TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-24-1-5p
miRNA Sequence: UGCCUACUGAGCUGAUAUCAGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr5--11527 --1716
NM_000167chrX----11711 --
NM_000176chr513285 12883 ----
NM_000210chr212322 ------
NM_000245chr711455 ------
NM_000288chr6----1300 --
NM_000318chr822736 2252 ------
NM_000391chr11----11557 --
NM_000555chrX37580 6428 57 26238 2107 --17279
NM_000721chr1----1746 --
NM_000806chr5--11501 ----
NM_000818chr101178 ------
NM_000840chr71378 ------
NM_000921chr121471 ------
NM_000926chr1169084 6877 2126 1862 687 296 18202 28985 7608 29232 1799
NM_000945chr2----1369 --
NM_001001323chr12--12701 ----
NM_001003681chr22198 ------
NM_001006600chr51285 1456 1513 11710
NM_001007189chr5------1136
NM_001007257chr11395 ------
NM_001011885chr15--11482 ----
NM_001012977chrX21357 267 ------
NM_001014797chr10107382 6814 6784 6669 6101 6050 5919 5696 5097 2647 57190 7074 1844 1778 887 26691 2200 --
NM_001018074chr513285 12883 ----
NM_001018075chr513285 12883 ----
NM_001018076chr513285 12883 ----
NM_001018077chr513285 12883 ----
NM_001020825chr5--1358 ----
NM_001024094chr513285 12883 ----
NM_001025105chr5--11547 ----
NM_001031684chr221155 563 --11118 1535
NM_001031849chr3------1477
NM_001037164chr7----134 --
NM_001042493chr6--11421 ----
NM_001042506chrX1267 ------
NM_001204chr255254 2664 2476 2316 917 ----11001
NM_001430chr2--11472 ----
NM_001448chrX--1244 --11322
NM_001682chr12--12415 ----
NM_001892chr5--11547 ----
NM_002007chr11----1107 --
NM_002025chrX42871 2622 950 862 13018 18553 17825
NM_002063chrX1990 ------
NM_002214chr7--14412 15707 --
NM_002519chr11----128 --
NM_002581chr964376 4337 3849 3842 3743 3701 13804 21252 1036 13661
NM_002601chr2--1161 ----
NM_002787chr7------1610
NM_002956chr12----1199 --
NM_002968chr16--1764 ----
NM_002994chr41343 ------
NM_003081chr20----182 --
NM_003185chr201370 ------
NM_003253chr21------11387
NM_003286chr2011157 ------
NM_003295chr131180 ------
NM_003796chr191468 ------
NM_003829chr91237 ------
NM_003850chr131629 ------
NM_003913chr611524 ------
NM_003972chr10--11053 ----
NM_004050chr1442526 2446 365 161 3981 284 103 2452 153 12233
NM_004087chr311870 ------
NM_004157chr3----1789 --
NM_004342chr7------21808 451
NM_004505chr17------11543
NM_004660chrY11471 ------
NM_004768chr1----11121 11059
NM_004993chr1411042 1380 --11068
NM_005126chr331496 377 123 12216 --11847
NM_005188chr11107045 6327 6283 5504 2964 2286 1982 1245 989 755 ----11872
NM_005254chr15--1423 ----
NM_005277chr41536 --1592 11519
NM_005302chr71353 ------
NM_005458chr912207 ------
NM_005487chr22198 ------
NM_005504chr1225145 1030 16416 --1717
NM_005604chr611606 ----12131
NM_005738chr7----134 --
NM_005826chr1----1499 --
NM_005880chr16------11266
NM_005977chr13----1304 --
NM_006194chr14--11261 ----
NM_006206chr4----1755 --
NM_006251chr5--13281 ----
NM_006252chr135593 4912 2444 35932 5760 368 1399 --
NM_006292chr11----167 --
NM_006727chr5----1441 --
NM_006734chr611447 ------
NM_006854chr7----11700 --
NM_006930chr5------21558 595
NM_007010chr172323 179 11414 ----
NM_007038chr2125018 783 --31735 1382 483 26108 5692
NM_007358chr1--148 ----
NM_013261chr433594 3128 2548 ----13407
NM_013377chr121592 ------
NM_013960chr8----1502 --
NM_013995chrX12152 ----1662
NM_014106chr15----22957 977 1229
NM_014153chr161446 ----1144
NM_014250chr22198 ------
NM_014686chr1922344 484 ------
NM_014707chr71547 ------
NM_014828chr14----11717 --
NM_014841chr6----1993 --
NM_014892chr6--1195 ----
NM_014903chr12----12180 --
NM_014912chr10----1462 --
NM_014918chr151562 ------
NM_015132chr71449 ------
NM_015335chr12----1806 --
NM_015355chr1711670 ------
NM_015569chr154151 3799 1376 808 236 13182 1370 23178 110
NM_015576chr342590 2050 2038 2031 ----12858
NM_015589chr141154 ------
NM_015866chr11395 ------
NM_015878chr8----11572 --
NM_015955chr2----1147 --
NM_016078chr17--3977 955 244 ----
NM_016131chr2----1847 --
NM_016319chr121177 --1307 --
NM_016512chr8----1239 --
NM_016519chr41159 ------
NM_016654chr15--1423 ----
NM_017628chr423527 3424 14665 34871 4107 1935 --
NM_017693chr1311595 ------
NM_017925chr9--1757 11441 --
NM_018244chr201338 ------
NM_018313chr312380 ------
NM_018383chr2----1627 --
NM_018440chr848093 7588 3044 1719 11373 17842 12356
NM_018638chr1235298 4667 2096 ------
NM_018650chr121485 836 --1205 --
NM_018652chr151312 ------
NM_018695chr51285 1456 1513 11710
NM_019005chr7----150 --
NM_019024chr2----1130 --
NM_019053chr101687 ------
NM_019084chr1021011 897 1593 22386 1899 --
NM_020144chr7----1842 --
NM_020381chr6----11848 --
NM_020425chr6--11421 ----
NM_020760chr21780 ------
NM_020783chr18----11738 --
NM_020865chr3------1129
NM_020921chr141842 --163 --
NM_021116chr788041 7955 3496 2806 2301 2009 1326 513 48748 8015 1784 1316 ----
NM_021159chr4--1141 ----
NM_022144chrX--1125 ----
NM_022484chr7----1447 --
NM_022719chr2283302 2987 2849 1320 1213 1207 900 788 13800 22653 963 12713
NM_024411chr201366 ------
NM_024490chr15--1561 ----
NM_024613chr8----1158 --
NM_024896chr92776 470 ------
NM_024989chr248102 6446 2766 1189 --22640 399 --
NM_030660chr1411042 1380 --11068
NM_031372chr41440 --11585 --
NM_032189chr13----14835 11449
NM_032195chr21186 ------
NM_032379chr11----173 --
NM_032424chr1131005 998 119 1569 --11062
NM_032582chr17------11566
NM_032870chr61356 ------
NM_032943chr11----173 --
NM_032973chrY------1544
NM_033138chr7------21808 451
NM_033139chr7------21808 451
NM_033140chr7------21808 451
NM_033157chr7------21808 451
NM_053016chr937737 5993 1125 ----27473 5685
NM_130811chr20----182 --
NM_133474chr411072 11425 21534 1248 --
NM_134447chr191468 ------
NM_144571chr456567 6162 5941 1744 177 37020 4454 4399 --12571
NM_144636chr31544 ------
NM_144664chr11------1317
NM_144778chr131960 ------
NM_144967chrX1663 ----1803
NM_144992chr2--1539 ----
NM_145808chr7----12718 12685
NM_147128chr7----11379 --
NM_147175chrX--1177 ----
NM_148174chr8----11572 --
NM_152300chr172323 179 11414 ----
NM_152589chr121232 ------
NM_152890chr1----1849 --
NM_152994chr21245 ------
NM_153261chr16--11588 ----
NM_153498chr10--1318 ----
NM_172071chr187153 7037 5393 5090 2250 1575 1277 61 --1370 22648 1104
NM_173536chr4----1214 --
NM_173552chr31502 ------
NM_173829chr5----35102 4503 1736 --
NM_175069chr9----1941 --
NM_178151chrX37580 6428 57 26238 2107 --17279
NM_178152chrX37580 6428 57 26238 2107 --17279
NM_178153chrX37580 6428 57 26238 2107 --17279
NM_178175chrX----1166 --
NM_178566chr9--11875 ----
NM_178868chr3--166 ----
NM_181521chr1697062 7011 6933 6428 5674 5511 5198 4606 2003 --1158 15782
NM_181712chr1----11977 --
NM_182691chr7------21211 1000
NM_182692chr7------21211 1000
NM_182765chr1011726 ------
NM_183043chr13----1304 --
NM_183044chr13----1304 --
NM_194282chr412990 ------
NM_198240chr12----1199 --
NM_198567chr5----1127 --
NM_199000chr7----12165 --
NM_199487chr201338 ------
NM_201591chr41536 --1592 11519
NM_201592chr41536 --1592 11519
NM_203391chrX----11711 --
NM_203406chr5--1683 11964 12154
NM_206907chr5--13281 ----
NM_206927chr11----173 --
NM_206928chr11----173 --
NM_206929chr11----173 --
NM_206930chr11----173 --
NM_207304chr131847 ------
NM_207406chr445501 3976 733 341 ----25608 1612
NM_207422chrX1274 ------
NM_212460chr7----134 --