TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-2355-5p
miRNA Sequence: AUCCCCAGAUACAAUGGACAA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000025chr81447 ------
NM_000138chr152951 271 ------
NM_000141chr1011209 ------
NM_000192chr121481 ------
NM_000217chr1274208 3465 1741 1247 1241 1234 166 11732 ----
NM_000237chr8196 ------
NM_000268chr2243454 2551 1246 830 1606 31094 631 101 13748
NM_000332chr675860 5699 5645 2248 825 503 392 31607 1205 833 ----
NM_000351chrX23312 3120 32900 2860 878 --23263 81
NM_000437chr121600 701 2755 245 --1270
NM_000462chr1521539 179 ------
NM_000538chr132543 141 ------
NM_000555chrX77204 6198 6132 3108 2826 566 236 27101 6139 ----
NM_000611chr1165876 2614 1911 1850 1658 863 46084 5725 1674 546 12724 14511
NM_000633chr1864953 4125 1576 1557 1161 544 34875 1604 441 2509 471 --
NM_000724chr102476 81 ------
NM_000801chr202380 272 ------
NM_000814chr1543771 3468 2956 618 ------
NM_000831chr1145786 4960 4728 4681 4054 2388 2100 2052 1989 1605 1244 633 529 96 21356 743 21586 33 --
NM_000844chr31323 ------
NM_000875chr1576486 5456 4871 4534 2182 826 59 1787 --12127
NM_000903chr1611151 ------
NM_000924chr124528 409 186 147 2334 155 2926 504 1220
NM_000935chr31993 ------
NM_000964chr1711327 --2280 120 31289 398 134
NM_001001331chr332022 379 372 --1228 --
NM_001001392chr1141098 509 502 41 ------
NM_001001936chr101452 ------
NM_001002843chr151433 ------
NM_001002909chr172488 60 ------
NM_001002914chr1741231 969 807 29 11155 --21099 371
NM_001003674chr1852757 2241 724 245 226 1423 ----
NM_001003675chr1852757 2241 724 245 226 1423 ----
NM_001003681chr2231531 690 301 --1309 --
NM_001003792chr31882 ------
NM_001003793chr31882 ------
NM_001003800chr942371 831 250 237 1319 --11066
NM_001003891chr223202 135 97 ------
NM_001003945chr941335 785 381 322 ------
NM_001004304chr1283042 2563 1981 1182 1176 1008 826 273 43126 2762 1170 356 ----
NM_001004342chr196025 5623 5226 4730 4548 2340 2106 444 156 15258 13897 22244 1200
NM_001004419chr1233960 1702 852 33621 3568 1773 1352 --
NM_001005861chr31745 ------
NM_001006617chr92447 236 --1180 --
NM_001006619chr92447 236 --1180 --
NM_001006620chr92447 236 --1180 --
NM_001006621chr92447 236 --1180 --
NM_001006944chr114643 542 463 231 --2630 218 1488
NM_001008925chr423118 2234 ------
NM_001009993chr2113969 3878 3157 3139 2853 1743 1645 1541 751 510 48 23283 1548 --13713
NM_001010924chr101891 ------
NM_001010971chr11399 ------
NM_001011722chr11177 ------
NM_001011722chr11177 ------
NM_001012398chr161240 ------
NM_001013406chr72614 136 ------
NM_001013415chr41131 ------
NM_001013635chr122808 419 ------
NM_001013690chr1282384 2337 2258 2200 2103 2075 2067 1551 --22300 1831 --
NM_001013693chr1112189 2025 1169 1065 820 590 584 560 418 345 333 --32693 790 131 --
NM_001013693chr1112189 2025 1169 1065 820 590 584 560 418 345 333 --32693 790 131 --
NM_001013699chr121367 ------
NM_001014442chr13157 ------
NM_001017440chr777741 7599 5958 5627 911 648 159 21286 1214 17872 11840
NM_001017926chr81101 ------
NM_001017969chr91189 ------
NM_001018111chr732742 734 648 23727 75 190 23889 1341
NM_001024463chr151370 ----1247
NM_001024736chr1551360 1354 1307 1280 1136 11538 11524 --
NM_001024809chr1711327 --2280 120 31289 398 134
NM_001024959chr34878 629 584 111 ------
NM_001024960chr34878 629 584 111 ------
NM_001025076chr1065333 4213 2435 1941 1505 649 14099 ----
NM_001025077chr1056691 5571 2863 2007 1230 15457 ----
NM_001025079chr363351 3173 1057 959 610 98 ------
NM_001029863chr621020 701 ------
NM_001030001chr141447 ------
NM_001030055chr1424710 1223 1843 13365 --
NM_001031685chr11226 ------
NM_001031732chr433603 3597 230 ------
NM_001032380chr1011893 ------
NM_001033057chr331679 512 318 ------
NM_001033081chr141807 1447 421 272 ----11723
NM_001033082chr141807 1447 421 272 ----11723
NM_001033507chr161547 1403 732 642 122 105 11640 11704 --
NM_001033925chr101709 ------
NM_001034841chr1685512 4419 3966 3909 3806 3604 1827 59 24903 2081 25050 3505 --
NM_001037164chr72743 629 1238 ----
NM_001037165chr797473 5594 3097 3064 2111 1219 937 863 299 38913 6760 3419 33151 3107 854 --
NM_001038640chr152686 663 ------
NM_001039583chr222407 110 ------
NM_001039584chr222407 110 ------
NM_001040057chr71495 ----1476
NM_001040142chr21487 ------
NM_001040143chr21487 ------
NM_001040427chr16130 ------
NM_001042357chr101174 ------
NM_001042358chr101174 ------
NM_001042360chr101174 ------
NM_001042361chr101205 ------
NM_001042363chr101174 ------
NM_001042364chr101205 ------
NM_001042365chr101205 ------
NM_001042387chr101205 ------
NM_001042389chr101174 ------
NM_001042390chr101174 ------
NM_001042392chr101174 ------
NM_001042393chr101205 ------
NM_001042395chr101174 ------
NM_001042396chr101205 ------
NM_001042397chr101205 ------
NM_001042404chr121276 602 ------
NM_001042599chr237089 6429 3108 11999 ----
NM_001042601chr322593 827 ----12113
NM_001042632chr203925 845 477 ------
NM_001042633chr203925 845 477 ------
NM_001106chr399646 7930 6547 6505 6395 3900 2215 2178 1799 46365 3588 3439 3032 43840 2915 1113 655 13278
NM_001146chr821535 194 ------
NM_001173chr1424710 1223 1843 13365 --
NM_001241chr222114 1799 ------
NM_001241chr222114 1799 ------
NM_001300chr101451 ------
NM_001343chr531172 1061 413 ------
NM_001420chr1992874 2572 935 740 728 432 365 190 165 --32892 2678 643 --
NM_001463chr22684 199 ------
NM_001543chr5134748 4739 4688 4019 1906 1667 1560 1510 1369 1231 1180 992 650 14113 33967 3854 255 44701 4491 591 146
NM_001554chr11553 ------
NM_001567chr115543 533 475 137 121 1644 2622 507 --
NM_001650chr1822826 2541 --33954 3362 923 --
NM_001655chr1112099 ------
NM_001683chr332022 379 372 --1228 --
NM_001719chr20128 ------
NM_001731chr12175 ------
NM_001777chr363351 3173 1057 959 610 98 ------
NM_001798chr1211018 ------
NM_001829chr41187 ------
NM_001941chr1833084 927 664 13228 11158 1909
NM_001954chr65761 744 692 659 306 1297 1554 --
NM_001962chr51168 ------
NM_001967chr31212 ------
NM_001980chr1212254 ------
NM_001995chr421421 1281 ------
NM_002015chr1322064 879 ------
NM_002025chrX58664 8179 7471 1495 771 --16297 191
NM_002062chr64485 389 317 26 ------
NM_002092chr425070 751 ------
NM_002101chr22437 349 --1402 1367
NM_002139chrX1415 ------
NM_002140chr93822 371 221 --1743 --
NM_002148chr21163 ------
NM_002199chr4130 ------
NM_002227chr11831 ------
NM_002230chr1751030 780 192 186 113 --3882 261 221 21039 383
NM_002254chr21217 ------
NM_002267chr1321563 1502 ------
NM_002270chr535580 3926 705 1335 ----
NM_002309chr22113074 2770 2272 2129 2123 1933 879 625 112 83 62 --1252 --
NM_002359chr1764091 4048 2750 1496 1486 1316 --1555 --
NM_002375chr352221 2082 2017 704 431 ------
NM_002387chr521624 158 --23818 60 --
NM_002427chr1121106 46 ------
NM_002499chr1592163 2112 2037 1903 1845 1774 798 788 530 12123 1806 --
NM_002524chr11840 ------
NM_002539chr2155 ------
NM_002577chr333456 341 83 ------
NM_002585chr1145 ------
NM_002595chr1221723 1424 ------
NM_002628chr31229 ------
NM_002713chr14796 379 153 60 ------
NM_002717chr81584 ------
NM_002834chr1283149 3032 2851 1596 1313 1229 409 328 23316 1528 ----
NM_002849chr12137 ------
NM_002859chr1261737 1728 1590 1424 1147 389 21621 450 1263 11449
NM_002874chr94844 564 129 122 1726 ----
NM_002886chr354968 4068 3512 3248 350 25129 3870 --1807
NM_002901chr111126 --1240 --
NM_002958chr31745 ------
NM_002973chr121202 ------
NM_003009chr192288 128 ------
NM_003010chr171566 ------
NM_003011chr91165 ------
NM_003076chr1231466 626 93 --11389 --
NM_003112chr71141 ------
NM_003131chr692126 1936 1808 1782 1732 1441 574 497 388 21632 908 3865 827 489 --
NM_003164chr11131 ------
NM_003199chr1835423 3438 3430 ------
NM_003216chr2273060 2189 1263 1087 1000 606 600 43185 2856 2228 212 21078 56 --
NM_003236chr242482 2245 937 180 ----1447
NM_003304chr311415 ------
NM_003367chr192458 377 ------
NM_003370chr193667 500 249 --3540 268 197 --
NM_003413chrX11755 ------
NM_003453chr132498 479 ------
NM_003463chr613244 --11170 --
NM_003472chr611140 ------
NM_003482chr1292193 1961 1943 1749 1042 941 889 148 108 1340 11689 --
NM_003569chr62144 135 ------
NM_003583chr1243304 2617 969 476 ------
NM_003633chr532069 845 575 ------
NM_003637chr151101 525 284 271 74 --11035 --
NM_003656chr3146 ------
NM_003673chr171114 ------
NM_003707chr3186 ------
NM_003872chr21275 ----155
NM_003942chr114643 542 463 231 --2630 218 1488
NM_003966chr557733 5824 5012 3105 1831 14806 16241 --
NM_003980chr611362 ------
NM_004028chr1822826 2541 --33954 3362 923 --
NM_004050chr1461899 1831 1813 1717 1711 948 --137 1252
NM_004074chr111165 ------
NM_004100chr61569 ------
NM_004114chrX1280 ------
NM_004116chr2188 ------
NM_004187chrX41367 1195 294 87 --2542 193 1346
NM_004227chr772760 2742 1240 905 804 264 172 --22131 691 1782
NM_004263chr291772 1130 641 620 452 411 386 307 170 --167 --
NM_004295chr172350 202 1190 ----
NM_004302chr1242653 2367 2065 1160 11167 --12584
NM_004319chr11252 ------
NM_004331chr812365 ------
NM_004338chr1852757 2241 724 245 226 1423 ----
NM_004343chr191124 ------
NM_004397chr1154194 3780 3017 682 60 14149 --1268
NM_004422chr171381 ------
NM_004437chr152821 2442 1293 1220 264 23307 884 12841 --
NM_004463chrX161 ------
NM_004482chr21369 ------
NM_004535chr2061424 710 430 185 104 73 --1651 --
NM_004537chr121969 ------
NM_004588chr1183795 3470 2818 1107 923 655 391 122 11586 32533 264 226 --
NM_004622chr222290 163 12116 ----
NM_004643chr143667 312 188 --1241 1646
NM_004660chrY31870 1645 540 1835 ----
NM_004687chr1721880 206 ------
NM_004739chr112446 250 ------
NM_004774chr1753080 2618 2603 2050 1245 --13009 1563
NM_004804chr222767 1808 1610 1592 --
NM_004836chr21154 ------
NM_004849chr611672 ------
NM_004864chr192166 152 ------
NM_004866chr544857 4057 920 727 24865 249 ----
NM_004912chr72614 136 ------
NM_004924chr193214 204 144 --21064 931 --
NM_004943chr1921101 145 --1298 --
NM_004985chr1251257 1103 762 739 263 ------
NM_004992chrX98206 7011 6461 5898 3326 3275 3199 822 179 15152 37572 6733 6027 --
NM_004992chrX98206 7011 6461 5898 3326 3275 3199 822 179 15152 37572 6733 6027 --
NM_005022chr171212 ------
NM_005027chr193441 235 132 ------
NM_005028chr1042039 927 238 151 1399 ----
NM_005056chr1255384 1999 1536 873 274 ------
NM_005098chr8153 ------
NM_005116chr2084405 4358 4300 4060 2775 1780 1240 624 13008 --13699
NM_005121chr1723361 147 ------
NM_005124chr62841 80 ------
NM_005184chr193511 379 294 ------
NM_005206chr1721149 1081 ------
NM_005235chr237089 6429 3108 11999 ----
NM_005238chr1143075 2924 541 467 ----122
NM_005277chr411586 ------
NM_005326chr16130 ------
NM_005339chr444213 3903 3225 978 1679 ----
NM_005359chr1886426 6321 6314 6055 6048 6030 4680 1121 ----12428
NM_005376chr13822 748 164 ----11011
NM_005387chr111528 ------
NM_005397chr732742 734 648 23727 75 190 23889 1341
NM_005398chr101167 ----1488
NM_005426chr11226 ------
NM_005437chr101994 ----11184
NM_005487chr2231531 690 301 --1309 --
NM_005502chr92829 344 ------
NM_005504chr1266039 5981 4942 4870 4798 1311 14952 ----
NM_005574chr11288 26 ------
NM_005578chr32755 514 13806 ----
NM_005596chr934997 2067 1815 ------
NM_005665chr114067 ------
NM_005718chr34878 629 584 111 ------
NM_005731chr21404 ------
NM_005738chr72743 629 1238 ----
NM_005779chr523346 932 --1484 --
NM_005785chr1241657 1456 688 152 --11428 --
NM_005801chr171117 ------
NM_005802chr91251 ------
NM_005822chr622142 735 ------
NM_005850chr1185 ------
NM_005866chr91682 ----1611
NM_005899chr173357 159 63 ------
NM_005910chr17114029 3520 3428 3375 3094 3081 2772 1090 709 517 414 --1384 1367
NM_005920chr1133718 3699 3553 3421 2977 2792 2494 1012 983 956 930 731 330 --22916 260 11063
NM_005923chr6164 ------
NM_005935chr445078 4641 4062 1179 1892 ----
NM_005937chr1782943 1426 1160 729 640 626 568 375 11144 33674 1007 951 12793
NM_005964chr172593 341 ------
NM_006011chr151280 ------
NM_006040chr1641352 1184 954 387 ------
NM_006047chr2012548 ------
NM_006048chr131120 831 286 --1900 --
NM_006106chr1142342 1093 756 267 --12114 1276
NM_006145chr1911017 ------
NM_006148chr1772100 2009 1925 1879 533 458 369 ----1255
NM_006202chr1941800 543 531 202 11257 1422 2685 210
NM_006203chr51332 --12137 13778
NM_006237chr1311901 895 334 322 269 262 212 197 119 57 36 --1401 --
NM_006239chr41161 ------
NM_006309chr3137 ------
NM_006328chr111657 ------
NM_006367chr12302 170 ------
NM_006375chrX11192 ------
NM_006379chr72564 356 ------
NM_006440chr22189 ------
NM_006449chr231613 516 27 ------
NM_006480chr51463 ------
NM_006482chr1243304 2617 969 476 ------
NM_006534chr2032945 2304 1314 23389 1335 --11147
NM_006546chr17126080 6042 5379 5250 4762 4407 4373 4079 2607 1912 760 644 46550 5485 5041 4062 26087 2088 25433 5299
NM_006561chr1065333 4213 2435 1941 1505 649 14099 ----
NM_006602chr201216 ------
NM_006648chr91171 ------
NM_006726chr42813 168 1369 ----
NM_006751chr21414 ------
NM_006763chr12791 711 --1837 2396 79
NM_006801chr192484 171 ------
NM_006805chr55386 380 374 325 151 1122 ----
NM_006901chr15159 --1187 1549
NM_006910chr161256 ------
NM_006912chr122500 461 ------
NM_006981chr922076 201 1229 --1356
NM_007106chr1311773 ------
NM_007125chrY11339 ------
NM_007144chr177892 873 392 302 272 115 108 ------
NM_007170chr12374 29 ------
NM_007192chr141981 ------
NM_007212chr121969 1428 ------
NM_007222chr81101 ------
NM_007249chr1348492 8054 7508 2766 12582 13041 17428
NM_007322chr193568 481 413 ------
NM_007372chr17184 ------
NM_007373chr1011279 ------
NM_012081chr52334 252 ------
NM_012155chr192209 186 ------
NM_012193chr1164942 4757 3973 3394 1594 910 ----15246
NM_012199chr153531 3312 1843 1196 844 64473 3892 2860 867 833 157 --11593
NM_012214chr244597 1691 1678 1598 15713 14028 --
NM_012223chr2172 ------
NM_012232chr1742094 1684 1392 169 52177 1962 643 529 511 31975 564 309 1406
NM_012296chr1183501 3384 3221 2998 1230 1207 994 342 21179 965 12922 13215
NM_012297chr421928 1897 ------
NM_012304chr522369 2172 22011 1891 --22399 588
NM_012407chr222407 110 ------
NM_012448chr1752457 2051 2012 1903 606 ------
NM_012458chr1931030 319 249 ------
NM_012479chr742375 1891 978 71 184 ----
NM_013269chr1233887 1629 779 33548 3495 1700 1279 --
NM_013279chr1142025 1860 1705 548 --21872 1834 21634 523
NM_013280chr112259 142 ------
NM_013446chr71369 ------
NM_013993chr65761 744 692 659 306 1297 1554 --
NM_013994chr65761 744 692 659 306 1297 1554 --
NM_014110chr14796 379 153 60 ------
NM_014154chr3197 ------
NM_014155chr1144922 4579 1179 149 ------
NM_014233chr17102008 1947 1690 1504 1462 473 333 327 212 152 31555 571 402 21700 1684 --
NM_014250chr2231531 690 301 --1309 --
NM_014292chr2231651 155 30 ------
NM_014309chr2255023 5015 4775 3663 2153 13672 24552 1971 21094 426
NM_014423chr565321 5088 4859 3941 2271 336 --13887 --
NM_014445chr312268 ------
NM_014515chr12142 ------
NM_014620chr122546 284 ------
NM_014634chr2232925 2536 365 13156 12879 13025
NM_014659chr151370 ----1247
NM_014661chr10133736 3706 3393 3065 2970 2883 1214 797 609 396 390 370 28 13687 33700 2719 456 1160
NM_014683chr1712040 ------
NM_014707chr711943 ------
NM_014730chr1284567 4392 4357 4202 3795 1980 871 744 13613 11966 14584
NM_014730chr1284567 4392 4357 4202 3795 1980 871 744 13613 11966 14584
NM_014739chr644049 3512 3270 866 ------
NM_014747chr1134561 4218 4152 3695 2330 2004 1701 1685 1663 1086 1057 396 36 12121 1654 --
NM_014751chr82595 327 127 ----
NM_014764chr121116 ------
NM_014767chr1073599 3231 3051 2268 2262 1076 996 --33201 2287 116 32882 2297 888
NM_014772chr1873529 3147 3042 2200 1123 110 40 --33344 1397 1325 11106
NM_014812chr121276 602 ------
NM_014827chr11162 ------
NM_014836chr1011893 ------
NM_014839chr11335 ------
NM_014848chr1542233 2214 1093 188 11112 --12482
NM_014872chr922007 228 ------
NM_014877chr1757683 6601 5604 4923 1114 16245 --11415
NM_014901chr571986 1824 1698 1631 830 645 78 ------
NM_014909chr14123606 3311 3249 3052 2985 2860 1571 1096 1021 444 437 39 31282 255 80 43119 2836 2809 1486 21256 949
NM_014935chr1123594 3237 3171 2983 1123 1071 986 629 572 331 274 153 23047 368 12840 13265
NM_015000chr1212253 ------
NM_015017chr111264 ------
NM_015020chr1643585 1092 1071 46 11106 ----
NM_015060chr71202 ------
NM_015061chr92711 71 ------
NM_015075chrX62222 2175 2168 1932 1829 1689 --31857 699 251 --
NM_015077chr1793509 2977 1664 1518 1027 737 309 303 266 13466 --13383
NM_015094chr22104224 4053 3957 3781 3403 3259 3172 2932 980 964 13854 24006 469 12940
NM_015107chrX42103 1693 1567 65 --12181 --
NM_015144chr1623928 3117 12701 ----
NM_015158chr9162 ------
NM_015176chr11641 ------
NM_015185chrX52860 2844 2702 2333 839 1222 12033 --
NM_015197chr1472999 1232 889 843 826 612 423 13395 43031 2383 1263 446 11225
NM_015199chr342978 923 782 282 11003 ----
NM_015254chr872963 2417 1263 1125 814 320 197 12424 32436 898 31 31959 515 256
NM_015291chr121219 568 ------
NM_015317chr232469 2022 174 1183 ----
NM_015326chr13719 713 82 12966 12283 --
NM_015335chr1242332 1834 760 496 ------
NM_015344chr81109 ------
NM_015349chr612077 ------
NM_015355chr171381 ------
NM_015436chr422937 2053 ------
NM_015457chr114990 193 179 163 1807 ----
NM_015564chr513568 ------
NM_015605chr101205 ------
NM_015686chrX71007 973 749 376 291 106 63 21660 122 21897 1754 1829
NM_015845chr181698 ----151
NM_015872chr1101688 1667 1641 1586 1513 393 352 194 173 94 21320 520 41658 1313 667 283 1551
NM_015878chr81177 ------
NM_015889chr223202 135 97 ------
NM_015898chr1972320 1986 711 422 403 360 292 --3744 412 386 --
NM_015955chr2194 ------
NM_015981chr583137 3044 2435 1203 1001 744 494 239 22993 597 21283 361 --
NM_016246chr19122 ------
NM_016357chr1211063 ----1266
NM_016418chr2243514 2611 1306 890 1666 31154 691 161 13808
NM_016441chr23949 284 278 1304 ----
NM_016467chr211299 ------
NM_016526chr1152416 2188 1711 781 441 ----11976
NM_016621chr1164573 4187 3775 3500 3464 356 ----21739 1240
NM_016623chr81253 ------
NM_016823chr1721019 951 ------
NM_016834chr17114029 3520 3428 3375 3094 3081 2772 1090 709 517 414 --1384 1367
NM_016835chr17114029 3520 3428 3375 3094 3081 2772 1090 709 517 414 --1384 1367
NM_016841chr17114029 3520 3428 3375 3094 3081 2772 1090 709 517 414 --1384 1367
NM_017590chr22112491 2476 2327 2254 1738 872 527 355 326 97 33 --4902 895 429 347 --
NM_017596chr193114 1712 1680 1311 1195 1145 928 454 418 23838 429 53960 3789 793 675 317 --
NM_017612chr122464 205 ------
NM_017636chr191267 ----1318
NM_017637chr979387 8795 8594 7320 6909 2180 89 --17831 --
NM_017650chr734183 1284 705 14177 --24192 939
NM_017661chr151433 ------
NM_017714chr20157 ------
NM_017719chr312045 ------
NM_017786chr81492 ------
NM_017873chr962524 2053 1950 1010 574 400 --32589 835 697 --
NM_017953chr1182 ------
NM_018028chr1941168 1142 417 220 --1472 --
NM_018030chr181958 ----1262
NM_018107chr141136 ------
NM_018125chr11177 ------
NM_018154chr19189 ------
NM_018157chr1251260 920 856 814 742 1863 ----
NM_018178chr12780 131 ------
NM_018179chr121207 ----1254
NM_018193chr15132 ------
NM_018302chr41691 ------
NM_018315chr41131 ------
NM_018413chr121107 ------
NM_018433chr21505 ------
NM_018703chr161256 ------
NM_018945chr62644 113 --22648 2349 --
NM_018951chr73983 364 305 ----1219
NM_018970chr722334 470 --1555 --
NM_018976chr1211802 ------
NM_019063chr212028 ----11972
NM_019106chr2242730 523 500 412 --1512 1338
NM_019593chr20128 ------
NM_019857chrX4697 637 528 29 --1275 --
NM_020122chr255590 5026 3931 1271 1179 --23960 588 --
NM_020137chrX1362 ------
NM_020141chr132285 911 456 1149 --12259
NM_020177chr532704 2179 292 ------
NM_020198chr172156 149 ------
NM_020205chr1103276 3099 2989 2192 1396 867 821 586 362 337 ------
NM_020342chr22724 389 ------
NM_020443chr125068 1780 1259 1324 1418
NM_020463chr21288 ------
NM_020640chr31518 ------
NM_020647chr81216 ----1456
NM_020699chr165109 5101 5095 4380 651 606 35130 3932 848 73942 1595 1439 1432 1194 722 299 13672
NM_020713chr20103122 2853 2338 2190 2031 909 898 711 276 204 --22222 790 1973
NM_020717chrX43224 3162 1784 1555 1826 1733 1183
NM_020718chr1635274 4706 4095 15410 --14955
NM_020760chr221590 155 ------
NM_020770chr131115 955 294 ------
NM_020772chr1752750 1540 1531 1244 621 2631 59 16085 28319 6628
NM_020781chr721236 124 ------
NM_020795chr1751884 1664 1474 1401 385 --1216 31905 1452 683
NM_020804chr6102341 2044 1984 1978 1751 873 658 206 199 191 --1930 --
NM_020830chr22180 155 ----23143 428
NM_020870chr42609 506 ------
NM_020899chr173864 276 121 21809 678 --12270
NM_020918chr1033218 3032 209 12715 ----
NM_020946chr931669 1512 488 21774 22 1628 31486 1323 180
NM_020956chr19114611 4485 3977 3689 3357 3287 3122 1304 1208 635 457 34300 471 330 33959 3150 644 14246
NM_020958chr141123 ------
NM_020962chr15126 ------
NM_021003chr141681 ------
NM_021007chr21487 ------
NM_021116chr7127499 6943 3384 3130 2318 2137 1833 1668 1430 1185 550 24 28160 5799 1609 11697
NM_021132chr101236 ------
NM_021190chr13114 77 23 ------
NM_021224chr91365 ------
NM_021238chr121623 ------
NM_021633chr14976 910 546 267 ------
NM_021639chr12849 352 ------
NM_021831chr21249 ------
NM_021912chr1543771 3468 2956 618 ------
NM_021973chr41498 ------
NM_021976chr651037 1000 261 81 70 2823 377 2938 402 --
NM_021977chr653787 3284 3055 2444 628 1956 ----
NM_022048chr1576135 5318 5114 4628 1969 819 569 21231 98 2435 34 --
NM_022075chr11760 ----191
NM_022091chr61263 --12507 --
NM_022166chr1674390 4227 3855 3843 2462 2370 1857 22048 2019 --2606 94
NM_022455chr5153 ------
NM_022476chr161240 ------
NM_022491chr1293482 2804 2616 2306 1354 1212 1165 488 252 23373 649 ----
NM_022497chr363119 1425 739 477 48 25 11486 2751 559 --
NM_022648chr274108 3795 1741 1138 1032 137 50 2370 36 23729 1146 23114 1217
NM_022658chr121198 ------
NM_022659chr8181 ------
NM_022726chr63261 100 93 1690 ----
NM_022735chr11184 ------
NM_022756chr141329 1188 1055 483 ------
NM_022824chr52617 65 ------
NM_022898chr1474302 1210 970 906 619 613 421 ----1782
NM_022970chr1011209 ------
NM_024019chr41254 ------
NM_024036chr111272 ------
NM_024056chr121615 ------
NM_024117chr92447 236 --1180 --
NM_024297chr171213 ------
NM_024423chr1833298 1141 878 13442 11372 11123
NM_024546chr131255 ------
NM_024567chr81452 ------
NM_024595chr11413 ------
NM_024680chr111110 ------
NM_024704chr201173 ------
NM_024713chr1511222 ------
NM_024742chr1661670 1659 1550 1334 705 699 ------
NM_024770chr245927 2678 1369 682 25725 584 ----
NM_024785chr21509 ------
NM_024824chr141263 ------
NM_024834chr103797 658 440 1467 ----
NM_025179chr134008 3640 85 23037 342 2283 129 31955 1729 1024
NM_025222chr352761 2725 2714 2665 546 ------
NM_025238chr1511020 ------
NM_025250chr762964 2942 2572 2267 830 414 --12377 --
NM_030579chr1673399 2647 2389 840 815 64 40 ------
NM_030674chr1234644 4164 692 --15389 1816
NM_030806chr148535 7953 6473 1762 11187 26991 1967 --
NM_030809chr123818 216 116 1127 3748 625 205 --
NM_030884chr352221 2082 2017 704 431 ------
NM_030940chr9155 ------
NM_030963chr61105 ------
NM_030981chr1141113 928 115 92 11182 --1904
NM_031262chr93765 314 164 ------
NM_031263chr93822 371 221 --1743 --
NM_031412chr1261112 1062 329 278 251 41 21183 75 1456 --
NM_031417chr1972666 2068 1063 684 551 431 399 --22821 2180 32546 2111 671
NM_031442chrX22011 708 ----23111 680
NM_031468chr777741 7599 5958 5627 911 648 159 21286 1214 17872 11840
NM_031492chr111454 ------
NM_031858chr173357 159 63 ------
NM_031862chr173357 159 63 ------
NM_032028chr51459 ------
NM_032128chr41713 ------
NM_032281chr1992874 2572 935 740 728 432 365 190 165 --32892 2678 643 --
NM_032294chr176510 466 399 323 201 193 1267 41685 597 530 102 11364
NM_032352chr141559 ------
NM_032440chr101982 ------
NM_032550chr101452 ------
NM_032711chr1764091 4048 2750 1496 1486 1316 --1555 --
NM_032737chr1972602 2515 2451 2333 2047 1771 538 1645 32296 2004 1742 1712
NM_032765chr51354 ------
NM_032932chr17136338 6297 5810 5658 5391 5339 4309 2173 2041 1875 1575 858 149 --35267 1455 356 15144
NM_033211chr521328 181 11546 ----
NM_033224chr737414 1465 820 --14963 --
NM_033326chr1132187 1795 1725 ----11662
NM_033360chr1251378 1224 883 860 384 ------
NM_033401chr161141 ------
NM_033430chr421368 323 ------
NM_033437chr421368 323 ------
NM_033632chr41131 ------
NM_033642chrX1280 ------
NM_033656chr2155640 5550 4095 1097 221 11669 ----
NM_052827chr1211018 ------
NM_052860chr5181 ------
NM_052906chr22184958 4951 4129 3791 3776 3188 2028 1965 1763 1683 1616 1534 1492 1425 692 380 361 289 44088 3524 1064 57 63663 1889 1865 788 353 45 14347
NM_054033chr21217 ------
NM_058191chr211867 ------
NM_058241chr222014 1699 ------
NM_058241chr222014 1699 ------
NM_078625chr61179 ------
NM_080430chr221133 ------
NM_080491chr1183501 3384 3221 2998 1230 1207 994 342 21179 965 12922 13215
NM_080544chr331361 1190 1167 1281 11323 --
NM_080597chr181958 ----1262
NM_080669chr1774044 3679 3621 1439 1294 1023 652 23233 545 34024 3362 1794 33355 3144 958
NM_080672chr201228 ------
NM_080717chr121481 ------
NM_080818chr13----1185 1727
NM_130438chr2112391 ------
NM_130838chr1521539 179 ------
NM_130839chr1521539 179 ------
NM_130846chr12137 ------
NM_133264chr1753546 3489 3218 2508 554 43553 1550 382 298 13597 13384
NM_133370chr433603 3597 230 ------
NM_138333chr9157 ------
NM_138396chr12195 ------
NM_138558chr14796 379 153 60 ------
NM_138576chr1474302 1210 970 906 619 613 421 ----1782
NM_138689chr111174 ------
NM_138730chr6145 ------
NM_138994chr161141 ------
NM_139015chr1221738 1269 ----21322 302
NM_139071chr1231466 626 93 --11389 --
NM_139131chr111528 ------
NM_144571chr422605 1072 25944 972 --11299
NM_144973chr1233245 329 322 14163 ----
NM_145025chr61156 ------
NM_145173chr1972359 881 820 813 366 289 179 --22493 2411 2428 122
NM_145284chrX2942 622 162 ----
NM_145351chr1741911 1903 1686 356 1440 41737 527 219 156 2810 137
NM_145912chr22104212 3533 3216 1821 1753 1255 1126 715 441 204 23552 1843 33350 655 465 1559
NM_147157chr91682 ----1611
NM_147686chr6143 ------
NM_148174chr81177 ------
NM_152272chr831331 1097 1015 ----11090
NM_152424chrX104436 4430 4424 3119 1839 1071 749 85 77 51 64247 4176 4146 3978 1481 548 ----
NM_152437chr1211914 11658 --12369
NM_152512chr221430 ------
NM_152789chr71495 ----1476
NM_152838chr2012548 ------
NM_152862chr21404 ------
NM_152890chr12867 855 ------
NM_153186chr9162 ------
NM_153188chr535580 3926 705 1335 ----
NM_153633chr122546 284 ------
NM_153715chr73983 364 305 ----1219
NM_170607chr1711528 ------
NM_170686chr721236 124 ------
NM_171825chr583137 3044 2435 1203 1001 744 494 239 22993 597 21283 361 --
NM_172037chr811486 ------
NM_172103chr61569 ------
NM_172105chr61569 ------
NM_172206chr176510 466 399 323 201 193 1267 41685 597 530 102 11364
NM_172349chr5153 ------
NM_173198chr922076 201 1229 --1356
NM_173200chr922076 201 1229 --1356
NM_173463chr454196 4138 3412 1726 23 --11719 --
NM_173470chrX159 ------
NM_173475chr1631246 1104 209 ------
NM_173510chr222458 132 ------
NM_173552chr312382 ------
NM_173595chr12175112 4835 4676 4670 4607 4566 4403 4395 4192 3990 3984 3919 3704 3483 1803 1211 555 --54684 1261 493 341 135 14156
NM_173872chr41119 ------
NM_174934chr1172503 1431 1155 1149 494 484 478 1788 12894 --
NM_175063chr195296 98 86 80 74 ------
NM_175709chr22102658 2558 2551 2017 1951 523 248 223 77 46 12266 22770 196 12385
NM_175856chr51335 ------
NM_175859chrX4697 637 528 29 --1275 --
NM_177398chr161547 1403 732 642 122 105 11640 11704 --
NM_177399chr161547 1403 732 642 122 105 11640 11704 --
NM_177952chr141681 ------
NM_178151chrX77204 6198 6132 3108 2826 566 236 27101 6139 ----
NM_178152chrX77204 6198 6132 3108 2826 566 236 27101 6139 ----
NM_178153chrX77204 6198 6132 3108 2826 566 236 27101 6139 ----
NM_178450chr53482 63 41 ------
NM_178818chr1632287 2077 121 ----11662
NM_181458chr21105 ------
NM_181481chr1852757 2241 724 245 226 1423 ----
NM_181482chr1852757 2241 724 245 226 1423 ----
NM_181483chr1852757 2241 724 245 226 1423 ----
NM_181486chr121481 ------
NM_181521chr1697068 6858 4902 2586 1599 1115 693 676 204 --22501 1587 26443 529
NM_181659chr2032945 2304 1314 23389 1335 --11147
NM_181659chr2032945 2304 1314 23389 1335 --11147
NM_181716chr17141 ------
NM_181746chr11760 ----191
NM_181828chr2243514 2611 1306 890 1666 31154 691 161 13808
NM_181829chr2243514 2611 1306 890 1666 31154 691 161 13808
NM_181830chr2243514 2611 1306 890 1666 31154 691 161 13808
NM_181833chr2243454 2551 1246 830 1606 31094 631 101 13748
NM_182314chrX11192 ------
NM_182488chr131333 ------
NM_182620chr17198 ------
NM_182943chr31993 ------
NM_182970chr2084243 3365 3230 2607 1361 1185 829 636 22773 117 34158 3529 981 13196
NM_183057chr81230 ------
NM_183244chr201228 ------
NM_183246chr201228 ------
NM_194291chr831831 796 307 ------
NM_194356chr1212377 ------
NM_194358chr1241657 1456 688 152 --11428 --
NM_194359chr1241657 1456 688 152 --11428 --
NM_194454chr72614 136 ------
NM_194455chr72614 136 ------
NM_194456chr72614 136 ------
NM_197968chr132498 479 ------
NM_198204chr1711528 ------
NM_198205chr1711528 ------
NM_198225chr1011893 ------
NM_198446chr11176 ------
NM_198472chr101267 ------
NM_198490chr3103337 3289 3052 2883 2725 2675 2169 693 566 419 1788 127 --
NM_198560chr3123414 3303 2942 2910 2856 2838 2376 2313 1439 1316 940 913 21277 949 13191 1174
NM_198793chr363347 3169 1053 955 606 94 ------
NM_198963chr22358 95 ------
NM_198993chr1721707 510 ----3329 316 160
NM_199262chr1771950 1857 1765 1638 279 175 75 1528 2537 272 --
NM_199324chr413394 ------
NM_201266chr21275 ----155
NM_201279chr21275 ----155
NM_201521chr61312 ------
NM_201522chr61312 ------
NM_201523chr61312 ------
NM_201570chr102476 81 ------
NM_201571chr102476 81 ------
NM_201572chr102476 81 ------
NM_201590chr102476 81 ------
NM_201591chr411586 ------
NM_201592chr411586 ------
NM_201593chr102476 81 ------
NM_201596chr102476 81 ------
NM_201597chr102476 81 ------
NM_201624chr111264 ------
NM_203327chr2084405 4358 4300 4060 2775 1780 1240 624 13008 --13699
NM_203329chr1165876 2614 1911 1850 1658 863 46084 5725 1674 546 12724 14511
NM_203330chr1165876 2614 1911 1850 1658 863 46084 5725 1674 546 12724 14511
NM_203331chr1165876 2614 1911 1850 1658 863 46084 5725 1674 546 12724 14511
NM_203342chr152821 2442 1293 1220 264 23307 884 12841 --
NM_203343chr152821 2442 1293 1220 264 23307 884 12841 --
NM_203350chr121183 656 ------
NM_203499chr17184 ------
NM_203504chr421928 1897 ------
NM_203505chr421928 1897 ------
NM_206853chr631178 1093 508 ------
NM_206884chr7139 ------
NM_206885chr7139 ------
NM_207111chr752412 1790 1760 454 42 12240 12428 2858 802
NM_207116chr752412 1790 1760 454 42 12240 12428 2858 802
NM_207291chr192458 377 ------
NM_207337chr121971 ------
NM_207406chr446545 4928 1704 347 ------
NM_207660chr141263 ------
NM_207661chr141263 ------
NM_207662chr141263 ------
NM_212460chr72743 629 1238 ----
NM_212554chr1011491 ------
NM_213654chr3197 ------