TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-2355-3p
miRNA Sequence: AUUGUCCUUGCUGUUUGGAGAU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000112chr524893 1315 1185 --24554 698
NM_000176chr553352 3033 2926 2682 424 23599 2380 ----
NM_000314chr1043163 1304 241 90 125 13196 --
NM_000618chr1255727 4825 1298 1247 863 12530 --15049
NM_000618chr1255727 4825 1298 1247 863 12530 --15049
NM_000633chr1875123 4508 4492 4354 4323 1275 1066 13999 23557 678 --
NM_000809chr457006 927 867 845 259 13491 36280 2002 1062 37581 7360 2357
NM_000813chr544716 2120 1604 663 ----23862 96
NM_000831chr1125554 5204 5066 4963 4778 2487 2104 2027 1845 1208 690 335 24267 4219 24888 1712 12000
NM_001001664chr223183 154 23517 570 23098 1495 21627 1291
NM_001005473chr596005 5711 5591 5248 4550 4173 994 516 56 --11673 25571 984
NM_001007094chr1053918 3215 1175 1025 715 43984 3932 3449 1369 11668 24293 1736
NM_001009554chr443681 3153 1748 1264 --11877 13504
NM_001009554chr443681 3153 1748 1264 --11877 13504
NM_001013620chr1278251 6661 5591 5499 5167 2560 1214 11906 21225 1049 --
NM_001014797chr10127649 7013 6871 6672 6454 5776 2473 2311 2304 1134 869 646 27961 7130 1235 16520
NM_001018074chr553352 3033 2926 2682 424 23599 2380 ----
NM_001018075chr553352 3033 2926 2682 424 23599 2380 ----
NM_001018076chr553352 3033 2926 2682 424 23599 2380 ----
NM_001018077chr553352 3033 2926 2682 424 23599 2380 ----
NM_001018111chr7103911 3819 3560 3074 2468 1331 1152 839 811 493 11345 23741 1117 23518 3416
NM_001024094chr553352 3033 2926 2682 424 23599 2380 ----
NM_001031695chr22135115 3756 3458 3445 2004 1654 1350 1170 1160 723 473 438 29 23509 919 ----
NM_001033087chr2052723 1112 530 483 112 21996 496 23314 3160 1426
NM_001037334chr1821919 733 11700 --21494 132
NM_001039840chrX85990 5820 5730 4658 4622 4099 471 456 34051 532 400 1760 --
NM_001039937chr1313712 23793 3522 33671 3537 1118 13380
NM_001040152chr764195 4141 3239 1595 1007 998 14845 13746 --
NM_001042555chr1244267 3618 3101 675 --24374 1688 13715
NM_001042603chr1264885 4079 660 326 34 24 ----23298 1637
NM_001106chr389191 8041 6340 3845 3695 3047 1186 645 1990 26200 1068 38789 7731 3533
NM_001167chrX55982 4814 4276 2373 998 15270 14951 11423
NM_001204chr267302 7219 4773 2148 871 566 16646 12173 25259 2227
NM_001438chr1------23365 993
NM_001616chr263470 2426 1414 1288 1068 195 23217 2508 --11231
NM_001858chr634555 3479 1833 ----24412 3769
NM_001918chr148515 7704 3197 1573 18201 11120 28211 7584
NM_002025chrX68793 8136 8062 7735 2802 181 17660 --15604
NM_002737chr1766411 5941 5690 4579 1675 729 21096 551 24611 770 12540
NM_002874chr952103 1969 426 153 146 1161 ----
NM_003161chr1722690 1311 13284 --2991 411
NM_003298chr334372 2366 2098 24939 1782 11200 2476 274
NM_003421chr1053918 3215 1175 1025 715 43984 3932 3449 1369 11668 24293 1736
NM_003861chr1422783 795 --22749 2124 22600 900
NM_004171chr1199185 8838 7287 6813 5877 3317 1791 1141 338 16375 13354 29046 7543
NM_004412chr1025727 5075 11089 --24766 645
NM_004571chr2132855 2506 1216 1597 --32680 1139 652
NM_004612chr934831 3580 103 ----2337 224
NM_004703chr1721747 1688 ----22312 769
NM_004748chr1543255 1158 1109 1070 --21475 1014 12914
NM_004956chr733314 3293 1628 --23206 609 11203
NM_004992chrX128293 8226 8118 7666 6742 2681 1731 963 895 607 470 387 1908 47804 5607 799 620 12631
NM_004992chrX128293 8226 8118 7666 6742 2681 1731 963 895 607 470 387 1908 47804 5607 799 620 12631
NM_005056chr1265129 4323 904 570 278 268 ----23542 1881
NM_005076chr173897 3542 3508 2557 1060 177 155 --23081 471 11069
NM_005151chr1821919 733 11700 --21494 132
NM_005359chr1866429 5220 4739 4464 4141 1124 26326 5445 --11585
NM_005397chr7103911 3819 3560 3074 2468 1331 1152 839 811 493 11345 23741 1117 23518 3416
NM_005596chr9115576 5135 4571 4546 4432 4223 2554 2029 1269 1011 31 1190 16254 --
NM_005819chr142691 1258 937 228 1574 --22472 519
NM_005935chr454364 852 322 129 89 --24426 2036 1249
NM_006212chr174876 4794 3720 3353 1027 700 219 1413 21897 174 1247
NM_006306chrX74898 4308 2215 1921 1137 878 390 31078 821 472 35076 4835 3639 14208
NM_006546chr1786391 4960 4681 4542 2652 2620 1479 99 24819 2469 24999 34 --
NM_006628chr1564127 3340 1712 1323 559 198 ----23379 3350
NM_006654chr1244267 3618 3101 675 --24374 1688 13715
NM_006750chr16117928 6965 6935 6835 5993 5295 5247 2832 1292 1174 790 --15267 --
NM_006815chr12----11287 21218 1153
NM_006912chr192518 2445 2344 2297 2069 1672 1026 654 112 ------
NM_007030chr5194503 3902 3875 3840 3805 3770 3735 3727 3700 3692 3665 3657 3630 3343 1388 1124 1106 1027 533 --34037 3929 645 --
NM_007050chr20107364 6736 6716 6123 5460 3247 2615 1875 1354 1045 46430 5325 5030 1109 26937 3166 15011
NM_007249chr13108192 7865 7799 7129 6750 6705 3409 2971 544 99 33735 2850 2297 46259 6117 1941 1374 18850
NM_007350chr1264198 3279 3008 1310 694 54 23161 1226 14247 23176 1380
NM_012141chr1313712 23793 3522 33671 3537 1118 13380
NM_012252chr733700 1552 592 31842 1015 973 1934 1505
NM_012296chr11103853 3386 1575 1353 1320 1263 1053 1025 778 484 --33951 1338 663 1700
NM_012309chr1154929 4903 1515 469 224 --31941 994 855 14805
NM_013231chr1473167 3037 2667 1320 388 325 33 --23452 1494 --
NM_013372chr1542302 707 642 628 23117 2835 32695 634 401 --
NM_014157chr1631115 893 213 11105 1812 23999 3077
NM_014309chr22125105 3746 3448 3435 1994 1644 1340 1160 1150 713 463 428 23499 909 ----
NM_014423chr531268 591 502 --22029 821 1774
NM_014747chr165197 4787 4751 1902 1504 873 34156 2090 1512 44645 2262 1886 1558 --
NM_014877chr1732333 709 616 11632 11671 16261
NM_014912chr1063542 1415 1118 743 582 61 --2530 431 --
NM_014982chr1455265 4466 4254 4044 739 35415 4013 3905 --1252
NM_015051chr942482 2448 2177 728 23322 2116 12106 23308 1098
NM_015090chr1125448 5337 5313 4997 4153 4117 2306 2295 2041 1434 1171 1023 ----14926
NM_015310chr8107417 6881 6172 6057 5335 3249 2628 2012 1900 764 23352 392 27650 7199 --
NM_015455chr553872 3063 2741 1607 140 12705 121 1770
NM_016009chr154583 4339 4019 1193 445 13003 13033 1702
NM_016131chr242130 2079 1545 397 1838 21650 1442 1653
NM_016248chr1321561 357 ----31432 1215 74
NM_016260chr266360 5018 4778 2606 1630 1325 1815 --22618 1674
NM_017637chr9119165 8579 7542 6391 6066 5817 3726 3209 3081 1242 952 --11230 13380
NM_017754chr624421 341 11225 1182 31390 189 68
NM_017831chr1844364 3797 3614 3121 24072 97 --24167 3194
NM_017848chrX44436 3474 428 82 ----22941 1754
NM_018085chr188130 7670 7200 2845 1941 1850 1545 198 17337 36962 5541 886 --
NM_018178chr131992 1468 296 --11382 21813 677
NM_018373chr1474716 2589 2185 1951 1721 810 689 --25341 2091 11133
NM_018440chr888240 8096 6926 6688 5640 1374 893 221 38285 3407 2820 ----
NM_020205chr123412 1257 2514 375 23270 23 22665 901
NM_020739chr1543255 1158 1109 1070 --21475 1014 12914
NM_020772chr1798327 8044 7579 7419 6027 1479 683 371 61 22803 543 25877 125 15363
NM_020774chr1831207 720 274 --1235 15818
NM_020830chr222672 96 22281 306 --21303 734
NM_021647chr443681 3153 1748 1264 --11877 13504
NM_021813chr665437 1988 1626 1486 1416 1367 35013 4834 662 --12156
NM_021911chr544716 2120 1604 663 ----23862 96
NM_021961chr1155654 2360 1953 917 373 27030 5346 25741 2335 25548 2564
NM_024345chr946069 5133 4135 3888 25662 5120 22072 1432 24532 3746
NM_024837chr1561726 1663 1236 1187 706 648 3620 360 222 1547 --
NM_024949chr454670 4071 3765 715 230 14024 --34424 4118 896
NM_024989chr241871 1494 1237 85 16766 27732 7440 16283
NM_025179chr174933 4644 4635 3172 1603 1468 285 24274 3823 43755 1701 1403 75 --
NM_030648chr464871 4466 2088 1887 1550 76 ----15009
NM_032445chr1541838 753 716 162 22030 1010 --1362
NM_033505chr232205 1316 121 32676 1769 1332 15826 1444
NM_080491chr11103853 3386 1575 1353 1320 1263 1053 1025 778 484 --33951 1338 663 1700
NM_080669chr17114094 3854 3235 1921 1540 1376 1368 871 253 131 114 --43324 229 94 28 --
NM_080676chr2052723 1112 530 483 112 21996 496 23314 3160 1426
NM_080867chr1411759 35082 4890 1213 11254 11790
NM_080872chr84856 520 278 44 --33515 2465 1470 1268
NM_133170chr20107364 6736 6716 6123 5460 3247 2615 1875 1354 1045 46430 5325 5030 1109 26937 3166 15011
NM_138492chr541239 349 163 119 --1360 1366
NM_144571chr456773 6126 5161 5048 1748 ----11939
NM_144578chr1455068 4467 3600 1993 99 45450 4497 1920 478 25380 1799 --
NM_145307chr1044202 3244 1713 1451 23329 557 --22869 1544
NM_145727chr671310 1147 1111 1026 1017 924 162 3883 570 228 --11196
NM_145912chr22103610 3505 3326 1845 1824 1128 723 626 387 103 3733 609 563 21836 1613 13132
NM_152263chr195164 5131 4751 4454 2037 1886 1672 1218 407 14532 13984 --
NM_152407chr5------2899 415
NM_152624chr546864 6567 6449 247 --36167 6093 1186 27119 615
NM_152673chr364388 4168 4109 4081 502 130 33197 2787 971 34018 3256 978 13502
NM_152733chr6156284 5846 5460 5367 4739 4646 4634 4118 3955 2599 2434 2307 1895 1250 41 21869 614 34372 4349 2572 1167
NM_153207chr1274119 3503 3002 1435 1201 425 39 --1141 --
NM_173642chr169111 8395 6911 5862 2059 527 26044 5646 --11571
NM_173851chr853297 2950 2766 1320 1132 23170 382 13743 --
NM_174911chr863879 3370 3061 3053 2870 934 1184 --13732
NM_175624chr1287803 7159 5787 5487 2408 1669 1545 795 --12547 27205 1842
NM_175625chr1287803 7159 5787 5487 2408 1669 1545 795 --12547 27205 1842
NM_175733chr1142050 1777 791 342 --144 2409 35
NM_175736chr12106780 6604 6506 5817 2464 2379 2361 1247 721 295 --56791 5895 3128 2918 1420 --
NM_176081chr1025727 5075 11089 --24766 645
NM_176083chr1025727 5075 11089 --24766 645
NM_182580chr192360 2336 2169 2144 1600 1591 807 698 641 11582 11662 1946
NM_182664chr142359 2193 284 217 ----2121 46
NM_183238chr1273499 3296 3269 3138 2916 2571 1271 --2672 374 --
NM_194071chr795404 4583 3865 3847 3627 2122 837 272 112 ----14476
NM_198465chrX52658 2286 376 286 277 22583 2481 --22181 2103
NM_198900chr12106780 6604 6506 5817 2464 2379 2361 1247 721 295 --56791 5895 3128 2918 1420 --
NM_198935chr2072942 2904 2323 524 486 353 335 21284 738 --2571 342
NM_199421chr1411759 35082 4890 1213 11254 11790
NM_205846chr541239 349 163 119 --1360 1366
NM_206594chr1------23365 993
NM_206595chr1------23365 993
NM_206909chr8107417 6881 6172 6057 5335 3249 2628 2012 1900 764 23352 392 27650 7199 --
NM_207481chr21271 --1436 21203 128