006643chr92358 98 11763 ----
NM_001006944chr111727 ------
NM_001006946chr221313 723 ------
NM_001007024chr1733747 1571 185 12834 ----
NM_001007025chr1733747 1571 185 12834 ----
NM_001007026chr121355 ------
NM_001007027chr11193 ------
NM_001007072chr151185 ------
NM_001007097chr975045 4902 4064 1016 950 783 85 ------
NM_001007098chr11329 ------
NM_001007102chr621598 1399 ------
NM_001007156chr1541912 1720 1399 447 ------
NM_001007226chr172967 933 ------
NM_001007227chr172967 933 ------
NM_001007228chr172967 933 ------
NM_001007229chr172967 933 ------
NM_001007230chr172967 933 ------
NM_001007237chr142804 2002 908 582 1115 ----
NM_001007246chr2131866 1697 103 ------
NM_001007257chr121330 1199 11237 ----
NM_001007271chr102981 414 ------
NM_001007466chr645192 4317 1642 357 ------
NM_001007559chr181134 ------
NM_001007794chr1--1205 ----
NM_001008220chr543898 3799 3535 1519 ------
NM_001008225chr71524 ------
NM_001008239chr1863583 3348 2856 2574 989 100 ------
NM_001008392chr333240 2930 978 22261 1037 ----
NM_001008405chr721785 27 ------
NM_001008540chr22384 318 ------
NM_001008541chr1022006 1461 ------
NM_001008541chr1022006 1461 ------
NM_001008564chr13--22211 1838 ----
NM_001008738chr512875 1327 ----
NM_001008777chr171279 ------
NM_001008860chr151669 ------
NM_001008892chr151669 ------
NM_001008894chr151669 ------
NM_001008895chr1311391 ------
NM_001009552chr81237 1480 ----
NM_001009566chr11138 --11397 --
NM_001009881chr1160 ------
NM_001009882chr1160 ------
NM_001009899chr335331 5268 4820 1173 ----
NM_001009944chr1631010 871 634 ----172
NM_001009955chr11506 ------
NM_001009955chr11506 ------
NM_001009959chr222623 1722 ------
NM_001009993chr254212 3575 1630 1290 1027 ------
NM_001010857chr11112 ------
NM_001010861chr112779 22377 2295 ----
NM_001010888chrX34614 4057 3944 11756 ----
NM_001010891chr555581 1742 1176 1115 762 12296 ----
NM_001010924chr1021034 409 --1489 --
NM_001010927chr62481 374 ------
NM_001010986chrX42443 1698 1684 1538 --12193 --
NM_001011513chr434044 3057 2754 ------
NM_001011537chr332352 1838 1492 1413 ----
NM_001011551chrX--151 ----
NM_001011666chr745123 1176 452 152 16271 ----
NM_001011705chr13125 ------
NM_001011708chr212718 ------
NM_001011724chr131281 ------
NM_001011725chr131281 ------
NM_001011885chr1511366 ------
NM_001012329chr142373 2036 1847 32 ------
NM_001012410chr31448 ------
NM_001012415chr91107 ------
NM_001012418chr674214 4073 4035 3935 1610 1001 37 ------
NM_001012420chr152716 421 ------
NM_001012478chr191419 ------
NM_001012506chr31150 ------
NM_001012512chr181183 1268 ----
NM_001012513chr181194 1279 ----
NM_001012614chr41528 2305 122 ----
NM_001012643chr192525 206 ------
NM_001012751chr1031630 206 117 ------
NM_001012761chr542737 2533 2465 165 1599 ----
NM_001012958chr12455 178 ------
NM_001012958chr12455 178 ------
NM_001012968chrX2923 694 ------
NM_001012977chrX1234 11181 11101 --
NM_001013031chr1043458 3087 838 448 11321 ----
NM_001013406chr721354 1135 ------
NM_001013415chr41214 ------
NM_001013438chr31653 ------
NM_001013620chr1247449 7037 3155 917 25479 2200 ----
NM_001013629chr1042133 1953 1924 1681 ------
NM_001013690chr1222407 806 ------
NM_001013699chr12--1373 ----
NM_001013843chr152918 274 ------
NM_001014380chr1345909 5721 5250 1596 ------
NM_001014765chr111531 152 ----
NM_001014797chr1076635 6242 6075 2985 2966 2590 945 1975 ----
NM_001014809chr41678 ------
NM_001014812chr151132 ------
NM_001014839chr11238 ------
NM_001014841chr11238 ------
NM_001015045chr432468 871 444 ------
NM_001015877chrX2882 322 11917 ----
NM_001015887chr311815 1142 ----
NM_001017369chr411081 ------
NM_001017371chr211147 ------
NM_001017395chr363416 2630 2596 1246 1156 999 --1497 --
NM_001017396chr221930 159 1392 1109 --
NM_001017424chr121527 1374 11343 ----
NM_001017425chr121527 1374 11343 ----
NM_001017440chr767792 7755 6234 5331 1585 205 --16758 --
NM_001017916chr1722061 1604 ------
NM_001017917chr1722061 1604 ------
NM_001017963chr142913 162 1300 ----
NM_001017969chr92661 545 ------
NM_001017979chr41507 --1646 --
NM_001017999chr121656 423 ------
NM_001017999chr121656 423 ------
NM_001018000chr121656 423 ------
NM_001018000chr121656 423 ------
NM_001018001chr121656 423 ------
NM_001018008chr152554 519 ------
NM_001018038chr92611 78 ------
NM_001018054chr111178 ------
NM_001018057chr112483 173 ------
NM_001018064chr931577 1347 501 ------
NM_001018067chr154681 4518 3735 1956 504 24432 593 ----
NM_001018068chr154681 4518 3735 1956 504 24432 593 ----
NM_001018069chr154681 4518 3735 1956 504 24432 593 ----
NM_001018074chr533847 2750 603 ----12601
NM_001018075chr533847 2750 603 ----12601
NM_001018076chr533847 2750 603 ----12601
NM_001018077chr533847 2750 603 ----12601
NM_001018111chr742791 1394 950 414 ------
NM_001020658chr12677 233 ------
NM_001020658chr12677 233 ------
NM_001020825chr521322 225 ----176
NM_001023567chr1522357 544 ------
NM_001023587chr311105 1936 ----
NM_001024071chr143800 746 209 ------
NM_001024094chr533847 2750 603 ----12601
NM_001024226chr12321 129 11029 ----
NM_001024227chr12321 129 11029 ----
NM_001024228chr12321 129 11029 ----
NM_001024401chr1612121 ------
NM_001024463chr153881 863 778 ------
NM_001024647chr1267459 7305 4983 4879 1165 166 1938 ----
NM_001024666chrX1213 ------
NM_001024808chr1251115 911 724 301 185 12193 ----
NM_001024934chr61262 ------
NM_001024935chr61262 ------
NM_001024936chr61262 ------
NM_001024948chr111023 11371 ----
NM_001024957chr11122 ------
NM_001025076chr1055910 5869 3802 2158 1361 ------
NM_001025077chr1087268 7227 5160 4578 2719 1244 1057 639 ------
NM_001025248chr15--11264 ----
NM_001025249chr15--11264 ----
NM_001025266chr364760 4735 4596 4461 4144 82 ------
NM_001025366chr61489 ------
NM_001025366chr61489 ------
NM_001025367chr61489 ------
NM_001025367chr61489 ------
NM_001025368chr61489 ------
NM_001025368chr61489 ------
NM_001025369chr61505 ------
NM_001025369chr61505 ------
NM_001025370chr61489 ------
NM_001025370chr61489 ------
NM_001025579chr174958 883 756 423 ------
NM_001025580chrX23659 289 12730 ----
NM_001025596chr11164 ------
NM_001025616chr41518 11878 ----
NM_001025780chr91289 ------
NM_001029858chr622768 581 1317 ----
NM_001029863chr642190 984 314 62 ------
NM_001029875chr51216 ------
NM_001029882chr11494 ------
NM_001029882chr11494 ------
NM_001029883chr252378 2361 2224 1983 777 ------
NM_001030006chr173851 269 33 ------
NM_001030007chr1643984 3832 2631 598 12856 ----
NM_001030055chr1411555 44315 3602 1771 695 ----
NM_001030287chr13993 483 84 ------
NM_001031690chr772622 2542 1165 970 937 501 396 11059 ----
NM_001031695chr2214979 22076 1523 ----
NM_001031700chr442372 2090 656 316 ------
NM_001031710chr71920 11076 ----
NM_001031712chr6--1395 ----
NM_001031716chr2--1951 ----
NM_001031717chr3--3824 772 143 ----
NM_001031804chr162540 237 ------
NM_001031812chr531735 150 50 --11436 --
NM_001032221chr941361 1237 1170 717 ------
NM_001032282chr821002 330 ------
NM_001032288chr2011338 ------
NM_001032293chr17158 ------
NM_001032296chr1311065 12290 ----
NM_001032367chr152462 431 ------
NM_001033045chr22570 114 13555 ----
NM_001033057chr32842 352 ------
NM_001033059chr61237 ------
NM_001033081chr131704 490 217 21335 340 ----
NM_001033082chr131704 490 217 21335 340 ----
NM_001033085chr2153 ------
NM_001033117chr374519 4497 4431 4246 1507 1014 35 14380 --11557
NM_001033506chr11196 ------
NM_001033507chr131880 1337 129 ------
NM_001033551chr1733931 1292 910 13238 ----
NM_001033557chr22341 133 ------
NM_001033566chr171985 ------
NM_001033568chr171985 ------
NM_001033578chr81183 ------
NM_001033756chr62727 423 ------
NM_001033756chr62727 423 ------
NM_001034833chr51292 ------
NM_001034837chr51774 ------
NM_001034838chr51774 ------
NM_001034850chr5--2416 248 ----
NM_001034852chr1451762 1472 424 395 339 1609 ----
NM_001034954chr1023247 610 ------
NM_001034955chr1023247 610 ------
NM_001034956chr1023247 610 ------
NM_001034957chr1023247 610 ------
NM_001035254chr93774 549 464 --11932 --
NM_001035267chr12----1288 --
NM_001037132chr731713 504 111 ------
NM_001037133chr731713 504 111 ------
NM_001037163chr74872 760 107 44 ------
NM_001037164chr731937 1770 1374 1776 ----
NM_001037172chr331034 925 911 11344 ----
NM_001037317chr112779 22377 2295 ----
NM_001037331chr181347 ------
NM_001037334chr1832278 502 383 1867 ----
NM_001037553chr2174707 4603 4193 3985 3219 3208 428 1772 ----
NM_001037738chr51207 ------
NM_001037872chr21634 ------
NM_001038702chr521723 830 --11919 --
NM_001039395chr93269 188 93 11989 ----
NM_001039459chr711168 1930 ----
NM_001039465chr141514 ------
NM_001039467chr203449 151 70 183 ----
NM_001039538chr213675 ------
NM_001039547chr323215 1810 26413 1408 ----
NM_001039574chr131068 1020 947 1706 ----
NM_001039585chr143738 3683 146 110 13779 ----
NM_001039590chrX63243 3112 2672 1411 717 644 1159 ----
NM_001039591chrX63243 3112 2672 1411 717 644 1159 ----
NM_001039618chr1165046 4703 4689 1470 1367 250 ------
NM_001039690chr1621826 1634 ------
NM_001039716chr12288 42 1899 ----
NM_001039840chrX3878 710 89 ------
NM_001039888chr11603 ------
NM_001039937chr1321228 1017 1900 ----
NM_001040001chr611912 1416 ----
NM_001040056chr16132 1677 ----
NM_001040057chr731189 1139 995 ------
NM_001040092chr8--1362 ----
NM_001040101chr43409 363 273 ------
NM_001040108chr1412465 22164 2127 ----
NM_001040110chr731726 1217 430 ------
NM_001040135chr73757 732 525 1808 1190 --
NM_001040142chr222237 406 12157 ----
NM_001040143chr222237 406 12157 ----
NM_001040144chr1621826 1634 ------
NM_001040146chr1621826 1634 ------
NM_001040152chr775071 3659 3617 3116 2019 1515 260 45122 4365 3473 314 13516 --
NM_001040153chr131972 ------
NM_001040158chr51535 ------
NM_001040167chr721193 805 ------
NM_001040181chr33907 462 426 ------
NM_001040182chr33907 462 426 ------
NM_001040183chr33907 462 426 ------
NM_001040199chr33907 462 426 ------
NM_001040200chr33907 462 426 ------
NM_001040214chr611981 1740 ----
NM_001040284chr1623625 888 ------
NM_001040402chr451006 897 264 164 70 12617 ----
NM_001040429chr1343608 2764 2420 1169 ------
NM_001040446chr542657 2520 2337 1848 --1714 --
NM_001040450chr151221 ------
NM_001040453chr151221 ------
NM_001040458chr5181 1154 ----
NM_001040619chr121443 534 11068 ----
NM_001040624chr842634 2476 2461 1757 1411 ----
NM_001040625chr842634 2476 2461 1757 1411 ----
NM_001040626chr842634 2476 2461 1757 1411 ----
NM_001040627chr842634 2476 2461 1757 1411 ----
NM_001040628chr842634 2476 2461 1757 1411 ----
NM_001040629chr842634 2476 2461 1757 1411 ----
NM_001040630chr842634 2476 2461 1757 1411 ----
NM_001040633chr71236 ------
NM_001040694chr1121049 359 1957 ----
NM_001040712chr922657 684 ------
NM_001040715chr163831 417 353 ------
NM_001040875chr832412 2397 896 --11929 --
NM_001041chr3--125 ----
NM_001042355chr1645371 3983 3536 1145 ------
NM_001042388chr182820 622 ------
NM_001042412chr1645371 3983 3536 1145 ------
NM_001042453chrX11516 ------
NM_001042473chr101116 ------
NM_001042475chr6150 ------
NM_001042478chr1168 ------
NM_001042481chr1431734 616 505 12437 ----
NM_001042492chr1713247 11247 ----
NM_001042494chr1532961 852 531 --13141 --
NM_001042495chr1532961 852 531 --13141 --
NM_001042496chr1532961 852 531 --13141 --
NM_001042497chr1532961 852 531 --13141 --
NM_001042510chr842169 2054 1352 140 ------
NM_001042511chr842169 2054 1352 140 ------
NM_001042537chrX32263 1996 593 12285 ----
NM_001042555chr1274283 4025 1290 1194 1061 605 208 14635 ----
NM_001042599chr256435 5963 5551 5065 929 36653 2131 308 ----
NM_001042601chr333082 705 378 ------
NM_001042603chr1263797 2040 1535 1039 994 755 13997 ----
NM_001042604chr384802 4480 4262 4231 3527 3391 563 158 14487 ----
NM_001042616chr42212 23 ------
NM_001042669chr41518 11878 ----
NM_001042728chr1231055 1016 25 ------
NM_001042749chrX11811 ----1250
NM_001042750chrX11811 ----1250
NM_001042751chrX11811 ----1250
NM_001043318chr1444007 3758 1000 691 ------
NM_001043351chr142170 877 587 490 ------
NM_001044305chr621221 507 ------
NM_001044385chr283153 2930 2820 2716 1170 1015 946 165 23407 1213 13702 --
NM_001044722chr531735 150 50 --11436 --
NM_001044723chr531735 150 50 --11436 --
NM_001049chr1422497 121 --1488 --
NM_001068chr3146 ------
NM_001069chr6145 ------
NM_001071775chr131331 11926 ----
NM_001077628chr11510 ------
NM_001079874chr12264 113 ------
NM_001083620chr442446 2310 1808 113 145 ----
NM_001083621chr164565 4220 4064 1234 160 87 23956 649 14573 --
NM_001095chr1241611 1338 629 312 ------
NM_001100108chr198250 7824 7710 2926 2559 1081 830 524 480 28177 494 ----
NM_001106chr3148023 7817 7788 7247 3776 3322 2971 2382 2334 1672 1513 1287 970 586 49355 8726 3399 3107 ----
NM_001113490chrX22752 426 ------
NM_001116chr1622097 68 --12268 --
NM_001117chr182668 331 12207 ----
NM_001122chr9128 ------
NM_001128chr1643984 3832 2631 598 12856 ----
NM_001144chr162452 114 11360 ----
NM_001146chr822118 277 ------
NM_001148chr422060 384 ------
NM_001149chr1031267 1159 489 1283 ----
NM_001154chr4128 ------
NM_001167chrX26710 2613 ------
NM_001172chr142288 85 2721 559 ----
NM_001173chr1411555 44315 3602 1771 695 ----
NM_001174chrX21805 142 ------
NM_001186chr2122113 884 12638 ----
NM_001204chr267758 7523 7504 5966 2320 1861 17282 ----
NM_001206chr943148 3070 594 468 12739 ----
NM_001222chr103652 600 194 ------
NM_001241chr21196 22463 979 ----
NM_001241chr21196 22463 979 ----
NM_001256chr1732668 1849 698 ------
NM_001257chr1621437 1076 1538 1995 --
NM_001259chr7106382 5601 4466 4153 2384 2339 2088 1981 1186 120 12112 ----
NM_001271chr1523244 2831 1119 ----
NM_001282chr173851 269 33 ------
NM_001284chr51172 ------
NM_001290chr41746 ------
NM_001304chr1743641 3020 771 620 ------
NM_001312chr141471 1488 ----
NM_001313chr41678 ------
NM_001328chr41528 2305 122 ----
NM_001329chr102657 538 ------
NM_001331chr112726 389 12178 ----
NM_001332chr531079 540 418 ------
NM_001356chrX22446 220 12506 ----
NM_001358chr41336 ------
NM_001364chr1113563 14701 13019 --
NM_001385chr81168 ------
NM_001387chr533113 2511 531 32060 1956 542 ----
NM_001390chr181927 43522 3209 2270 378 --12435
NM_001392chr182230 55 ------
NM_001396chr2122555 2267 ------
NM_001399chrX31244 658 80 1299 ----
NM_001406chr1751631 1546 1326 1213 136 ------
NM_001408chr121629 421 ------
NM_001419chr1934849 3255 1571 13464 ----
NM_001420chr1922563 246 ------
NM_001427chr711798 ------
NM_001431chr62397 378 ------
NM_001438chr112252 ------
NM_001448chrX21756 1401 ------
NM_001449chrX11013 1950 ----
NM_001453chr611719 11731 ----
NM_001455chr633983 3142 1320 ------
NM_001460chr121068 155 ------
NM_001463chr2--2784 290 ----
NM_001483chr73905 231 111 ------
NM_001493chrX2571 480 ------
NM_001495chr821134 899 ------
NM_001497chr952669 2568 935 799 51 12452 ----
NM_001508chr21731 1943 ----
NM_001518chr71764 --1789 --
NM_001530chr14--11048 ----
NM_001542chr142804 2002 908 582 1115 ----
NM_001546chr621076 249 ------
NM_001584chr1141118 1008 981 832 ------
NM_001587chrX22078 383 ------
NM_001604chr11--1106 ----
NM_001610chr113797 606 206 ----1574
NM_001614chr17--1520 ----
NM_001614chr17--1520 ----
NM_001616chr24909 797 510 444 ------
NM_001620chr112830 810 ------
NM_001634chr61237 ------
NM_001635chr741070 1030 831 821 1214 ----
NM_001656chr5--11485 ----
NM_001658chr12321 129 11029 ----
NM_001662chr71393 ------
NM_001663chr142859 428 ------
NM_001664chr3148 ------
NM_001668chr12799 144 ------
NM_001674chr13993 483 84 ------
NM_001677chr131052 859 422 ------
NM_001679chr3140 ------
NM_001682chr1231079 545 398 22439 407 ----
NM_001683chr31180 ------
NM_001690chr322411 2016 ------
NM_001699chr191321 ------
NM_001701chr911004 ------
NM_001706chr311031 1419 ----
NM_001709chr1142600 2328 942 502 1507 ----
NM_001718chr621151 934 ------
NM_001730chr1321498 209 11212 ----
NM_001730chr1321498 209 11212 ----
NM_001742chr71698 ------
NM_001753chr711195 ------
NM_001759chr1244679 4445 3755 611 ------
NM_001773chr131416 1261 502 ------
NM_001789chr331523 1273 662 ------
NM_001821chr153800 1456 877 128 24 31257 1168 400 ----
NM_001826chr12335 43 1312 ----
NM_001830chrX21419 247 ----11030
NM_001839chr11191 ------
NM_001842chr91564 ------
NM_001851chr62509 24 ------
NM_001854chr11282 ------
NM_001858chr654034 1808 1692 866 826 --13265 --
NM_001859chr943953 3407 3154 3065 ------
NM_001860chr921124 240 ------
NM_001876chr111496 ------
NM_001895chr2021177 801 ------
NM_001904chr321035 280 ------
NM_001915chr1722061 1604 ------
NM_001933chr143948 414 109 ----1547
NM_001938chr121916 418 ------
NM_001939chrX33635 2424 1526 12827 ----
NM_001940chr121355 ------
NM_001946chr124839 351 207 119 ------
NM_001948chr15--11264 ----
NM_001949chr63693 335 78 12600 ----
NM_001967chr3----138 --
NM_001968chr41837 ------
NM_001981chr122337 579 ------
NM_001987chr1253900 1452 934 840 298 13186 ----
NM_001995chr421275 396 11252 ----
NM_001999chr51961 ------
NM_002006chr431688 824 753 1220 ----
NM_002015chr131224 ------
NM_002017chr1121079 1011 ----1958
NM_002024chrX11608 ------
NM_002025chrX78326 7117 6725 6716 2571 2086 792 17864 ----
NM_002031chr62831 593 ------
NM_002040chr2112820 1742 ----
NM_002048chr941260 1219 966 426 ------
NM_002051chr101254 ------
NM_002063chrX21254 343 ------
NM_002073chr2221570 1295 1278 ----
NM_002074chr131556 1282 203 1563 ----
NM_002077chr912104 ------
NM_002086chr1731987 487 425 ------
NM_002091chr181183 1268 ----
NM_002092chr455058 3777 1647 716 529 13873 ----
NM_002107chr13487 472 441 ------
NM_002126chr171594 24124 1344 ----
NM_002128chr1362524 2445 2263 473 415 327 ------
NM_002137chr782418 2402 2296 1711 842 639 592 479 ------
NM_002140chr91178 ------
NM_002141chr72579 200 ------
NM_002148chr21563 ------
NM_002154chr5--152 ----
NM_002158chr233446 1500 513 1168 ----
NM_002181chr22537 34 ------
NM_002192chr7138 ------
NM_002193chr2--11879 ----
NM_002196chr202350 214 ------
NM_002196chr202350 214 ------
NM_002199chr41139 ------
NM_002202chr51397 ------
NM_002207chr32493 116 ------
NM_002214chr744604 2057 350 229 14782 ----
NM_002221chr111983 1390 ----
NM_002223chr1253735 3506 1572 988 943 23447 532 ----
NM_002232chr1124 1931 ----
NM_002241chr132101 1971 1130 ------
NM_002242chr221568 1291 ------
NM_002247chr1011778 21492 155 12341 --
NM_002264chr324327 1511 1653 ----
NM_002265chr171477 ----1193
NM_002267chr133785 764 365 ------
NM_002268chr331899 1209 597 ------
NM_002270chr514493 11212 ----
NM_002271chr1332342 983 153 12012 ----
NM_002293chr132680 2201 111 ------
NM_002296chr111134 ------
NM_002309chr2252193 2153 1039 535 23 ------
NM_002310chr576187 2546 2348 1156 942 695 625 46529 6383 4215 1903 12572 --
NM_002313chr1085024 1733 1248 1007 968 782 316 284 ----11816
NM_002334chr1151885 1317 710 680 151 ------
NM_002356chr632807 2060 496 ------
NM_002359chr1764265 3524 3308 2884 966 293 ------
NM_002360chr732624 543 412 ----12209
NM_002373chr1541343 1297 845 158 ------
NM_002374chr213675 ------
NM_002375chr342216 1861 1682 234 1753 ----
NM_002380chr81379 ------
NM_002381chr21778 ------
NM_002384chr181965 ------
NM_002397chr5--1399 ----
NM_002398chr22956 575 ------
NM_002399chr1511281 11353 ----
NM_002401chr1742239 1817 747 713 ------
NM_002428chr1611181 ------
NM_002430chr2272415 2014 1667 1010 980 874 374 ------
NM_002442chr1211449 ------
NM_002444chrX31797 1256 325 ------
NM_002460chr643739 2580 1242 1115 ------
NM_002473chr222462 102 21322 1245 ----
NM_002480chr1221129 606 ------
NM_002494chr4149 ------
NM_002499chr1542429 1960 636 332 1597 ----
NM_002500chr211194 ------
NM_002501chr1911318 ------
NM_002509chr201555 ------
NM_002515chr1411381 ------
NM_002518chr211083 ------
NM_002519chr112584 144 ------
NM_002520chr52127 74 ------
NM_002537chr152385 264 --191 --
NM_002541chr73866 154 113 ----1368
NM_002546chr8123 ------
NM_002567chr122744 597 ------
NM_002577chr344023 3946 3643 562 ------
NM_002581chr945529 5204 3900 1275 ------
NM_002582chr164697 374 127 34 1232 ----
NM_002588chr521624 237 ------
NM_002594chr2012133 1408 ----
NM_002595chr1211576 1174 ----
NM_002608chr2231223 372 53 ------
NM_002609chr521852 112 ------
NM_002613chr16135185 4893 4886 4590 4341 4015 3311 1726 1431 1205 629 446 399 14382 ----
NM_002645chr1132606 1911 220 ------
NM_002646chr141734 694 387 176 ------
NM_002655chr835277 4748 572 24269 4034 ----
NM_002657chr2073437 3269 3226 2899 1068 564 449 1629 ----
NM_002670chr321646 346 ------
NM_002699chr11317 1472 ----
NM_002710chr121793 ------
NM_002716chr1113582 13168 ----
NM_002730chr1921374 1151 11145 ----
NM_002731chr122880 248 ------
NM_002732chr92480 321 ------
NM_002734chr1721970 412 1229 ----
NM_002745chr2234068 3530 1543 ------
NM_002753chr41744 ------
NM_002755chr153799 344 322 ------
NM_002756chr171976 ------
NM_002768chr1631603 1115 1019 --1499 --
NM_002813chr1251470 1451 1330 1283 489 2538 344 ----
NM_002814chrX3277 220 42 ------
NM_002821chr61755 ------
NM_002823chr22646 601 ------
NM_002834chr1253849 3553 899 694 309 ------
NM_002839chr922657 684 ------
NM_002840chr131556 1433 1234 1107 ----
NM_002843chr1133387 1330 175 ------
NM_002844chr6165 ------
NM_002848chr121834 21186 1092 ----
NM_002849chr1211032 1434 ----
NM_002852chr31244 ------
NM_002865chr81255 ------
NM_002866chr191530 --1441 --
NM_002868chr122846 185 ------
NM_002869chr1121555 535 ------
NM_002886chr344354 4230 3283 1064 ------
NM_002890chr51351 ------
NM_002892chr1411452 ------
NM_002893chrX1300 ------
NM_002895chr202825 248 ------
NM_002897chr24635 628 511 209 ------
NM_002906chr1112121 ------
NM_002912chr61625 ------
NM_002923chr11489 ------
NM_002924chr12492 191 ------
NM_002941chr3----1223 --
NM_002942chr311059 ------
NM_002950chr3148 ------
NM_002958chr31903 ------
NM_002966chr1140 ------
NM_002968chr163721 287 276 ------
NM_002970chrX2132 74 ------
NM_002971chr311134 ------
NM_002973chr121227 ------
NM_002994chr421453 1431 2315 247 ----
NM_002997chr221313 723 ------
NM_002998chr842170 2029 394 325 1462 ----
NM_002999chr2031925 1679 1414 ------
NM_003003chr171226 ------
NM_003009chr192273 123 ------
NM_003010chr1721737 1677 11952 ----
NM_003011chr911484 ------
NM_003016chr1741737 1674 251 203 21639 1387 ----
NM_003017chr62437 124 ------
NM_003026chr921147 256 --11355 --
NM_003028chr973789 3571 3154 2908 788 371 150 11219 13395 --
NM_003030chr311296 11910 ----
NM_003031chr16--1140 ----
NM_003043chr331533 427 39 ------
NM_003045chr1374902 3069 1875 1215 1161 1035 548 13101 ----
NM_003047chr121361 1120 ------
NM_003051chr131716 1581 621 ------
NM_003068chr81936 ------
NM_003071chr321963 689 ------
NM_003076chr121111 1600 ----
NM_003081chr204922 319 128 33 1447 ----
NM_003087chr101227 ------
NM_003091chr20194 ------
NM_003093chr6172 ------
NM_003107chr612292 --11787 --
NM_003108chr287085 6926 6237 2290 1668 1642 1324 1004 25186 1261 1448 --
NM_003111chr211147 ------
NM_003112chr7--23116 2696 ----
NM_003113chr21319 1772 ----
NM_003128chr222458 317 ----12573
NM_003136chr141385 ------
NM_003137chr621817 463 12169 ----
NM_003144chr63733 561 315 21829 1562 ----
NM_003150chr1722378 2270 ------
NM_003156chr112323 273 2939 237 ----
NM_003161chr1742713 2402 1133 1056 ------
NM_003178chr32867 238 11650 12166 --
NM_003179chrX1122 ------
NM_003189chr133226 2390 952 2352 297 ----
NM_003199chr1814977 ------
NM_003200chr1942004 732 682 449 1114 ----
NM_003204chr1711802 ------
NM_003211chr1221397 1191 152 ----
NM_003221chr621366 584 14146 ----
NM_003223chr161534 ------
NM_003224chr204978 849 675 378 ------
NM_003247chr631649 1276 809 1443 ----
NM_003250chr172312 189 ------
NM_003257chr1511269 ------
NM_003262chr334970 1345 1053 ------
NM_003269chr621171 826 ------
NM_003286chr202813 176 ------
NM_003295chr131184 ------
NM_003297chr12121 1266 ----
NM_003298chr326186 4620 ------
NM_003319chr21874 --1639 --
NM_003325chr222446 124 ------
NM_003336chrX1117 ------
NM_003337chr5--1405 ----
NM_003338chr101354 ------
NM_003340chr41885 21289 391 ----
NM_003341chr3--1593 ----
NM_003344chr721636 464 ------
NM_003345chr161530 ------
NM_003348chr1221331 498 2578 314 ----
NM_003349chr2011338 ------
NM_003356chr111867 ------
NM_003369chr1132032 1124 837 11097 ----
NM_003370chr191616 ------
NM_003371chr92519 374 ------
NM_003373chr1021510 444 ------
NM_003374chr51812 ------
NM_003376chr61489 ------
NM_003376chr61489 ------
NM_003387chr22521 366 ------
NM_003390chr113938 747 284 ------
NM_003392chr344221 2821 1611 1540 1755 ----
NM_003400chr21638 ------
NM_003406chr8168 1622 ----
NM_003410chrX2553 108 ------
NM_003411chrY21514 103 11622 21146 163 --
NM_003412chr31451 ------
NM_003413chrX21801 1452 ------
NM_003418chr32778 523 ------
NM_003457chr17158 ------
NM_003458chr353957 3878 3470 3436 49 ------
NM_003459chr22671 564 ------
NM_003463chr62659 624 1216 ----
NM_003467chr22384 318 ------
NM_003468chr294392 3957 3154 2873 2800 722 455 338 100 ------
NM_003469chr2--1170 ----
NM_003470chr1631778 322 142 ------
NM_003471chr341788 1763 242 149 ------
NM_003472chr641282 496 296 169 ------
NM_003474chr102235 149 --1786 --
NM_003477chr111260 ------
NM_003478chr1143249 3144 3065 214 1412 ----
NM_003482chr1222058 705 --11903 --
NM_003483chr1232832 2664 239 ------
NM_003487chr171226 ------
NM_003488chr172881 245 ------
NM_003489chr2132390 2330 2139 ------
NM_003490chr22----11047 --
NM_003507chr221875 316 ------
NM_003513chr6126 ------
NM_003558chr91213 ------
NM_003563chr172967 933 ------
NM_003566chr1221062 412 ----1814
NM_003569chr61617 ------
NM_003574chr1845667 1660 1549 22 24639 369 ----
NM_003576chr1311065 12290 ----
NM_003580chr81476 ------
NM_003583chr1263778 3515 2660 2631 1126 701 ------
NM_003589chr1311391 ------
NM_003590chr243285 3031 752 544 13242 ----
NM_003591chr101123 ------
NM_003603chr43427 341 164 ----188
NM_003615chr353245 3131 2663 445 94 ------
NM_003620chr171205 ------
NM_003629chr143400 3246 2757 456 ------
NM_003630chr61671 ------
NM_003631chr10--2158 61 ----
NM_003632chr171241 1314 ----
NM_003633chr572325 2057 1842 1662 771 715 336 2646 401 ----
NM_003636chr121575 69 ------
NM_003642chr2153 ------
NM_003644chr1776588 4944 4531 1325 1157 1082 248 25703 5065 --11690
NM_003654chr111613 ------
NM_003659chr21298 2267 233 ----
NM_003668chr121117 1249 ----
NM_003670chr3--21221 464 ----
NM_003671chr922361 234 ------
NM_003672chr12427 27 ------
NM_003684chr15892 851 711 326 204 ------
NM_003685chr192782 640 ------
NM_003687chr521062 930 ------
NM_003690chr21474 ------
NM_003692chr92919 645 ------
NM_003702chr81220 1268 ----
NM_003704chr41223 --1484 --
NM_003705chr2----1190 --
NM_003709chr2----1337 --
NM_003710chr152462 431 ------
NM_003713chr121078 24 ------
NM_003714chr532216 2117 417 ------
NM_003718chr71185 ------
NM_003728chr41270 ------
NM_003735chr521624 237 ------
NM_003736chr521624 237 ------
NM_003749chr1332327 528 223 ------
NM_003750chr101958 ------
NM_003758chr151249 21242 1091 ----
NM_003758chr151249 21242 1091 ----
NM_003760chr11628 ------
NM_003768chr121800 165 ------
NM_003774chr1232682 733 184 ------
NM_003780chr11545 ------
NM_003794chr321088 336 ------
NM_003795chr61225 ------
NM_003797chr11140 ------
NM_003799chr1842993 1792 989 156 1938 ----
NM_003800chr611589 --156 --
NM_003819chr11200 ------
NM_003822chr111230 ------
NM_003827chr191436 ------
NM_003829chr931064 879 87 ------
NM_003831chr1831817 1794 1514 ------
NM_003846chr11711 ------
NM_003872chr211964 22338 2144 ----
NM_003873chr1042087 598 514 69 ------
NM_003877chr122888 853 1981 ----
NM_003885chr1721007 586 ------
NM_003893chr101360 ------
NM_003895chr2112081 22206 1604 ----
NM_003908chr2041322 1045 165 80 11214 ----
NM_003909chr872787 2431 1977 1866 802 379 314 ------
NM_003913chr642625 1158 1027 378 12774 ----
NM_003931chr61262 ------
NM_003932chr2231653 705 591 ------
NM_003941chr72708 107 --12292 --
NM_003942chr111727 ------
NM_003947chr311333 ------
NM_003953chr122304 251 ------
NM_003956chr10140 ------
NM_003958chr643923 3883 3046 2750 23734 2445 ----
NM_003968chr31634 ------
NM_003980chr611384 1569 ----
NM_003983chr1654063 3122 1070 848 670 33977 3421 990 14029 --
NM_003988chr1011456 --11448 --
NM_003994chr1223270 1697 ------
NM_004024chr121352 443 1977 ----
NM_004027chr2--128 ----
NM_004037chr12835 73 ------
NM_004040chr221254 941 ------
NM_004050chr1432166 1886 817 1443 ----
NM_004055chr1141394 902 298 123 ------
NM_004061chr51438 ------
NM_004067chr72523 225 ------
NM_004085chrX154 ------
NM_004087chr311280 11853 ----
NM_004090chr1733424 2657 216 ------
NM_004093chr1342756 1252 692 248 12158 13085 1915
NM_004098chr101511 1376 ----
NM_004102chr12574 558 ------
NM_004103chr82616 68 1623 ----
NM_004107chr192177 55 ------
NM_004112chr1721647 642 ------
NM_004114chrX2875 53 ------
NM_004115chr131125 ------
NM_004124chr1412842 ------
NM_004133chr821981 471 1116 22038 972 --
NM_004136chr1513275 ------
NM_004156chr81237 1480 ----
NM_004157chr32592 124 ------
NM_004161chr211357 ------
NM_004170chr911789 11852 ----
NM_004171chr1149001 6480 3477 177 17995 ----
NM_004181chr41107 ------
NM_004185chr1--1186 ----
NM_004210chr1022146 543 ------
NM_004225chr81419 11019 ----
NM_004228chr19----1148 --
NM_004229chrX1743 ------
NM_004232chr1833563 3107 3040 ------
NM_004236chr151229 ------
NM_004238chr21280 ------
NM_004241chr101228 ------
NM_004251chrX1220 ------
NM_004261chr11368 ------
NM_004272chr541993 1710 1366 1314 ------
NM_004274chr1422109 751 ------
NM_004277chr611569 ------
NM_004279chr732078 1983 805 ------
NM_004291chr51138 ------
NM_004294chr131701 ------
NM_004302chr1242942 900 701 581 ------
NM_004305chr22432 373 ------
NM_004311chr101113 1467 ----
NM_004326chr11489 ------
NM_004330chr1531120 167 54 ------
NM_004331chr822569 722 ------
NM_004338chr18127052 7007 6060 5473 5295 4992 4957 4645 4539 1924 1889 644 36451 5782 2097 ----
NM_004342chr72511 237 ------
NM_004349chr821312 380 ------
NM_004370chr621698 660 ------
NM_004379chr231291 1195 591 1476 ----
NM_004384chr531735 150 50 --11436 --
NM_004386chr1912232 ------
NM_004393chr32508 61 --1744 --
NM_004397chr1133959 2648 1172 23808 1635 ----
NM_004405chr21258 ------
NM_004408chr93489 446 56 --1330 --
NM_004411chr72591 106 ------
NM_004412chr1065037 4426 4282 3755 2267 1139 15663 15747 --
NM_004414chr2121092 568 --11495 --
NM_004423chr322127 830 ------
NM_004429chrX31147 1084 594 1400 ----
NM_004431chr1167 ------
NM_004432chr911484 1454 ----
NM_004436chr11593 ------
NM_004438chr21308 ------
NM_004440chr631449 626 465 ------
NM_004449chr2121126 535 1578 ----
NM_004454chr352039 1986 1910 568 136 12062 ----
NM_004457chr221716 507 ------
NM_004458chrX31764 1006 156 ------
NM_004459chr1721357 48 ------
NM_004461chr191185 ------
NM_004464chr41509 ------
NM_004480chr141543 ------
NM_004481chr142579 2450 904 797 11077 ----
NM_004483chr16154 ------
NM_004487chr3--1931 ----
NM_004494chr1145 11118 ----
NM_004498chr152286 275 ------
NM_004502chr171383 ------
NM_004504chr2174 1399 ----
NM_004505chr1732021 393 190 ------
NM_004508chr1021120 815 ------
NM_004514chr1782959 2654 2599 2520 1051 719 321 292 ------
NM_004516chr192288 80 ------
NM_004535chr2011627 ------
NM_004540chr211192 ------
NM_004561chr1141825 1710 600 221 ------
NM_004571chr2133412 2777 1296 23001 342 ----
NM_004575chr451456 1448 621 290 240 ------
NM_004576chr51341 ------
NM_004582chr11421 ------
NM_004586chrX74495 4242 3439 3404 3317 636 128 1750 ----
NM_004588chr1113652 --1339 --
NM_004593chr32683 157 ------
NM_004595chrX2359 59 ------
NM_004596chr19------1180
NM_004598chr523185 3043 ------
NM_004603chr72777 395 ------
NM_004612chr954411 3784 3104 943 312 ------
NM_004631chr111178 ------
NM_004634chr32556 441 ------
NM_004651chrX1363 ------
NM_004654chrY11373 ------
NM_004657chr2130 ------
NM_004663chr1511433 ------
NM_004667chr15161 ------
NM_004673chr11988 ------
NM_004687chr1752087 2066 2012 1911 1732 ------
NM_004697chr921070 50 ------
NM_004703chr1731731 456 403 --1277 --
NM_004719chr1212842 11161 ----
NM_004725chr1011448 21015 530 ----
NM_004726chrX64973 4691 3609 1334 689 533 24919 713 ----
NM_004729chrX32163 578 59 ------
NM_004730chr521463 364 ------
NM_004737chr2231281 883 36 --158 --
NM_004739chr111654 ------
NM_004742chr311778 --11750 --
NM_004745chr846351 5560 2114 2090 14801 ----
NM_004748chr1522687 827 1136 ----
NM_004768chr1172 ------
NM_004774chr171475 ------
NM_004776chr2033000 2965 1309 42840 2558 965 771 ----
NM_004779chr5--1351 ----
NM_004796chr1432162 1690 256 ------
NM_004798chr2042650 2545 917 164 23292 2635 ----
NM_004815chr114463 23825 1760 ----
NM_004831chr191867 ------
NM_004834chr223399 237 ------
NM_004835chr3--1831 ----
NM_004835chr3--1831 ----
NM_004840chrX51893 1763 638 198 153 ------
NM_004845chrX44006 3478 1370 363 ------
NM_004857chr1423649 3246 ------
NM_004859chr1732471 849 681 22416 1226 ----
NM_004865chr61170 1272 ----
NM_004871chr1733747 1571 185 12834 ----
NM_004879chr111383 ------
NM_004884chr153585 436 374 1140 ----
NM_004887chr511073 ------
NM_004893chr51535 ------
NM_004898chr4--32864 2198 1969 ----
NM_004904chr745123 1176 452 152 16271 ----
NM_004911chr71488 ------
NM_004912chr721354 1135 ------
NM_004947chr332607 2254 434 ------
NM_004953chr31384 ------
NM_004956chr782900 1392 1116 1062 951 741 567 399 13323 ----
NM_004965chr212561 523 ------
NM_004968chr7187 ------
NM_004973chr681590 1569 1390 1324 583 485 89 74 ------
NM_004976chr1113468 --1703 --
NM_004978chr141731 1683 1610 1236 11369 ----
NM_004985chr1214465 33915 3578 1079 ----
NM_004992chrX87619 6961 5313 2463 2203 1945 307 52 37845 6365 2718 ----
NM_004992chrX87619 6961 5313 2463 2203 1945 307 52 37845 6365 2718 ----
NM_004999chr623732 208 21075 684 ----
NM_005010chr731713 504 111 ------
NM_005011chr731726 1217 430 ------
NM_005016chr12136 ------
NM_005025chr31213 ------
NM_005027chr1911209 ------
NM_005032chrX31015 839 292 ------
NM_005045chr71635 ------
NM_005056chr1254041 1779 1283 1238 999 14241 ----
NM_005063chr1023386 394 13612 ----
NM_005065chr1435091 4055 3717 ------
NM_005067chr32277 212 ------
NM_005068chr6--11386 ----
NM_005069chr211109 ------
NM_005078chr1521499 536 124 ----
NM_005088chrX1735 ------
NM_005095chr132063 833 67 1623 ----
NM_005105chr151344 725 461 298 87 ------
NM_005116chr2064159 3752 3284 536 509 148 --11728 --
NM_005119chr131193 1024 249 --1162 --
NM_005120chrX2203 163 ------
NM_005134chr182820 622 ------
NM_005135chr1532961 852 531 --13141 --
NM_005151chr1832278 502 383 1867 ----
NM_005153chr162807 739 ------
NM_005156chr965001 4177 3908 1969 682 314 ------
NM_005171chr1211316 ------
NM_005180chr10--11537 1389 --
NM_005187chr16173 ------
NM_005194chr201445 ------
NM_005197chr1465622 5203 4096 2353 447 243 1955 ----
NM_005198chr221184 ------
NM_005201chr321060 366 ------
NM_005207chr2283467 3452 3177 3154 2989 1289 967 382 --13524 --
NM_005219chr53630 474 239 ------
NM_005221chr7150 ------
NM_005233chr312437 ------
NM_005234chr19124 ------
NM_005235chr256435 5963 5551 5065 929 36653 2131 308 ----
NM_005238chr1143052 2406 1370 558 ------
NM_005245chr41604 1276 167 --
NM_005249chr141815 ------
NM_005256chr111914 ------
NM_005261chr8140 1405 ----
NM_005277chr411317 ------
NM_005296chrX1154 ------
NM_005311chr731066 1056 183 ------
NM_005318chr2231259 1157 436 ------
NM_005324chr1721796 1330 1373 ----
NM_005329chr1632025 1493 96 ------
NM_005334chrX21586 190 --1119 --
NM_005339chr431730 1671 953 33855 3831 3472 ----
NM_005342chrX32216 563 287 12437 ----
NM_005347chr931596 145 21 11713 ----
NM_005348chr142913 162 1300 ----
NM_005349chr41255 --1139 --
NM_005359chr1846115 5364 3990 2110 --14730 --
NM_005374chr172468 112 22180 816 ----
NM_005387chr112189 62 ------
NM_005388chr931532 1139 95 ------
NM_005392chr921722 1437 ------
NM_005397chr742791 1394 950 414 ------
NM_005398chr1011150 ----1985
NM_005399chr134341 3474 1610 ------
NM_005406chr182129 86 ------
NM_005407chr142559 383 ------
NM_005415chr21311 ------
NM_005436chr1063628 1290 1230 1059 767 404 13509 1263 --
NM_005440chr17----13278 --
NM_005442chr32623 67 1459 ----
NM_005443chr4--1504 ----
NM_005455chr1--1539 ----
NM_005493chr61213 ------
NM_005497chr1775347 4675 4050 1442 848 367 112 ------
NM_005499chr191174 ------
NM_005502chr933042 1304 654 --13093 --
NM_005509chr521209 219 ------
NM_005520chr5182 ------
NM_005537chr132788 741 ------
NM_005539chr1031380 1326 1276 1263 11339 --
NM_005546chr51527 1537 ----
NM_005563chr11895 1665 ----
NM_005573chr51682 ------
NM_005574chr111296 ------
NM_005578chr324855 4683 1350 ----
NM_005581chr192483 24 ------
NM_005586chr61645 ------
NM_005595chr11321 ------
NM_005596chr9--15847 ----
NM_005599chr131367 1199 207 --11560 --
NM_005604chr61438 ------
NM_005610chr11599 ------
NM_005614chr7--1966 ----
NM_005626chr1195 ------
NM_005627chr6--1719 1297 --
NM_005634chrX3265 153 146 ------
NM_005637chr181134 ------
NM_005647chrX42820 632 618 370 12374 ----
NM_005650chr2231309 1039 241 ------
NM_005655chr821002 330 ------
NM_005664chr152747 98 1253 ----
NM_005667chr21394 ------
NM_005668chr533388 3334 1230 ------
NM_005686chr161461 1111 522 483 474 186 ------
NM_005688chr341201 1163 428 354 11239 ----
NM_005690chr121196 ------
NM_005708chr131319 ------
NM_005717chr121251 161 ------
NM_005722chr21711 12150 ----
NM_005724chr15171 ------
NM_005725chr12824 61 1117 ----
NM_005731chr21293 ------
NM_005734chr112751 701 ------
NM_005735chr22789 250 ------
NM_005737chr252937 2871 674 359 323 ------
NM_005738chr731937 1770 1374 1776 ----
NM_005742chr23630 308 260 ------
NM_005746chr712305 ------
NM_005752chr1611222 ------
NM_005776chr141845 ------
NM_005778chr31341 1101 --165
NM_005779chr552429 967 572 450 358 ------
NM_005795chr222694 1995 12472 ----
NM_005796chr161248 --129 --
NM_005801chr171179 ------
NM_005808chr333240 2930 978 22261 1037 ----
NM_005819chr13797 476 338 --1415 --
NM_005828chr1754897 1500 1365 299 191 11185 ----
NM_005832chr31147 1353 ----
NM_005840chrX42768 1741 701 378 35349 5276 243 ----
NM_005841chr4154 1769 ----
NM_005842chr131125 ------
NM_005850chr1173 ------
NM_005859chr531536 631 215 ------
NM_005862chr32882 736 1311 ----
NM_005869chr51119 ------
NM_005871chr103937 907 245 ------
NM_005873chr203449 151 70 183 ----
NM_005876chr22804 774 1556 ----
NM_005885chr571641 1540 596 331 192 162 95 1311 ----
NM_005886chr162261 112 ------
NM_005898chr111874 ------
NM_005900chr41765 ------
NM_005901chr1873058 2590 2346 2239 1578 1359 347 37689 7653 6231 ----
NM_005902chr1544375 4360 3149 1499 193 ----
NM_005909chr512840 ------
NM_005910chr1734126 1160 717 11572 11630 --
NM_005917chr2--1175 ----
NM_005920chr143776 3745 1449 301 ------
NM_005930chr14--167 ----
NM_005933chr1122690 2220 1581 ----
NM_005934chr1921635 535 --12152 --
NM_005935chr455238 3948 3508 1752 1013 11789 ----
NM_005938chrX41329 1067 472 320 ------
NM_005941chr83727 208 78 172 ----
NM_005955chr175036 4983 4464 3917 3806 868 699 2550 272 23754 829 --
NM_005962chr1022006 1461 ------
NM_005962chr1022006 1461 ------
NM_005964chr1711415 ------
NM_005966chr232374 2003 404 ------
NM_005994chr171679 ------
NM_005996chr1231276 1141 613 21388 1086 ----
NM_006007chr923498 2996 24106 580 ----
NM_006010chr31255 ------
NM_006011chr1511182 21008 393 ----
NM_006015chr141051 1023 872 116 ------
NM_006016chr682239 1798 1610 899 512 314 249 226 21780 429 ----
NM_006017chr41741 ------
NM_006032chr141169 ------
NM_006035chr1431113 223 85 ------
NM_006036chr242070 1603 798 647 12473 ----
NM_006037chr243297 1526 904 21 11756 ----
NM_006040chr1621200 429 31375 307 150 ----
NM_006043chr16--1684 ----
NM_006047chr2042347 544 186 43 13004 ----
NM_006048chr11455 ------
NM_006054chr1111481 ------
NM_006060chr764215 3703 2870 2802 2764 450 ------
NM_006076chr732041 602 333 ------
NM_006079chr62601 271 ------
NM_006080chr722974 915 ------
NM_006090chr1--1205 ----
NM_006095chr454299 3756 2814 1354 612 159 ----
NM_006106chr1122990 2447 1172 ----
NM_006113chr12264 113 ------
NM_006116chr2231582 1090 385 --11296 --
NM_006122chr152817 156 ------
NM_006133chr1142410 1686 810 515 ------
NM_006135chr1----1161 --
NM_006136chr7199 ------
NM_006139chr21552 ------
NM_006141chr1632617 1740 842 ------
NM_006153chr32238 26 ------
NM_006156chr14--1244 ----
NM_006160chr1721068 1056 ------
NM_006162chr1821746 1240 1598 ----
NM_006166chr1241693 1051 1013 504 ------
NM_006167chr831677 803 681 ------
NM_006180chr931577 1347 501 ------
NM_006186chr22979 483 ------
NM_006190chr2--11037 ----
NM_006191chr121929 ------
NM_006194chr1411218 ------
NM_006195chr92938 473 ------
NM_006196chr22383 37 ------
NM_006201chrX21200 904 ------
NM_006203chr521139 1042 ------
NM_006206chr432284 875 474 ------
NM_006209chr8--1362 ----
NM_006212chr173847 3674 3283 1967 1624 1017 185 12131 ----
NM_006216chr21615 ------
NM_006228chr81394 ------
NM_006243chr11165 1856 ----
NM_006245chr62755 87 ------
NM_006246chr14--1402 ----
NM_006251chr513157 --12340 --
NM_006254chr31401 ------
NM_006256chr12959 904 ------
NM_006257chr102984 921 ------
NM_006264chr41168 ------
NM_006267chr211864 1143 ----
NM_006268chr11140 ------
NM_006281chr81181 1909 ----
NM_006281chr81181 1909 ----
NM_006283chr843622 1962 1827 1718 14680 ----
NM_006293chr1531026 702 247 21018 998 ----
NM_006301chr122591 106 ------
NM_006306chrX65904 4444 3924 1733 1543 43 ------
NM_006312chr122860 752 ------
NM_006313chr121275 ------
NM_006317chr51195 ------
NM_006321chr352067 1798 1656 681 423 ------
NM_006325chr122211 50 1824 ----
NM_006330chr841624 1368 540 392 ------
NM_006352chr132031 1550 443 ------
NM_006353chr631373 938 140 ------
NM_006357chr21414 ------
NM_006359chrX32263 1996 593 12285 ----
NM_006362chr11165 ------
NM_006371chr364595 3857 1883 1219 1022 80 ------
NM_006372chr61507 ------
NM_006373chr1721038 282 ------
NM_006375chrX31596 242 211 ------
NM_006377chr911233 ------
NM_006379chr7--22289 2080 ----
NM_006380chr1711560 31652 1444 1351 ----
NM_006386chr2232257 2122 844 ------
NM_006391chr11123 ------
NM_006393chr1014115 24219 358 ----
NM_006401chr9170 ------
NM_006405chr14126 ------
NM_006434chr1023247 610 ------
NM_006439chr41544 1408 ----
NM_006454chr463069 2820 2320 1200 430 103 ------
NM_006457chr434044 3057 2754 ------
NM_006458chr111340 ------
NM_006459chr1031843 1789 167 11449 ----
NM_006465chr1521461 166 --1214 --
NM_006482chr1263778 3515 2660 2631 1126 701 ------
NM_006489chr1411381 ------
NM_006517chrX11639 11572 ----
NM_006526chr2042121 1743 841 589 --11412 --
NM_006532chr1931610 1525 744 11719 ----
NM_006537chr151578 ------
NM_006538chr244148 3483 2965 2844 ------
NM_006540chr821503 543 ------
NM_006544chr1421561 1023 24236 305 ----
NM_006545chr3132 ------
NM_006546chr1736661 2199 1619 ------
NM_006548chr311475 ------
NM_006555chr732001 1490 337 ------
NM_006559chr12967 477 1992 ----
NM_006560chr11164 ------
NM_006561chr1055910 5869 3802 2158 1361 ------
NM_006565chr1621272 181 ------
NM_006572chr1783008 2816 2343 969 694 564 201 174 1478 ----
NM_006574chr32249 226 1271 ----
NM_006575chr1411198 ------
NM_006589chr11109 ------
NM_006591chr1131859 1372 497 1201 ----
NM_006593chr21222 ------
NM_006595chr112779 357 ------
NM_006599chr1667701 7284 6103 5848 1057 485 11457 ----
NM_006601chr1251122 1004 891 254 106 ------
NM_006603chrX11811 ----1250
NM_006609chr212574 11189 ----
NM_006621chr11693 ------
NM_006624chr1032062 1612 1467 ------
NM_006625chr1--11085 ----
NM_006625chr1--11085 ----
NM_006625chr1--11085 ----
NM_006634chr22226 177 ------
NM_006646chr1352964 2180 1218 1136 335 1227 ----
NM_006650chr543898 3799 3535 1519 ------
NM_006654chr1274283 4025 1290 1194 1061 605 208 14635 ----
NM_006677chr32181 23 ------
NM_006681chr4--1121 ----
NM_006690chr2021634 1588 1670 ----
NM_006698chr2011463 ------
NM_006700chr123311 159 62 ------
NM_006703chr62437 153 ------
NM_006711chr162185 170 ------
NM_006720chr1085024 1733 1248 1007 968 782 316 284 ----11816
NM_006722chr312965 1701 ----
NM_006726chr42861 407 ------
NM_006727chr5152 ------
NM_006732chr1932046 1867 856 ------
NM_006734chr611071 ------
NM_006738chr1554487 3395 3278 966 62 --12929 --
NM_006745chr411081 ------
NM_006750chr1666657 5123 4895 2653 1551 224 ------
NM_006751chr2--1346 ----
NM_006754chr731205 786 271 ------
NM_006755chr111175 ------
NM_006766chr832010 820 106 1399 ----
NM_006772chr631465 1216 664 ------
NM_006775chr653037 2219 865 530 172 11074 --12100
NM_006777chrX22377 2122 ------
NM_006788chr1841942 1463 404 89 ------
NM_006791chr151244 ------
NM_006807chr1711272 ------
NM_006811chr201262 ------
NM_006813chr6--1372 1928 --
NM_006816chr51288 ------
NM_006819chr113366 357 259 --1162 --
NM_006823chr831287 1003 477 ------
NM_006826chr21205 ------
NM_006827chr1422318 1175 12178 ----
NM_006832chr14160 ----1952
NM_006836chr121540 ------
NM_006838chr1231477 1251 85 ------
NM_006842chr111136 ------
NM_006846chr51252 ------
NM_006852chr1721854 869 ------
NM_006856chr12--21115 388 ----
NM_006873chr243226 937 670 275 ------
NM_006874chr41827 2894 33 ----
NM_006884chr311296 11910 ----
NM_006885chr1622770 983 14173 ----
NM_006888chr1453242 3215 2975 1313 806 1663 1626 --
NM_006896chr721089 1022 --1824 --
NM_006899chr201130 1286 ----
NM_006912chr122427 41 ------
NM_006922chr222056 208 ------
NM_006924chr1784151 4006 3889 3743 3103 1154 788 608 ------
NM_006925chr141514 ------
NM_006927chr1641657 559 234 114 1714 ----
NM_006936chr2151293 1225 907 425 43 1479 ----
NM_006937chr17--1489 ----
NM_006939chr1421127 1092 ------
NM_006940chr121329 11607 ----
NM_006943chr20142 11304 ----
NM_006946chr111188 ------
NM_006947chr421220 26 11560 ----
NM_006950chrX2741 658 --1845 --
NM_006956chr731825 607 417 ------
NM_006963chr1011233 ------
NM_006965chr1811127 ------
NM_006981chr92626 589 22860 2493 ----
NM_006982chr12187 ------
NM_006991chr31742 11026 ----
NM_006997chr10162 ------
NM_006999chr551355 798 639 218 182 11633 1817 --
NM_007005chr951499 514 369 338 211 11165 ----
NM_007006chr1623336 708 ------
NM_007007chr1274624 3889 1593 1540 950 696 449 ------
NM_007008chr21118 ------
NM_007011chr1555231 2532 1493 966 750 24829 2256 ----
NM_007013chr8183 ------
NM_007015chr13125 ------
NM_007017chr5--1680 ----
NM_007026chr17--1532 ----
NM_007030chr555184 5115 5069 4991 4408 1332 --11221
NM_007034chr1--1806 ----
NM_007035chr122619 41 ------
NM_007039chr1411617 11702 ----
NM_007040chr191432 ------
NM_007050chr2097181 6959 6921 5888 5104 2865 2599 1512 42 27891 2642 15465 --
NM_007067chr1711305 ------
NM_007084chr13----1471 --
NM_007087chr164795 662 535 513 ------
NM_007107chr342387 636 253 159 1324 ----
NM_007118chr51228 150 ----
NM_007124chr61415 ------
NM_007125chrY21041 75 ------
NM_007135chr91174 ------
NM_007146chr17--12260 ----
NM_007150chrX282 58 ------
NM_007174chr1221799 817 22267 193 ----
NM_007178chr122475 302 ------
NM_007187chr131378 ------
NM_007192chr14------1251
NM_007200chr1554487 3395 3278 966 62 --12929 --
NM_007203chr943437 2944 2876 1392 ------
NM_007214chr6153 ------
NM_007236chr151116 ------
NM_007249chr1388476 7245 6857 6358 3024 1160 1152 260 1311 ----
NM_007260chr13666 563 490 ------
NM_007270chr711513 ------
NM_007274chr13275 219 117 ------
NM_007279chr191419 ------
NM_007286chr552002 1758 604 490 187 ------
NM_007294chr1731258 1126 328 11349 ----
NM_007295chr1731258 1126 328 11349 ----
NM_007296chr1731258 1126 328 11349 ----
NM_007297chr1731258 1126 328 11349 ----
NM_007298chr1731258 1126 328 11349 ----
NM_007299chr1731258 1126 328 11349 ----
NM_007300chr1731258 1126 328 11349 ----
NM_007302chr1731258 1126 328 11349 ----
NM_007303chr1731258 1126 328 11349 ----
NM_007304chr1731258 1126 328 11349 ----
NM_007305chr1731258 1126 328 11349 ----
NM_007308chr41226 ------
NM_007322chr191392 1528 ----
NM_007347chr1523107 1101 ------
NM_007358chr12749 388 ------
NM_007363chrX2975 868 ------
NM_007373chr1041790 1719 1519 1125 ------
NM_007374chr142470 409 ----1354
NM_007375chr162002 1112 1103 768 592 239 ------
NM_009585chr3--1831 ----
NM_009585chr3--1831 ----
NM_012062chr121196 ------
NM_012063chr121196 ------
NM_012064chr121159 ------
NM_012073chr51132 1486 ----
NM_012081chr533643 3631 100 ------
NM_012082chr8179 1710 ----
NM_012084chrX3556 506 375 ------
NM_012089chr111129 21120 308 ----
NM_012090chr131086 1061 1035 ------
NM_012095chr1013460 1712 ----
NM_012104chr1112589 ------
NM_012104chr1112589 ------
NM_012110chr4139 ------
NM_012120chr652857 2641 1913 880 571 12405 ----
NM_012129chr752507 2471 2210 2159 328 ------
NM_012141chr1321228 1017 1900 ----
NM_012156chr2033392 3319 2742 1701 ----
NM_012158chr132520 66 ------
NM_012175chr111726 145 ----
NM_012193chr1144546 2007 722 542 --1536 --
NM_012199chr124153 1722 ------
NM_012214chr266101 4130 1788 1267 936 186 ------
NM_012215chr1011355 ------
NM_012218chr191127 21188 1134 ----
NM_012232chr1722193 253 2359 155 11599 --
NM_012234chr342616 1288 895 291 ------
NM_012235chr3141 ------
NM_012238chr1031401 613 247 ------
NM_012244chr1421350 1220 ------
NM_012247chr101919 ------
NM_012250chr111313 11321 ----
NM_012257chr71376 ------
NM_012262chr195199 4095 3820 3750 1699 1337 1317 958 531 13783 ----
NM_012272chr121312 ------
NM_012278chrX1141 ------
NM_012281chr71524 ------
NM_012290chr211359 ------
NM_012293chr242159 2003 1676 34 2792 138 ----
NM_012294chr743950 3723 2493 1553 1428 ----
NM_012296chr1133886 3529 670 13591 ----
NM_012297chr432520 961 600 ------
NM_012300chr5--1959 ----
NM_012301chr71477 ------
NM_012302chr11266 ------
NM_012304chr532553 963 25 --1273 --
NM_012308chr1132054 536 251 ------
NM_012309chr1144785 4533 4048 866 13301 ----
NM_012316chr1--14263 ----
NM_012319chr182134 78 138 ----
NM_012320chr1641399 249 150 45 163 ----
NM_012326chr22569 254 --1244 --
NM_012384chr2021571 44 22166 1576 ----
NM_012395chr712696 23402 41 ----
NM_012405chr122499 2344 1775 ----
NM_012416chr911254 21247 483 ----
NM_012417chr17--1430 ----
NM_012421chr1196 ------
NM_012428chr151226 1332 ----
NM_012429chr22------11393
NM_012446chr51457 ------
NM_012454chr62481 374 ------
NM_012464chr42909 416 22701 947 ----
NM_012471chrX11784 --11491 --
NM_012479chr732747 706 265 ------
NM_012481chr171677 ------
NM_013230chrY21710 560 ------
NM_013231chr1433956 3466 345 22820 356 ----
NM_013233chr2------11110
NM_013242chr162381 108 ------
NM_013253chr112483 173 ------
NM_013254chr121175 ------
NM_013255chr787645 7591 6264 6095 5385 1219 1055 407 ------
NM_013257chr81183 ------
NM_013269chr1253432 1511 1483 1430 444 ------
NM_013279chr113513 165 109 ------
NM_013281chr201348 11217 ----
NM_013283chr52359 295 ------
NM_013286chr32674 247 33115 2644 294 ----
NM_013293chr72530 155 1200 --1669
NM_013305chr182110 48 ------
NM_013322chr71164 ------
NM_013330chr1192 ------
NM_013341chr212718 ------
NM_013354chr821389 558 ------
NM_013357chr81103 ------
NM_013373chr222987 644 --1690 --
NM_013374chr321209 194 1488 ----
NM_013376chr192266 23 ------
NM_013381chr121275 ------
NM_013390chr941281 1146 710 202 ------
NM_013392chr23422 40 33 ------
NM_013396chr2121472 1348 ------
NM_013410chr13381 313 68 ------
NM_013411chr132716 2047 408 ------
NM_013433chr1941986 1697 571 83 ------
NM_013436chr21681 ------
NM_013438chr921277 438 1106 ----
NM_013444chrX2413 310 ------
NM_013446chr731051 115 51 ------
NM_013448chr142486 72 ------
NM_013449chr1241933 1038 999 946 --1546 --
NM_013960chr82672 639 ------
NM_013995chrX--12238 ----
NM_014000chr1021510 444 ------
NM_014011chr2--1147 ----
NM_014016chr331513 1268 310 ------
NM_014021chr123006 2840 ------
NM_014030chr1721233 1038 11181 ----
NM_014035chr511135 11366 ----
NM_014048chr1645117 4528 4384 3248 23692 114 ----
NM_014060chrX145 ------
NM_014089chr13--22211 1838 ----
NM_014112chr844020 3410 1619 994 22187 1290 1626 --
NM_014117chr161379 ------
NM_014153chr162629 159 ------
NM_014155chr1175839 2876 2437 2397 1017 690 253 ------
NM_014157chr163948 856 656 ------
NM_014159chr31201 ------
NM_014181chr231872 729 157 11074 ----
NM_014183chr201303 ------
NM_014184chr11137 ------
NM_014212chr123961 187 135 ------
NM_014217chr121527 1374 11343 ----
NM_014225chr191298 194 ----
NM_014231chr12126 ------
NM_014232chr1731586 1373 225 1153 ----
NM_014232chr1731586 1373 225 1153 ----
NM_014233chr1721959 1348 2673 630 ----
NM_014243chr452121 1793 1706 1578 471 ------
NM_014248chr221123 164 ----
NM_014263chr1011135 11399 1597 --
NM_014271chrX--188 ----
NM_014280chr11379 ------
NM_014284chr11238 ------
NM_014294chr811256 21351 338 ----
NM_014325chr1221764 1557 ------
NM_014331chr427451 1149 15224 ----
NM_014333chr114703 586 188 145 --1819 --
NM_014345chr61403 ------
NM_014351chr2241246 1219 1163 179 ------
NM_014363chr132856 60 11262 ----
NM_014365chr123819 707 313 ------
NM_014381chr1412465 22164 2127 ----
NM_014390chr71530 ------
NM_014392chr43409 363 273 ------
NM_014408chr11542 ------
NM_014415chr31118 11282 ----
NM_014417chr192882 328 ------
NM_014423chr524344 466 15376 ----
NM_014445chr31887 22327 2274 ----
NM_014454chr64830 780 747 257 ------
NM_014456chr101422 ------
NM_014491chr71939 ------
NM_014494chr1622164 444 ------
NM_014502chr111302 ------
NM_014504chr72719 478 ------
NM_014515chr123975 788 52 ------
NM_014520chr173361 131 98 ------
NM_014521chr241513 1274 734 350 21407 67 ----
NM_014554chr1251416 613 208 99 54 ------
NM_014562chr22748 700 ------
NM_014572chr1321644 93 1336 ----
NM_014574chr1421475 1243 ------
NM_014584chr1421603 1220 ------
NM_014585chr21137 ------
NM_014592chr51774 ------
NM_014601chr19128 --11495 --
NM_014612chr931471 1098 1073 ------
NM_014613chr532481 1930 750 ------
NM_014615chr1643620 3523 3307 2890 ----1197
NM_014616chr353404 3244 2696 1388 917 ------
NM_014618chr92330 277 ------
NM_014620chr122619 236 ------
NM_014629chr831340 895 289 2956 25 ----
NM_014630chr1563763 2997 2501 1398 740 718 1309 ----
NM_014634chr2222849 1272 ------
NM_014636chr954295 4132 2690 2653 487 21648 772 ----
NM_014647chr1642254 2215 1925 1845 12282 ----
NM_014659chr153881 863 778 ------
NM_014665chr863408 3226 3151 2772 2341 558 1605 ----
NM_014666chr521127 140 ------
NM_014667chr321811 1573 ------
NM_014676chr12677 233 ------
NM_014677chr8--123 ----
NM_014686chr1972349 2074 2064 1880 1869 776 349 22032 1842 ----
NM_014690chr772622 2542 1165 970 937 501 396 11059 ----
NM_014701chr1533096 2665 664 ------
NM_014705chr731404 596 585 ------
NM_014707chr711572 ------
NM_014709chr22398 54 ------
NM_014717chr191784 ------
NM_014718chr121694 1208 ----
NM_014720chr1021289 479 ------
NM_014721chr647029 5373 5077 2676 11799 ----
NM_014726chr172946 26 ------
NM_014729chr831525 1501 262 ------
NM_014732chr1655827 5418 5378 824 538 15866 1157 --
NM_014740chr17142 ------
NM_014742chr201408 ------
NM_014743chr411967 2241 202 ----
NM_014746chr274249 2888 2751 1188 668 648 260 1364 ----
NM_014747chr145731 4819 3903 987 ------
NM_014755chr241709 1484 606 522 13748 ----
NM_014759chr851592 1523 1419 1213 608 ------
NM_014764chr1221219 450 ------
NM_014767chr1053038 1214 789 565 309 ------
NM_014772chr1832436 1156 342 22270 459 ----
NM_014779chr3----1182 --
NM_014787chr132669 1782 825 ------
NM_014790chr51348 ------
NM_014795chr2282 71 ------
NM_014800chr711168 1930 ----
NM_014807chr111817 ------
NM_014810chr112296 1910 ----
NM_014819chr541981 1912 1795 353 ------
NM_014824chr1121555 1245 1193 ----
NM_014827chr121276 1206 ------
NM_014828chr143840 184 117 ------
NM_014830chr1223809 1444 1167 ----
NM_014835chr2022088 187 3803 786 541 ----
NM_014840chr1252983 822 556 380 261 22151 625 ----
NM_014841chr61317 21087 190 ----
NM_014850chr374519 4497 4431 4246 1507 1014 35 14380 --11557
NM_014859chr17------11436
NM_014862chr1554106 1355 603 132 27 --13707 --
NM_014868chr123576 370 79 ------
NM_014870chr164565 4220 4064 1234 160 87 23956 649 14573 --
NM_014872chr922141 742 139 ----
NM_014873chr134637 3660 1788 ----11734
NM_014874chr131521 670 184 ------
NM_014876chr2231509 514 57 1337 ----
NM_014877chr1736578 2426 1040 12352 ----
NM_014883chr432468 871 444 ------
NM_014892chr6--142 ----
NM_014901chr52709 545 ------
NM_014903chr122815 388 ------
NM_014906chr1713353 11280 --1765
NM_014909chr1463975 3877 2620 1345 1101 646 23935 1462 ----
NM_014912chr1012872 ------
NM_014917chr11220 ------
NM_014920chr653298 2881 2518 1148 588 ------
NM_014923chr1321572 441 ------
NM_014932chr311802 2568 476 ----
NM_014934chr1343823 2617 992 399 ------
NM_014935chr1136 22500 1033 ----
NM_014938chr123837 792 213 22067 918 ----
NM_014942chr61426 ------
NM_014944chr11138 --11397 --
NM_014946chr232469 882 441 ------
NM_014947chr143072 2968 2264 1917 ------
NM_014952chr1511640 ------
NM_014962chr2022574 2020 11832 ----
NM_014969chr11206 ------
NM_014974chr1011104 ------
NM_014978chr1021446 703 ------
NM_014982chr1453847 3718 3654 1652 1239 ------
NM_014988chr422802 1779 ------
NM_014991chr432391 841 272 ------
NM_014992chr141191 ------
NM_014994chr1522026 268 --12360 --
NM_014997chr722066 1156 ------
NM_015000chr1232715 1156 316 ------
NM_015005chr1421716 1426 ------
NM_015008chr363416 2630 2596 1246 1156 999 --1497 --
NM_015015chr1932022 1260 72 --1517 --
NM_015017chr11275 11273 ----
NM_015018chr6172 ------
NM_015020chr1633233 570 372 23407 2725 ----
NM_015025chr232640 2208 61 ------
NM_015026chr1233578 905 110 24642 1186 ----
NM_015032chr1332171 1121 1044 11879 ----
NM_015040chr243173 2714 204 133 ------
NM_015042chr1523737 3378 ------
NM_015044chr1642759 2199 440 55 ------
NM_015045chr101357 3379 344 233 ----
NM_015046chr952686 2648 2307 2071 109 12295 ----
NM_015049chr222870 2440 ------
NM_015051chr922306 2148 23267 3139 ----
NM_015052chr71249 11341 ----
NM_015055chr1131826 541 335 1750 ----
NM_015061chr91233 1717 ----
NM_015068chr763923 2511 2469 1409 871 367 23974 3217 ----
NM_015071chr576323 6206 5699 4530 2146 1894 1173 ------
NM_015074chr154904 4510 3723 3346 1878 34972 4331 408 ----
NM_015076chr643655 1803 1181 325 ------
NM_015090chr165706 5428 4841 4672 2479 1652 12459 ----
NM_015092chr1624166 2941 1765 ----
NM_015094chr2224420 4180 1588 --14526
NM_015100chr111975 ------
NM_015106chr31160 ------
NM_015115chr451006 897 264 164 70 12617 ----
NM_015125chr191598 ------
NM_015129chrX1425 11779 ----
NM_015130chr421309 309 ------
NM_015132chr711613 ------
NM_015137chr832385 2310 790 11629 ----
NM_015138chr154776 683 155 100 ------
NM_015144chr1653646 3360 3292 2593 83 ------
NM_015149chr111430 ------
NM_015153chr61242 ------
NM_015155chr1022704 35 22989 2114 ----
NM_015156chr1433840 3776 1051 --12959 --
NM_015161chr1631356 1063 63 ------
NM_015163chr1411528 ----1190
NM_015172chr131363 1154 169 11473 ----
NM_015178chr832339 1852 33 ------
NM_015180chr141856 ------
NM_015192chr2022833 741 12731 ----
NM_015197chr1462590 2198 967 695 428 39 ------
NM_015198chr731223 483 184 ------
NM_015199chr342407 2303 792 625 12470 ----
NM_015202chr1621194 265 ------
NM_015206chr1523276 1268 12367 ----
NM_015208chr1823016 1317 ------
NM_015209chr121656 423 ------
NM_015215chr133186 2283 440 ------
NM_015216chr521353 1038 2379 142 ----
NM_015236chr43601 336 108 ------
NM_015247chr1645371 3983 3536 1145 ------
NM_015250chr931360 570 439 ------
NM_015252chr2--1812 ----
NM_015260chr1931563 1001 182 ------
NM_015265chr2--12669 ----
NM_015267chr121378 1417 ----
NM_015269chr1160 ------
NM_015270chr122899 239 ------
NM_015271chr424175 538 ------
NM_015272chr16--11758 ----
NM_015278chr653261 2864 2776 2189 2171 ------
NM_015284chr131652 1555 1371 --1729 --
NM_015288chr573742 2663 2520 2365 1053 585 168 ------
NM_015292chr121238 ------
NM_015294chr1731110 1053 54 ------
NM_015296chr1321211 921 11113 ----
NM_015299chr1443603 3345 2873 366 11256 12916 --
NM_015310chr842513 2455 1628 1068 27536 6111 ----
NM_015314chr731630 1043 382 ------
NM_015315chr531195 1124 555 12291 ----
NM_015317chr221756 1152 22314 293 12219 --
NM_015321chr1963348 1716 1695 1630 574 151 1864 ----
NM_015326chr122293 1905 ------
NM_015339chr2031045 173 73 1745 ----
NM_015344chr822079 1591 ------
NM_015349chr612274 ----12840
NM_015355chr1721233 346 ------
NM_015359chr862795 2401 779 699 617 163 ------
NM_015365chrX23659 289 12730 ----
NM_015375chr145029 4698 3483 501 ------
NM_015385chr1023247 610 ------
NM_015396chr32481 117 ------
NM_015397chr921503 1384 ------
NM_015409chr1242649 2318 2122 1735 ------
NM_015443chr1721424 456 ------
NM_015444chr32426 88 ------
NM_015447chr91262 ------
NM_015455chr514054 13969 ----
NM_015458chr854993 3433 3413 1696 1625 ------
NM_015459chr11--1219 ----
NM_015460chr331839 1554 144 ------
NM_015464chr72139 86 1408 ----
NM_015477chr152663 358 ------
NM_015488chr211482 1341 ----
NM_015497chr151855 ------
NM_015508chr311114 11445 ----
NM_015509chr1231642 1185 548 ------
NM_015527chr164833 610 273 98 ----1292
NM_015530chr21639 ------
NM_015534chr11162 1825 ----
NM_015549chr141582 ------
NM_015550chr733060 2556 990 ------
NM_015554chr1551971 1957 1909 431 36 ------
NM_015569chr124145 435 ------
NM_015570chr721735 1477 ------
NM_015575chr252851 2681 1357 1008 290 ------
NM_015576chr32987 524 12935 ----
NM_015577chr531779 647 63 1720 ----
NM_015578chr1921565 99 ------
NM_015601chr101890 ------
NM_015609chr132306 2129 227 ------
NM_015626chr171353 ------
NM_015635chr921433 387 ------
NM_015640chr154681 4518 3735 1956 504 24432 593 ----
NM_015676chr14199 ------
NM_015686chrX12408 --1899 --
NM_015691chrX3800 764 276 ------
NM_015695chr641982 1946 748 192 ------
NM_015702chr2124 ------
NM_015834chr212747 261 ----1953
NM_015844chr181965 ------
NM_015846chr181965 ------
NM_015847chr181965 ------
NM_015866chr121330 1199 11237 ----
NM_015874chr41255 --1139 --
NM_015878chr811913 ------
NM_015879chr1858620 3162 2019 1602 32 ------
NM_015881chr112483 173 ------
NM_015885chr11145 ------
NM_015895chr6--1204 ----
NM_015898chr1922375 1566 ------
NM_015902chr8124 196 ----
NM_015904chr22707 265 ------
NM_015906chr154590 3336 3085 1091 555 11555 ----
NM_015912chr832210 2133 1820 ------
NM_015915chr14--1239 ----
NM_015920chr152589 39 ------
NM_015975chrX11755 ------
NM_015980chr541541 1376 1096 170 ------
NM_015981chr542475 2156 297 30 11157 ----
NM_015984chr11373 1553 ----
NM_015995chr1564419 2082 2007 1119 603 234 13384 ----
NM_015999chr1190 ------
NM_016002chr1--1527 ----
NM_016009chr154826 4384 4139 3185 1022 ------
NM_016016chr172280 144 ------
NM_016018chr821130 528 ------
NM_016019chr74969 870 329 72 ------
NM_016021chr612982 22206 647 ----
NM_016022chr11902 ------
NM_016025chr1631857 775 382 11634 ----
NM_016040chr122514 2346 11999 --11878
NM_016048chr521000 700 ------
NM_016057chr123880 322 55 ------
NM_016061chr231469 1124 659 21666 312 ----
NM_016073chr15160 1107 ----
NM_016076chr132896 2641 2500 23065 2424 23012 296 --
NM_016083chr633007 938 786 ------
NM_016096chr842169 2054 1352 140 ------
NM_016107chr5155 11278 ----
NM_016121chr11905 ------
NM_016126chr1--158 ----
NM_016131chr212292 ------
NM_016132chr1533080 2690 759 ------
NM_016133chr211234 11668 ----
NM_016141chr31210 1579 ----
NM_016162chr122613 286 1119 ----
NM_016173chr354419 3746 1654 971 212 23097 2817 ----
NM_016185chr172745 125 --123 --
NM_016195chr101119 1264 ----
NM_016201chr352286 2112 1747 1667 595 1344 ----
NM_016203chr71236 ------
NM_016206chr367175 7016 3005 2643 2425 1841 26155 2894 ----
NM_016230chr61361 ------
NM_016231chr1721479 601 1254 ----
NM_016243chr12592 26 ------
NM_016248chr1333772 2563 1349 ------
NM_016252chr2--1894 ----
NM_016260chr236801 5000 1154 16146 ----
NM_016279chr5--1129 ----
NM_016289chr221851 1612 2108 47 ----
NM_016308chr122083 532 ------
NM_016316chr21634 ------
NM_016322chr942351 2028 1252 433 22777 1172 ----
NM_016337chr142400 121 ----1339
NM_016339chr1711505 11813 ----
NM_016374chr1140 ------
NM_016374chr1140 ------
NM_016376chr1734035 1100 755 13625 --11246
NM_016395chr1521920 1357 1421 ----
NM_016396chr1511960 ------
NM_016422chr1123105 714 ------
NM_016424chr1721536 1504 ------
NM_016436chr2022653 493 12119 ----
NM_016441chr222237 1947 ------
NM_016451chr111205 ------
NM_016453chr32663 193 ------
NM_016463chr51161 ------
NM_016467chr21144 ------
NM_016470chr201398 ------
NM_016479chr331160 133 93 ------
NM_016485chr632005 918 791 ------
NM_016488chr1241865 1684 1564 704 ------
NM_016507chr172132 126 --1852 --
NM_016513chr653298 2881 2518 1148 588 ------
NM_016522chr1121637 1112 ------
NM_016525chr91386 ------
NM_016529chr131329 ------
NM_016530chr1532691 1421 1224 13597 ----
NM_016531chr433220 3178 689 53196 2620 1151 1131 772 ----
NM_016542chrX11516 ------
NM_016544chr2--22888 122 ----
NM_016559chr31597 ------
NM_016569chr1231276 1141 613 21388 1086 ----
NM_016577chr353972 3271 1212 1048 809 33797 1483 193 ----
NM_016578chr112191 75 ------
NM_016588chr62688 93 1752 ----
NM_016603chr512212 ------
NM_016604chr511184 ------
NM_016605chr552459 2362 1952 1070 681 ------
NM_016612chr81537 ------
NM_016620chr111148 ------
NM_016621chr1133687 2900 1084 23801 3373 1762 --
NM_016623chr82637 25 ------
NM_016626chr1811727 ------
NM_016628chr101222 ------
NM_016630chr151388 ------
NM_016651chr142935 260 11144 ----
NM_016834chr1734126 1160 717 11572 11630 --
NM_016835chr1734126 1160 717 11572 11630 --
NM_016836chr24635 628 511 209 ------
NM_016839chr24635 628 511 209 ------
NM_016841chr1734126 1160 717 11572 11630 --
NM_016937chrX1948 ------
NM_016946chr131423 998 430 ------
NM_016953chr225691 5292 ------
NM_017412chr8133 ------
NM_017413chrX1115 ------
NM_017415chr563972 3374 2902 1483 411 112 24448 4362 ----
NM_017423chr42732 309 ------
NM_017450chr17------1480
NM_017455chr151226 1332 ----
NM_017457chr19----1148 --
NM_017481chr111189 ------
NM_017519chr63254 191 61 ------
NM_017522chr111178 ------
NM_017544chrX1222 ------
NM_017548chr332124 574 495 ------
NM_017551chr104728 637 549 528 ------
NM_017582chr141789 1241 1223 63 ------
NM_017583chr1121705 634 11484 ----
NM_017590chr22------11810
NM_017593chr41465 ------
NM_017596chr134542 3766 1251 14683 ----
NM_017599chr122817 230 ------
NM_017602chrX1651 ------
NM_017610chr153768 699 507 11704 ----
NM_017629chr111850 ------
NM_017632chr41342 ------
NM_017633chr633717 3002 325 23429 2595 ----
NM_017637chr9109049 8117 8015 6436 5760 2890 2620 1823 1374 465 39316 5724 619 ----
NM_017641chr12270 35 ------
NM_017643chr171779 22564 365 ----
NM_017644chr353546 3514 1538 1513 605 ------
NM_017649chr102414 102 ------
NM_017650chr734929 812 542 ------
NM_017658chr1434363 3400 1386 13256 ----
NM_017661chr1521271 79 ------
NM_017672chr1531261 961 371 ------
NM_017694chr211808 ------
NM_017699chr321170 47 1377 ----
NM_017709chr131180 1019 647 ------
NM_017714chr201146 ------
NM_017715chr7126 ------
NM_017719chr331844 499 449 ------
NM_017724chr32709 227 ------
NM_017728chr1752580 2449 2276 1994 643 --11961 --
NM_017737chr13703 328 275 2303 80 ----
NM_017742chr1831782 641 299 ------
NM_017748chr171276 ------
NM_017753chr92285 25 ------
NM_017762chr1532325 846 256 22229 38 ----
NM_017769chr1412427 ------
NM_017772chr621576 256 11468 ----
NM_017778chr821044 434 ------
NM_017780chr81100 ------
NM_017787chr1052865 894 850 559 413 ------
NM_017789chr21755 ------
NM_017794chr9--1320 ----
NM_017799chr14--21637 1307 ----
NM_017810chr16163 ------
NM_017813chr855753 5299 4994 1787 869 24215 237 ----
NM_017816chr4157 ------
NM_017824chr1032674 948 331 ------
NM_017848chrX13497 1308 ----
NM_017866chr821066 451 ------
NM_017875chr32697 662 1721 ----
NM_017896chr2053419 3179 2981 2537 632 23089 328 ----
NM_017902chr1064704 4544 4486 4012 1995 1330 35042 392 286 ----
NM_017919chr963868 3811 2012 1461 736 59 15464 ----
NM_017934chr6189 ------
NM_017938chrX21994 582 ------
NM_017953chr1170 ------
NM_017969chr21165 ------
NM_017987chr102737 721 ------
NM_017988chr121930 ------
NM_018000chr221879 1524 1386 ----
NM_018014chr231263 370 117 ----1267
NM_018027chr1023198 22 13300 ----
NM_018030chr1821061 283 1383 ----
NM_018034chr5122 ------
NM_018036chr1434396 3068 1563 11169 ----
NM_018047chr51218 ------
NM_018064chr61238 ------
NM_018070chr11506 ------
NM_018084chr232704 801 467 ------
NM_018086chr221200 325 1347 ----
NM_018092chr1611262 ------
NM_018098chr32955 342 ------
NM_018105chr81870 ------
NM_018120chr811041 ------
NM_018121chr1031072 1002 717 1644 ----
NM_018133chr311712 1645 ----
NM_018144chr101266 ------
NM_018150chr11867 ------
NM_018157chr1213223 ------
NM_018159chrX--11085 ----
NM_018178chr111832 ------
NM_018181chr1821713 106 11408 ----
NM_018184chr3--1189 ----
NM_018195chr1151889 840 793 696 108 ------
NM_018201chr932521 2506 249 ------
NM_018202chr12822 797 1121 ----
NM_018206chr161632 ------
NM_018211chr12886 52 ------
NM_018214chr631231 140 43 ------
NM_018216chr11105 ------
NM_018227chr422247 2093 ------
NM_018240chr14916 789 644 59 ------
NM_018243chr423815 3529 13510 ----
NM_018247chr642016 1246 922 327 ------
NM_018254chr132037 2019 1960 ------
NM_018257chr203276 100 72 11948 ----
NM_018263chr242417 712 381 110 ------
NM_018266chr3--11059 ----
NM_018307chr171985 ------
NM_018313chr32665 545 ------
NM_018315chr41214 ------
NM_018320chr11--21238 182 ----
NM_018323chr4--179 ----
NM_018330chr1031704 1070 383 11366 ----
NM_018351chr1223886 1724 13812 ----
NM_018362chr1113810 ------
NM_018364chr144035 3918 2650 368 ------
NM_018374chr725128 1235 14510 ----
NM_018388chrX31396 520 487 ------
NM_018399chr62131 76 1280 ----
NM_018403chr322743 1595 1961 ----
NM_018412chr71152 ------
NM_018416chr12--12612 ----
NM_018424chr911738 ------
NM_018427chr1631464 499 357 ------
NM_018429chr52914 781 12088 ----
NM_018433chr2138 ------
NM_018440chr846778 5630 2271 1822 46992 2000 1219 281 ----
NM_018444chr81339 12086 ----
NM_018452chr6_random32680 2432 1233 63640 3109 2857 869 780 757 ----
NM_018462chr32737 636 ------
NM_018469chr1711327 ------
NM_018482chr821925 263 21702 92 ----
NM_018489chr13798 778 764 ------
NM_018490chr111749 2626 353 ----
NM_018553chr1721366 662 31867 632 395 ----
NM_018557chr231466 1147 24 11383 ----
NM_018566chr135129 4676 3968 11766 ----
NM_018569chr411253 ------
NM_018584chr11437 ------
NM_018638chr1255685 5558 4809 4101 540 12083 ----
NM_018640chr1212598 12550 ----
NM_018650chr11302 ------
NM_018682chr73261 226 130 1179 ----
NM_018691chr521072 846 ------
NM_018695chr522448 1908 ------
NM_018697chr742081 1631 266 249 ------
NM_018700chr531669 1366 172 11484 ----
NM_018704chr1--1803 ----
NM_018710chr811350 ------
NM_018715chr112253 2685 47 ----
NM_018841chr133376 2607 159 11145 ----
NM_018844chr722027 269 ------
NM_018847chr921669 190 ------
NM_018896chr171251 ------
NM_018898chr511736 11895 1885 --
NM_018899chr511736 11895 1885 --
NM_018900chr511736 11895 1885 --
NM_018901chr511736 11895 1885 --
NM_018902chr511736 11895 1885 --
NM_018903chr511736 11895 1885 --
NM_018904chr511736 11895 1885 --
NM_018905chr511736 11895 1885 --
NM_018906chr511736 11895 1885 --
NM_018907chr511736 11895 1885 --
NM_018908chr511736 11895 1885 --
NM_018909chr511736 11895 1885 --
NM_018910chr511736 11895 1885 --
NM_018911chr511736 11895 1885 --
NM_018912chr521624 237 ------
NM_018913chr521624 237 ------
NM_018914chr521624 237 ------
NM_018915chr521624 237 ------
NM_018916chr521624 237 ------
NM_018917chr521624 237 ------
NM_018918chr521624 237 ------
NM_018919chr521624 237 ------
NM_018920chr521624 237 ------
NM_018921chr521624 237 ------
NM_018922chr521624 237 ------
NM_018923chr521624 237 ------
NM_018924chr521624 237 ------
NM_018925chr521624 237 ------
NM_018926chr521624 237 ------
NM_018927chr521624 237 ------
NM_018928chr521624 237 ------
NM_018929chr521624 237 ------
NM_018945chr632728 711 107 ------
NM_018948chr111276 1160 ----
NM_018951chr731241 470 298 ------
NM_018953chr123791 743 192 ------
NM_018972chr832412 2397 896 --11929 --
NM_018994chr11470 ------
NM_018999chr1024106 4083 44314 4239 3706 1093 ----
NM_019000chr5--2416 248 ----
NM_019001chr384802 4480 4262 4231 3527 3391 563 158 14487 ----
NM_019004chr722120 868 22390 815 ----
NM_019006chr152704 627 ------
NM_019008chr2223718 1484 ------
NM_019009chr115910 490 398 299 72 ------
NM_019015chr7197 ------
NM_019021chr112849 613 ------
NM_019024chr2--134 ----
NM_019027chr42906 265 ------
NM_019028chr111320 ------
NM_019045chrX2809 245 ------
NM_019046chr101724 ------
NM_019083chr12620 118 ------
NM_019091chr25851 755 730 718 52 ------
NM_019096chr62119 31 ------
NM_019106chr2243454 2777 2289 313 12257 ----
NM_019114chr932147 2025 942 22510 2201 ----
NM_019116chr1653749 3357 1336 1329 730 11442 ----
NM_019555chr31271 ------
NM_019557chr11595 ------
NM_019558chr2156 ------
NM_019590chr10196 ------
NM_019593chr2032646 2034 879 --143 --
NM_019610chr121822 1524 ------
NM_019613chr1731242 247 140 ------
NM_019843chr221116 ------
NM_019859chr1021348 365 ------
NM_019895chr33907 462 426 ------
NM_020039chr1241611 1338 629 312 ------
NM_020116chr421440 1205 ------
NM_020122chr244637 890 312 37 ------
NM_020132chr2174707 4603 4193 3985 3219 3208 428 1772 ----
NM_020134chr21212 ------
NM_020144chr721728 282 ------
NM_020148chr1842912 863 650 160 ------
NM_020150chr1022095 355 ------
NM_020151chr22107 66 21215 211 ----
NM_020156chr71528 ------
NM_020159chr431634 1188 1123 ------
NM_020164chr81409 ------
NM_020180chr18----11213 --
NM_020182chr2043384 3324 3288 2723 12797 ----
NM_020198chr1711263 ------
NM_020200chr1011088 172 ----
NM_020201chr171699 ------
NM_020205chr133368 2602 921 ------
NM_020214chr151266 ------
NM_020238chr1121049 359 1957 ----
NM_020240chr521723 830 --11919 --
NM_020244chr12139 ------
NM_020245chr645098 4223 1548 263 ------
NM_020248chr142373 2036 1847 32 ------
NM_020310chr1782725 2644 2206 2147 2139 2114 776 378 --1908 --
NM_020311chr22501 234 1174 ----
NM_020336chr2023215 617 21077 518 ----
NM_020342chr212563 12293 ----
NM_020346chr1121381 119 ------
NM_020348chr1012621 1145 ----
NM_020354chr102739 87 ------
NM_020387chr11208 ------
NM_020390chr311123 171 ----
NM_020403chr1311265 1482 ----
NM_020416chr432525 739 553 12579 ----
NM_020429chr741991 861 288 126 ------
NM_020432chr71681 ------
NM_020443chr166842 6444 6124 2351 2320 162 15096 ----
NM_020445chr73757 732 525 1808 1190 --
NM_020456chr1321833 118 ------
NM_020463chr221379 507 1222 ----
NM_020465chr1631663 1558 562 11754 ----
NM_020466chr623756 770 23811 1135 ----
NM_020474chr181774 21387 375 ----
NM_020482chr6--1243 --145
NM_020526chr111586 ------
NM_020532chr21118 ------
NM_020630chr102676 571 1612 ----
NM_020640chr331933 723 345 ------
NM_020647chr832234 655 497 ------
NM_020648chr1822853 1825 ------
NM_020651chr2171 11657 ----
NM_020655chr1621397 226 --1321 --
NM_020689chr2031451 614 114 ------
NM_020693chr11168 ------
NM_020697chr861173 1032 977 909 374 351 ------
NM_020699chr164947 1492 1424 1300 1036 1025 ------
NM_020703chr11572 ------
NM_020708chr20------179
NM_020711chr222623 1722 ------
NM_020717chrX23220 1421 21997 1701 ----
NM_020718chr1676253 4431 4037 2237 1853 1566 1088 24023 1989 11893 --
NM_020732chr63254 191 61 ------
NM_020734chr1221318 81 ------
NM_020739chr1522687 827 1136 ----
NM_020742chrX12328 ------
NM_020747chr52879 166 ------
NM_020748chr1721982 1648 ------
NM_020752chr1042503 1844 950 533 ------
NM_020761chr1751859 740 622 428 40 2726 57 1175 --
NM_020762chr121132 ------
NM_020764chr1621262 1221 11351 ----
NM_020766chrX21390 540 24027 899 ----
NM_020769chrX1797 1677 ----
NM_020772chr17108486 7255 6786 6682 6176 2817 2235 1667 1399 951 1358 ----
NM_020774chr1846211 4159 1549 1397 --11742 --
NM_020791chr1721305 37 ------
NM_020792chr332565 2198 730 ------
NM_020794chr111124 11018 ----
NM_020795chr1721670 1289 ------
NM_020796chr532602 2334 1858 12640 ----
NM_020801chr532524 650 285 ------
NM_020804chr612574 ----1752
NM_020805chr1821547 1505 11712 ----
NM_020807chr161219 ------
NM_020808chr12815 110 ------
NM_020809chr1122290 2043 1902 ----
NM_020810chr1442728 864 666 336 ------
NM_020819chr611198 ------
NM_020825chr1632779 2564 375 23789 3476 ----
NM_020830chr2--3754 658 411 182 --
NM_020839chr32524 197 ------
NM_020841chr1221611 782 23049 2516 ----
NM_020844chr886249 5130 5107 2992 2167 1881 1306 972 27048 351 ----
NM_020854chr1831141 571 162 ------
NM_020856chr191181 ------
NM_020858chr1511733 ------
NM_020860chr411039 11092 ----
NM_020861chr611071 ------
NM_020868chr221949 1300 ------
NM_020871chrX11878 1791 ----
NM_020873chr31293 ------
NM_020917chr1931278 1205 608 ------
NM_020920chr14138 ------
NM_020922chrX11345 ------
NM_020926chrX--125 ----
NM_020927chr1641760 696 143 92 ------
NM_020935chr254023 3925 676 642 625 12891 ----
NM_020948chr11716 1184 ----
NM_020956chr1934588 3480 1053 23577 731 14648 --
NM_020958chr141311 ------
NM_020964chr1843247 1891 59 34 11881 ----
NM_020977chr422060 384 ------
NM_020983chr122899 239 ------
NM_020987chr1031267 1159 489 1283 ----
NM_020988chr162178 52 ------
NM_020993chr1251115 911 724 301 185 12193 ----
NM_021003chr142813 624 ------
NM_021005chr151417 ------
NM_021007chr222237 406 12157 ----
NM_021033chr1333121 3030 1050 23077 583 ----
NM_021038chr333364 3028 803 ------
NM_021064chr621516 384 11687 ----
NM_021069chr43427 341 164 ----188
NM_021072chr51272 ------
NM_021088chr221930 159 1392 1109 --
NM_021090chr22104657 4588 4182 4037 3860 3438 1132 699 243 38 24738 316 ----
NM_021096chr2263187 2997 2928 2773 1071 1054 12265 ----
NM_021097chr212011 11234 ----
NM_021101chr321686 867 12151 ----
NM_021104chr12----1288 --
NM_021109chrX173 ------
NM_021109chrX173 ------
NM_021111chr911098 ------
NM_021120chrX43055 2412 1151 439 22673 985 ----
NM_021131chr961451 1161 929 567 339 116 ------
NM_021136chr142154 143 ------
NM_021145chr721072 321 ------
NM_021148chr711746 139 ----
NM_021155chr1942709 2259 1926 537 ------
NM_021159chr421632 136 ----11120
NM_021161chr14134 ------
NM_021168chr16--11579 ----
NM_021180chr11581 1759 --197
NM_021190chr1--1139 ----
NM_021215chr2032416 2137 500 11588 1946 --
NM_021219chr21137 ------
NM_021249chr1421439 1377 ------
NM_021255chr1422632 88 ------
NM_021620chr61731 ------
NM_021622chr1021978 483 ------
NM_021627chr31909 1122 ----
NM_021643chr231766 1404 1270 ------
NM_021648chr622608 2047 ------
NM_021807chr71488 ------
NM_021809chr2062432 1957 1641 519 379 41 ------
NM_021813chr675668 4511 4309 4303 4143 3881 82 24821 3886 ----
NM_021814chr62264 87 11648 ----
NM_021825chr11228 21 ------
NM_021905chr62784 43 ------
NM_021911chr554083 1912 1071 390 263 13703 ----
NM_021912chr1532893 729 649 34059 3737 2909 ----
NM_021913chr191321 ------
NM_021914chr1422430 1861 1638 ----
NM_021925chr2--11457 ----
NM_021935chr32991 687 ------
NM_021940chr621221 507 ------
NM_021943chr6--11763 131 --
NM_021949chrX22607 2550 ------
NM_021954chr1353581 2743 1307 300 176 ------
NM_021956chr631514 975 120 ------
NM_021960chr111735 12753 ----
NM_021964chr346398 5946 4735 84 1200 --11544
NM_021973chr41631 1724 ----
NM_021988chr2011338 ------
NM_021998chrX21443 1244 1582 ----
NM_021999chr131542 ------
NM_022037chr22767 63 ------
NM_022041chr1641918 1713 894 361 ------
NM_022048chr1546396 5158 1946 228 ------
NM_022051chr11168 ------
NM_022059chr17--152 ----
NM_022072chr31246 ------
NM_022075chr12621 345 ------
NM_022079chr101890 ------
NM_022114chr164718 4561 3661 3418 1904 1623 12924 ----
NM_022133chr821429 1388 11224 ----
NM_022137chr1451762 1472 424 395 339 1609 ----
NM_022166chr1645395 4679 1626 1078 15755 14876 --
NM_022169chr112323 145 ------
NM_022170chr721132 187 21096 152 ----
NM_022173chr22767 63 ------
NM_022307chr7187 ------
NM_022336chr232002 1768 21 ------
NM_022362chr101335 ------
NM_022374chr2196 ------
NM_022442chr2011338 ------
NM_022456chr1267459 7305 4983 4879 1165 166 1938 ----
NM_022459chr1334041 1932 1551 1187 ----
NM_022463chr1711460 ------
NM_022465chr1212182 ------
NM_022474chr1432356 2048 1020 12083 --12551
NM_022484chr72295 76 ------
NM_022497chr322547 411 ------
NM_022572chr211482 1341 ----
NM_022574chr722009 294 ------
NM_022648chr254262 3592 3056 965 554 1463 12929 --
NM_022650chr51351 ------
NM_022652chr124839 351 207 119 ------
NM_022658chr1211059 ------
NM_022719chr2273786 3583 3311 2444 215 209 110 ------
NM_022726chr631786 1512 289 ------
NM_022735chr131854 1369 561 ------
NM_022737chr1921024 309 ------
NM_022753chr162650 2548 2361 899 763 76 ----12729
NM_022756chr111097 ------
NM_022763chr31981 1451 ----
NM_022767chr1541484 1228 365 196 11908 ----
NM_022768chr12341 272 ------
NM_022780chr211621 1243 ----
NM_022781chr953016 2412 1231 855 620 21298 732 ----
NM_022802chr102657 538 ------
NM_022817chr22557 80 11924 ----
NM_022822chr111879 ------
NM_022824chr511764 1168 ----
NM_022826chr2--1851 ----
NM_022828chr511758 ------
NM_022831chr121353 698 11548 ----
NM_022832chr432544 977 586 ------
NM_022836chr12539 400 ------
NM_022841chr1532681 2311 368 1269 ----
NM_022893chr243145 2913 993 430 22542 1172 ----
NM_022894chr221105 174 2227 86 ----
NM_022898chr1433968 3331 928 ------
NM_022910chr1631663 1558 562 11754 ----
NM_022912chr253048 2580 2272 1888 1107 12418 ----
NM_022965chr441459 1193 623 232 ------
NM_022970chr1031309 528 89 ------
NM_022977chrX31764 1006 156 ------
NM_023000chr1411452 ------
NM_023001chr1411452 ------
NM_023009chr1148 ------
NM_023012chr12--1550 1315 --
NM_023037chr131225 11009 ----
NM_023039chr51279 ------
NM_023068chr20--31247 1160 486 ----
NM_023071chr122704 308 1263 ----
NM_023076chr162949 314 12235 1796 1194
NM_023079chr1731694 449 419 ------
NM_023929chr822801 120 ------
NM_024007chr532433 1932 645 12358 ----
NM_024016chr172803 674 ------
NM_024034chr203897 182 47 ------
NM_024050chr191184 ------
NM_024069chr191703 ------
NM_024090chr421843 552 ------
NM_024117chr91935 ------
NM_024293chr23160 116 61 ------
NM_024297chr171226 --1542 --
NM_024312chr1221610 132 1291 ----
NM_024319chr1124 ------
NM_024329chr111183 ------
NM_024336chr16148 ------
NM_024429chr71236 ------
NM_024494chr1--1186 ----
NM_024501chr2----1564 --
NM_024511chr41773 ------
NM_024520chr22230 42 ------
NM_024524chr312550 ------
NM_024539chrX11215 ------
NM_024551chr1222568 1018 ------
NM_024551chr1222568 1018 ------
NM_024554chr131586 1459 172 ------
NM_024563chr531737 1437 443 11282 ----
NM_024567chr81579 1124 ----
NM_024569chr122381 328 ------
NM_024594chr511876 ------
NM_024595chr1152 ------
NM_024612chr17--2419 182 --1304
NM_024630chr61554 ------
NM_024645chr821591 1502 ------
NM_024646chr133570 3296 369 ------
NM_024659chr21961 ------
NM_024665chr334545 4137 232 ------
NM_024666chr1521197 42 ------
NM_024698chr1121204 1131 ------
NM_024721chr812273 12607 ----
NM_024742chr1621311 82 11217 ----
NM_024745chr16183 ------
NM_024755chr152918 274 ------
NM_024761chr965032 3264 1671 1556 926 37 14893 ----
NM_024770chr244615 1751 1205 497 ------
NM_024779chr121410 ------
NM_024811chr1111919 --11979 --
NM_024828chr91148 ------
NM_024837chr15----11813 1235
NM_024859chrX--1796 --11026
NM_024877chr192245 169 ------
NM_024887chr141774 1658 1629 1341 ------
NM_024900chr431556 866 827 --11768 --
NM_024900chr431556 866 827 --11768 --
NM_024909chr611591 ------
NM_024915chr852391 2231 1817 1773 527 1116 1975 --
NM_024930chr521098 851 22778 2126 ----
NM_024941chr5--11226 ----
NM_024944chr211183 1510 ----
NM_024947chr366464 3119 3055 2571 2477 2392 38564 728 420 ----
NM_024949chr434541 1842 336 ------
NM_024953chr1222314 716 ------
NM_024989chr246939 1635 921 470 21480 733 --12213
NM_024991chr1023247 610 ------
NM_025045chr22148 ------
NM_025054chr833580 1284 658 1216 ----
NM_025058chr1--1723 ----
NM_025073chr164185 3380 3158 1740 1058 157 34701 4233 649 ----
NM_025074chr411061 13015 ----
NM_025076chr22271 73 ------
NM_025083chr1531558 469 30 11424 ----
NM_025106chr121521 689 ------
NM_025125chr1011622 ------
NM_025126chr122516 293 ------
NM_025129chr19--141 ----
NM_025134chr1612215 12368 ----
NM_025140chr121203 --128 --
NM_025146chr31700 22735 1016 ----
NM_025151chr822018 441 ------
NM_025160chr143913 1497 1277 208 ------
NM_025164chr1141890 1795 153 76 ------
NM_025179chr154779 4453 3986 3251 106 23357 48 ----
NM_025181chr22729 284 ------
NM_025182chr91737 ------
NM_025191chr143386 2340 309 166 ------
NM_025195chr821621 188 ------
NM_025202chr221026 83 ------
NM_025211chr92209 75 ------
NM_025222chr322829 142 ------
NM_025235chr102870 243 ------
NM_025238chr1511163 ------
NM_025250chr752910 2055 1975 1088 972 ------
NM_025263chr631271 481 314 1453 ----
NM_030579chr1623363 1428 13038 ----
NM_030583chr81379 ------
NM_030621chr1454123 4031 2981 993 505 11175 1553 --
NM_030625chr1042418 725 593 79 161 ----
NM_030627chr523285 1641 ------
NM_030634chr122272 2239 ------
NM_030640chr121341 ------
NM_030647chr755593 5070 4572 4509 1032 --174 --
NM_030648chr444276 3566 1413 97 21822 1433 --13929
NM_030650chr223911 3316 13199 ----
NM_030652chr6--1292 ----
NM_030661chr711185 ------
NM_030664chr102655 414 12269 ----
NM_030665chr1711371 ------
NM_030667chr121834 21186 1092 ----
NM_030668chr121834 21186 1092 ----
NM_030669chr121834 21186 1092 ----
NM_030670chr1211866 22218 2124 ----
NM_030671chr1211866 22218 2124 ----
NM_030674chr1221286 33 ------
NM_030751chr10195 ------
NM_030751chr10195 ------
NM_030756chr101247 ------
NM_030761chr132115 2107 1683 --1804 --
NM_030762chr1231610 1403 1378 ------
NM_030763chrX--1751 ----
NM_030790chr162223 34 ------
NM_030799chr5----11893 --
NM_030805chr221060 226 ------
NM_030806chr149091 7028 6696 582 11779 ----
NM_030808chr173872 797 337 ------
NM_030809chr1212493 ------
NM_030881chr2232257 2122 844 ------
NM_030884chr342216 1861 1682 234 1753 ----
NM_030885chr332064 1801 1760 ------
NM_030915chr241969 1713 1637 285 ------
NM_030922chr151669 ------
NM_030945chr5198 ------
NM_030948chr6130 ------
NM_030949chr61505 1413 ----
NM_030963chr62579 213 ------
NM_030981chr1131045 365 235 ------
NM_031216chr18129 --1908 --
NM_031217chr111208 ------
NM_031243chr782418 2402 2296 1711 842 639 592 479 ------
NM_031262chr91121 ------
NM_031263chr91178 ------
NM_031267chr71185 ------
NM_031268chr16135185 4893 4886 4590 4341 4015 3311 1726 1431 1205 629 446 399 14382 ----
NM_031283chr21266 127 ----
NM_031305chr41518 11878 ----
NM_031365chr222493 262 21872 131 --137
NM_031366chr222493 262 21872 131 --137
NM_031371chr1140 ------
NM_031371chr1140 ------
NM_031372chr411464 21579 1508 ----
NM_031411chr511736 11895 1885 --
NM_031412chr122939 224 ------
NM_031431chr1311848 11305 ----
NM_031439chr831393 1266 265 11919 ----
NM_031442chrX22992 449 1148 ----
NM_031453chr1032233 1842 45 22194 975 ----
NM_031468chr767792 7755 6234 5331 1585 205 --16758 --
NM_031476chr1652764 2361 2038 820 279 ------
NM_031483chr2012415 ------
NM_031845chr213675 ------
NM_031847chr213675 ------
NM_031849chr511736 11895 1885 --
NM_031850chr3--1831 ----
NM_031850chr3--1831 ----
NM_031857chr511736 11895 1885 --
NM_031860chr511736 11895 1885 --
NM_031890chr2222603 2263 --12236 --
NM_031922chr61142 ------
NM_031953chr41169 ------
NM_031966chr51174 ------
NM_031989chr12136 ------
NM_031992chr721132 187 21096 152 ----
NM_032012chr965213 4496 4052 3813 1200 1184 2755 366 ----
NM_032017chr141661 1632 810 285 167 ----
NM_032041chr842634 2476 2461 1757 1411 ----
NM_032049chr3--1831 ----
NM_032049chr3--1831 ----
NM_032052chr2251332 1070 1011 441 397 ------
NM_032088chr521624 237 ------
NM_032092chr521624 237 ------
NM_032102chr1133094 2824 718 12393 --1390
NM_032116chr1345909 5721 5250 1596 ------
NM_032121chrX62818 2426 1873 844 671 625 11889 ----
NM_032124chr181321 ------
NM_032144chr221412 384 ------
NM_032145chr611812 ------
NM_032153chr3--12344 ----
NM_032186chr111148 ------
NM_032189chr1364250 1913 1389 1193 428 331 24787 268 --1205
NM_032192chr171740 --148 --
NM_032195chr211505 ------
NM_032199chr1013560 13485 ----
NM_032208chr213310 11160 ----
NM_032221chr203748 345 195 21847 1399 ----
NM_032229chr133810 730 34 ------
NM_032236chr111008 1765 ----
NM_032242chr363154 2750 2505 2045 857 381 ------
NM_032250chr92664 324 ------
NM_032281chr1922563 246 ------
NM_032288chr332352 1838 1492 1413 ----
NM_032295chr7163 ------
NM_032298chr191318 ------
NM_032320chr11150 ------
NM_032357chr22701 38 ------
NM_032403chr521624 237 ------
NM_032420chr51712 ------
NM_032434chr261203 607 529 311 96 45 31541 474 50 ----
NM_032435chr132394 2350 88 1166 ----
NM_032438chr621598 1399 ------
NM_032439chr10165 ------
NM_032440chr101732 11844 ----
NM_032445chr15--1432 ----
NM_032446chr553066 1459 1251 951 49 23294 221 ----
NM_032452chr143508 481 293 ------
NM_032457chr413353 12490 ----
NM_032458chrX21212 652 22247 33 ----
NM_032466chr821582 1397 ------
NM_032467chr81409 ------
NM_032468chr821582 1397 ------
NM_032521chr2042383 1197 340 242 ------
NM_032552chr931904 1282 256 ------
NM_032558chr911295 ------
NM_032560chr141762 ------
NM_032575chr16--21970 1868 ----
NM_032578chr1021433 21 ------
NM_032590chr121146 ------
NM_032594chr141829 ------
NM_032596chr91122 ------
NM_032626chr161324 ------
NM_032632chr142770 50 ------
NM_032663chr1222053 1720 ------
NM_032682chr323007 2248 ------
NM_032689chr19--1570 ----
NM_032711chr1764265 3524 3308 2884 966 293 ------
NM_032727chr101326 ------
NM_032731chr1721475 515 ------
NM_032777chr811433 ------
NM_032784chr62345 209 ------
NM_032803chrX122 ------
NM_032812chr101115 ------
NM_032813chr132997 947 ------
NM_032827chr211116 ------
NM_032833chr122071 81 1300 ----
NM_032842chr7--21683 149 ----
NM_032875chr171774 ------
NM_032902chr81208 ------
NM_032927chr4140 1505 ----
NM_032932chr1786412 6356 6005 5371 5356 5307 4096 3936 ------
NM_032936chr7133 ------
NM_032940chr161843 1217 ----
NM_032947chr55973 458 186 124 118 ------
NM_032960chr141325 446 404 294 ------
NM_032968chrX11369 21006 580 ----
NM_032969chrX11369 21006 580 ----
NM_032971chrY3950 315 267 ------
NM_032972chrY3950 315 267 ------
NM_032973chrY11369 21006 580 ----
NM_032975chr181927 43522 3209 2270 378 --12435
NM_032980chr181927 43522 3209 2270 378 --12435
NM_032999chr71764 --1789 --
NM_033000chr71764 --1789 --
NM_033001chr71764 --1789 --
NM_033016chr2231223 372 53 ------
NM_033018chrX21200 904 ------
NM_033020chr154590 3336 3085 1091 555 11555 ----
NM_033030chr24505 190 158 102 ------
NM_033044chr131086 1061 1035 ------
NM_033056chr101688 ------
NM_033082chr121170 ------
NM_033083chr323389 2772 ------
NM_033103chr192865 221 ------
NM_033105chr8192 ------
NM_033132chr1321893 1514 11869 ----
NM_033138chr72511 237 ------
NM_033139chr72511 237 ------
NM_033140chr72511 237 ------
NM_033143chr41840 ------
NM_033157chr72511 237 ------
NM_033161chr931953 1604 598 ------
NM_033181chr633007 938 786 ------
NM_033182chr111531 152 ----
NM_033211chr5167 --11607 --
NM_033224chr767817 4899 2341 2174 2154 1444 11013 ----
NM_033225chr842959 2680 2052 621 12882 11949 --
NM_033226chr162144 78 ------
NM_033278chr111340 ------
NM_033285chr853105 1333 1243 165 83 ------
NM_033290chrX53770 3375 3273 2629 2386 ------
NM_033312chr1123 ------
NM_033315chr1731739 1406 231 12169 ----
NM_033326chr1121885 389 ------
NM_033331chr922361 234 ------
NM_033360chr1214586 34036 3699 1200 ----
NM_033380chrX1407 ------
NM_033381chrX1407 ------
NM_033389chr1763968 3728 3416 1626 1010 286 13854 ----
NM_033401chr162394 218 ------
NM_033407chr1--1204 ----
NM_033449chr531351 749 37 156 ----
NM_033495chrX3941 288 26 ------
NM_033496chr101177 ------
NM_033497chr101177 ------
NM_033498chr101177 ------
NM_033500chr101177 ------
NM_033503chr1533203 2624 310 12439 ----
NM_033505chr266675 4747 4654 4605 2075 960 12163 ----
NM_033512chr822943 943 1769 ----
NM_033549chr511006 ------
NM_033551chr531195 1124 555 12291 ----
NM_033631chr143100 2661 1396 21 ------
NM_033632chr41214 ------
NM_033642chrX2875 53 ------
NM_033644chr5--1959 ----
NM_033645chr5--1959 ----
NM_033656chr2144983 4028 3790 603 34061 3660 66 --1636
NM_044472chr13529 521 508 ------
NM_052828chr61510 ------
NM_052845chr1223008 2856 2887 782 ----
NM_052855chr17--1621 ----
NM_052867chr1311229 11146 ----
NM_052879chr1223074 3040 33991 1402 568 ----
NM_052897chr122770 708 ------
NM_052898chr821859 608 ------
NM_052901chr92358 98 11763 ----
NM_052905chr221713 373 ------
NM_052906chr2234893 3384 606 23699 1057 ----
NM_052911chr181975 1780 ----
NM_052918chr1043657 3286 1037 647 ------
NM_052925chr191292 ------
NM_052927chr51160 ------
NM_052934chr132006 1493 394 2635 456 ----
NM_052937chr842673 1945 1090 487 11780 ----
NM_052940chr11223 ------
NM_053002chr32982 374 ------
NM_053016chr987983 7879 1895 1641 1012 686 463 425 27357 7115 ----
NM_053023chr1143327 2408 2152 211 1537 ----
NM_053025chr311801 ------
NM_053026chr311801 ------
NM_053027chr311801 ------
NM_053028chr311801 ------
NM_053031chr311801 ------
NM_053032chr311801 ------
NM_053042chr432912 2537 967 --11220 --
NM_053056chr1132713 2540 2206 --11051 --
NM_053067chr9--1106 ----
NM_053280chr112193 73 ------
NM_054016chr122020 157 ------
NM_054016chr122020 157 ------
NM_054016chr122020 157 ------
NM_054026chr82899 803 ------
NM_054110chr3----1229 --
NM_057161chr63503 429 143 140 ----
NM_057175chr41397 1310 ----
NM_057749chr821071 92 1196 ----
NM_058167chr121000 266 --1939 --
NM_058170chr121170 526 1501 ----
NM_058191chr211862 ------
NM_058237chr14--1760 ----
NM_058241chr2196 22363 879 ----
NM_058241chr2196 22363 879 ----
NM_078471chr171465 ------
NM_078485chr62509 24 ------
NM_078487chr923140 2331 ------
NM_080391chr11549 ------
NM_080392chr12598 40 ------
NM_080491chr1133886 3529 670 13591 ----
NM_080552chr201203 ------
NM_080591chr92722 470 ------
NM_080594chr162185 170 ------
NM_080597chr1821061 283 1383 ----
NM_080607chr202842 39 ------
NM_080616chr203585 122 45 ------
NM_080617chr202899 252 ------
NM_080629chr11282 ------
NM_080630chr11282 ------
NM_080645chr621698 660 ------
NM_080655chr9--1190 ----
NM_080664chr1441882 1274 246 28 ------
NM_080669chr1763559 3308 3276 1284 785 535 --11529 --
NM_080671chr212015 ------
NM_080678chr21230 ------
NM_080683chr41168 ------
NM_080684chr41168 ------
NM_080685chr41168 ------
NM_080686chr61147 ------
NM_080723chr61401 11083 --11192
NM_080738chr11619 ------
NM_080752chr201404 ------
NM_080792chr202905 779 ------
NM_080862chr311021 1933 ----
NM_080872chr823956 3373 ------
NM_080927chr312648 12581 ----
NM_100264chr101222 ------
NM_100486chr101222 ------
NM_130385chr112924 828 11245 ----
NM_130391chr922657 684 ------
NM_130392chr922657 684 ------
NM_130393chr922657 684 ------
NM_130436chr2122555 2267 ------
NM_130438chr2123132 2844 ------
NM_130439chr1022006 1461 ------
NM_130439chr1022006 1461 ------
NM_130440chr131556 1433 1234 1107 ----
NM_130442chr711168 1930 ----
NM_130459chr921080 177 ------
NM_130469chr144848 657 593 247 ------
NM_130811chr204922 319 128 33 1447 ----
NM_130838chr151565 ------
NM_130839chr151565 ------
NM_130846chr1211032 1434 ----
NM_130847chr1175790 5597 5551 2308 1405 1100 1003 11297 11557 --
NM_133170chr2097181 6959 6921 5888 5104 2865 2599 1512 42 27891 2642 15465 --
NM_133263chr51141 ------
NM_133264chr1743645 3311 2939 2598 1973 ----
NM_133265chrX22752 426 ------
NM_133334chr486406 6134 6052 4740 2470 2219 442 286 25275 5203 ----
NM_133372chr512875 1327 ----
NM_133378chr21874 --1639 --
NM_133432chr21874 --1639 --
NM_133433chr5----1176 --
NM_133437chr21874 --1639 --
NM_133493chr654506 4258 1063 1040 730 14093 ----
NM_133499chrX2811 728 --1915 --
NM_133510chr141121 ------
NM_133625chr341354 907 549 275 ------
NM_133631chr3----1223 --
NM_133633chr22----11163 --
NM_133634chr2121678 1294 ------
NM_133638chr541438 563 490 295 ------
NM_133642chr2231281 883 36 --158 --
NM_133647chr1532961 852 531 --13141 --
NM_134265chr171353 ------
NM_134428chr9--194 ----
NM_134442chr231291 1195 591 1476 ----
NM_138270chrX32718 2583 2489 ------
NM_138288chr1411970 ------
NM_138317chr14134 ------
NM_138318chr14134 ------
NM_138333chr91501 ------
NM_138423chr152762 37 ------
NM_138426chr71353 ------
NM_138441chr6187 ------
NM_138444chr1333436 1848 1746 14316 ----
NM_138468chr235836 5132 199 ------
NM_138473chr1234905 1153 585 ------
NM_138479chr131444 256 141 ------
NM_138492chr52411 330 ------
NM_138559chr231253 360 107 ----1257
NM_138576chr1433968 3331 928 ------
NM_138609chr51535 ------
NM_138610chr51535 ------
NM_138621chr244148 3483 2965 2844 ------
NM_138638chr1422430 1861 1638 ----
NM_138693chr7----153 --
NM_138713chr1667701 7284 6103 5848 1057 485 11457 ----
NM_138714chr1667701 7284 6103 5848 1057 485 11457 ----
NM_138764chr19149 ------
NM_138771chr71211 ------
NM_138773chr51851 ------
NM_138782chr521677 720 ------
NM_138927chr211870 ------
NM_138931chr311031 1419 ----
NM_138970chr1432162 1690 256 ------
NM_138971chr1112589 ------
NM_138971chr1112589 ------
NM_138972chr1112589 ------
NM_138972chr1112589 ------
NM_138973chr1112589 ------
NM_138973chr1112589 ------
NM_138980chr41613 ------
NM_138981chr41744 ------
NM_138982chr41613 ------
NM_138994chr162394 218 ------
NM_139014chr631453 769 382 ------
NM_139015chr1251605 1363 1337 1222 1151 21711 1665 ----
NM_139048chr311126 ------
NM_139071chr121111 1600 ----
NM_139078chr121117 1249 ----
NM_139131chr112189 62 ------
NM_139135chr141051 1023 872 116 ------
NM_139136chr121431 ------
NM_139156chr12835 73 ------
NM_139170chr162544 24 1560 ----
NM_139211chr43124 117 74 ------
NM_139212chr43124 117 74 ------
NM_139215chr171226 ------
NM_139276chr1722378 2270 ------
NM_139279chr231092 1049 826 1899 ----
NM_139280chr1731104 1016 523 ------
NM_139283chr1222565 848 1295 ----
NM_139312chr1011135 11399 1597 --
NM_139316chr741070 1030 831 821 1214 ----
NM_139319chr1221862 428 11757 ----
NM_139343chr22432 373 ------
NM_139344chr22432 373 ------
NM_139345chr22432 373 ------
NM_139346chr22432 373 ------
NM_139347chr22432 373 ------
NM_139348chr22432 373 ------
NM_139349chr22432 373 ------
NM_139350chr22432 373 ------
NM_139351chr22432 373 ------
NM_144498chr2022088 187 3803 786 541 ----
NM_144568chr141221 ------
NM_144571chr486385 5930 5823 1847 1633 1155 1020 131 ------
NM_144578chr1454766 4157 3575 1979 1811 25007 1837 ----
NM_144580chr1146 ------
NM_144582chr261921 1758 1690 1673 944 419 ------
NM_144595chr131972 ------
NM_144628chr2023054 2468 ------
NM_144633chr32962 161 ------
NM_144635chr31138 1902 ----
NM_144636chr33768 640 95 ------
NM_144664chr1132503 2006 914 ------
NM_144726chr5--1976 ----
NM_144732chr191432 ------
NM_144767chr1554487 3395 3278 966 62 --12929 --
NM_144949chr2--1147 ----
NM_144963chr8--22681 698 ----
NM_145005chr911073 ------
NM_145036chr17144 ------
NM_145055chr1863583 3348 2856 2574 989 100 ------
NM_145068chr171442 1173 136 --
NM_145109chr171976 ------
NM_145117chr1142972 2530 1036 256 1757 ----
NM_145185chr192738 362 --1268 --
NM_145201chr82273 123 ------
NM_145203chr131176 ------
NM_145206chr1013153 ------
NM_145234chrX1720 ------
NM_145251chr1421142 626 ------
NM_145259chr256549 5528 5280 4970 583 25140 2767 ----
NM_145279chr111799 ------
NM_145284chrX2617 35 1902 ----
NM_145290chr4--1216 ----
NM_145307chr1023120 1758 ------
NM_145309chr11175 ------
NM_145313chr1021093 587 ------
NM_145320chr733060 2556 990 ------
NM_145321chr733060 2556 990 ------
NM_145322chr733060 2556 990 ------
NM_145341chr101422 ------
NM_145349chr1731637 1444 224 ------
NM_145686chr223399 237 ------
NM_145687chr223399 237 ------
NM_145690chr8168 1622 ----
NM_145698chr101116 ------
NM_145716chr11506 ------
NM_145731chr222616 227 ------
NM_145733chr2221243 78 146 ----
NM_145735chr135950 900 643 494 72 ------
NM_145738chr222616 227 ------
NM_145754chr8--1196 ----
NM_145799chrX1448 33110 931 389 ----
NM_145800chrX1844 ------
NM_145802chrX1793 ------
NM_145804chr1151308 1145 1019 177 105 11347 ----
NM_145808chr732812 901 414 ------
NM_145858chr211337 1421 ----
NM_145861chr11619 ------
NM_145891chr1641617 1598 1504 1151 --11419 --
NM_145892chr1641617 1598 1504 1151 --11419 --
NM_145893chr1641739 1720 1626 1273 --11541 --
NM_145912chr2263998 1275 1167 895 434 221 ------
NM_147150chr943437 2944 2876 1392 ------
NM_147161chr13442 358 257 ------
NM_147164chr91564 ------
NM_147168chr91122 ------
NM_147175chrX21998 269 11438 ----
NM_147189chr811431 ------
NM_148174chr811913 ------
NM_148894chr42827 111 ------
NM_148898chr71939 ------
NM_148899chr71939 ------
NM_152233chr1421439 1377 ------
NM_152253chr2244299 2651 768 521 1694 ----
NM_152261chr122642 114 1743 ----
NM_152264chr1121069 250 ----1890
NM_152265chr121303 134 ------
NM_152277chr512077 160 11463 1768
NM_152280chr133471 2723 1179 ------
NM_152282chr331034 925 911 11344 ----
NM_152317chr12150 ------
NM_152330chr1431734 616 505 12437 ----
NM_152344chr1711129 ------
NM_152345chr172463 234 --1336 --
NM_152388chr283153 2930 2820 2716 1170 1015 946 165 23407 1213 13702 --
NM_152409chr532524 2254 296 ------
NM_152410chr61339 ------
NM_152414chr821427 1202 ------
NM_152417chr821200 414 ------
NM_152422chr91466 1711 ----
NM_152423chrX41157 995 490 41 ------
NM_152424chrX74415 3550 1745 1313 721 677 285 11494 ----
NM_152437chr1222359 1717 ------
NM_152450chr1532067 1960 1605 21836 1479 1486 --
NM_152470chr1844161 4094 3964 3054 ------
NM_152493chr1------11359
NM_152523chr21491 ------
NM_152529chr22570 114 13555 ----
NM_152538chr311815 1142 ----
NM_152557chr711332 ------
NM_152588chr123477 464 160 1174 ----
NM_152594chr1512133 ------
NM_152621chr4148 ------
NM_152622chr512812 ------
NM_152624chr545968 2945 2077 659 12919 ----
NM_152641chr1242527 2357 816 227 --11968 --
NM_152660chr14912 173 71 43 ------
NM_152663chr11323 ------
NM_152682chr411339 ------
NM_152692chrX--151 ----
NM_152699chr333667 1147 845 1869 ----
NM_152716chr1171445 1422 1390 1269 1056 549 147 --11482 --
NM_152721chr181758 ------
NM_152744chr723093 929 ------
NM_152745chr7--2404 61 ----
NM_152749chr72978 290 ------
NM_152758chr822296 252 ------
NM_152787chrX33854 3173 145 ------
NM_152789chr731189 1139 995 ------
NM_152793chr754470 3784 1494 755 230 23458 1177 ----
NM_152835chr122723 1081 12588 ----
NM_152836chr821429 1388 11224 ----
NM_152837chr821429 1388 11224 ----
NM_152838chr2042347 544 186 43 13004 ----
NM_152860chr1221444 377 ------
NM_152862chr21293 ------
NM_152890chr12972 32 ------
NM_152910chr132176 110 ------
NM_152924chr1555231 2532 1493 966 750 24829 2256 ----
NM_152989chr121329 11607 ----
NM_152991chr113630 570 488 ------
NM_153013chr522360 2057 1684 ----
NM_153020chr621685 364 ------
NM_153029chr1633782 3732 1530 --13394 --
NM_153035chr122833 2036 1234 ----
NM_153050chr22104657 4588 4182 4037 3860 3438 1132 699 243 38 24738 316 ----
NM_153051chr22104657 4588 4182 4037 3860 3438 1132 699 243 38 24738 316 ----
NM_153184chr331796 1482 156 ------
NM_153188chr514493 11212 ----
NM_153223chr511450 ------
NM_153235chr611681 1173 ----
NM_153261chr1631292 1096 380 ------
NM_153262chr152678 2599 1236 915 91 ------
NM_153267chr91614 ------
NM_153321chr172965 147 ------
NM_153322chr172965 147 ------
NM_153346chrX2590 89 ------
NM_153367chr1033995 3932 1035 11471 ----
NM_153374chr152398 375 ------
NM_153437chr9181 ------
NM_153450chr111626 ------
NM_153498chr101230 ------
NM_153607chr522793 1123 ------
NM_153616chr1511733 ------
NM_153617chr1511733 ------
NM_153618chr1511733 ------
NM_153619chr1522971 2432 ------
NM_153631chr711185 ------
NM_153632chr711185 ------
NM_153633chr122619 236 ------
NM_153649chr142170 877 587 490 ------
NM_153690chr31799 ------
NM_153715chr731241 470 298 ------
NM_153746chr61554 ------
NM_153748chr121431 ------
NM_153812chr132306 829 145 1352 ----
NM_153825chr421595 1507 2586 566 ----
NM_153828chr21118 ------
NM_170587chr81220 1268 ----
NM_170606chr7--1727 ----
NM_170607chr1711390 ------
NM_170662chr31435 ------
NM_170665chr1233050 1433 983 12850 13739 --
NM_170674chr1511281 11353 ----
NM_170675chr151957 11029 ----
NM_170676chr151957 11029 ----
NM_170677chr1511281 11353 ----
NM_170679chr511334 ------
NM_170709chr81183 ------
NM_170731chr1142600 2328 942 502 1507 ----
NM_170732chr1142600 2328 942 502 1507 ----
NM_170733chr1142600 2328 942 502 1507 ----
NM_170734chr1142600 2328 942 502 1507 ----
NM_170735chr1142600 2328 942 502 1507 ----
NM_170768chr11--11357 ----
NM_171825chr542475 2156 297 30 11157 ----
NM_171998chrX1177 ------
NM_172037chr821045 429 11459 ----
NM_172058chr831842 1830 190 1129 ----
NM_172059chr831842 1830 190 1129 ----
NM_172060chr831842 1830 190 1129 ----
NM_172070chr211597 22263 670 ----
NM_172071chr125158 1847 35974 4554 574 ----
NM_172127chr41643 1432 ----
NM_172128chr41599 1388 ----
NM_172130chr121575 69 ------
NM_172159chr341788 1763 242 149 ------
NM_172160chr341788 1763 242 149 ------
NM_172169chr103652 600 194 ------
NM_172170chr103652 600 194 ------
NM_172171chr103652 600 194 ------
NM_172173chr103652 600 194 ------
NM_172231chr19------192
NM_172315chr1511281 11353 ----
NM_172316chr1511281 11353 ----
NM_172387chr1821699 1193 1551 ----
NM_172388chr1821746 1240 1598 ----
NM_172389chr1821746 1240 1598 ----
NM_173054chr71635 ------
NM_173075chr451680 624 543 471 209 ------
NM_173156chr141499 1417 782 246 11603 --1116
NM_173171chr22979 483 ------
NM_173173chr22979 483 ------
NM_173174chr82616 68 1623 ----
NM_173175chr82616 68 1623 ----
NM_173176chr82616 68 1623 ----
NM_173198chr92626 589 22860 2493 ----
NM_173199chr9--1416 ----
NM_173200chr92626 589 22860 2493 ----
NM_173214chr1667701 7284 6103 5848 1057 485 11457 ----
NM_173354chr2152039 1948 1654 1630 371 ------
NM_173470chrX52480 2431 2069 585 386 ------
NM_173475chr162478 150 11191 ----
NM_173491chr521294 59 ------
NM_173495chrX31995 978 501 --1659 --
NM_173496chr103438 381 360 --1245 --
NM_173500chr1521363 1294 ------
NM_173508chr11987 ----11122
NM_173510chr2222630 431 22896 27 ----
NM_173511chr263905 2824 1064 747 538 22 ------
NM_173546chr31634 ------
NM_173552chr312020 2529 229 ----
NM_173561chr62188 81 ------
NM_173576chr1021614 610 ------
NM_173582chr1121772 1580 24243 1981 ----
NM_173591chr122973 94 3983 895 243 ----
NM_173595chr1265263 4739 4538 4259 4038 1810 ------
NM_173602chr1233622 3441 3171 ------
NM_173630chr18--183 ----
NM_173672chr632565 2507 55 1333 ----
NM_173694chrX42509 1764 1750 1604 --12259 --
NM_173794chrX1181 ------
NM_173797chr511215 1412 ----
NM_173808chr113904 11491 ----
NM_173814chr152532 63 ------
NM_173848chr82850 838 ------
NM_174856chr201130 1286 ----
NM_174911chr841572 1005 861 837 ------
NM_174916chr151955 ------
NM_175058chr113406 135 94 ------
NM_175607chr34617 581 515 26 ------
NM_175610chr1511269 ------
NM_175612chr34617 581 515 26 ------
NM_175613chr3126 ------
NM_175623chr1267459 7305 4983 4879 1165 166 1938 ----
NM_175634chr821312 380 ------
NM_175635chr821312 380 ------
NM_175636chr821312 380 ------
NM_175747chr61858 --1138 --
NM_175767chr53630 535 166 ------
NM_175768chr631718 1179 324 ------
NM_175854chr1332432 1845 1072 1207 ----
NM_175856chr52146 120 ------
NM_175863chr63254 191 61 ------
NM_175866chr121456 400 ------
NM_175876chr122755 1116 ------
NM_175898chr151239 ------
NM_175907chr1812339 12867 1851 --
NM_175929chr131125 ------
NM_175931chr16173 ------
NM_176081chr1065037 4426 4282 3755 2267 1139 15663 15747 --
NM_176083chr1065037 4426 4282 3755 2267 1139 15663 15747 --
NM_176812chr202704 226 ------
NM_176814chr71145 1234 ----
NM_176871chr81683 23308 1106 ----
NM_177398chr131880 1337 129 ------
NM_177399chr131880 1337 129 ------
NM_177414chr121078 24 ------
NM_177424chr121789 31 11501 ----
NM_177438chr1454123 4031 2981 993 505 11175 1553 --
NM_177553chr111914 ------
NM_177559chr2021177 801 ------
NM_177560chr2021177 801 ------
NM_177952chr142813 624 ------
NM_177968chr221526 1360 ------
NM_177974chr152762 37 ------
NM_177995chr91466 1711 ----
NM_177996chr2033392 3319 2742 1701 ----
NM_177999chr933062 3022 2344 13674 ----
NM_178000chr961451 1161 929 567 339 116 ------
NM_178001chr961451 1161 929 567 339 116 ------
NM_178003chr961451 1161 929 567 339 116 ------
NM_178009chr132139 73 ------
NM_178010chr121329 11607 ----
NM_178011chr1021159 524 13084 ----
NM_178140chr51735 12715 ----
NM_178148chr62444 61 ------
NM_178151chrX107741 7709 7306 7016 6219 1644 1587 795 538 357 21106 559 ----
NM_178152chrX107741 7709 7306 7016 6219 1644 1587 795 538 357 21106 559 ----
NM_178153chrX107741 7709 7306 7016 6219 1644 1587 795 538 357 21106 559 ----
NM_178154chr141543 ------
NM_178155chr141543 ------
NM_178156chr141543 ------
NM_178157chr141543 ------
NM_178161chr10------1318
NM_178167chr162419 26 ------
NM_178175chrX1177 ------
NM_178177chr3--161 ----
NM_178232chr15--1589 ----
NM_178313chr212170 11984 ----
NM_178314chr121813 ------
NM_178424chr5--1417 ----
NM_178426chr13899 244 21 ------
NM_178427chr12799 144 ------
NM_178450chr53651 298 178 ------
NM_178498chr1142688 1346 701 598 13746 ----
NM_178502chr12131 ------
NM_178509chr1733423 1131 726 13985 ----
NM_178539chr1211407 ------
NM_178548chr11604 ------
NM_178554chr383589 2645 2256 1433 732 434 323 311 ------
NM_178568chr1751408 1142 1132 216 129 ------
NM_178585chr432391 841 272 ------
NM_178587chr14185 ------
NM_178812chr8159 11400 --11437
NM_178818chr1641786 1780 1718 60 ------
NM_178819chr8183 ------
NM_178860chr172740 86 ------
NM_180976chr62755 87 ------
NM_180977chr62755 87 ------
NM_180989chr1322481 1915 ------
NM_181054chr14--11194 ----
NM_181332chrX12328 ------
NM_181349chr741991 861 288 126 ------
NM_181351chr1122830 2175 ------
NM_181354chr8--11205 ----
NM_181356chr61196 1841 ----
NM_181361chr31147 1353 ----
NM_181442chr2031045 173 73 1745 ----
NM_181443chr2022574 2020 11832 ----
NM_181459chr2--1411 ----
NM_181460chr2--1458 ----
NM_181481chr18127052 7007 6060 5473 5295 4992 4957 4645 4539 1924 1889 644 36451 5782 2097 ----
NM_181482chr18127052 7007 6060 5473 5295 4992 4957 4645 4539 1924 1889 644 36451 5782 2097 ----
NM_181483chr18127052 7007 6060 5473 5295 4992 4957 4645 4539 1924 1889 644 36451 5782 2097 ----
NM_181492chr2231247 977 179 ------
NM_181504chr52906 461 23357 1046 ----
NM_181505chr171740 --148 --
NM_181523chr52906 461 23357 1046 ----
NM_181524chr52906 461 23357 1046 ----
NM_181552chr71689 ------
NM_181598chr14--1239 ----
NM_181642chr152462 431 ------
NM_181645chr112211 174 ------
NM_181671chr17--1741 ----
NM_181672chrX12063 ------
NM_181673chrX12063 ------
NM_181674chr51341 ------
NM_181675chr51341 ------
NM_181676chr51341 ------
NM_181677chr51341 ------
NM_181678chr51341 ------
NM_181702chr8140 1405 ----
NM_181704chr2121258 46 ------
NM_181746chr12621 345 ------
NM_181762chrX1117 ------
NM_181777chrX1117 ------
NM_181782chr612218 ------
NM_181784chr242065 1912 1830 1683 ------
NM_181809chr123488 3263 2192 82 21490 1369 --
NM_181839chr831287 1003 477 ------
NM_181864chr13275 219 117 ------
NM_181865chr13275 219 117 ------
NM_181866chr13275 219 117 ------
NM_181873chr1122 ------
NM_181876chr432525 739 553 12579 ----
NM_181886chr41885 21289 391 ----
NM_181887chr41885 21289 391 ----
NM_181888chr41885 21289 391 ----
NM_181889chr41885 21289 391 ----
NM_181890chr41885 21289 391 ----
NM_181891chr41885 21289 391 ----
NM_181892chr41932 21336 438 ----
NM_181893chr41885 21289 391 ----
NM_182314chrX31596 242 211 ------
NM_182470chr152510 412 ------
NM_182471chr152510 412 ------
NM_182481chr2111163 ------
NM_182482chr2111163 ------
NM_182484chr2121258 46 ------
NM_182488chr132777 205 ------
NM_182503chr645220 3511 1894 68 33947 3585 596 ----
NM_182511chr1811051 ------
NM_182529chr7--130 ----
NM_182543chr102135 45 180 ----
NM_182557chr1121746 620 ------
NM_182580chr122115 1686 ------
NM_182641chr1721357 48 ------
NM_182648chr142486 72 ------
NM_182663chr131918 1828 901 1775 ----
NM_182664chr122048 1958 1905 ----
NM_182665chr131918 1828 901 1775 ----
NM_182666chr3--1593 ----
NM_182678chr21414 ------
NM_182691chr711427 ------
NM_182692chr711427 ------
NM_182697chr721636 464 ------
NM_182700chr731356 600 530 --1204 --
NM_182705chr1752901 2505 2080 249 215 --142 --
NM_182715chr731205 786 271 ------
NM_182728chr1421350 1220 ------
NM_182752chr1--11502 21306 253 --
NM_182757chr64636 570 553 219 1353 ----
NM_182763chr111724 12742 ----
NM_182767chr1212089 ------
NM_182796chr52359 295 ------
NM_182797chr2021226 94 ------
NM_182830chr141656 1529 ----
NM_182896chr31465 ------
NM_182898chr745123 1176 452 152 16271 ----
NM_182899chr745123 1176 452 152 16271 ----
NM_182910chr141856 ------
NM_182913chr141856 ------
NM_182914chr141856 ------
NM_182917chr31384 ------
NM_182918chr2121126 535 1578 ----
NM_182931chr73261 226 130 1179 ----
NM_182948chr122880 248 ------
NM_182964chr1142972 2530 1036 256 1757 ----
NM_182970chr2063859 3812 1574 1309 836 760 ------
NM_182972chr121014 895 1491 1699 --
NM_182978chr181693 1181 ----
NM_183049chr4173 ------
NM_183061chr3136 ------
NM_183078chr643829 3789 2952 2656 23640 2351 ----
NM_183228chr171677 ------
NM_183229chr171677 ------
NM_183230chr171677 ------
NM_183231chr171677 ------
NM_183232chr171677 ------
NM_183373chr6255 34 ------
NM_183376chr1521886 960 12324 ----
NM_184231chr32663 193 ------
NM_194247chr223627 3450 21522 54 ----
NM_194248chr21983 --1125 --
NM_194259chr161530 ------
NM_194260chr161530 ------
NM_194261chr161530 ------
NM_194271chr122516 293 ------
NM_194278chr1444007 3758 1000 691 ------
NM_194281chr18133 193 ----
NM_194282chr42971 695 1538 ----
NM_194285chr1123365 351 22274 145 ----
NM_194291chr842851 2447 360 186 163 ----
NM_194292chr1--1115 ----
NM_194298chr1031960 1678 1262 1249 ----
NM_194315chr121000 266 --1939 --
NM_194318chr1342456 2309 625 72 ------
NM_194322chr21983 --1125 --
NM_194328chr953016 2412 1231 855 620 21298 732 ----
NM_194329chr953016 2412 1231 855 620 21298 732 ----
NM_194330chr953016 2412 1231 855 620 21298 732 ----
NM_194332chr953016 2412 1231 855 620 21298 732 ----
NM_194434chr1845667 1660 1549 22 24639 369 ----
NM_194442chr111134 ------
NM_194452chr11--21238 182 ----
NM_194453chr11--21238 182 ----
NM_194454chr721354 1135 ------
NM_194455chr721354 1135 ------
NM_194456chr721354 1135 ------
NM_194457chr121000 266 --1939 --
NM_194458chr121000 266 --1939 --
NM_194463chrX11215 ------
NM_197956chr951842 1668 1519 758 649 2341 270 ----
NM_197970chr24505 190 158 102 ------
NM_197972chr1192 ------
NM_198066chr1443019 1096 380 178 --12160 --
NM_198074chr14472 282 270 209 ------
NM_198158chr312965 1701 ----
NM_198159chr312965 1701 ----
NM_198173chr11581 1759 --197
NM_198174chr11581 1759 --197
NM_198177chr312965 1701 ----
NM_198178chr312965 1701 ----
NM_198181chr1532730 2683 729 1509 ----
NM_198195chr31634 ------
NM_198204chr1711390 ------
NM_198205chr1711390 ------
NM_198215chr101126 ------
NM_198217chr132788 741 ------
NM_198218chr132788 741 ------
NM_198219chr132788 741 ------
NM_198241chr31384 ------
NM_198242chr31384 ------
NM_198243chr152608 100 1882 ----
NM_198244chr31384 ------
NM_198261chr12--1550 1315 --
NM_198262chr12--1550 1315 --
NM_198264chr11109 ------
NM_198270chrX23097 2849 ------
NM_198376chr171251 ------
NM_198377chr171251 ------
NM_198378chr171251 ------
NM_198379chr171251 ------
NM_198380chr171251 ------
NM_198382chr171251 ------
NM_198383chr171251 ------
NM_198384chr171251 ------
NM_198385chr171251 ------
NM_198386chr171251 ------
NM_198387chr171251 ------
NM_198388chr171251 ------
NM_198391chr201348 11217 ----
NM_198446chr1145 ------
NM_198465chrX1713 ------
NM_198485chr332376 2075 1692 ------
NM_198507chr51139 ------
NM_198513chr822004 1359 ------
NM_198516chr11167 ------
NM_198563chr31122 ------
NM_198570chr71344 1351 ----
NM_198576chr121110 28 ------
NM_198581chr297349 7129 6036 2629 1902 1626 732 299 57 16332 ----
NM_198700chr11164 ------
NM_198794chr1411198 ------
NM_198859chr341921 1493 1051 944 1126 ----
NM_198896chr1121555 535 ------
NM_198902chr15171 ------
NM_198903chr51205 ------
NM_198904chr51205 ------
NM_198935chr2032498 2293 214 1430 ----
NM_198956chr731356 600 530 --1204 --
NM_198968chr1343823 2617 992 399 ------
NM_198989chr131121 ------
NM_198995chr181500 1204 ----
NM_199003chr811154 ------
NM_199076chr102414 102 ------
NM_199141chr191682 ------
NM_199144chr2011338 ------
NM_199169chr2043384 3324 3288 2723 12797 ----
NM_199170chr2043384 3324 3288 2723 12797 ----
NM_199171chr2043384 3324 3288 2723 12797 ----
NM_199185chr52127 74 ------
NM_199188chr1223074 3040 33991 1402 568 ----
NM_199190chr1223074 3040 33991 1402 568 ----
NM_199203chr2011338 ------
NM_199320chr422947 1821 ------
NM_199320chr422947 1821 ------
NM_199327chr4154 1769 ----
NM_199355chr1621182 117 ------
NM_199427chr203518 48 27 ------
NM_199436chr232469 882 441 ------
NM_199454chr164718 4561 3661 3418 1904 1623 12924 ----
NM_199461chr1031015 796 501 --1292 --
NM_199462chr145029 4698 3483 501 ------
NM_199478chrX--1739 ----
NM_201266chr211964 22338 2144 ----
NM_201269chr111148 ------
NM_201279chr211964 22338 2144 ----
NM_201403chr111799 ------
NM_201428chr1111481 ------
NM_201429chr1111481 ------
NM_201430chr1111407 ------
NM_201432chr1776588 4944 4531 1325 1157 1082 248 25703 5065 --11690
NM_201433chr1776588 4944 4531 1325 1157 1082 248 25703 5065 --11690
NM_201521chr61366 ------
NM_201522chr61366 ------
NM_201523chr61366 ------
NM_201559chr633983 3142 1320 ------
NM_201567chr331523 1273 662 ------
NM_201568chr141499 1417 782 246 11603 --1116
NM_201569chr141499 1417 782 246 11603 --1116
NM_201570chr1021656 134 ------
NM_201571chr1021656 134 ------
NM_201572chr1021656 134 ------
NM_201590chr1021656 134 ------
NM_201591chr411317 ------
NM_201592chr411317 ------
NM_201593chr1021656 134 ------
NM_201596chr1021656 134 ------
NM_201597chr1021656 134 ------
NM_201624chr11275 11273 ----
NM_201627chr51402 ------
NM_201628chr143176 2692 1089 645 --12836 --
NM_201999chr41827 2894 33 ----
NM_202002chr122207 32 ------
NM_203283chr41255 --1139 --
NM_203284chr41255 --1139 --
NM_203301chr14194 ------
NM_203304chr19--1616 ----
NM_203305chr93774 549 464 --11932 --
NM_203318chr171465 ------
NM_203327chr2064159 3752 3284 536 509 148 --11728 --
NM_203350chr1--1434 ----
NM_203351chr1742239 1817 747 713 ------
NM_203354chr14--167 ----
NM_203355chr14--167 ----
NM_203356chr14--167 ----
NM_203364chr1111206 148 ----
NM_203372chr221716 507 ------
NM_203394chr122913 687 12354 1322 --
NM_203399chr11895 1665 ----
NM_203401chr11895 1665 ----
NM_203403chr921108 145 ------
NM_203404chr12835 73 ------
NM_203406chr512357 32696 1140 224 ----
NM_203417chr2121092 568 --11495 --
NM_203418chr2121092 568 --11495 --
NM_203434chr9--1435 ----
NM_203446chr2132891 1841 92 23016 2414 ----
NM_203458chr123659 3641 ------
NM_203459chr132563 2438 753 1129 ----
NM_203463chr254260 3954 1225 373 201 13987 ----
NM_203464chr13381 313 68 ------
NM_203467chr14--154 ----
NM_203487chr1311265 1482 ----
NM_203504chr432520 961 600 ------
NM_203505chr432520 961 600 ------
NM_203506chr1731987 487 425 ------
NM_205768chr132031 1550 443 ------
NM_205842chr21681 ------
NM_205846chr52411 330 ------
NM_205860chr111230 ------
NM_205861chr141774 1658 1629 1341 ------
NM_206594chr112252 ------
NM_206595chr112252 ------
NM_206839chr151244 ------
NM_206852chr142154 143 ------
NM_206853chr623841 3532 1688 ----
NM_206854chr655102 4793 660 276 155 21949 36 ----
NM_206855chr676067 5758 4176 1625 1241 1120 656 11001 ----
NM_206857chr142154 143 ------
NM_206860chr10162 ------
NM_206861chr10162 ------
NM_206862chr10162 ------
NM_206866chr2122113 884 12638 ----
NM_206907chr513157 --12340 --
NM_206909chr842513 2455 1628 1068 27536 6111 ----
NM_206943chr2--1266 ----
NM_207009chr101345 1212 ----
NM_207012chr1013460 1712 ----
NM_207042chr11593 ------
NM_207045chr11593 ------
NM_207046chr11593 ------
NM_207171chr111975 ------
NM_207292chr333364 3028 803 ------
NM_207293chr333364 3028 803 ------
NM_207294chr333364 3028 803 ------
NM_207295chr333364 3028 803 ------
NM_207296chr333364 3028 803 ------
NM_207297chr333389 3053 828 ------
NM_207299chr92285 25 ------
NM_207303chr1042902 1363 469 62 14168 ----
NM_207306chr143926 3209 260 146 ------
NM_207311chr1211185 ------
NM_207317chr51292 ------
NM_207343chr111334 ------
NM_207372chr1022397 2236 ------
NM_207406chr464964 4276 2349 2256 1958 435 25264 2230 ----
NM_207422chrX2422 278 ------
NM_207517chr1521237 28 31906 640 547 ----
NM_207518chr1921374 1151 11145 ----
NM_207520chr21118 ------
NM_207521chr21118 ------
NM_207577chr1132817 1155 751 1721 12598 --
NM_207645chr1141309 1252 944 868 1447 ----
NM_212460chr731937 1770 1374 1776 ----
NM_212471chr1721970 412 1229 ----
NM_212472chr1721970 412 1229 ----
NM_212539chr31401 ------
NM_213589chr234413 714 318 ------
NM_213609chr32946 882 ------
NM_213662chr1722472 2364 ------