TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-2277-5p
miRNA Sequence: AGCGCGGGCUGAGCGCUGCCAGUC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000032chrX----136 --
NM_000037chr832241 1614 330 ------
NM_000068chr19151 --1600 --
NM_000088chr1711233 ------
NM_000092chr223034 1230 11571 ----
NM_000118chr93673 356 136 --1251 --
NM_000168chr713241 ------
NM_000278chr1042011 1898 1792 272 --11806 --
NM_000332chr624492 350 ------
NM_000337chr521995 253 ------
NM_000367chr612095 ------
NM_000398chr22----1118 137
NM_000430chr1722838 2796 ------
NM_000439chr5153 ------
NM_000474chr71216 ------
NM_000555chrX1301 ------
NM_000836chr191380 --3316 140 82 --
NM_000841chr62235 102 ------
NM_000842chr112615 51 --129 --
NM_000864chr1----1974 --
NM_000875chr1521573 137 ------
NM_000883chr7----1260 --
NM_000883chr7----1260 --
NM_000964chr1711348 --11220 --
NM_001001132chr2121437 1282 ------
NM_001001342chr1011473 ------
NM_001001395chr12--12705 ----
NM_001001502chr5----1179 --
NM_001001549chr712611 --12232 --
NM_001001550chr712611 --12232 --
NM_001001555chr712611 --12232 --
NM_001001795chr81745 --4242 115 90 81 1209
NM_001001890chr212227 31 --1181 1170
NM_001002031chr12150 --135 --
NM_001002762chr1042329 1918 723 404 ------
NM_001002860chr1413121 ------
NM_001003694chr31507 ------
NM_001003800chr921392 314 --11319 1308
NM_001004303chr1165 ------
NM_001004303chr1165 ------
NM_001004354chr93255 183 111 1347 4774 745 39 33 --
NM_001004419chr12----1510 --
NM_001005209chr21261 ------
NM_001005291chr172128 68 ----154
NM_001005505chr31147 ------
NM_001006115chr312607 --12675 --
NM_001006617chr931099 985 320 ------
NM_001006619chr931099 985 320 ------
NM_001006620chr931099 985 320 ------
NM_001006621chr931099 985 320 ------
NM_001006624chr131955 1753 98 ------
NM_001006944chr112457 79 ------
NM_001007098chr1198 ------
NM_001007279chr223357 220 114 --1266 --
NM_001007466chr6--148 13187 --
NM_001007533chr17289 56 --127 --
NM_001007559chr1811907 ------
NM_001008392chr321005 105 ------
NM_001008408chr765101 4579 3916 1512 995 117 ------
NM_001008701chr1922101 995 --1510 --
NM_001009566chr121404 189 --1274 --
NM_001010917chr1062075 447 440 344 69 59 ------
NM_001011537chr31348 12254 ----
NM_001011666chr724612 1678 ------
NM_001012329chr112055 ------
NM_001012644chr202106 60 --1131 --
NM_001013661chr1125 ------
NM_001013690chr12156 ----11783
NM_001014797chr1017583 ------
NM_001014809chr42803 675 ------
NM_001017440chr737215 3230 55 141 ----
NM_001017963chr141875 ------
NM_001018050chr2232512 2166 35 ------
NM_001018052chr2232512 2166 35 ------
NM_001018108chr1532037 657 70 ------
NM_001023567chr1512014 --1352 --
NM_001024226chr12152 126 ------
NM_001024227chr12152 126 ------
NM_001024228chr12152 126 ------
NM_001024401chr1631977 1913 425 --11995 --
NM_001024809chr1711348 --11220 --
NM_001024845chr11662 --140 --
NM_001025107chr11289 --12319 --
NM_001025107chr11289 --12319 --
NM_001025242chrX41295 908 279 119 ------
NM_001025243chrX41295 908 279 119 ------
NM_001025366chr6--1174 ----
NM_001025366chr6--1174 ----
NM_001025367chr6--1174 ----
NM_001025367chr6--1174 ----
NM_001025368chr6--1174 ----
NM_001025368chr6--1174 ----
NM_001025369chr6--1190 ----
NM_001025369chr6--1190 ----
NM_001025370chr6--1174 ----
NM_001025370chr6--1174 ----
NM_001025579chr173770 264 46 --1177 --
NM_001025596chr111416 ------
NM_001025780chr911197 1194 ----
NM_001029882chr11503 ------
NM_001029882chr11503 ------
NM_001029998chr411399 ------
NM_001030001chr14141 ------
NM_001030007chr1613645 ------
NM_001030055chr141591 ------
NM_001031680chr1----1101 --
NM_001031685chr11241 ------
NM_001031695chr221304 11444 ----
NM_001031801chr22188 ------
NM_001032280chr6----148 --
NM_001032296chr1332608 1081 895 ------
NM_001033026chr193246 180 60 --1454 --
NM_001033057chr3--1604 ----
NM_001033117chr321573 200 ------
NM_001033551chr1743745 1332 1191 52 ------
NM_001033756chr6--1108 ----
NM_001033756chr6--1108 ----
NM_001034852chr1421409 100 1747 ----
NM_001035521chr21187 ------
NM_001037132chr71342 ------
NM_001037133chr71342 ------
NM_001037331chr182268 254 ------
NM_001037967chrX----136 --
NM_001037969chrX----136 --
NM_001038493chr22353 321 --147 --
NM_001039350chr721440 1302 --11088 --
NM_001039457chr1125 1214 ----
NM_001039538chr211036 ------
NM_001039547chr337611 6249 971 ------
NM_001040142chr2149 ------
NM_001040143chr2149 ------
NM_001040151chr1124395 1287 ------
NM_001040424chr2153008 2795 2675 2595 884 12605 ----
NM_001040446chr511684 ------
NM_001040661chr73926 254 92 ------
NM_001042388chr181115 ------
NM_001042425chr6----148 --
NM_001042603chr1233521 3463 3405 ------
NM_001042632chr202224 137 ------
NM_001042633chr202224 137 ------
NM_001042681chr112021 ------
NM_001042682chr112021 ------
NM_001042682chr112021 ------
NM_001042692chr22562 77 ------
NM_001043318chr1463447 2902 1037 580 427 34 --1238 1231
NM_001065chr12139 --1162 --
NM_001068chr3--1240 ----
NM_001080418chr12207 35 --2222 96 --
NM_001092chr1722234 251 ------
NM_001094chr171195 --1568 --
NM_001111chr11289 --12319 --
NM_001116chr1672858 2808 2781 733 651 632 626 12410 --12243
NM_001117chr1812267 ------
NM_001122631chr111558 ------
NM_001127chr22----1204 --
NM_001128chr1613645 ------
NM_001135chr15--2807 788 ----
NM_001144chr16----133 --
NM_001163chr92957 364 --1100 --
NM_001173chr141591 ------
NM_001174chrX5935 786 564 555 531 ------
NM_001189chr4----136 --
NM_001194chr194465 433 240 171 2662 543 1202 --
NM_001199chr82259 169 --1191 --
NM_001290chr4138 ------
NM_001300chr101185 ------
NM_001313chr42803 675 ------
NM_001346chr32632 373 ------
NM_001391chr18129 ------
NM_001397chr122310 882 ------
NM_001400chr111070 ------
NM_001420chr1922617 139 ------
NM_001426chr2122 --128 --
NM_001498chr6170 ------
NM_001500chr62128 109 ------
NM_001518chr71920 ------
NM_001521chr21187 ------
NM_001552chr171108 ------
NM_001569chrX41295 908 279 119 ------
NM_001619chr113967 948 110 ------
NM_001655chr111135 ------
NM_001658chr12152 126 ------
NM_001668chr11742 ------
NM_001679chr31323 ------
NM_001693chr8124 --11039 11150
NM_001694chr162432 318 --2441 178 --
NM_001704chr61221 ------
NM_001706chr311028 ------
NM_001707chr7164 ------
NM_001711chrX--11096 --1931
NM_001754chr212227 31 --1181 1170
NM_001800chr19135 ------
NM_001810chr201292 ------
NM_001896chr161321 ------
NM_001936chr721440 1302 --11088 --
NM_001945chr51994 ------
NM_001949chr61421 ------
NM_001956chr12603 38 ------
NM_001958chr202231 43 --187 --
NM_001962chr5--1478 ----
NM_001981chr111961 ------
NM_002010chr13----1467 --
NM_002023chr1139 ------
NM_002048chr9----370 53 40 --
NM_002103chr193450 359 197 ------
NM_002111chr452474 2418 617 462 61 ------
NM_002145chr17----136 --
NM_002147chr17----138 --
NM_002199chr41285 ------
NM_002226chr141239 1753 1647 --
NM_002264chr314396 ------
NM_002268chr311206 ------
NM_002319chr73926 275 79 ------
NM_002359chr1772804 1256 1168 676 664 411 351 --23919 1649 14196
NM_002360chr7132611 2586 2554 2361 1787 1760 620 589 567 560 322 279 181 ------
NM_002373chr15----11291 --
NM_002374chr211036 ------
NM_002442chr121315 ------
NM_002480chr1211188 ------
NM_002501chr1984088 3741 3545 3484 2602 1553 1094 206 --53464 3426 3336 2524 1111 --
NM_002509chr202167 23 ------
NM_002522chr1732403 1343 676 ------
NM_002537chr151261 ------
NM_002553chr7----1347 --
NM_002634chr17126 ------
NM_002653chr52340 107 1862 4939 908 673 410 1128
NM_002657chr202806 203 ------
NM_002699chr13957 611 450 --2433 60 --
NM_002716chr1111319 ------
NM_002731chr11146 ------
NM_002753chr41148 ------
NM_002824chr122498 171 ------
NM_002885chr11120 ------
NM_002886chr32141 25 133 ----
NM_002903chr17152 ------
NM_002911chr1961511 1500 1181 492 228 187 11473 ----
NM_002918chr1941003 788 249 233 --31042 709 359 --
NM_002926chr421155 731 ------
NM_002996chr161460 ------
NM_002998chr812128 ------
NM_003012chr8197 ------
NM_003021chr192405 27 ------
NM_003028chr923542 2866 ------
NM_003030chr3361 36 26 ------
NM_003034chr1226012 5365 17528 ----
NM_003036chr14771 468 206 118 ------
NM_003074chr3----1132 --
NM_003085chr5----1179 --
NM_003110chr171246 ------
NM_003131chr61319 ------
NM_003150chr1722230 381 ------
NM_003161chr171240 ------
NM_003200chr192749 659 --11834 --
NM_003202chr5186 ------
NM_003214chr62271 175 ------
NM_003215chr411089 ------
NM_003220chr6----148 --
NM_003223chr161828 ------
NM_003253chr2121516 99 ------
NM_003255chr1712203 12617 ----
NM_003270chrX21121 199 ------
NM_003300chr14----183 --
NM_003317chr142587 121 ------
NM_003345chr161488 ------
NM_003347chr2211623 ----147
NM_003376chr6--1174 ----
NM_003376chr6--1174 ----
NM_003378chr7140 --127 --
NM_003379chr61217 ------
NM_003404chr2011931 ------
NM_003412chr321919 83 ------
NM_003413chrX1424 ------
NM_003418chr31245 ------
NM_003442chr111338 ------
NM_003458chr31731 --1411 --
NM_003468chr223176 114 ------
NM_003470chr1621708 1677 ----1368
NM_003482chr1232551 2421 2174 ------
NM_003489chr211906 ------
NM_003502chr162548 138 ------
NM_003507chr21467 ------
NM_003508chr7----1333 --
NM_003547chr6169 ------
NM_003575chr72618 444 11484 11125 --
NM_003576chr1332608 1081 895 ------
NM_003586chr16------1600
NM_003590chr2------13833
NM_003629chr112811 ------
NM_003644chr1712272 15994 ----
NM_003655chr174317 280 167 36 ------
NM_003660chr194598 547 491 319 --2581 113 --
NM_003685chr192958 129 ------
NM_003714chr522199 424 --1243 --
NM_003749chr1321605 609 --1525 --
NM_003750chr10--1632 ----
NM_003779chr11117 ------
NM_003796chr191143 ------
NM_003873chr10----1484 --
NM_003924chr41142 11214 ----
NM_003927chr1811038 ------
NM_003938chr19131 --1282 --
NM_003942chr112457 79 ------
NM_003987chr1042011 1898 1792 272 --11806 --
NM_003988chr1042088 1975 1869 349 --11883 --
NM_003989chr1041947 1834 1728 208 --11742 --
NM_003990chr1041947 1834 1728 208 --11742 --
NM_004004chr13----161 --
NM_004047chr1125 1214 ----
NM_004050chr1412542 ------
NM_004078chr1----138 --
NM_004093chr132255 149 --181 --
NM_004104chr173595 296 286 --1252 --
NM_004161chr21282 ------
NM_004176chr172128 68 ----154
NM_004200chr1122697 2123 ------
NM_004205chr11134 --1406 --
NM_004227chr752622 2494 306 102 71 22420 281 ----
NM_004240chr19193 ------
NM_004302chr124707 470 283 58 ------
NM_004309chr173919 362 110 ------
NM_004311chr1022828 2501 ----12367
NM_004320chr162283 31 ------
NM_004321chr253414 3345 3309 2400 675 ------
NM_004342chr71338 ------
NM_004350chr1----1101 --
NM_004370chr611378 ------
NM_004383chr154518 499 421 127 ------
NM_004395chr5176 ------
NM_004409chr193745 182 73 --1537 --
NM_004419chr1011028 ------
NM_004421chr12711 68 ------
NM_004430chr85517 483 309 213 99 ------
NM_004437chr133634 2764 428 ------
NM_004438chr222596 876 ------
NM_004454chr321511 900 ----12246
NM_004472chr5----1114 --
NM_004474chr12298 61 ------
NM_004481chr122036 92 ------
NM_004496chr141243 ------
NM_004500chr1411766 --1164 --
NM_004516chr19177 ------
NM_004529chr92543 480 ------
NM_004575chr41377 ------
NM_004577chr71508 ------
NM_004588chr11295 28 ------
NM_004609chr201365 ------
NM_004622chr21107 ------
NM_004630chr1141164 1096 353 313 ------
NM_004634chr31507 ------
NM_004643chr14--1269 ----
NM_004664chr12158 ------
NM_004726chrX--11605 ----
NM_004734chr1312353 ------
NM_004740chr17185 ------
NM_004745chr831603 282 178 --2127 118 --
NM_004762chr1761467 790 763 571 505 342 ------
NM_004772chr51302 ------
NM_004776chr2012832 1924 ----
NM_004831chr192233 162 --197 --
NM_004839chr15129 ------
NM_004860chr17----181 --
NM_004904chr724612 1678 ------
NM_004926chr141433 ------
NM_004991chr3147 ------
NM_004992chrX57706 6935 6435 5928 556 --37492 5780 1119 --
NM_004992chrX57706 6935 6435 5928 556 --37492 5780 1119 --
NM_005010chr71342 ------
NM_005022chr171183 ------
NM_005028chr1021725 1537 ------
NM_005029chr10157 ------
NM_005038chr41484 ------
NM_005056chr1233765 3707 3649 ------
NM_005067chr31116 ------
NM_005099chr121061 252 ------
NM_005116chr2043800 876 433 109 13709 ----
NM_005134chr181115 ------
NM_005137chr221133 ------
NM_005176chr12150 --135 --
NM_005184chr1931209 1138 83 --154 --
NM_005187chr1691906 1874 1842 1810 1778 1327 232 110 38 ------
NM_005229chrX11015 ------
NM_005232chr7----179 --
NM_005245chr42122 62 --1134 --
NM_005249chr141856 ------
NM_005255chr42362 84 124 ----
NM_005281chr12900 758 ------
NM_005302chr7152 ------
NM_005311chr712611 --12232 --
NM_005348chr141875 ------
NM_005354chr192271 52 --2259 241 --
NM_005357chr19123 ------
NM_005369chrX--173 ----
NM_005386chr201909 181 ----
NM_005425chr16130 ------
NM_005426chr11241 ------
NM_005440chr1713274 --165 --
NM_005458chr9134 ------
NM_005461chr201410 --11288 --
NM_005465chr121760 514 ------
NM_005503chr15--11150 ----
NM_005520chr5--150 ----
NM_005539chr1041367 1343 518 503 ------
NM_005596chr915095 ------
NM_005599chr1142 ------
NM_005618chr61195 ------
NM_005634chrX1628 ------
NM_005637chr1811907 ------
NM_005650chr221958 1109 1147 --
NM_005656chr21------169
NM_005668chr51945 ------
NM_005704chr111018 ------
NM_005724chr151168 ------
NM_005808chr321005 105 ------
NM_005819chr1----1395 --
NM_005860chr1921434 209 ------
NM_005866chr9127 ------
NM_005895chr1263684 3674 2645 1291 369 23 --1837 --
NM_005920chr1----1623 --
NM_005941chr811006 ------
NM_005969chr112951 159 ------
NM_006007chr933934 3049 523 ------
NM_006015chr1128 ------
NM_006030chr31147 ------
NM_006037chr254635 3253 3239 83 72 14652 ----
NM_006160chr1721242 537 ------
NM_006166chr1212268 ------
NM_006178chr171222 ------
NM_006237chr131858 ------
NM_006251chr51725 ------
NM_006277chr2166 ------
NM_006317chr51305 ------
NM_006351chr192341 69 ------
NM_006362chr111105 ------
NM_006387chr192170 22 ------
NM_006454chr423066 2967 --32848 2817 2384 --
NM_006459chr101123 ------
NM_006474chr131955 1753 98 ------
NM_006517chrX------1105
NM_006549chr12263 36 ------
NM_006557chr911097 ------
NM_006560chr111416 ------
NM_006562chr10--1241 ----
NM_006599chr1611377 --15735 --
NM_006614chr313161 ------
NM_006618chr111090 ------
NM_006651chr4101496 1248 1229 1219 932 547 310 211 59 25 --51469 1463 522 198 135 11386
NM_006698chr2021220 98 ----11152
NM_006717chr923140 106 ------
NM_006749chr8--199 ----
NM_006761chr171289 ------
NM_006788chr181397 ----149
NM_006795chr1121387 1027 --3571 545 490 --
NM_006854chr711928 ------
NM_006884chr3361 36 26 ------
NM_006927chr165589 572 556 167 80 ------
NM_006950chrX1785 ------
NM_006990chr122302 862 ----1455
NM_007042chr31242 ------
NM_007051chr1151 ------
NM_007054chr51791 ------
NM_007084chr13190 --179 --
NM_007146chr1712760 ------
NM_007185chr1----1708 1368
NM_007192chr1411049 ------
NM_007249chr131257 ------
NM_007326chr22----1118 137
NM_007349chr7275 35 ------
NM_007358chr111776 ------
NM_007375chr11667 ------
NM_009588chr6--1201 ----
NM_012102chr112021 ------
NM_012154chr82633 264 ------
NM_012156chr2023389 2734 ------
NM_012164chr915229 22245 1280 ----
NM_012193chr1114875 ------
NM_012214chr211125 --12439 --
NM_012282chrX129 --1211 --
NM_012288chr621951 690 1801 ----
NM_012300chr511663 ------
NM_012307chr181843 ------
NM_012308chr11--12228 1518 --
NM_012321chr19126 1478 ----
NM_012333chr111690 ------
NM_012334chr513973 ------
NM_012384chr2022239 1703 ------
NM_012414chr11563 ------
NM_012458chr191354 ------
NM_012473chr22----135 --
NM_013227chr15--2807 788 ----
NM_013269chr12----1437 --
NM_013335chr21182 ------
NM_013433chr1911952 ------
NM_013437chr81467 ------
NM_013449chr1221930 485 ------
NM_014023chr103884 474 367 ------
NM_014079chr31270 --1195 --
NM_014141chr724121 326 ------
NM_014154chr31140 ------
NM_014233chr171369 ------
NM_014263chr1011338 ------
NM_014268chr181150 ------
NM_014272chr15----177 --
NM_014275chr51769 ------
NM_014278chr4--137 ----
NM_014282chr92289 112 ------
NM_014292chr2211207 --11259 --
NM_014309chr221294 11434 ----
NM_014351chr2221148 1015 ------
NM_014368chr9129 ------
NM_014417chr191647 ------
NM_014454chr6--1843 ----
NM_014507chr22----11221 --
NM_014577chr221237 ------
NM_014613chr523011 2401 ------
NM_014620chr121790 ------
NM_014646chr1832948 2555 1029 --12392 --
NM_014661chr1093780 3262 3061 3017 2953 2813 697 496 179 13457 ----
NM_014665chr8103630 3531 3342 3115 2998 1251 1144 993 985 914 23072 3063 21236 886 --
NM_014667chr312324 ------
NM_014686chr1922398 2007 ------
NM_014705chr7122 ------
NM_014712chr161453 ------
NM_014718chr121718 ------
NM_014729chr81274 ------
NM_014742chr20155 ----11293
NM_014743chr412308 ------
NM_014747chr121416 827 ------
NM_014828chr14--11695 ----
NM_014849chr12167 114 ------
NM_014850chr321573 200 ------
NM_014869chr331162 953 100 ------
NM_014921chr1922101 995 --1510 --
NM_014931chr192528 44 ------
NM_014944chr121404 189 --1274 --
NM_014947chr111201 ------
NM_014975chr19175 --124 --
NM_015025chr212205 ------
NM_015033chr972929 2729 2679 2455 352 156 120 --11285 1265
NM_015042chr151800 ------
NM_015074chr124753 1307 ------
NM_015079chr1532465 297 34 --1846 --
NM_015080chr112235 191 --1161 --
NM_015094chr2244271 3764 3162 248 --23034 734 --
NM_015103chr3----179 1334
NM_015113chr1722116 2041 --1164 --
NM_015149chr121945 780 ------
NM_015155chr1033146 3016 493 ------
NM_015167chr17140 ------
NM_015171chr16----147 --
NM_015172chr111139 ------
NM_015184chr31169 ------
NM_015215chr11757 ------
NM_015229chr1741206 733 135 78 --1952 --
NM_015250chr91389 ------
NM_015267chr1222075 715 ------
NM_015296chr131141 ------
NM_015328chr722595 114 ------
NM_015396chr3124 ------
NM_015444chr32167 38 ------
NM_015457chr11135 ----195
NM_015483chr7----1390 --
NM_015488chr211745 ------
NM_015497chr151870 ------
NM_015503chr162187 169 ------
NM_015542chr101235 ------
NM_015557chr143355 2688 2663 933 ------
NM_015589chr14125 ------
NM_015694chr7145 ------
NM_015831chr72922 154 ------
NM_015840chr11289 --12319 --
NM_015841chr11289 --12319 --
NM_015905chr71441 ------
NM_015910chr22562 77 ------
NM_016037chr121072 933 ------
NM_016075chr1322749 1153 13027 ----
NM_016147chr111274 ------
NM_016176chr12228 53 --121 --
NM_016221chr5152 ------
NM_016231chr171471 ------
NM_016272chr2222093 464 ------
NM_016281chr121193 ------
NM_016358chr5----136 --
NM_016463chr5--134 ----
NM_016507chr1712994 ------
NM_016577chr324350 1209 ------
NM_016588chr6----124 --
NM_016603chr521547 800 ------
NM_016621chr1153988 3288 1633 1554 1164 1740 1677 --
NM_016628chr101573 ------
NM_016823chr171427 ------
NM_016848chr9--130 ----
NM_016932chr22817 86 ------
NM_017456chr1761467 790 763 571 505 342 ------
NM_017553chr15------185
NM_017575chr17129 ------
NM_017590chr2211849 ------
NM_017602chrX----1896 --
NM_017607chr19167 ------
NM_017610chr15------188
NM_017617chr961443 1395 1042 1032 1015 450 ------
NM_017737chr11433 --1422 --
NM_017739chr1121 ------
NM_017742chr1811779 ------
NM_017766chr1138 --2204 28 --
NM_017778chr811016 ------
NM_017789chr2------1827
NM_017793chr151234 ------
NM_017845chr41654 ------
NM_018027chr101428 ------
NM_018028chr19176 ------
NM_018077chr7177 ------
NM_018086chr211197 ------
NM_018126chr41199 ------
NM_018198chr111180 --11407 --
NM_018400chr1124395 1287 ------
NM_018419chr20267 51 ------
NM_018571chr21643 ------
NM_018640chr12--12705 ----
NM_018645chr2123 ------
NM_018652chr15131 ------
NM_018667chr1641039 286 160 150 ------
NM_018715chr132142 489 37 ------
NM_018834chr51729 ------
NM_018947chr715038 ------
NM_018952chr17----1219 --
NM_018979chr121642 ------
NM_019009chr1151873 756 119 104 90 ------
NM_019102chr7------147
NM_019102chr7------147
NM_019593chr2012102 ------
NM_019595chr2166 ------
NM_019606chr7------1186
NM_019885chr242372 741 390 275 --1429 --
NM_020064chr93544 220 32 ------
NM_020148chr1833012 438 47 ------
NM_020151chr211492 ------
NM_020155chr111123 ------
NM_020180chr1841369 1248 1191 885 ------
NM_020182chr2041433 1037 739 56 --12298 --
NM_020184chr2133 --1592 --
NM_020248chr112055 ------
NM_020382chr12------1281
NM_020431chr1422742 1042 ------
NM_020456chr1321789 856 ------
NM_020475chr832178 1551 267 ------
NM_020476chr832178 1551 267 ------
NM_020477chr832178 1551 267 ------
NM_020478chr832241 1614 330 ------
NM_020480chr832178 1551 267 ------
NM_020525chr121146 ------
NM_020647chr821842 692 ------
NM_020659chr191542 ------
NM_020689chr20----11448 --
NM_020693chr11135 ------
NM_020706chr21----1105 --
NM_020708chr207761 455 438 393 107 64 43 1187 1971 11598
NM_020747chr51746 ------
NM_020764chr1621242 1232 --3262 202 27 1236
NM_020765chr1189 ------
NM_020772chr1725233 528 ------
NM_020796chr52176 110 ------
NM_020801chr51534 ------
NM_020807chr16------166
NM_020856chr1911368 ------
NM_020962chr151890 1901 1874 --
NM_020967chr20195 ------
NM_021007chr2149 ------
NM_021012chr1753094 2336 587 296 53 ------
NM_021019chr12175 ------
NM_021020chr833338 2677 2285 ----161
NM_021025chr53456 387 182 ------
NM_021033chr1311017 ------
NM_021064chr61504 --1448 --
NM_021090chr222706 538 ----185
NM_021120chrX33052 1978 906 ------
NM_021155chr1921843 860 ------
NM_021192chr21170 ------
NM_021267chr19131431 1311 1232 1185 1131 1101 1075 1043 539 505 407 297 22 1903 51290 998 952 363 355 1243
NM_021570chr9286 70 --136 --
NM_021625chr12----1391 --
NM_021643chr2------11609
NM_021814chr6----1219 --
NM_021926chr111158 ------
NM_021945chr623339 431 ------
NM_021962chr1722234 251 ------
NM_021973chr42262 89 ------
NM_021991chr17--147 1118 --
NM_022003chr1151235 1216 392 230 211 11128 ----
NM_022048chr1511603 ------
NM_022085chr62623 47 ------
NM_022137chr1421409 100 1747 ----
NM_022469chr1----2404 31 --
NM_022470chr311237 ------
NM_022552chr211078 1920 ----
NM_022572chr211745 ------
NM_022574chr72747 456 ------
NM_022648chr223855 3200 --13042 --
NM_022737chr19151 ------
NM_022758chr612637 ------
NM_022822chr112793 617 --2605 569 166
NM_022898chr1424416 3534 --1104 --
NM_023035chr19--171 ----
NM_023067chr34523 481 414 266 1436 ----
NM_023076chr1632789 2600 1187 --2811 160 --
NM_023929chr811044 ------
NM_024016chr176808 324 147 70 59 45 ------
NM_024107chr17----1193 --
NM_024117chr931099 985 320 ------
NM_024293chr2----1273 --
NM_024294chr612637 ------
NM_024507chr161114 --126 --
NM_024522chr1----2128 98 --
NM_024545chr21122 ------
NM_024567chr81532 ------
NM_024599chr172162 53 ------
NM_024630chr61787 ------
NM_024674chr1--1836 ----
NM_024676chr12200 183 ------
NM_024704chr20--1275 ----
NM_024721chr8----122 --
NM_024742chr1611258 --21341 757 --
NM_024770chr234593 1711 887 ------
NM_024798chr1532319 813 748 12748 ----
NM_024811chr1121348 661 ------
NM_024830chr542128 2099 291 246 1370 137 --
NM_024835chr17152 ------
NM_024859chrX1813 --1190 --
NM_024933chr21603 1467 ----
NM_024979chr1351540 1485 449 284 123 --21275 27 --
NM_025140chr121518 --124 --
NM_025164chr1122046 1903 ------
NM_025191chr11291 ------
NM_025195chr811644 ------
NM_025224chr204499 155 103 48 --1936 --
NM_025237chr17174 --152 --
NM_025251chr82489 237 1817 1353 --
NM_025257chr61342 ------
NM_025263chr62614 145 ------
NM_030629chr1611628 ------
NM_030640chr121730 ------
NM_030651chr6130 ------
NM_030661chr721246 1110 11348 ----
NM_030665chr173998 984 286 ----178
NM_030808chr172684 178 --191 --
NM_030810chr62623 47 ------
NM_031309chr831444 423 354 11459 ----
NM_031314chr1411766 --1164 --
NM_031417chr19147 ------
NM_031439chr8----134 --
NM_031445chr232733 2498 34 ------
NM_031459chr111396 ----11455
NM_031468chr737215 3230 55 141 ----
NM_031478chr162635 44 ------
NM_031492chr11168 ------
NM_031845chr211036 ------
NM_031847chr211036 ------
NM_031890chr221789 ------
NM_032017chr131714 1617 851 --11851 --
NM_032028chr52533 165 ------
NM_032109chr54333 261 214 180 --2467 339 --
NM_032153chr331077 716 589 140 163 187
NM_032193chr1111381 ------
NM_032242chr33829 618 609 1209 12838 --
NM_032246chr15131 ------
NM_032281chr1922617 139 ------
NM_032283chr11134 ------
NM_032288chr31348 12254 ----
NM_032294chr1711392 --147 --
NM_032298chr191439 ------
NM_032375chr192179 30 ------
NM_032430chr193439 154 50 ------
NM_032552chr921783 140 --11690 --
NM_032711chr1772804 1256 1168 676 664 411 351 --23919 1649 14196
NM_032772chr10----197 --
NM_032812chr101264 ------
NM_032875chr171319 ------
NM_032927chr41117 ------
NM_032978chr18129 ------
NM_032979chr18129 ------
NM_032981chr18129 ------
NM_032999chr71920 ------
NM_033000chr71920 ------
NM_033001chr71920 ------
NM_033023chr72940 331 ------
NM_033081chr201435 ------
NM_033129chr2021565 256 --4340 303 64 22 --
NM_033132chr13194 ------
NM_033138chr71338 ------
NM_033139chr71338 ------
NM_033140chr71338 ------
NM_033157chr71338 ------
NM_033161chr9137 ------
NM_033224chr725310 249 ------
NM_033225chr81280 ------
NM_033259chr36791 617 290 224 129 107 ------
NM_033266chr16134 ------
NM_033387chr932008 793 620 --12371 --
NM_033420chr191782 --2990 911 --
NM_033455chr112305 69 ------
NM_033644chr511663 ------
NM_033645chr511663 ------
NM_052864chr41484 ------
NM_052876chr192362 102 --1503 --
NM_052905chr221580 586 ------
NM_052910chr132566 416 --1100 --
NM_053023chr111444 ------
NM_053043chr765101 4579 3916 1512 995 117 ------
NM_054013chr51769 ------
NM_054027chr522245 355 ------
NM_057175chr412136 ------
NM_058167chr131011 446 358 144 2894 885 1858
NM_058175chr212549 46 ------
NM_058243chr192879 663 ------
NM_079421chr19135 ------
NM_080599chr101235 ------
NM_080600chr191198 ------
NM_080611chr202106 60 --1131 --
NM_080645chr611378 ------
NM_080664chr142584 496 ------
NM_080881chr5176 ------
NM_100264chr101573 ------
NM_100486chr101573 ------
NM_130386chr181262 ------
NM_130797chr721440 1302 --11088 --
NM_130830chr333115 1168 98 11323 1325 --
NM_133177chr111018 ------
NM_133178chr111018 ------
NM_133263chr51120 ------
NM_133452chr191372 1847 ----
NM_133499chrX1855 ------
NM_134447chr191143 ------
NM_138338chr2232512 2166 35 ------
NM_138357chr1011229 ------
NM_138559chr21243 ------
NM_138576chr1424416 3534 --1104 --
NM_138689chr11188 ------
NM_138713chr1611377 --15735 --
NM_138714chr1611377 --15735 --
NM_138732chr112235 191 --1161 --
NM_138734chr112235 191 --1161 --
NM_138795chr12573 529 ------
NM_138931chr311028 ------
NM_138981chr41148 ------
NM_139015chr1221483 200 ------
NM_139135chr1128 ------
NM_139136chr121177 ------
NM_139159chr193941 86 53 ------
NM_139276chr1722230 381 ------
NM_139278chr831043 238 154 ------
NM_139279chr221063 44 ------
NM_139280chr1731394 977 935 ------
NM_139312chr1011338 ------
NM_139323chr2011931 ------
NM_144586chr21494 ------
NM_144667chr1221025 283 ------
NM_144976chr19----1442 --
NM_144992chr22110 89 ------
NM_144994chr23446 216 24 --167 --
NM_145008chr112812 677 ------
NM_145113chr1411217 192 ----
NM_145117chr1142241 608 484 183 ------
NM_145159chr141239 1753 1647 --
NM_145260chr21286 ------
NM_145725chr14----183 --
NM_145726chr14----183 --
NM_145730chr22----1204 --
NM_147156chr101176 ------
NM_147157chr9127 ------
NM_147189chr8----1323 --
NM_147193chr1--180 ----
NM_147202chr912635 --1104 --
NM_147204chr12----1391 --
NM_147223chr21598 ------
NM_152219chr172526 143 ------
NM_152240chr311237 ------
NM_152253chr2223524 3360 14043 13174 --
NM_152344chr17----11303 --
NM_152345chr171119 --2458 77 --
NM_152420chr91667 ------
NM_152470chr1823639 1324 13501 13689 --
NM_152520chr21250 ------
NM_152557chr721241 51 ------
NM_152588chr1211842 ------
NM_152589chr12--1251 ----
NM_152722chr112344 32 ------
NM_152758chr8--12696 ----
NM_152787chrX1856 --1446 --
NM_153050chr222706 538 ----185
NM_153051chr222706 538 ----185
NM_153247chr73926 254 92 ------
NM_153270chrX145 ------
NM_153273chr312607 --12675 --
NM_153334chr222111 21 ------
NM_153350chr1621271 1155 --1107 --
NM_153367chr1023858 118 ------
NM_153499chr122161 134 ------
NM_153500chr122161 134 ------
NM_153619chr15----1354 --
NM_153620chr71341 ------
NM_153631chr721246 1110 11348 ----
NM_153632chr721246 1110 11348 ----
NM_153633chr121790 ------
NM_153746chr61787 ------
NM_153748chr121177 ------
NM_153759chr211078 1920 ----
NM_153819chr111214 ------
NM_172070chr2--1831 ----
NM_172071chr11861 ------
NM_172206chr1711392 --147 --
NM_172216chr12263 36 ------
NM_172226chr122161 134 ------
NM_172375chr14173 ------
NM_173201chr162220 92 ------
NM_173214chr1611377 --15735 --
NM_173491chr511430 ------
NM_173492chr9----187 --
NM_173595chr1214639 ------
NM_173602chr1213655 ------
NM_173633chr19126 ------
NM_173809chr1011473 ------
NM_173832chr873682 3387 3326 2462 119 103 31 --33319 3195 80 12896
NM_174937chr101563 ------
NM_175629chr211078 1920 ----
NM_175736chr1227675 488 ------
NM_175898chr1531459 352 298 --1162 --
NM_175902chr173230 215 86 ------
NM_175913chr201835 ------
NM_175931chr1691906 1874 1842 1810 1778 1327 232 110 38 ------
NM_176812chr201141 ----148
NM_177441chr17----1193 --
NM_177991chr202106 60 --1131 --
NM_177996chr2023389 2734 ------
NM_178135chr411184 ------
NM_178151chrX1301 ------
NM_178152chrX1301 ------
NM_178153chrX1301 ------
NM_178427chr11742 ------
NM_178554chr31473 ------
NM_178557chr431571 389 132 1449 1624 --
NM_178565chr81221 ------
NM_178568chr1721668 381 ------
NM_178835chr41784 ------
NM_178841chr162350 25 ----1125
NM_178860chr171163 ------
NM_178864chr11----1509 --
NM_181050chr162548 138 ------
NM_181336chr641287 1083 962 81 ------
NM_181353chr202233 162 ------
NM_181358chr121700 51 ------
NM_181492chr221896 147 185 --
NM_181534chr17141 ------
NM_181552chr76312 271 253 235 163 103 ------
NM_181670chr124523 77 70 25 ------
NM_181689chr201909 181 ----
NM_181701chr91419 --158 --
NM_181825chr22------174
NM_182528chr21130 ------
NM_182700chr7----2415 269 --
NM_182760chr3----1292 --
NM_182779chr12711 68 ------
NM_182895chr222111 21 ------
NM_182898chr724612 1678 ------
NM_182899chr724612 1678 ------
NM_182948chr11146 ------
NM_182964chr1142241 608 484 183 ------
NM_182972chr111087 ------
NM_183243chr7----1260 --
NM_183243chr7----1260 --
NM_183377chr171195 --1568 --
NM_183425chr2041128 1081 242 213 --31186 451 419 --
NM_194259chr161488 ------
NM_194260chr161488 ------
NM_194261chr161488 ------
NM_194278chr1463447 2902 1037 580 427 34 --1238 1231
NM_194282chr421230 1065 ------
NM_194315chr131011 446 358 144 2894 885 1858
NM_194457chr131011 446 358 144 2894 885 1858
NM_194458chr131011 446 358 144 2894 885 1858
NM_197941chr512743 ------
NM_198074chr1----1418 --
NM_198268chr121700 51 ------
NM_198269chr121700 51 ------
NM_198390chr1611628 ------
NM_198492chr193267 259 26 ------
NM_198527chr15----1449 --
NM_198700chr111416 ------
NM_198715chr116301 ------
NM_198859chr335107 3506 2055 ------
NM_198867chr192342 80 162 --1127
NM_198900chr1227675 488 ------
NM_198902chr151168 ------
NM_198956chr7----2415 269 --
NM_199131chr102933 565 --2957 642 --
NM_199169chr2041433 1037 739 56 --12298 --
NM_199170chr2041433 1037 739 56 --12298 --
NM_199171chr2041433 1037 739 56 --12298 --
NM_199189chr51729 ------
NM_199262chr172451 24 1219 ----
NM_199330chr15129 ------
NM_199331chr15129 ------
NM_199332chr15129 ------
NM_201432chr1712272 15994 ----
NM_201433chr1712272 15994 ----
NM_201632chr5186 ------
NM_201634chr51185 ------
NM_201995chr112735 667 ------
NM_201998chr112800 732 ------
NM_202002chr121609 ------
NM_203327chr2043800 876 433 109 13709 ----
NM_203342chr133634 2764 428 ------
NM_203343chr133634 2764 428 ------
NM_203394chr1212227 ------
NM_206907chr51725 ------
NM_207397chr11670 --1313 --
NM_207442chr141328 --1140 --
NM_213648chr5186 ------
NM_213654chr31140 ------
NM_213662chr1722324 475 ------