TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-23b-5p
miRNA Sequence: UGGGUUCCUGGCAUGCUGAUUU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000118chr95779 722 345 317 76 1306 2801 133 3747 734 36
NM_000216chrX21351 93 1307 12860 1663
NM_000259chr1565413 5294 4574 4310 1641 402 26164 55 --14655
NM_000332chr636387 1523 997 --15418 1535
NM_000337chr555347 946 552 446 238 21580 1569 14458 1997
NM_000362chr2263488 2661 2231 604 444 168 12845 22701 265 --
NM_000555chrX96091 5791 5475 5270 5142 2152 1926 730 471 12260 13001 11802
NM_000609chr1062660 2320 2064 518 355 281 22403 1025 22816 24 140
NM_000612chr1142970 2629 2602 586 13029 22891 2326 33393 3088 740
NM_000635chr192423 378 --2302 61 2646 558
NM_000719chr12136587 5999 4997 4626 4089 2653 2299 2082 1361 466 331 143 131 34854 2595 1755 25654 5631 --
NM_000793chr142297 87 34001 467 71 --1426
NM_000827chr542058 1957 1866 1035 22181 1814 --32413 1759 1003
NM_000875chr15116327 6040 5963 5062 4501 2129 2107 1966 1608 790 248 --22012 1986 26076 2171
NM_000899chr1243052 1059 684 536 11659 --11424
NM_001001331chr382424 2402 2134 1926 575 420 188 40 12731 ----
NM_001001419chr554739 1724 1497 1195 817 --14854 --
NM_001001420chr554739 1724 1497 1195 817 --14854 --
NM_001001664chr242900 1169 1096 499 --11199 --
NM_001001669chr582720 2624 2439 2287 2229 2036 956 876 21925 235 2887 542 --
NM_001001938chr953047 1498 1410 1226 392 23689 3630 --13427
NM_001002860chr1454284 2862 1433 1212 740 ------
NM_001003407chr1054220 3884 1880 1389 633 14584 1540 --
NM_001003408chr1054220 3884 1880 1389 633 14584 1540 --
NM_001003652chr1877225 7079 2861 2440 2009 1779 151 37886 6589 5803 ----
NM_001003794chr363088 2547 2385 2373 1042 882 --12016 22628 2000
NM_001003800chr952973 1194 813 603 374 23181 968 13570 1664
NM_001003940chr1593570 3209 2616 1325 1142 781 657 299 169 13087 1991 21215 371
NM_001003942chr1593570 3209 2616 1325 1142 781 657 299 169 13087 1991 21215 371
NM_001003943chr1593574 3213 2620 1329 1146 785 661 303 173 13091 1995 21219 375
NM_001004304chr1283003 2456 2276 1003 250 166 97 41 22508 123 22813 2635 --
NM_001004317chr644206 2736 985 120 --1952 13596
NM_001004342chr1105591 5387 4231 2256 2091 1923 1829 1659 627 446 12354 32237 1964 1404 --
NM_001004419chr1254006 3689 1226 614 119 --21618 438 --
NM_001005375chrY21153 277 1714 11493 1595
NM_001005473chr546249 5923 2369 411 35575 4682 2589 ----
NM_001005502chr1285101 3860 1743 1487 1190 605 91 40 13788 21958 1206 14432
NM_001005609chrX163440 3397 3195 2672 2654 2405 2352 2328 1444 880 845 822 715 237 66 50 13548 43082 2732 2685 213 --
NM_001006115chr3112746 2618 2594 2558 2318 2233 2147 1860 1850 51 25 1540 12342 1156
NM_001006600chr51145 21735 102 11504 --
NM_001007023chr142297 87 34001 467 71 --1426
NM_001008392chr372682 2338 1289 580 522 184 58 --22895 42 --
NM_001008408chr785691 5324 4596 1640 654 240 168 81 ----14609
NM_001008701chr1942769 1959 991 262 22655 1172 31995 420 49 1254
NM_001009899chr375963 5793 5109 4792 4598 2196 323 11849 --16313
NM_001010891chr555747 5302 2721 476 123 ----34550 1283 874
NM_001011666chr775951 5611 4383 4038 1463 1165 273 --11300 --
NM_001012393chr1134642 3752 730 ----11382
NM_001013031chr1043194 2772 1076 964 --1732 13107
NM_001013717chr531102 474 228 2285 119 11362 --
NM_001017440chr787204 6688 6505 5557 3200 3042 2200 123 57628 6464 1300 694 140 1718 17942
NM_001018050chr2272969 899 719 507 359 258 23 --22629 1249 13358
NM_001018052chr2272969 899 719 507 359 258 23 --22629 1249 13358
NM_001018065chr955714 4870 1621 1225 43 24713 2305 14169 14327
NM_001018066chr955714 4870 1621 1225 43 24713 2305 14169 14327
NM_001018111chr763883 3708 3685 783 687 104 --21583 290 --
NM_001024401chr16102784 2655 2153 1946 945 892 369 223 82 24 12684 22288 377 11862
NM_001024647chr1267016 4964 4784 1514 567 28 66286 5337 2790 2289 2165 1533 16479 26430 1436
NM_001025076chr1045847 5618 4853 4154 34749 4549 687 ----
NM_001025077chr1077205 6976 6211 5512 4821 1023 964 36107 5907 2045 --11194
NM_001025252chr831096 899 440 --22865 651 --
NM_001025253chr831096 899 440 --22865 651 --
NM_001030007chr1653728 3712 3642 3596 2663 11394 32763 523 48 --
NM_001031695chr2264952 4919 3468 1884 761 365 1911 182 24157 538
NM_001031804chr1654254 4082 3868 1280 774 24238 3552 ----
NM_001033117chr384358 3849 3787 3594 1934 1854 1684 1121 1929 2765 185 --
NM_001034841chr1675552 5515 4912 4620 4151 1406 895 --21726 1654 --
NM_001037165chr7188756 7991 7202 6327 3516 3249 3011 2996 2941 2796 2784 2549 2526 1766 1438 1034 939 58 36020 3004 1322 16034 11589
NM_001039538chr242904 2738 2510 538 22804 2583 ----
NM_001039577chr194363 3592 3441 3225 3217 3007 2863 1251 936 --34343 4319 3621 11427
NM_001039693chr283608 3552 3433 858 783 440 332 178 22863 1351 1341 --
NM_001039762chr1052134 1969 1794 1772 91 142 ----
NM_001039840chrX55216 5199 4301 4239 2055 14405 --14039
NM_001040108chr1463008 2971 2759 2752 2741 947 ----12120
NM_001040152chr765035 4802 4469 4459 3309 680 ----21049 763
NM_001040441chr145379 4656 979 437 55318 5211 4308 3978 1834 ----
NM_001040450chr1542028 1926 897 24 12849 ----
NM_001040453chr1542028 1926 897 24 12849 ----
NM_001040712chr952997 2638 2479 852 217 13071 ----
NM_001042459chr3196 ----149
NM_001042494chr1543716 2736 777 127 ------
NM_001042495chr1543716 2736 777 127 ------
NM_001042496chr1543716 2736 777 127 ------
NM_001042497chr1543716 2736 777 127 ------
NM_001042537chrX21985 575 --11675 22189 417
NM_001042599chr276537 5468 5422 1809 1121 422 203 1527 11244 11017
NM_001042603chr1275273 5111 5012 4496 1894 727 615 24676 710 ----
NM_001044385chr263348 3180 2579 1554 1493 1159 13384 ----
NM_001048183chr193415 3168 1371 1065 694 677 216 74 23 42566 2444 905 707 ----
NM_001083621chr173215 3200 3194 2911 1779 487 188 13313 --11104
NM_001099678chr335987 5627 1695 14938 15289 --
NM_001100108chr187842 7750 7059 6749 6666 2443 2255 919 56249 5639 5614 2814 2173 --11369
NM_001106chr3119663 8813 7002 6691 6659 6099 3825 3816 3650 3344 3140 --37437 1116 429 16672
NM_001128chr1653728 3712 3642 3596 2663 11394 32763 523 48 --
NM_001174chrX31440 324 305 --2473 440 11907
NM_001204chr267390 7171 6681 6124 4765 738 11122 ----
NM_001259chr786187 6110 5658 5616 4316 1962 1223 242 12144 ----
NM_001351chr321767 1123 2693 618 --1497
NM_001386chr842419 2296 1502 263 ------
NM_001390chr1873298 3284 1315 623 433 151 91 12304 13565 --
NM_001397chr162627 2574 2361 826 669 139 1146 42197 2043 878 750 11628
NM_001399chrX163440 3397 3195 2672 2654 2405 2352 2328 1444 880 845 822 715 237 66 50 13548 43082 2732 2685 213 --
NM_001440chr862130 2106 1936 1739 699 479 --32060 1717 190 22006 1069
NM_001460chr132613 1043 36 ----11029
NM_001683chr382424 2402 2134 1926 575 420 188 40 12731 ----
NM_001874chr1285101 3860 1743 1487 1190 605 91 40 13788 21958 1206 14432
NM_001949chr64927 631 471 53 ------
NM_001987chr1233370 341 257 11364 53680 3516 3229 156 45 13085
NM_002025chrX68616 5741 2490 1355 1340 404 38858 5806 1874 25620 77 --
NM_002035chr1823770 1214 33337 2803 555 --167
NM_002205chr122777 203 --1811 3862 657 241
NM_002214chr785552 4524 4283 3907 2169 2010 1886 1489 14218 13491 --
NM_002221chr182897 2842 2297 2286 1933 659 522 307 22686 445 2322 293 --
NM_002313chr1054220 3884 1880 1389 633 14584 1540 --
NM_002374chr242904 2738 2510 538 22804 2583 ----
NM_002384chr182911 725 ----3143 123 103
NM_002522chr17113844 3469 3460 3423 3348 3316 3198 1319 1199 1009 23 --1216 --
NM_002545chr1134642 3752 730 ----11382
NM_002577chr353473 3183 1124 831 190 ------
NM_002581chr983493 2264 1905 1576 1269 1164 827 613 144 11081 --
NM_002613chr1673852 3640 1111 1000 853 508 412 23976 805 2478 459 1277
NM_002645chr1122939 2423 12678 --12702
NM_002655chr841614 1039 932 173 11226 --14792
NM_002657chr20133685 3628 3432 2838 2808 2781 1575 1130 307 270 193 185 46 22749 675 23425 1503 11496
NM_002737chr1766083 6040 5646 4899 1411 64 --35793 2603 360 1428
NM_002833chr15--11017 21414 308 11077
NM_002839chr952997 2638 2479 852 217 13071 ----
NM_002886chr354273 4240 3800 3498 1163 11785 34145 3581 127 --
NM_002959chr161172 1047 928 783 323 39 23673 22 2943 179 33235 2844 105
NM_003028chr9103808 3689 2890 2621 2565 1269 1245 956 619 437 --22475 417 --
NM_003034chr1267301 7222 6576 713 414 329 36647 2252 1197 15900 --
NM_003045chr1394702 4059 3904 1385 1252 936 747 589 353 23737 1776 24299 4258 --
NM_003048chr221983 638 ----185
NM_003099chr15104902 4241 4056 1816 1232 1040 980 444 317 75 45908 4635 4511 23 35329 5282 5067 --
NM_003108chr2116886 6036 5588 2931 2865 2806 2550 1584 597 495 430 ----12345
NM_003188chr6--1569 --1686
NM_003202chr561597 408 370 251 199 91 11770 1445 11246
NM_003247chr621986 633 ----1193
NM_003339chr511120 197 147 1396
NM_003392chr361035 916 207 152 122 38 14199 ----
NM_003404chr2081821 1404 1353 759 695 610 447 309 ------
NM_003466chr22330 81 12326 12233 22419 922
NM_003468chr242892 2883 918 158 14033 23277 235 --
NM_003488chr172872 174 ----1729
NM_003583chr1223545 1220 --13377 12901
NM_003607chr124235 583 21349 890 --23833 3348
NM_003626chr112122 90 21058 58 --182
NM_003644chr17115986 5507 5484 5217 5176 5092 2051 1217 634 482 282 26087 4592 --24696 1451
NM_003743chr211963 ----1655
NM_003758chr1531260 631 171 ----1208
NM_003758chr1531260 631 171 ----1208
NM_003759chr43498 91 50 --23551 342 12628
NM_003822chr133141 2518 370 23048 280 ----
NM_003885chr1741980 1656 439 157 22087 175 21842 635 1248
NM_003913chr634209 3830 3782 --23147 3075 --
NM_003958chr673681 3503 3390 3288 3213 2803 2741 13309 ----
NM_003966chr576669 5977 5696 4900 2495 2283 1567 16180 27752 5451 --
NM_003983chr16114243 3988 3927 3905 3636 3221 1531 1183 933 712 98 13960 24138 3605 13500
NM_003994chr1243052 1059 684 536 11659 --11424
NM_004081chrY21153 277 1714 11493 1595
NM_004090chr1753189 660 429 416 383 ----12703
NM_004113chr32581 263 21356 380 ----
NM_004171chr11158645 8447 8296 7916 6291 5919 3674 3212 3127 2475 1560 1312 634 603 256 69623 7212 7030 6437 2713 1637 19076 --
NM_004296chr1464005 3281 3156 2990 1065 40 44053 1372 1335 877 23619 2971 --
NM_004302chr12132447 2420 2372 2215 2113 2075 882 790 526 397 350 316 141 1244 32016 966 117 --
NM_004380chr1652274 2044 1976 504 94 11837 11992 --
NM_004397chr1174095 3990 3589 3309 827 512 106 1623 14338 14127
NM_004412chr1055835 5824 4643 4624 1432 11693 ----
NM_004437chr163232 2873 2867 2736 1105 604 13501 33071 2750 1060 --
NM_004501chr153483 3340 1574 613 205 12841 ----
NM_004525chr231293 993 371 ----1437
NM_004588chr11113357 3212 3118 2931 2883 2682 1440 1317 938 134 106 --11032 1748
NM_004673chr121533 978 ----1150
NM_004726chrX45287 5264 1253 370 33687 928 71 14848 11139
NM_004744chr423221 136 11138 --13417
NM_004745chr886123 5777 5098 4789 2108 1936 1701 647 45223 5062 4615 671 14635 1326
NM_004776chr2083101 2880 1282 1275 1134 393 368 190 1319 11103 1728
NM_004845chrX84094 3805 1578 750 660 623 151 128 21532 1239 13424 --
NM_004857chr1444178 3987 860 836 24395 3315 ----
NM_004862chr1631249 1229 25 --11126 11433
NM_004863chr1423561 78 34861 4508 1719 2488 29 --
NM_004904chr775951 5611 4383 4038 1463 1165 273 --11300 --
NM_004956chr72848 822 --23973 1327 --
NM_004976chr1151814 1035 270 106 80 14753 44509 4388 674 168 13421
NM_004992chrX128512 7533 6913 6440 2794 2662 2615 2316 1774 1754 1413 1359 26390 5948 26098 6066 17353
NM_004992chrX128512 7533 6913 6440 2794 2662 2615 2316 1774 1754 1413 1359 26390 5948 26098 6066 17353
NM_005056chr1275517 5355 5256 4740 2138 971 859 24920 954 ----
NM_005065chr1465227 3703 1913 1457 855 511 ------
NM_005076chr1104134 3603 2949 2870 1359 664 616 609 524 482 23549 184 1350 --
NM_005079chr831096 899 440 --22865 651 --
NM_005116chr2053980 3853 3128 1816 649 34039 3879 3667 --11185
NM_005135chr1543716 2736 777 127 ------
NM_005197chr1496043 2476 2423 1911 1669 1613 631 335 182 25441 225 34520 1048 506 --
NM_005202chr162259 2244 1890 505 438 75 ----11883
NM_005235chr276537 5468 5422 1809 1121 422 203 1527 11244 11017
NM_005338chr783991 3936 3645 3235 3210 1629 1249 901 22828 189 ----
NM_005339chr453243 2786 2737 1370 796 22700 870 14051 --
NM_005358chr1341429 1407 1247 1207 1274 ----
NM_005359chr1886532 6519 6020 4029 2470 2299 665 272 26292 4471 ----
NM_005397chr763883 3708 3685 783 687 104 --21583 290 --
NM_005402chr71139 ----11516
NM_005440chr1783221 3036 2118 1148 1138 894 639 503 --12523 --
NM_005497chr1756033 5328 4609 3786 904 25670 4734 22014 878 --
NM_005502chr931109 1084 42 1302 --1279
NM_005569chr2261502 1418 647 400 388 280 1295 21209 306 --
NM_005596chr956073 4065 909 490 85 36293 2225 1153 14986 --
NM_005779chr552614 2278 1415 595 578 12357 ----
NM_005808chr372682 2338 1289 580 522 184 58 --22895 42 --
NM_005840chrX137572 5661 5641 5340 4837 2970 2681 2577 2131 2026 1747 1408 1164 36808 1845 1652 17328 --
NM_005901chr1877225 7079 2861 2440 2009 1779 151 37886 6589 5803 ----
NM_005903chr554739 1724 1497 1195 817 --14854 --
NM_005933chr1163044 2992 2701 885 652 295 11987 11201 32750 2650 2322
NM_005934chr1982490 1863 1679 1657 1038 837 317 218 --21944 190 11603
NM_005955chr1105199 5189 5100 4134 3543 2063 1827 1689 1483 173 ------
NM_006016chr63875 549 216 12046 ----
NM_006203chr585304 3880 3711 2128 2116 1850 1697 1308 --15080 --
NM_006212chr135445 3496 1799 14715 11292 --
NM_006251chr542866 2369 715 627 --13103 --
NM_006252chr187291 6996 6534 5063 5053 1959 1123 892 ----12028
NM_006258chr1011339 21553 204 11426 --
NM_006282chr2053256 1623 1552 536 528 23964 124 22925 1310 --
NM_006306chrX135644 5629 5427 5360 4876 4757 3815 3736 3580 1300 1218 1044 415 35662 4131 1602 --24771 1001
NM_006359chrX21985 575 --11675 22189 417
NM_006371chr364602 4533 3484 1516 1092 431 14287 24724 2014 13259
NM_006464chr273732 3509 3465 1538 1468 860 92 ------
NM_006482chr1223545 1220 --13377 12901
NM_006517chrX71752 1581 690 439 377 308 244 1319 31907 684 264 --
NM_006526chr202232 147 21522 571 1743 --
NM_006546chr1786090 4987 4953 4726 4284 4254 4022 2024 32547 1986 1971 31875 163 93 25266 1122
NM_006548chr33294 220 164 11505 --11088
NM_006561chr1045847 5618 4853 4154 34749 4549 687 ----
NM_006599chr1677720 7645 6361 6232 2955 1853 503 ------
NM_006628chr1553655 3259 1866 1460 1019 11499 ----
NM_006720chr1054220 3884 1880 1389 633 14584 1540 --
NM_006750chr1687832 5928 2710 2353 2309 2230 2168 781 35938 1676 1339 26848 5709 15778
NM_006754chr7------11045
NM_006763chr141571 697 658 81 --1730 1819
NM_006827chr1463291 2705 2350 2121 2109 871 12222 ----
NM_006912chr142363 1942 1689 771 --1705 --
NM_006927chr1662071 1965 1750 1413 647 142 --1535 21483 64
NM_006950chrX6918 695 607 354 262 221 297 58 4627 589 367 202 --
NM_006981chr942477 1984 1010 799 ----1360
NM_007011chr15104498 4474 2712 2392 2285 1637 1506 1096 682 473 35584 5372 483 11718 26019 5680
NM_007030chr594626 3231 2037 2006 1975 1913 1882 1806 1040 21097 99 23384 386 --
NM_007078chr1052727 2717 623 191 120 1275 1593 12900
NM_007107chr362304 1578 872 805 745 425 11697 ----
NM_007146chr1762545 2266 1771 851 373 346 1300 ----
NM_007249chr13137041 6009 3701 3196 3061 2962 2751 2499 2312 1535 1297 877 72 37062 1471 1433 ----
NM_007283chr363088 2547 2385 2373 1042 882 --12016 22628 2000
NM_007347chr1522449 2117 33079 888 80 ----
NM_012137chr112049 22751 1143 1921 --
NM_012156chr2053220 2792 2589 2481 2119 --12111 12575
NM_012164chr952427 2127 1886 1873 1275 11132 36178 1754 779 --
NM_012192chr1192408 2378 2098 891 763 141 80 55 39 11815 ----
NM_012193chr1175334 4146 3870 3747 2131 1224 881 --45228 4494 4230 3897 --
NM_012214chr276154 5809 5230 5196 4687 4243 4220 34363 4334 1461 13975 --
NM_012249chr253333 2381 1271 1026 319 1961 ----
NM_012287chr333831 1454 976 ----1186
NM_012288chr665330 3568 3522 1669 1661 676 21558 838 23513 26 35572 5021 61
NM_012296chr1163544 3012 2591 1512 804 153 123 21018 146 1635
NM_012306chr1283038 2888 1344 761 561 359 352 187 --22690 178 13457
NM_012308chr1152477 1935 1919 729 133 11003 22392 993 22258 1581
NM_012309chr1164950 4750 4465 3794 1383 814 34382 1264 1237 24643 1194 --
NM_012316chr165383 5232 4466 3785 1347 921 35137 4814 4317 34573 3822 1367 1289
NM_012325chr201551 --2517 508 11599
NM_012333chr12553 97 21315 200 ----
NM_012471chrX31968 1571 1342 ----21521 31
NM_013230chrY51427 1119 573 461 152 1580 ----
NM_013236chr2231114 409 35 2983 974 ----
NM_013269chr1253933 3616 1153 541 46 --21545 365 --
NM_013279chr1151665 823 468 387 34 1354 41638 925 201 88 11775
NM_013382chr1452085 1956 1930 942 36 3892 581 131 2901 103 1161
NM_013423chrX3402 61 36 1223 --1869
NM_013427chrX3402 61 36 1223 --1869
NM_013951chr22330 81 12326 12233 22419 922
NM_013952chr231594 407 158 12403 12310 22496 999
NM_013953chr231594 407 158 12403 12310 22496 999
NM_013989chr142297 87 34001 467 71 --1426
NM_013992chr231594 407 158 12403 12310 22496 999
NM_014048chr1685001 4643 4536 4392 3421 1878 617 474 --11653 1151
NM_014155chr1177120 2533 1571 1471 1333 903 421 --25645 984 --
NM_014233chr1751801 1789 559 453 440 2851 37 21568 713 1172
NM_014253chrX22119 89 3526 322 241 --11917
NM_014309chr2264942 4909 3458 1874 751 355 1901 172 24147 528
NM_014331chr456391 3112 1758 1546 328 12058 --16997
NM_014345chr6--1901 --198
NM_014381chr1463008 2971 2759 2752 2741 947 ----12120
NM_014415chr3--150 --1652
NM_014504chr711324 11815 21345 163 11528
NM_014571chr132061 798 326 41864 987 821 369 2928 523 158
NM_014613chr542786 1145 1133 1047 12780 12640 1860
NM_014615chr1633063 1403 1345 31228 163 28 --13027
NM_014674chr333439 2988 2968 21341 320 43646 3522 2831 869 --
NM_014721chr626798 2419 2975 623 14783 --
NM_014730chr1295146 4840 4594 4469 4030 3341 1968 1245 1127 44899 3620 1539 324 ----
NM_014730chr1295146 4840 4594 4469 4030 3341 1968 1245 1127 44899 3620 1539 324 ----
NM_014747chr1135538 5375 5093 4809 4460 4387 4209 3950 1982 1863 1398 572 95 --55102 3625 1423 715 557 --
NM_014755chr211406 1245 --24183 1194
NM_014787chr172733 2602 2047 1086 565 270 215 ------
NM_014826chr124235 583 21349 890 --23833 3348
NM_014828chr1432293 2220 852 12520 1604 --
NM_014830chr1253161 1017 999 814 656 1354 12926 12816
NM_014839chr11122 22153 200 --1366
NM_014850chr384358 3849 3787 3594 1934 1854 1684 1121 1929 2765 185 --
NM_014870chr173215 3200 3194 2911 1779 487 188 13313 --11104
NM_014877chr1745761 5372 5313 2600 25282 1432 11418 --
NM_014890chr3196 ----149
NM_014921chr1942769 1959 991 262 22655 1172 31995 420 49 1254
NM_014924chr1442622 2544 2084 990 22489 657 ----
NM_014935chr1123864 3769 3711 3452 3122 2524 2511 871 450 310 223 144 33229 941 525 ----
NM_014938chr1241913 873 346 219 22279 1802 2957 205 --
NM_014948chr2042383 2174 949 264 3690 256 249 12345 12135
NM_014952chr1561877 1728 1469 462 355 211 11399 11296 11762
NM_014962chr2042598 622 402 254 ------
NM_015020chr1673251 2521 2473 2404 451 445 328 ------
NM_015025chr242628 2554 1785 1054 --22027 1806 --
NM_015033chr952814 2773 2498 2189 44 --22612 907 1787
NM_015035chr20156484 5797 5700 5468 5081 5062 4436 2235 1790 1643 1618 1270 968 655 136 24525 2676 1528 35856 4776 2501
NM_015042chr1573908 3891 2889 1688 1609 797 531 13744 31696 977 399 --
NM_015044chr1672568 1247 1145 1072 644 463 451 32377 2269 2089 11302 12847
NM_015045chr1032011 1747 1572 12135 --1589
NM_015049chr232536 632 161 1374 12416 1643
NM_015055chr1122656 686 22954 2114 12028 --
NM_015071chr554227 4187 2622 1610 894 46316 5231 3960 2558 21550 672 12483
NM_015077chr1784067 3695 3539 905 864 706 446 224 14737 44376 3469 3396 2969 --
NM_015079chr1563229 2607 2443 2258 2188 652 --12484 11293
NM_015094chr22234436 4293 4146 4091 4074 4023 4012 3974 3949 3924 3589 3515 3461 3216 3125 2974 1495 1438 1412 1262 829 567 298 --22861 1348 24351 50
NM_015101chr132394 2276 478 ----21953 896
NM_015156chr1453333 2885 2696 303 276 --1295 --
NM_015178chr882468 2373 2345 288 259 195 175 94 2531 119 12037 22485 2316
NM_015194chr1751664 1650 1516 569 391 21380 488 51542 822 407 122 28 1452
NM_015215chr162929 2669 912 904 754 368 13102 --1249
NM_015216chr52135 22 ----11552
NM_015225chr952674 2635 2523 2512 703 1783 ----
NM_015226chr16103449 3366 3045 2482 2440 1263 957 947 292 215 21207 308 22834 50 --
NM_015227chr2163266 3029 2380 1403 1269 128 22224 876 23076 2570 1864
NM_015299chr1443882 3042 3026 2694 --13826 23261 1488
NM_015310chr897106 6851 6459 6294 2786 2107 1145 577 515 11955 17150 17592
NM_015313chr1174035 3955 3716 2973 1903 1589 1437 --1744 --
NM_015326chr162817 2523 2353 1846 1165 407 22933 648 ----
NM_015328chr772852 2575 2300 1117 295 158 41 1569 --1764
NM_015329chr1972971 2686 2052 1858 1027 449 192 12226 1587 3889 606 598
NM_015335chr1232383 2296 437 --164 --
NM_015359chr851849 1021 539 339 317 1407 1254 --
NM_015361chr2----1886 1196
NM_015509chr1211497 ----21523 85
NM_015526chr1941369 1329 1198 940 --51288 1215 974 956 64 --
NM_015557chr1123292 2965 2923 1452 1419 1295 1032 874 615 582 396 111 32476 1162 193 21276 507 13314
NM_015844chr182911 725 ----3143 123 103
NM_015846chr182911 725 ----3143 123 103
NM_015847chr182911 725 ----3143 123 103
NM_015879chr1868442 7564 7437 7281 5293 78 17522 36053 1026 557 25706 1301
NM_015995chr15115328 5248 3458 2167 2150 2017 1977 1687 1400 843 241 25276 1795 34860 4468 695 13898
NM_016206chr348121 7763 2395 905 37977 2548 2473 12413 13256
NM_016260chr277545 5354 2488 2427 1596 1396 1213 26561 1966 124 --
NM_016422chr1182867 2801 2420 2185 1948 593 482 346 22455 1144 ----
NM_016577chr363625 1561 1345 684 378 86 12892 ----
NM_016733chr2261502 1418 647 400 388 280 1295 21209 306 --
NM_016952chr1172762 2691 2670 2663 1152 967 648 12677 13594 --
NM_016953chr275301 4545 4458 4020 1316 463 219 14881 35204 3992 2280 --
NM_017563chr356261 5894 2210 1812 1642 11961 14236 1465
NM_017575chr1771442 1318 1296 441 175 158 34 21341 541 1208 11009
NM_017599chr122524 131 --12116 11337
NM_017633chr623145 1236 --1490 11403
NM_017643chr1742086 639 489 397 ------
NM_017658chr1423619 1515 --11305 --
NM_017709chr173773 3069 3000 1158 384 196 66 13591 134 1107
NM_017801chr342320 2313 2200 59 12468 --12228
NM_017811chr962770 2537 2265 2026 1962 68 22581 272 32888 2122 393 --
NM_017813chr875284 5094 4383 3951 3689 2163 1232 --11898 --
NM_017848chrX52829 1529 1332 793 288 --33527 3058 1485 --
NM_017849chr23654 573 310 --22498 1064 41995 1107 989 635
NM_018184chr331762 703 668 ----1562
NM_018231chr162852 246 1329 --2289 51
NM_018246chr852395 2152 1770 946 868 ------
NM_018247chr663149 3084 2224 1944 1908 1266 --22034 704 --
NM_018340chr1665053 4067 3981 3844 3766 539 ----11732
NM_018373chr1486272 6179 6071 5818 1771 1217 1169 1099 14321 14122 14971
NM_018383chr23786 127 107 --1136 --
NM_018403chr363671 3546 2950 1023 96 31 12823 13439 --
NM_018440chr8138506 7472 7352 7261 7174 6743 6342 5903 2665 2583 1691 1553 615 1853 ----
NM_018482chr841782 760 301 199 --22450 2303 --
NM_018695chr51145 21735 102 11504 --
NM_018698chrX11920 1280 --11626
NM_018976chr1242764 1896 756 362 ------
NM_019094chr1233526 2851 1130 12941 --12410
NM_019555chr321607 189 ----1438
NM_020122chr2115980 5755 5427 4897 4601 4448 3966 3692 1395 720 582 15732 14335 15094
NM_020338chr1082784 2673 2629 2523 1447 446 286 78 11151 23131 131 1213
NM_020348chr1072660 2040 1812 812 800 377 190 159 2680 315 --
NM_020420chrY21153 277 1714 11493 1595
NM_020431chr1492719 2520 2243 2166 1057 1007 310 213 185 --1271 --
NM_020440chr153119 2804 2610 1139 695 1599 --11052
NM_020443chr1116230 5514 4954 4887 2567 1887 1829 1812 1738 630 211 11316 --21104 509
NM_020452chr171793 1688 860 272 260 243 80 --31783 1501 1460 1328
NM_020456chr1352122 1978 1447 885 128 12006 ----
NM_020466chr653390 1605 1299 1196 684 44370 1818 1275 501 ----
NM_020717chrX74884 4382 4247 1688 1319 584 386 21074 987 11274 --
NM_020718chr1676220 5389 4957 1521 1280 310 54 11210 ----
NM_020772chr1777536 7325 6610 5831 2714 210 104 28246 6282 --1460
NM_020796chr552455 2420 2304 2244 2065 1261 --12400
NM_020856chr1941457 508 323 231 ------
NM_020940chr1041918 910 814 257 32431 238 143 11104 --
NM_021032chr32581 263 21356 380 ----
NM_021079chr1772976 2473 2275 921 533 438 98 1414 22423 60 --
NM_021116chr7269081 8443 8423 8326 8293 8143 7928 7094 6445 6396 6086 5801 3358 3265 3223 2914 2788 2678 2596 2492 2482 2232 1551 1400 461 109 22276 2026 --28175 3061
NM_021202chr2062896 2771 2388 2007 688 26 42139 1885 494 180 32722 2534 486 --
NM_021942chr4173 ----1148
NM_022048chr15105542 5452 4724 4548 4400 4299 4142 1319 1296 487 ------
NM_022166chr16125593 4821 4229 4217 3959 2500 1869 1860 1280 1024 909 74 1501 ----
NM_022456chr1267016 4964 4784 1514 567 28 66286 5337 2790 2289 2165 1533 16479 26430 1436
NM_022648chr243985 3949 3196 66 184 13844 31221 356 59
NM_022719chr2283460 3027 2633 2589 2499 1335 1123 300 23534 2970 42737 888 512 439 --
NM_022745chr122684 154 42183 1096 373 57 --176
NM_022917chr941058 264 247 98 1271 --1461
NM_023923chr193415 3168 1371 1065 694 677 216 74 23 42566 2444 905 707 ----
NM_024007chr562708 2603 1958 1144 112 84 13085 ----
NM_024086chr1773363 2947 2813 1297 828 570 519 --23701 75 12919
NM_024095chr1251473 1454 1011 609 384 1489 11228 --
NM_024345chr963819 1957 1742 1437 961 251 --127 --
NM_024423chr1824104 1712 12639 --21051 176
NM_024596chr8115374 5303 5148 4260 2122 1775 1657 1426 611 529 93 55333 4044 3299 1126 154 ----
NM_024607chr854155 3908 3776 289 100 11783 11152 --
NM_024646chr163977 2934 2660 591 526 305 12433 137 --
NM_024674chr163088 2881 2632 2622 394 239 --22305 180 --
NM_024738chr1261806 1701 1358 313 301 53 --1193 168
NM_024740chr1163603 3330 1421 626 582 123 ----11266
NM_024770chr265542 5305 4405 2491 2116 1789 25299 2530 --16259
NM_024785chr24582 329 162 153 5959 429 207 147 53 1217 --
NM_024786chr54906 181 174 129 2191 137 --1697
NM_024817chr15115397 5177 5109 4757 4326 4210 4100 4009 1487 1396 1092 --21862 1812 35718 4587 3903
NM_024909chr651538 1383 609 202 24 2644 75 51302 1167 653 595 211 --
NM_024947chr378272 7649 7521 6966 6949 6859 327 15865 ----
NM_024963chr7114794 4280 3966 3781 3604 2368 1974 1118 665 347 53 65217 5079 3774 3752 1279 582 35458 1997 70 24947 2038
NM_024989chr246341 5966 3149 1090 --17851 25982 200
NM_025138chr132496 314 ----1466
NM_025160chr144265 1258 1061 732 21621 282 ----
NM_025179chr174738 4114 3378 3132 699 235 34 --23407 1780 14680
NM_025191chr152640 1103 783 687 153 ----1834
NM_025195chr851172 745 588 578 124 1435 1227 11263
NM_030576chr17112576 2562 2240 2114 2024 958 575 524 270 131 43 ----11957
NM_030621chr1443118 2783 2604 187 13330 --13406
NM_030647chr775348 5322 3923 795 220 135 58 12431 ----
NM_030648chr444501 3388 1855 1313 13747 14044 1539
NM_030650chr224184 3352 --13502 11465
NM_030651chr63649 599 250 174 1190 2743 175
NM_030674chr1274663 3962 3934 3741 3651 2184 604 14006 25465 5148 1831
NM_030806chr1139240 9009 9000 8866 8854 8231 8025 7314 5746 3719 2978 836 718 36551 3222 365 38587 6567 2210 16639
NM_030817chr1283500 3127 2578 1023 975 530 464 102 2520 473 --13022
NM_030964chr5103228 3137 2973 2676 2538 2338 1349 674 654 592 ----12717
NM_031268chr1673852 3640 1111 1000 853 508 412 23976 805 2478 459 1277
NM_031427chr1475327 5038 4583 4335 1725 1483 505 ----12356
NM_031468chr787204 6688 6505 5557 3200 3042 2200 123 57628 6464 1300 694 140 1718 17942
NM_031844chr153483 3340 1574 613 205 12841 ----
NM_031845chr242904 2738 2510 538 22804 2583 ----
NM_031847chr242904 2738 2510 538 22804 2583 ----
NM_032289chr541373 700 694 243 --2673 403 1537
NM_032373chr1024508 33 14093 --14326
NM_032446chr552776 2679 1034 435 292 12760 133 --
NM_032510chr1852173 1885 1742 1583 689 ------
NM_032581chr731644 436 37 --21814 104 --
NM_032873chr1143614 3423 1664 1086 --1468 --
NM_032932chr17166304 5840 5707 5499 5025 5018 4943 4080 4003 2122 2098 1998 1633 1002 42 35 15669 --14822
NM_032975chr1873298 3284 1315 623 433 151 91 12304 13565 --
NM_032980chr1873298 3284 1315 623 433 151 91 12304 13565 --
NM_032982chr762557 1858 1774 1650 989 117 ------
NM_033055chr14905 156 140 130 ------
NM_033211chr531790 1712 823 --11488 --
NM_033224chr768002 7213 6815 1349 756 206 15277 2673 502 --
NM_033274chr543357 3250 2869 1250 23384 57 2125 71 11091
NM_033290chrX53621 3007 1383 771 678 32730 2587 475 11284 --
NM_033387chr982679 2458 2305 2266 2258 2153 1779 636 2955 922 --11661
NM_033449chr561526 1503 416 403 214 103 11975 11580 1171
NM_033503chr1593570 3209 2616 1325 1142 781 657 299 169 13087 1991 21215 371
NM_033505chr296439 6210 5747 5529 5214 4975 2281 875 392 15078 --15849
NM_033516chr951400 1326 193 152 141 2336 286 11226 --
NM_052845chr12103236 2885 2848 2811 2275 1073 655 433 390 334 23247 988 ----
NM_052880chr2271314 1298 1250 1062 305 128 73 11123 1479 124
NM_052906chr22164930 4886 4878 4799 4487 4473 4340 4296 4164 4140 3595 851 782 710 638 32 --33667 1868 616 --
NM_052918chr1043393 2971 1275 1163 --1931 13306
NM_053016chr997837 6520 6469 5652 4968 3192 2367 2305 715 46793 6650 627 335 17449 --
NM_053043chr785691 5324 4596 1640 654 240 168 81 ----14609
NM_057175chr452188 2113 1805 887 678 ------
NM_080491chr1163544 3012 2591 1512 804 153 123 21018 146 1635
NM_080792chr2062162 1881 631 291 250 60 22141 720 --2541 123
NM_080836chr2084428 4408 3155 1578 1261 783 718 486 24392 1445 23816 564 2753 56
NM_080872chr833836 3747 781 22675 1487 11145 1227
NM_130391chr952997 2638 2479 852 217 13071 ----
NM_130392chr952997 2638 2479 852 217 13071 ----
NM_130393chr952997 2638 2479 852 217 13071 ----
NM_130438chr2153164 2262 2158 1217 1117 11232 ----
NM_130807chr19152267 2127 2111 2100 2086 1867 1799 1675 1619 729 681 495 353 226 73 1589 32072 843 379 --
NM_130830chr383959 3316 2750 2708 2571 1499 1387 1112 ----13593
NM_133264chr1743238 3169 740 730 13277 23387 750 --
NM_133445chr943055 2531 1043 48 11307 --23122 2316
NM_133478chr221979 1616 1930 --22193 97
NM_133499chrX6988 765 677 332 291 89 2167 128 3697 659 272 --
NM_133647chr1543716 2736 777 127 ------
NM_138338chr2272969 899 719 507 359 258 23 --22629 1249 13358
NM_138444chr1363600 3046 1325 579 377 169 21510 230 21482 239 --
NM_138459chr653296 2963 2721 293 49 ------
NM_138479chr131324 341 229 2816 459 31627 1563 705 1783
NM_138713chr1677720 7645 6361 6232 2955 1853 503 ------
NM_138714chr1677720 7645 6361 6232 2955 1853 503 ------
NM_138959chr1106417 5750 4659 4532 2453 1812 1756 1347 972 298 --46063 1390 1362 882 21738 1235
NM_139323chr2081821 1404 1353 759 695 610 447 309 ------
NM_144571chr476874 4938 2786 1814 1223 666 186 ----12337
NM_144590chr1042904 2674 2338 1167 32562 1855 331 ----
NM_144973chr12134952 4788 4573 4548 4421 3669 2053 1821 1631 1085 918 175 56 14995 ----
NM_145165chr1442776 2042 1006 311 52762 2687 2438 869 862 ----
NM_145279chr16721 541 525 104 88 78 --21330 69 --
NM_145307chr1063982 1388 1312 1222 982 632 23862 445 ----
NM_145331chr6--1569 --1686
NM_145332chr61160 1717 1657 1834
NM_145333chr61160 1717 1657 1834
NM_145912chr22104241 4199 4008 3012 1738 766 579 444 410 317 14308 11074 11419
NM_147202chr932192 1959 394 42136 2105 914 892 2483 264 12040
NM_147223chr212146 11543 177 2838 110
NM_147233chr211963 ----1655
NM_148955chr15104902 4241 4056 1816 1232 1040 980 444 317 75 45908 4635 4511 23 35329 5282 5067 --
NM_152253chr22114343 4008 3169 1575 1512 1126 1008 837 775 478 140 --64157 4128 3678 2915 757 110 --
NM_152263chr155952 4342 4332 4210 250 33683 1462 621 12356 23930 56
NM_152380chr12465 103 --11633 11540
NM_152388chr263348 3180 2579 1554 1493 1159 13384 ----
NM_152409chr5--11391 --11417
NM_152437chr121661 ----11528
NM_152622chr573522 1041 656 225 213 93 22 ------
NM_152624chr555074 4523 1630 1598 1416 32829 2819 597 16987 1744
NM_152756chr582632 1551 1491 1209 841 508 438 153 ------
NM_152793chr7103815 3753 3253 3235 3164 1245 1073 933 335 34 --13902 --
NM_152826chr15104902 4241 4056 1816 1232 1040 980 444 317 75 45908 4635 4511 23 35329 5282 5067 --
NM_152924chr15104498 4474 2712 2392 2285 1637 1506 1096 682 473 35584 5372 483 11718 26019 5680
NM_153029chr1694095 3287 2877 2679 1523 1450 1047 898 556 21444 1337 --1655
NM_153035chr173195 2600 835 613 586 452 155 ----12710
NM_153273chr3112746 2618 2594 2558 2318 2233 2147 1860 1850 51 25 1540 12342 1156
NM_153367chr1053855 1292 1272 427 381 1629 33573 1228 292 11376
NM_153456chr1376127 4334 4265 4000 1752 1028 520 26221 5593 15841 25878 337
NM_153620chr721822 114 21205 666 1313 --
NM_153810chr1034352 4040 803 --14240 14465
NM_170719chr132496 314 ----1466
NM_172071chr147177 7048 6178 5403 --15450 16628
NM_172375chr145286 217 202 164 131 ----2429 320
NM_173065chr193431 3132 2270 1446 1141 1082 600 507 27 12690 1529 --
NM_173156chr151549 724 596 364 241 --31680 1594 199 1407
NM_173198chr942477 1984 1010 799 ----1360
NM_173200chr942477 1984 1010 799 ----1360
NM_173214chr1677720 7645 6361 6232 2955 1853 503 ------
NM_173475chr1651787 1740 1117 664 233 ------
NM_173582chr1145548 5436 4462 73 35297 4714 1438 ----
NM_173595chr12135114 4994 4947 4763 4678 4195 4158 3887 3856 3743 3441 1132 984 11423 11744 11150
NM_173602chr1273360 3179 2958 2610 1161 923 442 33086 2658 906 ----
NM_173642chr178034 7018 6502 3478 2886 2084 992 28293 316 39005 6440 2542 --
NM_173681chr761930 661 403 357 202 73 32101 1962 1601 12013 1343
NM_173851chr843231 918 256 88 22703 347 11037 --
NM_174911chr841301 450 404 35 23198 559 11062 23498 3159
NM_175623chr1267016 4964 4784 1514 567 28 66286 5337 2790 2289 2165 1533 16479 26430 1436
NM_175624chr1277111 5059 4879 1609 662 123 111 66381 5432 2885 2384 2260 1628 26574 92 26525 1531
NM_175625chr1277111 5059 4879 1609 662 123 111 66381 5432 2885 2384 2260 1628 26574 92 26525 1531
NM_175733chr1142155 1438 698 169 31819 1634 1367 ----
NM_175736chr1276176 5762 5189 2593 1581 1233 1012 55094 2681 2023 1974 320 62696 2449 2222 1451 431 423 15739
NM_175900chr1691727 1448 1400 1101 702 631 586 237 52 1284 160 1435
NM_176081chr1055835 5824 4643 4624 1432 11693 ----
NM_176083chr1055835 5824 4643 4624 1432 11693 ----
NM_177438chr1443118 2783 2604 187 13330 --13406
NM_177538chr2106322 6010 3316 3291 2890 2051 1717 1001 345 74 47953 6712 2440 1270 --18194
NM_177996chr2053220 2792 2589 2481 2119 --12111 12575
NM_178013chr14102569 2194 2037 1911 1100 1013 815 734 654 209 ----22659 397
NM_178151chrX96091 5791 5475 5270 5142 2152 1926 730 471 12260 13001 11802
NM_178152chrX96091 5791 5475 5270 5142 2152 1926 730 471 12260 13001 11802
NM_178153chrX96091 5791 5475 5270 5142 2152 1926 730 471 12260 13001 11802
NM_178505chr1061177 1065 784 537 173 33 ------
NM_181443chr2042598 622 402 254 ------
NM_181489chr385938 5093 2144 1056 738 456 131 56 --25715 216 --
NM_181838chr511120 197 147 1396
NM_181844chr1761918 1418 1399 1303 1246 777 1792 2691 632 --
NM_182487chr964218 3979 3878 3542 3389 3383 1266 24059 3899 13913
NM_182511chr183956 945 307 144 2564 197 1412
NM_182607chrX11437 21134 142 --140
NM_182700chr731248 706 249 21509 1270 1265 --
NM_182715chr7------11045
NM_182830chr1432104 2064 285 1556 11983 --
NM_182898chr775951 5611 4383 4038 1463 1165 273 --11300 --
NM_182899chr775951 5611 4383 4038 1463 1165 273 --11300 --
NM_182970chr20174139 4057 3881 3875 3522 2856 2721 2700 2674 1421 995 913 807 734 649 510 488 34064 1046 375 54091 3644 1198 792 63 --
NM_183078chr673587 3409 3296 3194 3119 2709 2647 13215 ----
NM_194285chr1112907 ----13007
NM_194286chr1274983 2045 2005 898 447 326 184 46022 6011 1146 714 36106 4745 2455 11912
NM_198320chr1285101 3860 1743 1487 1190 605 91 40 13788 21958 1206 14432
NM_198581chr286631 5359 5270 5059 2843 2733 2662 1530 32370 1964 270 --11415
NM_198834chr1751997 1566 854 680 178 ----1607
NM_198836chr1751997 1566 854 680 178 ----1607
NM_198837chr1751997 1566 854 680 178 ----1607
NM_198838chr1751997 1566 854 680 178 ----1607
NM_198839chr1751997 1566 854 680 178 ----1607
NM_198900chr1276176 5762 5189 2593 1581 1233 1012 55094 2681 2023 1974 320 62696 2449 2222 1451 431 423 15739
NM_198956chr731248 706 249 21509 1270 1265 --
NM_198993chr1771408 1311 1145 1129 1112 601 145 --11268 21196 519
NM_199040chr1233526 2851 1130 12941 --12410
NM_199053chr4195 ----1170
NM_199262chr176791 645 531 443 418 54 22321 918 22119 1508 21846 1732
NM_199320chr442458 957 375 247 11868 12393 --
NM_199320chr442458 957 375 247 11868 12393 --
NM_199415chr2042383 2174 949 264 3690 256 249 12345 12135
NM_201403chr16721 541 525 104 88 78 --21330 69 --
NM_201432chr17115986 5507 5484 5217 5176 5092 2051 1217 634 482 282 26087 4592 --24696 1451
NM_201433chr17115986 5507 5484 5217 5176 5092 2051 1217 634 482 282 26087 4592 --24696 1451
NM_201568chr151549 724 596 364 241 --31680 1594 199 1407
NM_201569chr151549 724 596 364 241 --31680 1594 199 1407
NM_201632chr561597 408 370 251 199 91 11770 1445 11246
NM_201634chr561696 507 469 350 298 190 11869 1544 11345
NM_203327chr2053980 3853 3128 1816 649 34039 3879 3667 --11185
NM_203342chr163232 2873 2867 2736 1105 604 13501 33071 2750 1060 --
NM_203343chr163232 2873 2867 2736 1105 604 13501 33071 2750 1060 --
NM_205860chr133141 2518 370 23048 280 ----
NM_206907chr542866 2369 715 627 --13103 --
NM_206909chr897106 6851 6459 6294 2786 2107 1145 577 515 11955 17150 17592
NM_206914chr1231949 417 357 12178 2566 185 1161
NM_207306chr184383 4364 3700 3580 3368 3065 1846 1552 --23798 1584 14283
NM_207372chr1062226 2180 1823 1809 586 343 21701 54 --11688
NM_207406chr436103 4930 4457 25699 4148 25724 2103 --
NM_213648chr561597 408 370 251 199 91 11770 1445 11246