TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-24-3p
miRNA Sequence: UGGCUCAGUUCAGCAGGAACAG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr51434 11935 ----
NM_000046chr522872 757 12814 32200 1074 786 --
NM_000052chrX31287 1128 901 ------
NM_000084chrX36498 5534 1511 46258 6212 4385 2377 16473 --
NM_000109chrX42507 2330 1983 648 ------
NM_000112chr595103 4378 4281 4111 3445 3404 1892 1860 602 23915 2051 13832 13992
NM_000129chr611353 --11326 --
NM_000138chr1521926 1778 12655 --12236
NM_000139chr111899 --1761 --
NM_000141chr1021062 58 ------
NM_000161chr1431871 1604 178 11238 ----
NM_000168chr712097 12840 ----
NM_000183chr2----1168 --
NM_000189chr222309 458 1663 31478 614 172 --
NM_000192chr1221440 246 ------
NM_000202chrX32598 1534 471 13658 ----
NM_000212chr174888 507 449 322 --22138 248 22476 698
NM_000214chr201297 --21597 1548 --
NM_000222chr442001 586 482 135 ------
NM_000232chr443222 2699 1140 678 32568 1282 1091 --1468
NM_000240chrX2756 704 188 --12024
NM_000248chr352665 2617 1940 862 272 ------
NM_000254chr162802 2700 1118 1102 644 394 11056 ----
NM_000259chr1585119 4690 4586 1859 1046 622 376 338 15731 ----
NM_000262chr2221581 262 --2283 42 --
NM_000264chr911193 --33207 2082 1001 11013
NM_000280chr11177 ------
NM_000282chr131258 ------
NM_000286chr171645 ------
NM_000293chr164931 648 247 100 ------
NM_000297chr462048 1396 678 442 346 256 --1286 --
NM_000304chr172261 32 ------
NM_000310chr111091 11179 189 --
NM_000319chr122191 79 1859 1207 --
NM_000332chr636203 4551 473 --15476 --
NM_000334chr1742071 1983 842 828 11718 31977 278 29 --
NM_000340chr321017 75 ------
NM_000345chr41957 ------
NM_000346chr17------11466
NM_000362chr2242379 2334 2247 1337 --2684 46 --
NM_000368chr943284 856 352 97 23132 3120 1897 --
NM_000388chr341124 848 794 21 ------
NM_000408chr233136 2651 2131 ------
NM_000430chr1773419 2401 2316 1119 235 130 75 ------
NM_000435chr191852 ------
NM_000439chr542518 1621 623 164 ------
NM_000449chr11193 ----2497 135
NM_000460chr3--1352 ----
NM_000461chr354241 3385 1619 1033 699 23476 318 1921 --
NM_000462chr151365 --11421 11723
NM_000476chr9111373 1161 1089 556 542 477 426 369 147 102 74 1929 ----
NM_000489chrX43025 518 408 220 ----13374
NM_000493chr6--1131 ----
NM_000523chr221125 753 ------
NM_000555chrX56215 2832 2299 2280 1638 15204 24930 2569 26333 184
NM_000572chr12837 391 --1174 --
NM_000575chr22916 99 1869 1111 --
NM_000594chr6----1722 --
NM_000599chr263545 2860 2831 1753 1366 623 --33818 2939 2889 --
NM_000616chr12----11446 --
NM_000617chr121784 --22270 1441 --
NM_000618chr1225416 2488 15574 ----
NM_000618chr1225416 2488 15574 ----
NM_000621chr1351438 1381 880 214 40 11408 ----
NM_000719chr1256558 5039 4746 2081 696 14945 32652 2096 686 --
NM_000720chr31190 --1456 --
NM_000723chr171396 --21619 39 21516 1118
NM_000726chr231322 412 171 ------
NM_000756chr8------1338
NM_000782chr20159 ------
NM_000806chr511773 --1722 --
NM_000807chr4--1601 ----
NM_000813chr573598 2044 2034 1474 601 540 250 13765 ----
NM_000814chr1521584 43 43747 2845 625 506 12856 --
NM_000816chr5----142 --
NM_000824chr4--1813 ----
NM_000826chr42641 127 --12019 --
NM_000829chr1152149 2054 1898 767 172 ------
NM_000831chr1155982 5956 5920 5664 4805 4282 4251 2346 2091 1976 1781 957 503 90 39 34480 1523 125 25962 5903 26078 4110
NM_000832chr92268 220 --3595 212 115 1357
NM_000833chr1641274 1219 228 203 --11359 --
NM_000840chr7----1179 --
NM_000859chr5----11596 11096
NM_000868chrX21758 928 1531 ----
NM_000872chr101231 --2324 41 --
NM_000875chr1556752 4926 1528 900 237 14562 11879 --
NM_000883chr72495 81 --1446 --
NM_000883chr72495 81 --1446 --
NM_000891chr1733545 1301 1063 ----11152
NM_000899chr1223157 2808 12666 --14024
NM_000909chr411204 1411 ----
NM_000922chr112933 309 ------
NM_000926chr1189081 8587 7562 7333 7225 6002 3746 2749 --11133 --
NM_000935chr321050 942 1131 1191 --
NM_000944chr4148 --11563 --
NM_000945chr251505 1470 668 499 138 ------
NM_000950chrX13060 ------
NM_000956chr14--11006 ----
NM_000958chr51142 --11280 --
NM_000966chr1231072 248 123 --1416 --
NM_001001132chr212602 139 ------
NM_001001323chr1232532 636 71 --13146 --
NM_001001394chr21572 1604 ----
NM_001001395chr1232730 2644 451 ------
NM_001001419chr573774 1551 1521 1433 1300 1218 81 ------
NM_001001420chr573774 1551 1521 1433 1300 1218 81 ------
NM_001001433chr2072702 2480 2297 2087 1083 375 299 1648 12615 12896
NM_001001481chr82915 157 ----22493 2145
NM_001001484chr103952 365 200 ------
NM_001001664chr213667 32627 1319 820 13926 --
NM_001001890chr2144202 4160 3067 582 13679 2105 26 --
NM_001001933chr11603 ------
NM_001001936chr10192 ------
NM_001001974chr1012231 11469 ----
NM_001001995chrX------1583
NM_001002265chr103571 527 281 1177 ----
NM_001002266chr103571 527 281 1177 ----
NM_001002762chr101858 31990 504 40 12515 12874
NM_001002814chr862514 2484 1305 1267 595 473 23775 2460 --23010 289
NM_001002838chrX2710 297 ------
NM_001002860chr1483442 1600 1472 1183 1090 1034 915 609 31790 1522 1061 ----
NM_001002906chrY1485 ------
NM_001003407chr1064947 4796 4643 3541 1476 245 24571 153 11779 --
NM_001003408chr1064947 4796 4643 3541 1476 245 24571 153 11779 --
NM_001003652chr18108436 8373 8222 8164 7118 3418 2698 2681 1141 267 33283 1972 1214 26893 1356 15715
NM_001003674chr1866935 6502 4865 4651 1772 1741 26813 5418 161 --
NM_001003675chr1866935 6502 4865 4651 1772 1741 26813 5418 161 --
NM_001003679chr132173 1458 206 ------
NM_001003688chr42433 37 167 ----
NM_001003698chr63412 370 337 --11541 --
NM_001003699chr63412 370 337 --11541 --
NM_001003712chr1223788 3003 23732 203 ----
NM_001003789chr221837 1791 1445 --
NM_001003792chr31968 ------
NM_001003793chr31968 ------
NM_001003800chr973735 3484 3230 3000 2848 1151 378 --21407 602 1921
NM_001003810chr41173 ------
NM_001004051chrX2312 53 ------
NM_001004065chr953768 1527 1157 1006 342 33073 2811 1508 ----
NM_001004127chr1321019 860 1255 ----
NM_001004303chr11275 1292 ----
NM_001004303chr11275 1292 ----
NM_001004317chr631558 733 168 --1253 --
NM_001004323chr7------1136
NM_001004329chr1221159 265 1570 ----
NM_001004342chr156066 5395 4347 1642 1376 14093 25149 1037 --
NM_001004356chr421493 270 ------
NM_001004358chr421493 270 ------
NM_001004360chr2--1785 1407 --
NM_001004419chr1233796 613 300 --12798 --
NM_001005158chr3121 ------
NM_001005159chr3121 ------
NM_001005366chr122680 138 1717 ----
NM_001005375chrY1518 21439 673 ----
NM_001005386chr232405 2160 186 ------
NM_001005404chr1763688 3016 3003 737 688 648 1924 11194 --
NM_001005408chr17157 ------
NM_001005473chr545434 4689 1464 1349 14467 197 --
NM_001005474chr311480 11093 11038 --
NM_001005502chr1265100 3279 3206 2061 1511 629 13812 11047 --
NM_001005609chrX61473 1364 1105 922 896 641 ----13046
NM_001005732chr21--1415 1260 --
NM_001005743chr141541 ------
NM_001005744chr141541 ------
NM_001005745chr141541 ------
NM_001005746chr231322 412 171 ------
NM_001005747chr231322 412 171 ------
NM_001005845chr81543 1140 --1431
NM_001005861chr31686 ------
NM_001005909chr31234 ------
NM_001005910chr32100 68 ------
NM_001005911chr32100 68 ------
NM_001006600chr51701 ------
NM_001006605chr1160 1849 ----
NM_001006605chr1160 1849 ----
NM_001006610chr162791 282 2780 415 ----
NM_001006636chr2----1115 --
NM_001007024chr1754080 3681 3382 346 160 ------
NM_001007025chr1754080 3681 3382 346 160 ------
NM_001007072chr15----199 --
NM_001007102chr62261 178 ----1233
NM_001007226chr1741304 1223 327 239 11271 11153 --
NM_001007227chr1741304 1223 327 239 11271 11153 --
NM_001007228chr1741304 1223 327 239 11271 11153 --
NM_001007229chr1741304 1223 327 239 11271 11153 --
NM_001007230chr1741304 1223 327 239 11271 11153 --
NM_001007237chr142432 1843 1028 965 --21036 923 12163
NM_001007246chr2121729 638 11800 ----
NM_001007277chr1141110 340 124 47 ------
NM_001007466chr635009 4762 4221 13988 21636 400 --
NM_001007553chr1--1121 ----
NM_001007559chr1811742 11901 ----
NM_001008222chrX31076 905 242 --1402 --
NM_001008407chr72589 494 21539 1216 2190 145 --
NM_001008529chr171153 --21065 195 123
NM_001008536chr12753 170 ------
NM_001008541chr1022139 1608 1480 1394 31996 878 46
NM_001008541chr1022139 1608 1480 1394 31996 878 46
NM_001008564chr1351937 762 732 644 54 12160 ----
NM_001008738chr532450 2368 2329 22085 115 ----
NM_001008783chr61932 ------
NM_001008800chr1------160
NM_001008801chr1911843 11742 ----
NM_001008883chr1------160
NM_001008938chr111383 ------
NM_001009554chr474273 4103 1319 1313 802 790 329 ----12956
NM_001009554chr474273 4103 1319 1313 802 790 329 ----12956
NM_001009814chr13174 ------
NM_001009899chr355901 4522 2084 972 853 55587 5142 4556 2258 1610 --15399
NM_001009993chr264498 4137 3506 3200 2997 2921 33516 3037 2936 23151 1762 24438 4171
NM_001010846chr124075 1426 22869 427 23046 26 --
NM_001010854chr141274 1127 1564 --
NM_001010867chr1156447 5962 5866 5409 5377 5262 5230 4761 4621 2576 1089 1044 829 369 248 106373 5783 5754 5286 4592 2213 1833 1133 863 571 36648 2644 1273 26135 1876
NM_001010888chrX13882 24330 695 14054 --
NM_001010895chr922044 1947 11765 1664 --
NM_001010908chr10131 ------
NM_001010917chr1051983 1943 1845 878 435 1162 11928 2254 94
NM_001010924chr1011111 1376 ----
NM_001010927chr61234 ------
NM_001010934chr71281 ------
NM_001010935chr1------128
NM_001010942chr12------129
NM_001010984chr11301 ------
NM_001010986chrX--12159 ----
NM_001011513chr462939 2506 1561 1362 1271 528 1752 ----
NM_001011708chr252405 2349 2279 2195 574 12376 11115 --
NM_001012300chr124132 97 66 25 ------
NM_001012329chr151776 916 827 801 73 --32124 721 65 --
NM_001012393chr1154217 1626 1467 366 24 14528 --24429 1797
NM_001012415chr94867 572 128 112 --2631 75 --
NM_001012968chrX21833 897 ------
NM_001013031chr1023114 2642 --2963 445 --
NM_001013615chr13804 452 306 --1883 11091
NM_001013622chr491102 922 446 385 323 261 199 138 76 ------
NM_001013693chr1112787 2469 2021 1139 658 611 424 385 263 225 155 --31875 832 311 --
NM_001013693chr1112787 2469 2021 1139 658 611 424 385 263 225 155 --31875 832 311 --
NM_001013703chr153439 331 198 ------
NM_001013739chr72285 67 ------
NM_001013746chr732186 1867 1847 ------
NM_001013839chr1792596 2351 2083 1924 1897 1837 1658 89 79 --1147 --
NM_001014797chr1076233 6017 2792 2668 1787 1153 1009 25222 1672 27678 2808 --
NM_001014809chr41329 --1814 --
NM_001015048chr1433029 2596 804 22572 2097 32982 1167 742 --
NM_001015049chr1433029 2596 804 22572 2097 32982 1167 742 --
NM_001015053chr1751326 1150 1105 1053 25 --11462 1287
NM_001015877chrX52182 702 617 181 163 ------
NM_001017369chr421096 865 ------
NM_001017395chr333249 2314 404 ------
NM_001017424chr12744 98 --1380 1168
NM_001017425chr12744 98 --1380 1168
NM_001017524chr1161300 1127 1029 408 164 119 11546 11133 --
NM_001017923chr141204 ------
NM_001017926chr811600 ------
NM_001017963chr14----1349 --
NM_001017969chr91655 ------
NM_001018005chr15----163 --
NM_001018056chr91555 ------
NM_001018065chr955381 5346 4969 4364 2385 14748 25220 476 --
NM_001018066chr955381 5346 4969 4364 2385 14748 25220 476 --
NM_001018067chr175122 4952 4641 4585 4087 3834 1686 14193 ----
NM_001018068chr175122 4952 4641 4585 4087 3834 1686 14193 ----
NM_001018069chr175122 4952 4641 4585 4087 3834 1686 14193 ----
NM_001018108chr1532296 817 280 --1128 1186
NM_001018111chr753670 3048 2888 1412 479 --1217 --
NM_001023567chr1542433 783 758 453 ------
NM_001023587chr32796 114 ------
NM_001024024chr143925 658 88 1292 ----
NM_001024070chr143921 654 84 1288 ----
NM_001024647chr12126935 6321 5390 2863 2812 2787 2286 2162 2153 638 402 95 22729 2518 26454 6284 15318
NM_001024666chrX----140 --
NM_001024858chr1462535 1082 975 740 633 104 --2322 174 22065 560
NM_001024948chr122419 128 ----11083
NM_001025068chr311814 --2595 324 --
NM_001025069chr311814 --2595 324 --
NM_001025076chr1035582 4289 822 ------
NM_001025077chr1046940 5647 4878 2180 14752 ----
NM_001025079chr322806 996 ------
NM_001025107chr12897 282 --22078 1656 22339 1706
NM_001025107chr12897 282 --22078 1656 22339 1706
NM_001025109chr141075 891 365 26 --2948 783 --
NM_001025202chr72285 67 ------
NM_001025266chr374721 4181 3837 1704 871 686 462 21859 1374 --1625
NM_001025580chrX33824 1032 494 --129 --
NM_001025603chr11193 ----2497 135
NM_001025780chr911037 11191 ----
NM_001029859chr1162097 1810 1729 1673 318 208 11590 --22400 1786
NM_001029871chr2021302 369 --1550 --
NM_001030006chr1732511 2424 2267 ----12214
NM_001030007chr1642662 1349 1076 422 13178 1299 --
NM_001031679chr1292344 2301 1401 1183 1078 990 596 383 274 1503 11083 13084
NM_001031680chr142350 2237 696 66 1495 12203 --
NM_001031695chr2244206 1313 1260 492 21452 1237 34876 4868 1281 --
NM_001031716chr21316 1837 ----
NM_001031740chr181721 1668 1638 1415 1354 494 480 304 ------
NM_001031746chr103239 232 106 ----1288
NM_001031804chr1654095 3904 3604 661 642 13008 14236 --
NM_001031812chr521832 1809 ------
NM_001032221chr911816 ------
NM_001032280chr611130 ----1444
NM_001032296chr1352617 2285 2090 1934 558 11978 12514 --
NM_001032380chr1031516 1240 187 ------
NM_001032999chr2054354 1935 1715 1197 805 54810 4131 2147 1641 331 1225 1990
NM_001033045chr294071 4000 3978 3313 2879 2683 1415 605 575 14056 1105 --
NM_001033049chr2132328 2297 315 12067 ----
NM_001033057chr322143 1796 11912 --11322
NM_001033112chr51921 ------
NM_001033117chr384311 4217 4170 1720 1673 1550 1504 1216 23764 1146 33516 3397 1661 --
NM_001033551chr17173456 3421 3102 3003 2985 2949 2933 2902 1564 1486 1343 1008 682 486 304 236 189 1897 23388 422 --
NM_001033561chr17----1246 --
NM_001033566chr171290 ------
NM_001033568chr171290 ------
NM_001033723chr831097 696 544 --22376 36 22393 2072
NM_001033925chr1031595 1374 619 ----11822
NM_001034845chr41440 ----1281
NM_001034850chr521538 1417 ------
NM_001034954chr1061983 1261 1080 721 376 202 177 --1481
NM_001034955chr1061983 1261 1080 721 376 202 177 --1481
NM_001034956chr1061983 1261 1080 721 376 202 177 --1481
NM_001034957chr1061983 1261 1080 721 376 202 177 --1481
NM_001035chr111192 1488 ----
NM_001035003chr42203 161 ------
NM_001035004chr42203 161 ------
NM_001037131chr23824 388 84 ------
NM_001037174chr2----1649 --
NM_001037339chr111214 --11296 --
NM_001037340chr111214 --11296 --
NM_001037341chr111214 --11296 --
NM_001037341chr111214 --11296 --
NM_001037553chr2154327 3132 1878 1135 703 1139 1966 13580
NM_001037582chr41327 1488 11129 --
NM_001037738chr5181 ------
NM_001038707chr122088 1761 ------
NM_001038707chr122088 1761 ------
NM_001039350chr751677 1526 1389 1308 675 ------
NM_001039479chr1452084 1762 814 441 50 1850 31504 745 224 --
NM_001039538chr262931 2630 613 379 68 45 ------
NM_001039547chr3157748 7601 7339 7314 6511 5815 5705 5402 4864 2705 2591 2406 2308 643 541 56993 6567 5717 2894 2279 16696 --
NM_001039550chr24891 845 556 105 --2851 818 --
NM_001039585chr142900 2720 847 514 11153 --1227
NM_001039590chrX--33461 2899 2635 ----
NM_001039591chrX--33461 2899 2635 ----
NM_001039618chr1155146 3895 3722 1704 424 24493 4174 14700 --
NM_001039709chr2054354 1935 1715 1197 805 54810 4131 2147 1641 331 1225 1990
NM_001039711chr12957 188 1999 1254 --
NM_001039712chr12957 188 1999 1254 --
NM_001039840chrX45931 4955 4305 310 ----13882
NM_001039844chr1062468 2196 1988 1202 980 124 32826 1959 917 ----
NM_001039888chr1----1740 --
NM_001039937chr1333799 3637 1106 ------
NM_001040001chr642084 1580 646 284 ------
NM_001040002chr17----137 --
NM_001040142chr211784 ------
NM_001040143chr211784 ------
NM_001040159chr4--1477 ----
NM_001040214chr631888 375 95 --12257 --
NM_001040284chr1625778 1926 14203 --14684
NM_001040402chr422354 1150 11097 ----
NM_001040429chr1311312 23224 1055 ----
NM_001040446chr511688 22663 1714 2936 129 --
NM_001040624chr832457 2124 1751 22235 642 --12156
NM_001040625chr832457 2124 1751 22235 642 --12156
NM_001040626chr832457 2124 1751 22235 642 --12156
NM_001040627chr832457 2124 1751 22235 642 --12156
NM_001040628chr832457 2124 1751 22235 642 --12156
NM_001040629chr832457 2124 1751 22235 642 --12156
NM_001040630chr832457 2124 1751 22235 642 --12156
NM_001040709chr172476 2248 1795 1676 681 160 119 --12017 --
NM_001040712chr912195 ----167
NM_001040715chr162288 253 --31166 483 224 --
NM_001042355chr1663634 3358 2012 1678 1165 485 14678 ----
NM_001042388chr181648 ------
NM_001042412chr1663634 3358 2012 1678 1165 485 14678 ----
NM_001042413chr933148 1245 854 13996 14066 1986
NM_001042424chr41738 --42400 928 755 206 1161
NM_001042425chr611130 ----1444
NM_001042427chr102270 101 ------
NM_001042453chrX21291 87 ------
NM_001042481chr1432535 1711 1019 ------
NM_001042486chr2011177 --21316 1266 1117
NM_001042494chr1553287 1496 1097 251 137 22798 2481 1142 1286
NM_001042495chr1553287 1496 1097 251 137 22798 2481 1142 1286
NM_001042496chr1553287 1496 1097 251 137 22798 2481 1142 1286
NM_001042497chr1553287 1496 1097 251 137 22798 2481 1142 1286
NM_001042533chr333229 2500 2101 --168 --
NM_001042537chrX12129 22424 1950 ----
NM_001042539chr162180 148 ------
NM_001042555chr12--1496 14689 --
NM_001042599chr266822 6182 5132 5035 2701 1684 ------
NM_001042603chr1284271 4077 3793 3508 3450 3392 3334 279 --33481 3423 3365 24562 864
NM_001042604chr333521 1942 430 ------
NM_001042610chr162177 62 --31411 1193 302 11225
NM_001042632chr20102441 2188 1944 1583 948 835 399 356 186 63 1820 2546 220 1327
NM_001042633chr20102441 2188 1944 1583 948 835 399 356 186 63 1820 2546 220 1327
NM_001042681chr152468 2050 2030 966 236 ------
NM_001042682chr152468 2050 2030 966 236 ------
NM_001042682chr152468 2050 2030 966 236 ------
NM_001042683chr621162 165 ----11738
NM_001042728chr1231072 248 123 --1416 --
NM_001043318chr1463172 2729 1331 1051 460 273 --21028 490 --
NM_001043351chr131437 206 194 11679 11804 --
NM_001044305chr61451 ------
NM_001044385chr2103382 3197 2791 1611 1390 1040 1019 797 741 701 13296 --23987 2705
NM_001044722chr521832 1809 ------
NM_001044723chr521832 1809 ------
NM_001046chr522739 2255 ------
NM_001048183chr152497 1395 1231 1063 959 53214 2873 2739 2468 929 --13480
NM_001050chr1731470 1188 130 1156 ----
NM_001077628chr13518 168 162 --126 --
NM_001079874chr131908 796 474 1619 ----
NM_001083620chr42640 127 --12017 --
NM_001095chr121324 --11697 --
NM_001099678chr344961 4565 172 41 24735 1869 16111 13910
NM_001100108chr1146845 6553 6272 6055 5637 5549 2468 2068 1858 1663 1656 970 822 138 --17053 --
NM_001106chr3118985 8290 7996 7445 7052 6052 3431 3071 2145 1688 541 23130 2736 1263 11679
NM_001111chr12897 282 --22078 1656 22339 1706
NM_001113490chrX42970 2901 2430 754 ----13609
NM_001117chr183834 597 555 --11982 --
NM_001128chr1642662 1349 1076 422 13178 1299 --
NM_001135chr151245 --135 --
NM_001144chr162410 364 ----1518
NM_001146chr82829 526 11631 21668 271 --
NM_001152chrX163 ------
NM_001167chrX96149 5377 5314 4576 4419 4274 4156 1976 1077 45752 5403 4446 2137 --1688
NM_001174chrX4894 674 645 148 1236 ----
NM_001198chr612273 21573 51 ----
NM_001201chr463549 3417 2929 1568 1488 547 ------
NM_001204chr255081 5051 4827 1278 429 35696 4692 2303 ----
NM_001206chr9----32096 453 83 --
NM_001235chr114634 525 193 152 --1215 1247
NM_001241chr212008 ------
NM_001241chr212008 ------
NM_001256chr1752777 1893 1178 753 89 11080 176 --
NM_001259chr756010 5994 5008 1580 349 12063 12289 --
NM_001265chr133967 707 255 ----143
NM_001268chr133737 109 26 2264 96 ----
NM_001271chr1563281 2118 2087 839 777 723 11315 ----
NM_001273chr123485 420 33 --1413 --
NM_001280chr191473 ------
NM_001282chr1732511 2424 2267 ----12214
NM_001292chr153330 164 156 --1962 --
NM_001293chr111482 ------
NM_001304chr1722426 1233 22903 262 12887 --
NM_001310chr1242455 2092 1196 441 1544 --22963 1093
NM_001313chr41329 --1814 --
NM_001315chr622152 708 11761 1668 11832
NM_001316chr202158 61 ------
NM_001329chr102577 407 ------
NM_001331chr1152272 766 695 495 26 ----12615
NM_001346chr321947 299 --12010 --
NM_001351chr31420 21413 738 1674 --
NM_001356chrX22293 1952 1789 ----
NM_001364chr1174415 3584 3568 3477 3206 1419 890 --11108 --
NM_001386chr822009 948 ------
NM_001387chr562975 2947 2431 2256 2029 1176 --22838 2075 --
NM_001389chr213206 192 185 ------
NM_001392chr18151 ------
NM_001394chr82645 84 ------
NM_001396chr2131830 808 623 ------
NM_001399chrX61473 1364 1105 922 896 641 ----13046
NM_001400chr12897 80 ----1271
NM_001402chr622000 672 21927 1465 21640 555 --
NM_001407chr351582 1339 451 354 296 ------
NM_001418chr111526 ------
NM_001418chr111526 ------
NM_001419chr1953159 1662 909 616 421 1580 13047 --
NM_001431chr61967 ------
NM_001438chr131262 1201 717 11436 ----
NM_001448chrX11151 ----1605
NM_001478chr122850 745 --2111 36 --
NM_001497chr972122 1752 1712 903 570 103 74 --22308 1820 --
NM_001498chr611020 1126 --1118
NM_001514chr13533 527 79 ------
NM_001530chr141869 ------
NM_001542chr142432 1843 1028 965 --21036 923 12163
NM_001543chr573017 2998 1941 1761 1494 1355 1186 13974 53953 3895 3058 3028 1830 165
NM_001552chr1721030 794 --3278 93 87 --
NM_001584chr1111123 ------
NM_001604chr11177 ------
NM_001610chr113728 687 107 --150 1711
NM_001616chr21964 12447 ----
NM_001626chr19123061 2993 2944 2857 2695 2332 1281 1201 907 833 330 248 23088 2168 32256 2144 800 --
NM_001660chr31305 ------
NM_001663chr1422677 1721 ------
NM_001665chr112228 140 ------
NM_001668chr132144 1515 466 ------
NM_001677chr11228 ------
NM_001678chr173684 548 236 --21334 124 --
NM_001682chr1222246 350 --12860 --
NM_001695chr812967 42764 2684 2670 684 44001 3102 3007 2786 --
NM_001699chr1921798 326 21780 695 ----
NM_001704chr6--1442 ----
NM_001714chr12------1206
NM_001722chr81432 --2510 101 --
NM_001731chr122701 215 ------
NM_001735chr91393 ------
NM_001737chr5----121 --
NM_001742chr7------2335 36
NM_001753chr7----11364 1173
NM_001754chr2144202 4160 3067 582 13679 2105 26 --
NM_001760chr61654 1265 1872 --
NM_001761chr1631751 1740 408 11517 11580 1694
NM_001773chr141441 1257 392 113 --31314 1149 955 --
NM_001777chr322806 996 ------
NM_001792chr181864 --1194 --
NM_001796chr16133 ------
NM_001797chr162777 522 ------
NM_001802chr16----1805 --
NM_001830chrX43899 3551 1209 388 1878 ----
NM_001844chr121288 1274 ----
NM_001851chr62638 298 ------
NM_001858chr665147 3437 1921 1318 911 681 ------
NM_001874chr1265100 3279 3206 2061 1511 629 13812 11047 --
NM_001894chr2221231 890 ------
NM_001901chr61934 ------
NM_001904chr31423 ------
NM_001924chr11126 ------
NM_001931chr111118 ------
NM_001933chr1441311 1132 960 929 ------
NM_001936chr751677 1526 1389 1308 675 ------
NM_001938chr11687 ------
NM_001949chr622596 2559 --12198 --
NM_001957chr442291 1676 1539 72 22273 1903 ----
NM_001964chr521042 374 --2912 907 --
NM_001967chr32409 161 ------
NM_001969chr1453622 3373 3154 2573 1239 1729 ----
NM_001981chr122184 260 ------
NM_001982chr121859 --1936 --
NM_001995chr431247 1222 232 ------
NM_001999chr52311 192 1488 ----
NM_002010chr13124 ------
NM_002014chr121663 ------
NM_002015chr1321304 438 --12332 --
NM_002023chr151374 1205 429 407 25 ----11237
NM_002024chrX1274 ------
NM_002025chrX148605 7701 7657 7022 6754 6691 6398 3008 2827 2384 1904 1753 1593 1300 --39239 6177 1983 --
NM_002032chr111376 ------
NM_002039chr41870 ------
NM_002040chr211174 12579 ----
NM_002063chrX1503 ------
NM_002069chr71231 --11350 --
NM_002077chr912057 ----1352
NM_002080chr161880 ------
NM_002081chr231758 1660 126 ------
NM_002089chr41124 ------
NM_002092chr444981 3636 3582 1816 34672 3609 1395 ----
NM_002094chr161376 ------
NM_002105chr11----2977 94 --
NM_002106chr41126 ------
NM_002107chr11437 ------
NM_002126chr1753992 2871 2566 846 762 1931 ----
NM_002137chr711807 ------
NM_002138chr41173 ------
NM_002181chr21154 --2210 91 --
NM_002184chr5--1153 ----
NM_002190chr62368 219 1416 1529 --
NM_002196chr201950 ------
NM_002196chr201950 ------
NM_002199chr41970 ------
NM_002207chr3--1237 ----
NM_002214chr754774 3748 3682 1885 1286 22283 1445 11494 14262
NM_002230chr171252 1799 2377 133 --
NM_002252chr2--1323 ----
NM_002254chr242282 1717 1688 435 11542 41877 545 245 236 --
NM_002264chr313715 ----24439 3154
NM_002267chr1322128 861 --2806 434 --
NM_002268chr321630 436 11441 ----
NM_002270chr535148 4443 2043 23983 684 ----
NM_002271chr1341779 771 414 84 ------
NM_002293chr121994 315 --12143 1606
NM_002309chr2242977 1977 181 160 22206 448 32628 2435 1026 --
NM_002310chr552327 1232 1058 994 74 --11669 --
NM_002313chr1064947 4796 4643 3541 1476 245 24571 153 11779 --
NM_002314chr721039 277 ----1378
NM_002334chr1131928 1593 164 1833 21746 258 --
NM_002336chr1254246 3210 1161 357 307 11599 13866 --
NM_002347chr82330 218 --245 31 --
NM_002351chrX21462 1414 21273 89 ----
NM_002354chr21355 1383 ----
NM_002356chr622068 1817 ------
NM_002359chr1753717 3265 1311 1060 539 --54240 1426 569 346 165 23724 3653
NM_002373chr1531255 522 140 --168 11075
NM_002374chr262931 2630 613 379 68 45 ------
NM_002387chr533971 1786 390 11944 23137 219 --
NM_002390chr1762019 1773 1623 1439 615 598 11428 31985 1592 649 --
NM_002398chr221151 158 --11436 --
NM_002406chr53429 260 45 --2293 23 --
NM_002412chr10128 ------
NM_002430chr2272604 1973 1880 1798 1644 1612 114 12125 21780 837 --
NM_002442chr1221542 594 161 31604 1548 1321 --
NM_002467chr82466 45 --1107 --
NM_002480chr1211124 ------
NM_002481chr187724 6489 5904 5514 2273 1623 1191 418 ------
NM_002487chr15--1534 ----
NM_002499chr1522294 245 2256 117 135 1575
NM_002501chr1932544 1581 1347 13135 1766 13708
NM_002507chr1751939 1874 1831 1702 124 21338 306 31437 1308 115 --
NM_002508chr15688 428 376 263 94 11329 1128 --
NM_002515chr1431447 1324 1278 ------
NM_002519chr11157 --11325 --
NM_002522chr1753383 3275 2917 1305 1152 22440 2408 122 12607
NM_002545chr1154217 1626 1467 366 24 14528 --24429 1797
NM_002547chrX33069 3051 308 --11581 --
NM_002568chr81387 ------
NM_002570chr1531222 483 141 ----1428
NM_002581chr954783 4032 3947 1462 1037 ------
NM_002587chr52358 101 ----148
NM_002599chr1161128 905 885 430 307 247 --2924 146 1744
NM_002600chr111214 --11296 --
NM_002607chr72996 33 ------
NM_002628chr321083 360 ------
NM_002633chr11478 ------
NM_002645chr111970 ------
NM_002648chr631255 1226 442 ------
NM_002655chr821703 605 24913 3474 1165 --
NM_002657chr2042937 2896 1065 191 --21129 90 --
NM_002698chr19102926 2866 2813 2635 2518 1042 845 293 125 92 ----1821
NM_002707chr2162 --142 --
NM_002709chr243116 1436 654 384 12659 ----
NM_002715chr5--11176 ----
NM_002716chr1143051 1221 813 279 --11309 11341
NM_002717chr8--1576 ----
NM_002718chr352120 2058 2013 1989 1928 22147 410 2615 353 --
NM_002721chr9190 ------
NM_002731chr121127 120 --125 --
NM_002737chr1796291 5939 5423 4502 4078 2277 1744 1604 386 14959 --14541
NM_002742chr141146 ------
NM_002745chr2264219 4206 4065 3302 1464 123 24431 943 1876 11178
NM_002753chr41818 ------
NM_002773chr165572 516 460 395 147 194 1500 --
NM_002792chr20196 ------
NM_002808chr31124 ------
NM_002814chrX2284 152 ------
NM_002823chr21678 ------
NM_002830chr21241 ------
NM_002833chr1541275 1129 1023 458 --21556 64 --
NM_002837chr1222841 1350 33764 3326 1249 23719 2890 --
NM_002839chr912195 ----167
NM_002841chr31171 ------
NM_002843chr1112718 33162 3038 2870 12692 --
NM_002844chr611127 156 ----
NM_002845chr181519 ------
NM_002851chr7133 ----1563
NM_002858chr131145 906 87 1873 11189 --
NM_002859chr1221325 1166 --21217 194 11753
NM_002868chr1242270 2144 686 402 --22218 106 --
NM_002869chr1141611 690 672 572 ------
NM_002874chr911795 1927 ----
NM_002883chr227950 900 876 697 277 151 41 --2615 334 --
NM_002884chr1------128
NM_002890chr5--1127 1244 --
NM_002892chr141628 ------
NM_002893chrX1149 ------
NM_002897chr21688 ------
NM_002900chr10----1119 --
NM_002907chr121371 ----1430
NM_002928chr141321 665 527 468 146 ----
NM_002945chr17------1613
NM_002955chr63412 370 337 --11541 --
NM_002958chr31686 ------
NM_002959chr144134 3339 426 184 11681 13098 --
NM_002970chrX--1276 ----
NM_002994chr41569 1298 11826 --
NM_003011chr931139 677 180 ------
NM_003016chr17177 ------
NM_003022chrX140 ------
NM_003029chr161313 1049 549 376 349 151 1167 1248 --
NM_003031chr162791 282 1780 ----
NM_003034chr1277333 5020 2240 1427 1010 523 102 42328 2095 1042 571 ----
NM_003068chr8--1874 ----
NM_003076chr1231257 316 49 --31686 1476 561 --
NM_003093chr6182 ------
NM_003108chr256869 5353 5181 4594 2608 --25637 2026 --
NM_003112chr7----12626 --
NM_003118chr531966 1406 297 12035 ----
NM_003128chr232607 2352 1862 --1995 --
NM_003131chr672155 1760 884 562 541 357 167 11461 3857 550 140 --
NM_003137chr642111 1637 1414 341 ------
NM_003144chr631818 1598 125 ----11428
NM_003150chr1741545 852 159 150 1816 12134 --
NM_003155chr842620 974 606 581 1514 ----
NM_003157chr3----1263 --
NM_003164chr11----2469 78 --
NM_003174chr101583 ------
NM_003199chr1855380 4392 1800 1593 126 13531 ----
NM_003200chr1962247 1789 1720 957 695 310 --31917 1461 761 --
NM_003202chr521621 638 11309 1556 --
NM_003204chr1731807 1684 502 --1679 --
NM_003215chr421481 77 --21034 428 --
NM_003216chr2263295 2876 2567 1056 358 317 --32893 2353 836 22174 739
NM_003217chr121812 --31365 554 430 --
NM_003220chr611130 ----1444
NM_003221chr643038 2957 2832 1023 ------
NM_003240chr13619 255 22 --3697 311 211 --
NM_003246chr1521542 344 ------
NM_003250chr171382 ------
NM_003253chr212543 214 --1771 --
NM_003255chr1752647 2208 2068 944 533 --3707 685 650 --
NM_003257chr1511076 ------
NM_003262chr354100 3545 3333 1646 500 14692 ----
NM_003286chr201804 --168 1170
NM_003290chr1931133 941 163 ------
NM_003338chr10175 ------
NM_003342chr1772859 2491 2116 2084 1174 755 136 ------
NM_003344chr731576 1445 255 ------
NM_003348chr1211205 ------
NM_003363chr3--1531 ----
NM_003373chr104710 537 505 466 --163 --
NM_003379chr64948 399 295 147 ------
NM_003383chr91555 ------
NM_003384chr14191 ------
NM_003387chr251161 1073 853 543 444 ------
NM_003390chr11----11148 --
NM_003392chr354303 3263 1626 1591 1585 13552 11034 --
NM_003405chr221196 ------
NM_003406chr811977 ------
NM_003410chrX2574 549 ------
NM_003413chrX11367 ------
NM_003418chr31113 1286 ----
NM_003463chr621063 1032 ------
NM_003466chr232399 1554 30 12108 1778 --
NM_003468chr233165 584 537 ----23866 3637
NM_003469chr2----1166 --
NM_003471chr31955 ------
NM_003478chr1132897 2770 485 ------
NM_003482chr1282201 2087 1066 1005 779 643 298 179 12179 ----
NM_003485chr1421293 331 --2140 40 --
NM_003496chr74817 549 293 200 --152 --
NM_003498chr1652306 1736 1705 216 171 --1281 22618 443
NM_003559chr1742882 2531 1047 757 --1431 11410
NM_003563chr1741304 1223 327 239 11271 11153 --
NM_003574chr1854635 4298 1106 539 246 ------
NM_003576chr1352617 2285 2090 1934 558 11978 12514 --
NM_003583chr122698 239 13366 22628 50 --
NM_003590chr23692 537 178 13922 ----
NM_003592chr71360 ------
NM_003597chr252194 2164 1824 751 695 1745 ----
NM_003603chr431433 833 169 ----1748
NM_003607chr153816 1663 1347 1088 835 --13945 --
NM_003615chr314021 --11295 --
NM_003633chr562135 1839 1825 494 366 34 12109 ----
NM_003644chr1785396 5326 5061 4279 2050 1296 666 48 24314 2095 25483 4410 1102
NM_003653chr17------122
NM_003663chr3--13493 ----
NM_003692chr91809 ------
NM_003713chr131138 1106 430 --121 --
NM_003714chr553015 2732 2677 1992 646 12132 1378 32210 631 360
NM_003722chr331987 1104 848 ------
NM_003741chr3----2352 45 --
NM_003744chr141541 ------
NM_003750chr101693 ------
NM_003763chr2072702 2480 2297 2087 1083 375 299 1648 12615 12896
NM_003769chr12----2307 46 --
NM_003774chr1241348 1340 523 27 2675 416 ----
NM_003778chr31114 --1596 --
NM_003811chr191262 1666 2200 194 --
NM_003816chr81157 ----145
NM_003864chr41163 ------
NM_003872chr232482 2179 1128 22671 2352 12587 12942
NM_003873chr1032481 342 58 ----1117
NM_003884chr321643 552 ------
NM_003885chr174862 694 528 162 --1457 --
NM_003888chr1541600 1576 1182 466 194 21147 442 --
NM_003901chr1021979 137 31811 1733 777 --11672
NM_003904chr11------1137
NM_003913chr623470 471 ------
NM_003919chr7190 ------
NM_003927chr182888 204 1790 1263 --
NM_003932chr2221766 375 ------
NM_003955chr1711039 --2411 214 --
NM_003958chr632460 654 491 11180 23788 2740 12622
NM_003966chr577673 4898 2576 2184 2046 1516 286 1220 ----
NM_003971chr171412 ------
NM_003980chr6----11079 --
NM_003983chr1641406 1016 692 74 --31520 1349 609 33662 827 179
NM_003994chr1223157 2808 12666 --14024
NM_004006chrX42507 2330 1983 648 ------
NM_004007chrX42507 2330 1983 648 ------
NM_004009chrX42507 2330 1983 648 ------
NM_004010chrX42507 2330 1983 648 ------
NM_004011chrX42507 2330 1983 648 ------
NM_004012chrX42507 2330 1983 648 ------
NM_004013chrX42507 2330 1983 648 ------
NM_004014chrX42507 2330 1983 648 ------
NM_004015chrX42507 2330 1983 648 ------
NM_004016chrX42421 2244 1897 562 ------
NM_004017chrX42507 2330 1983 648 ------
NM_004018chrX42421 2244 1897 562 ------
NM_004020chrX42507 2330 1983 648 ------
NM_004021chrX42421 2244 1897 562 ------
NM_004022chrX42421 2244 1897 562 ------
NM_004023chrX42421 2244 1897 562 ------
NM_004035chr17105033 3687 3633 3415 3289 1977 1848 1564 1456 314 34587 3490 1940 --13503
NM_004036chr22668 152 ------
NM_004040chr241302 251 233 221 ------
NM_004050chr1472362 1847 1838 821 794 502 149 ------
NM_004052chr10----148 --
NM_004055chr1141823 1694 640 275 32023 1841 835 31570 67 61 11487
NM_004067chr721151 136 ------
NM_004080chr721367 571 147 11146 --
NM_004081chrY1518 21439 673 ----
NM_004087chr33668 543 399 ------
NM_004090chr1753143 2852 2096 1383 414 12986 --1150
NM_004098chr1021131 263 ------
NM_004100chr62818 267 ------
NM_004114chrX2923 192 ------
NM_004124chr1422912 2496 23092 464 12275 --
NM_004133chr81209 1416 ----
NM_004171chr1149264 9081 7608 7374 38670 2222 155 ----
NM_004187chrX11405 --1138 1302
NM_004200chr1163262 2408 2042 754 742 686 12143 42575 488 152 85 --
NM_004227chr742535 2485 2274 2224 ----1979
NM_004229chrX11401 ------
NM_004232chr1811323 13120 12703 --
NM_004235chr9------1134
NM_004238chr2------182
NM_004267chr3--1161 ----
NM_004272chr511890 --1762 --
NM_004279chr71339 1619 ----
NM_004286chr2232120 1897 908 12277 31116 835 262 21037 1004
NM_004293chr943831 3477 2790 498 1370 ----
NM_004302chr1242925 1970 659 63 32321 1011 925 22112 466 --
NM_004311chr1042343 2143 1185 391 --12607 --
NM_004320chr16----2289 27 --
NM_004330chr153879 862 373 ------
NM_004331chr81557 ----12595
NM_004338chr1866935 6502 4865 4651 1772 1741 26813 5418 161 --
NM_004350chr142350 2237 696 66 1495 12203 --
NM_004358chr2051143 1047 928 757 66 ----11109
NM_004364chr1921218 326 --1248 130
NM_004368chr194802 357 292 198 1961 11019 1192
NM_004370chr6194 ------
NM_004379chr241768 1738 414 396 --1354 --
NM_004384chr521832 1809 ------
NM_004386chr1932237 2041 792 ------
NM_004387chr5----2294 94 --
NM_004392chr1332598 1856 370 ------
NM_004397chr1144266 2762 1456 767 ------
NM_004409chr19146 ------
NM_004412chr1065673 5441 4628 4423 1946 730 24146 4062 24489 3804 --
NM_004420chr1132349 1865 957 --42328 2194 2084 407 --
NM_004423chr332510 846 638 1959 22706 803 --
NM_004427chr14866 345 144 50 11055 21144 889 --
NM_004430chr84927 803 599 589 --1866 --
NM_004431chr13664 225 188 --2538 194 181
NM_004432chr91762 ------
NM_004433chr131166 719 673 --11378 1336
NM_004438chr262619 2534 2230 1273 680 297 --22592 330 --
NM_004440chr61267 ------
NM_004447chr121140 11115 ----
NM_004454chr342068 1776 1440 681 12024 ----
NM_004457chr2136 ------
NM_004458chrX1677 ------
NM_004464chr443824 3473 1144 451 ------
NM_004485chr174369 4096 3568 3238 1225 903 677 43831 3186 1577 835 33767 3266 1138 --
NM_004498chr151323 1317 ----
NM_004500chr1411733 ------
NM_004501chr173821 3436 3411 2853 2712 2508 1327 22737 923 ----
NM_004508chr101736 ------
NM_004514chr1752495 1953 875 236 225 --32677 2515 242 --
NM_004527chr17----137 --
NM_004549chr1121537 1003 21470 464 1572 --
NM_004555chr16----194 --
NM_004571chr2142989 2720 534 467 ------
NM_004583chr17--1165 1641 --
NM_004586chrX44289 3949 3743 1621 11710 11283 --
NM_004588chr1174018 3533 1315 1253 861 624 219 12521 11037 --
NM_004595chrX1173 180 ----
NM_004598chr543312 3171 2897 2125 ------
NM_004612chr943552 2940 1455 521 14392 13090 --
NM_004630chr1141135 1017 431 144 --2915 858 1151
NM_004635chr351096 1015 464 390 342 ----1985
NM_004637chr331323 526 270 ------
NM_004645chr172710 667 ------
NM_004650chrX21251 541 11454 ----
NM_004656chr391199 1163 1054 797 486 480 418 339 293 --1494 --
NM_004660chrY11881 11911 ----
NM_004667chr15------138
NM_004677chrY1485 ------
NM_004687chr1721968 722 ------
NM_004689chr141371 ------
NM_004698chr1------1159
NM_004700chr12144 135 ------
NM_004703chr1732488 1810 750 12457 ----
NM_004721chr31141 ------
NM_004725chr1031465 1058 525 1385 ----
NM_004726chrX55414 5225 3582 686 446 45357 4577 3531 2112 --13821
NM_004734chr131439 --12349 --
NM_004742chr31331 --1500 --
NM_004745chr884957 2248 2158 1807 1765 1693 718 516 ------
NM_004758chr174812 278 194 79 --2439 299 1477
NM_004768chr11111 --1794 --
NM_004770chr8--1181 ----
NM_004772chr531382 1020 248 --1122 --
NM_004774chr1722045 402 42783 2761 486 85 12966 --
NM_004779chr53124 97 26 --2486 420 --
NM_004783chr162145 27 --174 --
NM_004788chr1141086 1014 892 709 ------
NM_004789chr9190 ------
NM_004796chr1422308 399 ------
NM_004798chr2063351 3093 2262 891 855 695 12671 12748 --
NM_004808chr1063235 3161 3131 2431 2219 938 12364 12620 --
NM_004822chr1783981 3123 1501 1141 1113 821 680 196 13607 1309 21315 1188
NM_004824chr621095 41 --11204 --
NM_004827chr4----11565 --
NM_004836chr21184 1174 ----
NM_004857chr143890 772 306 44668 1761 1326 468 ----
NM_004859chr1742912 2583 2297 813 ----12274
NM_004863chr14105204 4662 4357 4346 4160 3954 3414 1654 817 359 34885 4187 66 ----
NM_004865chr6135 1334 ----
NM_004869chr1831426 1332 609 ------
NM_004871chr1754080 3681 3382 346 160 ------
NM_004873chr1433029 2596 804 22572 2097 32982 1167 742 --
NM_004879chr112988 218 ------
NM_004897chr101855 ------
NM_004898chr432809 2325 2218 ------
NM_004902chr201743 ------
NM_004907chr191632 --2877 220 1905
NM_004911chr73500 468 444 ------
NM_004922chr102883 151 --1769 --
NM_004925chr9144 ------
NM_004929chr8--11401 ----
NM_004930chr11696 ------
NM_004932chr51174 ------
NM_004934chr5141 ------
NM_004947chr312276 1656 --11001
NM_004956chr71457 23885 3800 --1700
NM_004959chr971348 545 422 355 188 149 56 --21325 969 --
NM_004961chrX1488 1232 21369 193 11191
NM_004964chr12553 172 1453 134 --
NM_004969chr10----146 --
NM_004973chr631151 555 511 --11445 --
NM_004976chr11174796 4481 4030 3708 3453 3447 3371 3317 3225 1705 1681 1185 792 521 452 311 130 --44286 3697 1995 1632 24900 1799
NM_004978chr121384 554 2304 157 11646 1321
NM_004985chr1221023 906 1957 --13525
NM_004992chrX118069 6928 6439 6073 5946 5390 2826 2604 2173 1411 990 --47587 6474 1599 1440 --
NM_004992chrX118069 6928 6439 6073 5946 5390 2826 2604 2173 1411 990 --47587 6474 1599 1440 --
NM_005020chr71240 --159 1538
NM_005023chr511495 1152 ----
NM_005028chr1022196 1489 --1639 --
NM_005044chrX74291 4242 3580 1253 1228 992 857 --1791 --
NM_005056chr1294515 4321 4037 3752 3694 3636 3578 3480 523 1207 33725 3667 3609 24806 1108
NM_005063chr10113550 3398 3093 3050 2974 2805 2421 1321 934 401 390 22518 423 ----
NM_005065chr1434449 1392 680 14861 1196 --
NM_005078chr1591719 1661 1504 1252 1218 730 518 312 101 --1180 --
NM_005093chr2054354 1935 1715 1197 805 54810 4131 2147 1641 331 1225 1990
NM_005105chr131682 1652 472 ----11698
NM_005112chr42992 377 ------
NM_005116chr2023824 61 13510 ----
NM_005119chr121111 220 ------
NM_005120chrX2159 75 ------
NM_005134chr181648 ------
NM_005135chr1553287 1496 1097 251 137 22798 2481 1142 1286
NM_005156chr963498 2086 1842 1756 1471 113 13555 23311 1804 --
NM_005164chr1232305 812 359 12181 ----
NM_005168chr21599 1258 ----
NM_005188chr1197816 6933 6875 6212 6055 5696 5210 2319 997 35506 5131 660 27258 6743 --
NM_005194chr201409 ------
NM_005197chr1466218 5748 5487 4271 1924 469 12359 15590 --
NM_005202chr141562 918 271 191 --21939 288 --
NM_005206chr1741440 1410 1188 132 ------
NM_005207chr222855 665 --23398 948 --
NM_005219chr521242 1130 --1216 11137
NM_005222chr71278 ------
NM_005225chr2061166 1055 789 495 358 173 ------
NM_005228chr74616 416 251 21 11202 ----
NM_005235chr266822 6182 5132 5035 2701 1684 ------
NM_005238chr1121316 220 1916 ----
NM_005239chr2122028 46 --123 11525
NM_005241chr3183 ------
NM_005245chr42805 104 ------
NM_005254chr152146 140 ------
NM_005259chr2--1229 ----
NM_005264chr101755 ------
NM_005271chr103962 373 194 ------
NM_005277chr41137 ------
NM_005281chr11738 ----1350
NM_005296chrX2762 343 ------
NM_005297chr222303 255 --1594 --
NM_005312chr942226 2111 569 205 12458 32362 858 733 1989
NM_005316chr11--1227 ----
NM_005324chr1721992 1665 ------
NM_005329chr1641909 432 356 281 1612 1442 11691
NM_005337chr123412 333 310 ------
NM_005339chr423115 2762 --14131 1250
NM_005340chr51171 ------
NM_005342chrX21043 378 --12601 --
NM_005348chr14----1349 --
NM_005349chr41502 1644 ----
NM_005359chr1834567 1762 1369 35161 4599 2361 15241 --
NM_005369chrX186 ------
NM_005370chr192456 57 --2331 23 --
NM_005374chr1712113 --42139 1508 870 797 --
NM_005392chr941486 498 345 298 1369 --11148
NM_005397chr753670 3048 2888 1412 479 --1217 --
NM_005398chr1021453 115 ------
NM_005407chr142336 80 --1150 --
NM_005417chr2071775 1389 1362 1276 543 438 43 11656 21926 1436 --
NM_005436chr1022577 754 --33829 2919 401 11177
NM_005437chr10254 21 1153 ----
NM_005455chr121505 1183 11838 ----
NM_005458chr952147 2115 1607 103 51 ------
NM_005460chr5------155
NM_005461chr202478 124 --11283 --
NM_005465chr132063 1384 302 21968 780 ----
NM_005474chr1751326 1150 1105 1053 25 --11462 1287
NM_005475chr121764 22934 1085 --1714
NM_005476chr9144 --11146 11412
NM_005477chr1552516 2266 1814 956 301 12079 11583 --
NM_005477chr1552516 2266 1814 956 301 12079 11583 --
NM_005491chrX81788 1682 655 398 382 292 131 35 --41497 876 755 152 --
NM_005494chr71668 ------
NM_005497chr1775693 5352 4731 4477 4447 1348 157 11902 14923 --
NM_005505chr122370 343 123 3721 123 44 --
NM_005506chr432599 1931 36 --1873 --
NM_005509chr521818 1531 1521 ----
NM_005522chr751250 1166 1013 989 235 ------
NM_005523chr741609 635 388 310 --11005 --
NM_005530chr1541117 1082 576 256 ------
NM_005537chr131797 ------
NM_005540chr131395 1281 178 1549 1127 11539
NM_005544chr23745 306 256 ------
NM_005596chr922366 2130 36452 6059 564 --16213
NM_005600chr11266 160 ----
NM_005610chr12595 374 ------
NM_005613chr142097 884 857 820 2425 140 ----
NM_005614chr71997 --1162 --
NM_005619chr191162 --1379 --
NM_005637chr1811742 11901 ----
NM_005639chr121630 --1526 --
NM_005644chr1151 ------
NM_005650chr2221208 1008 ------
NM_005660chrX1224 ------
NM_005667chr21318 ------
NM_005668chr544486 3516 1728 431 23701 939 24056 488 --
NM_005690chr12163 ------
NM_005709chr11145 --1438 --
NM_005722chr232405 2160 186 ------
NM_005724chr152681 57 --2575 21 --
NM_005730chr1283511 3421 3412 1264 1185 814 625 370 --2848 674 --
NM_005734chr111136 ------
NM_005735chr23234 215 193 --1324 --
NM_005737chr242748 1921 1896 551 --1607 --
NM_005748chr1242753 2736 2577 2152 --13170 --
NM_005749chr17--1686 ----
NM_005754chr51962 ------
NM_005759chr234279 3826 1674 23834 1419 2212 168 --
NM_005779chr513535 23494 73 13330 --
NM_005786chr18--1198 172 --
NM_005789chr1731840 1789 33 --1784 --
NM_005806chr2131332 1187 76 --1246 --
NM_005822chr621618 333 1620 ----
NM_005827chr17199 ------
NM_005828chr17104529 4501 3808 3211 1452 1337 1180 1007 753 219 34216 3182 643 33794 1652 609 34092 4076 3535
NM_005832chr31348 --1440 --
NM_005839chr1179 1721 ----
NM_005840chrX21260 967 22775 1338 26886 4704 16583
NM_005853chr16--1444 ----
NM_005859chr531229 1082 331 1457 --11217
NM_005871chr101981 ------
NM_005880chr16----11388 --
NM_005883chr1972227 2185 1899 1872 926 281 68 --33020 2405 2008 --
NM_005897chr161152 1039 947 264 208 145 11179 ----
NM_005898chr1122873 227 ------
NM_005899chr171322 ------
NM_005900chr42433 37 167 ----
NM_005901chr18108436 8373 8222 8164 7118 3418 2698 2681 1141 267 33283 1972 1214 26893 1356 15715
NM_005903chr573774 1551 1521 1433 1300 1218 81 ------
NM_005906chr62578 96 1443 ----
NM_005909chr534061 2866 757 --23268 848 21114 585
NM_005911chr23991 919 458 ------
NM_005920chr173099 2993 2764 2559 2446 823 680 13652 21479 673 --
NM_005923chr62593 442 ------
NM_005933chr1172966 2854 2700 2236 818 615 331 --2850 132 --
NM_005934chr1952211 985 370 278 238 --22280 2172 1208
NM_005935chr444740 4394 3626 1859 13942 ----
NM_005937chr1723426 1362 23616 314 2544 400 --
NM_005938chrX2502 75 --1397 1403
NM_005943chr61260 11438 11643 1539
NM_005955chr145323 4642 3374 1499 34806 4227 2125 --11636
NM_005962chr1022139 1608 1480 1394 31996 878 46
NM_005962chr1022139 1608 1480 1394 31996 878 46
NM_005977chr13167 ------
NM_005986chr1362442 2408 2128 1834 1002 604 --12755 --
NM_005990chr541058 783 246 37 --22475 770 --
NM_005998chr1------160
NM_006007chr933003 2882 1380 13928 ----
NM_006011chr1552943 2627 1447 872 176 --23480 3372 --
NM_006016chr632030 1969 1465 12097 ----
NM_006022chr131913 ------
NM_006034chr1172332 1565 1008 868 781 182 156 1713 --21920 39
NM_006037chr284647 4346 4175 3578 1404 1016 621 196 --13214 --
NM_006040chr163942 477 209 --157 --
NM_006054chr111101 ------
NM_006062chr22958 202 --1231 --
NM_006071chr22--122 151 --
NM_006080chr71133 ------
NM_006085chr17432 273 243 217 155 110 85 1936 ----
NM_006095chr41478 --1117 --
NM_006096chr851608 1330 1098 353 135 ------
NM_006113chr131908 796 474 1619 ----
NM_006133chr1192286 2142 2082 992 720 609 562 539 252 1270 31725 931 140 12193
NM_006139chr242831 2048 1074 1044 2530 116 ----
NM_006148chr1792674 2415 2355 2337 2139 375 293 244 58 --22431 1148 --
NM_006152chr121207 ------
NM_006159chr121124 ------
NM_006164chr2------130
NM_006178chr1721550 1081 1442 --1470
NM_006186chr211065 11194 1807 --
NM_006195chr9--11306 --127
NM_006203chr555250 5150 4272 3535 538 1469 ----
NM_006206chr422289 846 ----12123
NM_006223chrX170 ------
NM_006224chr1742311 2215 2104 2010 2809 482 ----
NM_006237chr1321884 1872 --22108 615 12284
NM_006238chr631591 1576 90 1516 21368 544 11280
NM_006243chr121057 823 ------
NM_006246chr1431239 945 523 ------
NM_006251chr53983 617 422 1774 ----
NM_006252chr135383 4754 1030 ------
NM_006255chr14------1335
NM_006275chr2032436 2027 387 21584 237 ----
NM_006283chr863970 3648 3501 3375 1790 271 11321 ----
NM_006288chr11----2994 442 168
NM_006292chr11128 ------
NM_006293chr153772 393 345 1235 3827 363 54 --
NM_006298chr673427 2952 2636 802 671 160 25 1665 12921 --
NM_006306chrX54024 1355 810 301 292 25762 5205 53690 2288 1217 465 227 11261
NM_006307chrX1129 ------
NM_006323chr41687 ------
NM_006324chr16149 ------
NM_006337chr124132 97 66 25 ------
NM_006345chr41540 --1931 --
NM_006350chr5------123
NM_006352chr12771 324 ------
NM_006357chr21398 ------
NM_006359chrX12129 22424 1950 ----
NM_006367chr11294 ------
NM_006371chr394422 3680 3604 3545 3345 3334 1667 1309 162 1493 --11674
NM_006373chr173493 471 429 --1209 21276 1217
NM_006375chrX21308 1279 ------
NM_006378chr92892 164 --31115 1089 285 --
NM_006386chr2242052 1947 694 385 1319 ----
NM_006389chr113946 917 481 11346 1530 --
NM_006393chr1054298 4098 2842 165 23 23705 436 13242 --
NM_006403chr61194 --1442 --
NM_006420chr2053092 2571 1372 1227 573 --11138 --
NM_006421chr82209 110 1850 ----
NM_006434chr1061983 1261 1080 721 376 202 177 --1481
NM_006439chr4----1541 --
NM_006449chr231803 380 326 21764 220 ----
NM_006457chr462939 2506 1561 1362 1271 528 1752 ----
NM_006459chr1031971 1357 537 --21541 611 1732
NM_006482chr122698 239 13366 22628 50 --
NM_006486chr222588 191 ----1144
NM_006489chr1431447 1324 1278 ------
NM_006504chr1042660 1001 915 849 --12304 --
NM_006509chr191401 ------
NM_006517chrX12185 1697 31897 1751 1507 1765
NM_006526chr202688 327 ----11613
NM_006532chr1931545 372 195 11916 --1105
NM_006534chr2043398 713 152 117 1364 ----
NM_006538chr211269 1816 --22685 449
NM_006544chr1455467 5454 4707 4390 1009 ----14872
NM_006546chr1745933 5497 5357 4302 11857 21132 107 --
NM_006557chr921453 1272 ------
NM_006561chr1035582 4289 822 ------
NM_006565chr16137 --1214 1940
NM_006591chr1151523 1473 1419 1255 1212 --11856 --
NM_006595chr1151876 1840 1626 522 91 ------
NM_006599chr1638023 6368 2009 23316 2366 --16279
NM_006601chr12179 ------
NM_006609chr222321 459 ------
NM_006614chr31574 ------
NM_006620chr663537 3264 1768 1628 1314 644 11795 11610 --
NM_006621chr121385 1370 --1817 --
NM_006624chr1022022 445 --1686 --
NM_006628chr1533918 1513 1205 24180 4085 11347 --
NM_006629chr1852746 501 384 190 134 21869 161 12010 --
NM_006646chr1342162 933 885 557 --22803 857 --
NM_006654chr12--1496 14689 --
NM_006667chrX1105 ------
NM_006696chr5125 ----1116
NM_006704chr131374 ------
NM_006720chr1064947 4796 4643 3541 1476 245 24571 153 11779 --
NM_006722chr352665 2617 1940 862 272 ------
NM_006731chr975267 5149 4017 3705 476 428 366 15238 --11294
NM_006736chr241901 1855 1566 84 --51861 1828 1425 383 305 --
NM_006745chr421096 865 ------
NM_006750chr16116833 5991 5961 5873 5437 5101 2646 2229 2071 698 466 11638 16054 27109 2493
NM_006763chr151990 1786 541 239 23 1248 11978 --
NM_006766chr821812 999 12719 --12608
NM_006775chr62780 702 ----12046
NM_006790chr51415 ------
NM_006795chr1141366 1267 1186 100 --2433 163 --
NM_006807chr171998 11219 ----
NM_006812chr121509 --1117 --
NM_006823chr811329 ------
NM_006827chr1443210 2608 1076 570 12767 ----
NM_006833chr71115 --1408 --
NM_006838chr1211559 11411 21531 41 --
NM_006852chr1731859 389 266 --12616 --
NM_006854chr72765 465 --11948 --
NM_006868chr1843062 2755 2519 2036 22900 2022 12837 --
NM_006875chrX----2805 309 --
NM_006885chr1633665 3031 2985 ------
NM_006887chr22245 112 ------
NM_006888chr1452737 2681 2414 2401 336 12878 11027 --
NM_006896chr71199 --1759 --
NM_006908chr71989 ------
NM_006914chr91172 ------
NM_006916chr21109 ------
NM_006922chr2--21983 1967 ----
NM_006924chr1712776 24463 3364 ----
NM_006940chr1221316 712 11496 ----
NM_006947chr421402 435 ------
NM_006948chr2112036 1935 ----
NM_006951chr10----1717 --
NM_006981chr922269 24 ------
NM_006999chr511334 ------
NM_007007chr1223803 1374 ------
NM_007011chr1596195 5927 5637 5607 1653 1645 1286 925 917 1539 25792 1024 --
NM_007013chr81711 ------
NM_007030chr5145120 4945 4720 4699 4665 4322 1535 1318 1089 563 525 364 286 206 --11288 --
NM_007038chr2122348 237 25178 1737 15989 --
NM_007039chr1451684 1512 1449 878 326 1704 ----
NM_007050chr20157728 7201 7166 6869 6612 6560 5437 5372 2727 1987 1579 1078 1059 316 80 22208 1282 35624 2777 629 37537 5497 2327
NM_007052chrX2164 79 ------
NM_007078chr1052781 2751 2367 1166 630 --1119 --
NM_007081chr221837 1791 1445 --
NM_007084chr1341209 1022 995 551 ------
NM_007106chr1352510 711 696 585 217 11137 --1488
NM_007111chr131307 ------
NM_007124chr6----11734 --
NM_007153chr1943500 3202 1269 742 23229 1768 --13002
NM_007157chrX22399 189 11091 22445 212 --
NM_007158chr1--1121 ----
NM_007159chr31708 ----1518
NM_007174chr1221987 215 ------
NM_007175chr843547 1432 559 438 11226 12230 --
NM_007189chr771462 1358 1333 1186 1160 1060 278 ------
NM_007191chr12----1141 --
NM_007202chr171722 ------
NM_007203chr953768 1527 1157 1006 342 33073 2811 1508 ----
NM_007204chr11125 ------
NM_007210chr12102109 852 717 590 560 411 386 324 299 165 11639 22139 1984 --
NM_007212chr1------1123
NM_007219chr204796 733 710 227 1138 1717 --
NM_007222chr811600 ------
NM_007249chr1389301 6941 6542 6340 2730 2508 447 24 --1307 --
NM_007282chr31631 ------
NM_007285chr16------1447
NM_007292chr17105033 3687 3633 3415 3289 1977 1848 1564 1456 314 34587 3490 1940 --13503
NM_007294chr172278 47 ------
NM_007295chr172278 47 ------
NM_007296chr172278 47 ------
NM_007297chr172278 47 ------
NM_007298chr172278 47 ------
NM_007299chr172278 47 ------
NM_007300chr172278 47 ------
NM_007302chr172278 47 ------
NM_007303chr172278 47 ------
NM_007304chr172278 47 ------
NM_007305chr172278 47 ------
NM_007350chr1244358 3424 3226 3142 ------
NM_007353chr742888 2107 1932 33 12734 22317 517 --
NM_007358chr121593 528 1319 ----
NM_007359chr1721210 1177 --1284 11436
NM_007365chr141629 646 317 196 ----1229
NM_007373chr101716 ------
NM_012062chr12163 ------
NM_012063chr12163 ------
NM_012083chr1031050 932 339 --2957 75 --
NM_012097chr2----1649 --
NM_012102chr152468 2050 2030 966 236 ------
NM_012141chr1333799 3637 1106 ------
NM_012161chr43860 102 40 11144 ----
NM_012164chr966729 6377 6099 4629 1938 743 22489 1507 ----
NM_012188chr531000 882 762 ----122
NM_012193chr1195085 3877 3767 3516 2020 1903 1839 902 352 34771 4206 3430 ----
NM_012199chr144552 4085 3154 950 34190 3347 1343 14299 --
NM_012214chr275592 4668 3962 2108 1514 1484 1120 35167 4964 1010 45915 5553 4789 1655 --
NM_012215chr1041658 1366 1239 235 ------
NM_012232chr171547 11551 22143 375 --
NM_012234chr3--12968 ----
NM_012239chr1161300 1127 1029 408 164 119 11546 11133 --
NM_012247chr101219 ------
NM_012249chr223268 564 1505 ----
NM_012257chr71130 ----1928
NM_012259chr6----1411 --
NM_012261chr201666 ------
NM_012262chr134944 842 374 2473 118 ----
NM_012281chr721827 593 ------
NM_012286chrX1538 ------
NM_012290chr21224 --11676 --
NM_012294chr753364 3246 3182 1562 99 33480 2545 44 32490 1581 1192 --
NM_012300chr552239 1856 1699 874 94 ------
NM_012308chr1141947 596 385 131 11608 21001 335 1938
NM_012309chr1184095 1465 1381 1345 1062 946 557 143 23969 3193 13873 13607
NM_012316chr175180 4929 4749 4302 4058 3725 448 35161 4838 2157 25559 1301 14426
NM_012333chr1----1620 --
NM_012334chr564165 4140 3065 1873 1792 506 33120 1741 1281 ----
NM_012339chr103530 500 272 --1183 --
NM_012382chr533963 3438 219 1738 --12932
NM_012388chr1553143 2730 889 670 642 1282 12360 11939
NM_012421chr1----1163 --
NM_012434chr631506 647 301 11282 ----
NM_012446chr5--139 ----
NM_012448chr1722077 441 --12047 1919
NM_012454chr61234 ------
NM_012464chr432528 2286 1969 22647 1143 ----
NM_012471chrX21972 1349 --11434 --
NM_012473chr222705 139 ----1291
NM_012474chr1----1193 --
NM_012479chr722758 2584 12734 ----
NM_013227chr151245 --135 --
NM_013230chrY21117 693 2719 553 ----
NM_013233chr211027 ------
NM_013245chr162732 653 ------
NM_013246chr113654 134 107 187 ----
NM_013255chr798554 7970 6994 6248 6015 1858 1760 1389 959 28244 748 37658 6092 5352 --
NM_013261chr453654 3396 2382 1376 616 13130 --13773
NM_013262chr611257 ------
NM_013269chr1233723 540 227 ------
NM_013277chr121964 ------
NM_013279chr1152087 1691 909 821 224 31956 764 478 22226 1596 --
NM_013281chr2021213 308 ------
NM_013309chr1522613 2332 12303 ----
NM_013333chr191310 ------
NM_013341chr252405 2349 2279 2195 574 12376 11115 --
NM_013371chr11323 1291 ----
NM_013372chr1522827 1136 ----12926
NM_013396chr2111480 ------
NM_013399chr1651711 1655 1603 465 231 1718 41342 1256 431 155 11474
NM_013400chr741014 884 151 142 ------
NM_013411chr131976 1098 73 11953 11817 --
NM_013433chr1931436 515 261 21915 297 11305 1458
NM_013437chr81898 ------
NM_013438chr92593 540 ------
NM_013449chr1232865 885 759 12285 1816 --
NM_013951chr232399 1554 30 12108 1778 --
NM_013952chr232476 1631 107 12185 1855 --
NM_013953chr232476 1631 107 12185 1855 --
NM_013992chr232476 1631 107 12185 1855 --
NM_013995chrX41902 1655 1005 748 22358 2174 ----
NM_013999chr17----174 --
NM_014000chr104710 537 505 466 --163 --
NM_014007chr9166 ----11167
NM_014011chr212130 ------
NM_014021chr14693 659 275 111 12889 13088 --
NM_014023chr1062285 2106 1787 1158 992 226 12922 11904 --
NM_014028chr632567 2330 2274 12301 --12914
NM_014030chr1731230 920 403 1379 2982 929 160
NM_014034chr611315 ------
NM_014048chr1633361 2020 1090 1892 21993 994 14126
NM_014056chr311540 11465 11711 --
NM_014071chr202178 64 ------
NM_014089chr1351937 762 732 644 54 12160 ----
NM_014106chr151693 1850 ----
NM_014109chr811011 ------
NM_014112chr814203 14135 ----
NM_014141chr785166 4855 3625 3356 3327 1842 203 89 24115 3287 ----
NM_014155chr1136779 1339 674 --27258 420 --
NM_014191chr121163 ------
NM_014216chr1451448 1389 651 613 252 --21625 663 21086 57
NM_014217chr12744 98 --1380 1168
NM_014240chr383929 3899 3488 3350 3182 2938 1634 350 --22915 699 14015
NM_014243chr4----11703 --
NM_014283chr111223 1177 ----
NM_014309chr2244196 1303 1250 482 21442 1227 34866 4858 1271 --
NM_014313chr131499 1330 106 ------
NM_014319chr1221248 178 --11677 --
NM_014325chr12----21446 214 --
NM_014351chr2211436 ------
NM_014363chr131211 ------
NM_014372chr111636 --168 --
NM_014374chr741014 884 151 142 ------
NM_014379chr83702 655 89 ----1240
NM_014388chr174926 4563 4269 4129 3692 2342 858 --12197 14400
NM_014396chr741964 1613 1583 788 ------
NM_014397chr92396 54 --11210 --
NM_014398chr321446 214 1140 ----
NM_014423chr543751 2217 2174 1259 1250 ----
NM_014445chr332244 1990 893 21515 161 ----
NM_014469chr111245 ------
NM_014480chr192655 629 ------
NM_014489chr111354 1893 2551 239 --
NM_014494chr1631862 384 251 12156 ----
NM_014502chr111141 --129 1350
NM_014515chr122279 225 ------
NM_014517chr321862 144 ------
NM_014548chr1521384 1374 ------
NM_014554chr1242139 2122 1453 659 ----12257
NM_014572chr1311150 ------
NM_014574chr142417 249 ------
NM_014586chr2184453 3886 3875 3136 1900 1875 841 311 24363 3192 14712 13277
NM_014588chr202306 266 ------
NM_014591chr1031041 490 280 ----1497
NM_014601chr194633 471 337 300 11127 --11334
NM_014613chr542796 2564 987 636 ------
NM_014634chr2283226 2864 2784 2761 2575 1237 1188 612 --43062 2819 1169 648 12455
NM_014636chr9104128 3831 3471 3203 1708 1673 1506 1076 815 78 193 2266 54 --
NM_014646chr1882993 2193 2052 1266 1192 883 378 276 1539 2592 215 --
NM_014647chr1652054 1864 1700 891 171 1361 ----
NM_014655chr112359 --1220 1117
NM_014661chr1083286 1525 846 341 117 98 71 59 --23757 3057 --
NM_014665chr873429 2574 2240 494 330 221 136 --22461 356 13039
NM_014666chr51438 ------
NM_014667chr322057 1714 --150 --
NM_014670chr211359 21398 1152 ----
NM_014671chr71349 --11555 --
NM_014682chr832077 1919 590 11809 ----
NM_014686chr1941931 1823 1665 912 --11810 --
NM_014689chr21188 ------
NM_014701chr152993 941 23148 1253 ----
NM_014702chr623319 66 ------
NM_014707chr721961 229 ------
NM_014717chr193793 298 261 ------
NM_014729chr821896 132 ------
NM_014730chr1265197 4972 4616 3874 1125 607 11854 14897 33662 2060 942
NM_014730chr1265197 4972 4616 3874 1125 607 11854 14897 33662 2060 942
NM_014731chr2051469 1372 506 464 355 --21634 1561 --
NM_014735chrX11829 --1241 1566
NM_014737chr20103901 1605 1526 1457 1344 1243 1164 402 349 25 13576 12634 --
NM_014738chr171700 1302 3227 198 162 11000
NM_014739chr654083 3650 3426 945 543 1748 ----
NM_014741chr1142015 1942 1344 641 --21948 347 1101
NM_014743chr452289 1942 1150 1124 1008 --12656 --
NM_014746chr252915 1767 810 510 115 14124 --13395
NM_014747chr1155486 5244 4757 4656 4482 4343 4271 4208 4071 2291 2018 1147 1016 850 128 --64876 4698 4466 3680 1952 1365 --
NM_014755chr253911 3471 2606 1349 149 ----11458
NM_014756chr111383 ------
NM_014762chr152318 2180 836 338 258 --4712 683 276 212 --
NM_014764chr1211043 ------
NM_014765chr152226 1886 691 449 64 ------
NM_014767chr1033102 983 51 23537 276 33376 3218 595 --
NM_014771chr161110 1417 2907 283 1853
NM_014776chr1242932 2793 2200 1048 ------
NM_014779chr3----1340 11170
NM_014781chr811098 1313 ----
NM_014787chr12722 437 ------
NM_014797chr672795 2707 2434 1221 1124 404 206 12416 ----
NM_014803chr1011835 12176 ----
NM_014810chr17703 613 557 333 305 41 28 --22749 48 --
NM_014819chr51721 ------
NM_014820chr32816 710 11286 ----
NM_014826chr153816 1663 1347 1088 835 --13945 --
NM_014827chr12541 398 ------
NM_014828chr145571 494 370 254 80 ------
NM_014830chr1231379 1022 962 13564 ----
NM_014832chr132654 123 --1711 --
NM_014836chr1031516 1240 187 ------
NM_014839chr12963 355 ----11005
NM_014840chr1293319 2755 2384 2218 1315 1158 479 395 216 1152 ----
NM_014841chr6178 --1983 --
NM_014848chr1542399 2115 2059 562 ----1201
NM_014850chr384311 4217 4170 1720 1673 1550 1504 1216 23764 1146 33516 3397 1661 --
NM_014864chr143994 3797 3556 2996 24036 1466 11500 --
NM_014868chr123825 622 314 1716 ----
NM_014869chr341150 939 444 124 --1980 --
NM_014872chr92748 172 22122 503 ----
NM_014874chr131704 578 144 ------
NM_014876chr2271955 1689 1595 1571 593 332 188 22006 852 ----
NM_014877chr1736611 3086 2692 16185 27348 1839 16653
NM_014893chrY22147 629 ------
NM_014897chr1773268 3238 2504 2219 1976 470 174 12743 ----
NM_014898chr1952227 2205 1588 1558 40 12079 ----
NM_014901chr52305 242 1672 31905 557 475 --
NM_014902chr2011177 --21316 1266 1117
NM_014903chr121777 1647 ----
NM_014904chr1033774 2952 714 1219 --13491
NM_014906chr1721073 464 --13194 --
NM_014912chr1011306 ------
NM_014914chr23824 388 84 ------
NM_014918chr151141 ------
NM_014923chr1332285 1947 1787 ------
NM_014924chr1422227 865 13174 1315 12146
NM_014945chr561513 1495 1479 1355 543 465 11552 ----
NM_014947chr152554 2342 1139 1120 633 11195 ----
NM_014953chr1323932 3884 13517 ----
NM_014961chr421858 259 ------
NM_014964chr1741831 1807 1655 564 ----22191 2083
NM_014969chr12195 56 ------
NM_014982chr1495365 5306 5116 4852 3605 1418 919 528 133 13663 13681 --
NM_014988chr422678 398 22711 2414 --1509
NM_014989chr611905 11371 ----
NM_014992chr141185 ------
NM_015000chr1222466 1127 ------
NM_015008chr333249 2314 404 ------
NM_015025chr221098 436 12445 ----
NM_015026chr1241346 291 142 62 23367 1527 ----
NM_015027chr1631846 580 32 ------
NM_015033chr933145 437 30 11239 2516 314 --
NM_015035chr20166685 6234 6207 5949 5656 5522 5492 5269 5086 5061 4986 4424 4195 1537 1201 113 14329 14626 --
NM_015040chr262997 2546 1327 1297 1209 815 --12968 --
NM_015042chr1543235 3143 2974 690 22666 1171 23627 3170 --
NM_015050chr641064 466 441 373 1432 1924 --
NM_015051chr932934 2562 2499 --11128 --
NM_015052chr72928 419 ------
NM_015055chr1121085 231 ------
NM_015057chr132635 605 ------
NM_015060chr7----1235 --
NM_015061chr91616 ------
NM_015071chr555870 4693 4501 1154 146 23984 2138 25885 28 --
NM_015074chr154765 4365 1983 824 732 11298 24479 3334 1653
NM_015076chr643366 1353 710 140 23019 1508 ----
NM_015079chr15103140 3053 2284 1191 975 820 443 207 97 67 --13062 --
NM_015082chr521997 938 1216 11943 126
NM_015090chr1145758 5530 5081 4737 4650 4435 3980 2209 2165 2071 1736 1630 1225 794 11979 45657 4028 640 237 56132 5324 1934 1768 556
NM_015092chr1653779 1770 1740 1516 22 ------
NM_015100chr121709 1525 11361 --1205
NM_015107chrX21646 774 1595 1848 1368
NM_015110chr932180 1799 546 1243 1341 --
NM_015113chr1752357 1949 808 308 112 --12027 --
NM_015115chr422354 1150 11097 ----
NM_015116chr136626 440 432 325 313 71 ----11715
NM_015120chr2177 ------
NM_015124chr2232277 2228 104 11001 22348 1730 --
NM_015130chr41314 ------
NM_015132chr71598 --11789 11411
NM_015137chr8----162 --
NM_015143chr421216 253 ------
NM_015144chr1663673 3389 3180 843 420 88 23800 3439 ----
NM_015147chr232155 2125 169 11016 12278 --
NM_015149chr12620 435 --11359 --
NM_015153chr61496 ------
NM_015157chr1141123 953 362 93 --11140 --
NM_015176chr121264 1220 ------
NM_015178chr822177 519 22397 1739 22089 174 --
NM_015184chr3------1457
NM_015185chrX22022 548 --22621 2290 --
NM_015191chr1152167 1961 948 582 428 ----1809
NM_015192chr202841 432 ------
NM_015193chr821065 70 11208 11112 --
NM_015198chr711144 ------
NM_015202chr1641296 1283 387 307 --1470 1681
NM_015213chr11--1519 1309 --
NM_015215chr122340 1004 ------
NM_015216chr52973 331 ------
NM_015219chr1792596 2351 2083 1924 1897 1837 1658 89 79 --1147 --
NM_015225chr931223 731 228 ------
NM_015226chr1643257 2139 2113 275 13292 43358 2596 1113 291 --
NM_015229chr1741132 790 387 372 --1771 --
NM_015231chr11------1607
NM_015236chr4159 ------
NM_015238chr51543 ----197
NM_015245chr652714 2387 1783 806 641 --42338 2020 999 149 --
NM_015247chr1663634 3358 2012 1678 1165 485 14678 ----
NM_015250chr962037 1786 1532 1302 237 197 ------
NM_015252chr21661 ----1945
NM_015254chr862144 2047 2032 1139 573 50 12204 32667 621 156 --
NM_015263chr151136 ------
NM_015265chr21551 11003 ----
NM_015270chr1232227 505 363 11959 31559 383 95 --
NM_015272chr1611898 --21777 1600 --
NM_015277chr1841819 1417 1345 1295 --21404 1213 --
NM_015284chr151400 394 257 117 48 --194 11732
NM_015288chr542949 961 278 89 23335 383 32391 1088 713 --
NM_015291chr161345 1244 1153 785 668 378 42627 2321 1101 949 11254 --
NM_015294chr171954 ------
NM_015296chr131379 ------
NM_015299chr1483631 3599 3503 2995 1599 1541 827 109 22477 500 33130 2734 423 2480 320
NM_015310chr8167725 7398 7345 7305 7188 6805 6797 5979 5620 5598 5507 3349 3131 2116 1310 475 38196 2425 2293 37090 6761 6465 17299
NM_015313chr1144426 2925 1068 947 ----11183
NM_015315chr553350 2715 1011 177 134 --22874 494 --
NM_015317chr231946 873 212 ------
NM_015321chr19194656 4420 4344 3926 3575 3522 3516 3378 3240 1925 1835 1154 1097 1083 590 498 393 243 222 24805 3434 64368 3804 3257 1788 304 107 24054 3837
NM_015335chr1212468 ------
NM_015336chr12133 11985 ----
NM_015338chr2011355 2722 534 1235 --
NM_015347chr1212651 ------
NM_015358chr212501 206 ------
NM_015365chrX33824 1032 494 --129 --
NM_015374chr224415 399 389 157 --11354 --
NM_015375chr1124687 4372 3801 3565 1990 1960 1392 1129 947 917 435 183 14343 ----
NM_015378chr152956 2028 1942 940 594 12696 22856 2723 12344
NM_015381chr2241845 1603 1573 1304 --1167 --
NM_015385chr1061983 1261 1080 721 376 202 177 --1481
NM_015388chr6----1117 --
NM_015393chr453402 2525 881 792 432 23567 233 ----
NM_015435chr821281 574 ------
NM_015443chr171207 1387 ----
NM_015448chr103180 165 121 1147 ----
NM_015455chr521128 1066 --1182 --
NM_015458chr884641 4160 4130 3908 2047 1991 766 39 22018 1399 21806 1008 --
NM_015472chr31496 --150 --
NM_015472chr31496 --150 --
NM_015475chr21965 ------
NM_015483chr72170 30 ------
NM_015484chr11722 ------
NM_015497chr151863 ------
NM_015503chr162569 176 ------
NM_015520chr332841 2494 1886 12610 --22020 710
NM_015526chr191218 ----21345 71
NM_015534chr11131 ------
NM_015542chr102386 297 1336 ----
NM_015548chr6133 ------
NM_015550chr7--22678 2597 1787 --
NM_015554chr1512218 --12332 --
NM_015557chr153557 3471 3365 2528 956 12557 32214 1406 963 2186 49
NM_015564chr533336 2295 636 13608 --1902
NM_015569chr154694 4087 3992 3749 1373 --13642 --
NM_015570chr711586 1418 ----
NM_015575chr293368 3032 2502 2394 1366 850 696 642 581 ------
NM_015576chr31183 ----1687
NM_015590chr11703 ------
NM_015602chr141356 1148 374 272 ------
NM_015609chr162832 2166 959 781 646 96 22512 2474 32951 1047 764 --
NM_015626chr172390 147 ------
NM_015635chr92797 200 1158 1641 --
NM_015640chr175122 4952 4641 4585 4087 3834 1686 14193 ----
NM_015646chr12------129
NM_015686chrX31854 1717 847 --22344 856 --
NM_015711chr191628 1132 ----
NM_015726chr12193 54 --11515 --
NM_015833chr2132328 2297 315 12067 ----
NM_015840chr12897 282 --22078 1656 22339 1706
NM_015841chr12897 282 --22078 1656 22339 1706
NM_015850chr831536 1506 663 --2345 69 12074
NM_015874chr41502 1644 ----
NM_015878chr811844 ------
NM_015879chr18127146 7069 7051 6684 6630 6530 6510 2998 2686 2026 1618 1409 47096 5850 3406 2081 ----
NM_015898chr1982476 2406 1680 519 502 462 380 340 ------
NM_015906chr113691 11315 11024 --
NM_015912chr882238 1961 1789 1681 1551 800 297 178 --21771 1734 --
NM_015939chr201554 ------
NM_015975chrX31859 235 50 ------
NM_015980chr511560 --1649 11498
NM_015982chr17----1398 --
NM_015995chr15105083 4823 4383 3952 3917 1405 1386 748 547 44 --21717 864 --
NM_016002chr13270 178 90 ------
NM_016009chr134306 3275 264 13582 23851 903 --
NM_016018chr82886 525 --12437 --
NM_016021chr623024 23 11923 ----
NM_016025chr1611962 ----1683
NM_016032chrX31076 905 242 --1402 --
NM_016061chr231465 1434 307 1286 ----
NM_016070chr17--161 ----
NM_016075chr1342767 2462 2173 1113 169 ----
NM_016083chr673707 3447 3303 1436 1422 840 708 ------
NM_016098chr6------159
NM_016120chrX21125 473 2801 119 ----
NM_016131chr221641 409 --1690 --
NM_016132chr1522757 2348 ------
NM_016151chr162409 40 ------
NM_016206chr3108370 6847 2716 2683 2621 2545 2481 2451 2085 1792 18669 22666 220 --
NM_016220chr732186 1867 1847 ------
NM_016227chr111223 1177 ----
NM_016231chr171495 1417 11413 --
NM_016235chr1621204 583 1361 11494 --
NM_016258chr11819 ------
NM_016260chr267515 6636 5334 5289 4803 538 ------
NM_016269chr421163 310 ------
NM_016271chr1811682 ----22220 416
NM_016275chr311922 --1709 --
NM_016289chr231599 868 369 ------
NM_016291chr31234 ------
NM_016297chr283607 3053 2892 2666 1515 1148 327 70 43617 3417 2341 300 ----
NM_016315chr221448 289 ------
NM_016329chr3121 ------
NM_016357chr121891 --122 --
NM_016358chr53426 349 69 --3366 203 197 --
NM_016376chr1773667 3567 2795 1597 430 378 243 1552 24228 677 --
NM_016395chr15136 --21672 1274 1516
NM_016418chr2242731 2591 1428 197 23111 2362 33672 998 287 --
NM_016427chr181120 ------
NM_016436chr2032374 2286 482 12596 --1128
NM_016441chr212232 ------
NM_016448chr121875 1725 --252 27 --
NM_016451chr111101 ------
NM_016480chr51921 ------
NM_016507chr1752148 2115 2077 604 486 --11066 --
NM_016511chr121744 136 1163 --
NM_016525chr91152 --1165 --
NM_016530chr151823 12963 ----
NM_016531chr451475 1222 1127 760 636 ------
NM_016542chrX21291 87 ------
NM_016575chr1264774 4073 3635 1677 820 77 34811 3407 1533 14885 14764
NM_016591chr51268 ----1222
NM_016603chr522094 751 ------
NM_016604chr511078 ------
NM_016605chr531831 1053 248 1387 1786 --
NM_016621chr1184383 4144 3047 2897 2865 1178 1168 735 11493 23455 3246 14109
NM_016626chr182309 283 ------
NM_016628chr103718 108 73 ------
NM_016654chr152146 140 ------
NM_016836chr21688 ------
NM_016839chr21688 ------
NM_016932chr23858 121 22 --1227 --
NM_016936chr1622090 1742 --31707 281 218 --
NM_016950chr4--1477 ----
NM_016952chr1133208 2702 561 32656 1542 710 ----
NM_016953chr295858 4551 4271 3751 2334 2304 1569 997 134 21831 1787 1323 --
NM_017409chr12193 ------
NM_017415chr563841 3189 2898 1659 1311 216 23684 1743 13406 12946
NM_017420chr1411280 ------
NM_017447chr2133853 1693 618 ------
NM_017481chr11--1199 ----
NM_017488chr211428 ----1157
NM_017491chr42992 377 ------
NM_017519chr6------1407
NM_017548chr311717 --1316 11785
NM_017553chr15----1935 1105
NM_017563chr3106026 5948 5918 5160 4179 3915 1574 737 594 352 34074 2541 545 11922 --
NM_017569chr13140 ------
NM_017575chr1741493 393 265 216 --1584 194
NM_017577chr321654 1157 ------
NM_017582chr111786 ------
NM_017590chr2242516 2381 1048 220 1642 1819 --
NM_017596chr173983 3803 3474 3359 3331 3027 326 11660 84208 3343 3243 2867 1770 1077 1024 80 --
NM_017610chr151532 ------
NM_017612chr12----1163 --
NM_017626chr101577 --11353 21712 74
NM_017629chr111936 1180 ----
NM_017637chr978622 8293 8080 8060 7343 5890 3306 --26965 1706 --
NM_017644chr32984 929 34275 3933 956 ----
NM_017684chr153781 526 350 1691 ----
NM_017693chr1321256 497 --11170 --
NM_017709chr163917 2921 2847 1145 382 306 23184 181 32634 2623 930 --
NM_017714chr20----150 --
NM_017715chr71643 1729 1563 --
NM_017719chr322066 1718 ------
NM_017736chr1622904 641 11129 ----
NM_017739chr11181 ------
NM_017745chrX--1653 ----
NM_017752chrX41880 1482 820 686 --11987 --
NM_017753chr91422 ------
NM_017763chr1761021 1002 810 457 295 51 ------
NM_017778chr81204 ------
NM_017780chr81324 ------
NM_017787chr1042837 2556 2477 2245 2857 524 32438 2022 554 --
NM_017791chr1441120 1040 610 554 21515 1376 ----
NM_017798chr2021137 983 1387 1814 --
NM_017801chr322063 1970 --158 --
NM_017811chr91759 ------
NM_017813chr835211 3573 1614 35585 4833 303 1286 --
NM_017824chr1021058 832 ------
NM_017830chr46910 872 828 737 713 79 ------
NM_017848chrX2693 368 --11691 13271
NM_017851chr1521061 93 1873 ----
NM_017860chr11361 ------
NM_017893chr1021437 511 1992 11229 159
NM_017902chr1085403 4837 3946 3795 2067 1740 1042 482 --55632 5038 1660 1203 668 --
NM_017907chr112423 161 ------
NM_017919chr985815 4667 3889 3863 1524 1458 1421 202 ----12227
NM_017921chr1792310 2012 1723 1699 1660 1653 876 134 70 ------
NM_017929chr2241265 1252 903 429 --11236 --
NM_017938chrX32089 1903 1624 ------
NM_017948chr9--1341 ----
NM_017952chr264398 3324 1754 1592 1542 313 13025 --13880
NM_017988chr122275 53 ------
NM_018000chr271788 844 814 788 593 393 338 ------
NM_018003chr1521852 297 21760 290 181 --
NM_018015chrX21035 111 ------
NM_018024chr83556 483 141 ------
NM_018027chr1012613 32876 2277 109 ----
NM_018031chr3129 --1565 1605
NM_018036chr1423873 3541 ------
NM_018045chr161132 811 787 371 344 169 --1439 --
NM_018046chr511906 ------
NM_018053chr12749 721 --4732 224 168 144 --
NM_018063chr10----1159 --
NM_018085chr196949 6356 6238 2509 2484 1848 1595 1308 1172 16327 27452 2326 137
NM_018105chr821142 920 ------
NM_018115chr42740 290 ------
NM_018121chr1063065 2906 2345 2220 1226 491 ------
NM_018133chr31690 ------
NM_018155chr3--11211 ----
NM_018156chr152956 2028 1942 940 594 12696 22856 2723 12344
NM_018157chr1252831 2358 2248 1109 824 11091 12520 --
NM_018178chr12384 66 --11490 --
NM_018182chr1721854 728 --12061 11745
NM_018184chr321583 1426 ----1338
NM_018201chr992420 1940 1898 1887 992 974 507 405 356 42499 2065 1596 389 22262 453 31998 751 261
NM_018244chr2021248 937 11078 --11276
NM_018247chr622718 2581 ------
NM_018293chr312304 ----12917
NM_018299chr82915 157 ----22493 2145
NM_018307chr171290 ------
NM_018313chr332536 1026 736 11725 ----
NM_018327chr20----1676 --
NM_018334chr71339 ------
NM_018351chr1243639 3394 1697 1499 --1856 --
NM_018357chr15----1360 --
NM_018361chr853732 2884 2816 1012 327 23324 2959 ----
NM_018362chr1132942 1461 704 23451 2806 ----
NM_018364chr121095 890 ------
NM_018367chr1122070 1748 1445 --12420
NM_018373chr14106103 4679 4310 3948 1539 1015 808 790 676 294 11510 14333 --
NM_018374chr715099 14610 ----
NM_018375chr1431710 1349 155 ------
NM_018388chrX31418 1299 333 ----1978
NM_018403chr363592 3004 1294 568 107 74 12975 13064 --
NM_018416chr1242536 2280 764 720 ------
NM_018424chr911760 1702 ----
NM_018429chr51134 12409 ----
NM_018433chr2----1379 --
NM_018440chr887208 6396 6366 6086 5248 2798 2194 196 22858 1974 37701 7187 5989 --
NM_018448chr1211227 ------
NM_018452chr6_random53104 3043 2593 2366 818 13009 ----
NM_018489chr121562 104 ------
NM_018509chr1711747 --11657 --
NM_018557chr21137 ------
NM_018566chr184560 2019 1834 783 682 477 378 370 23875 3583 21812 515 --
NM_018571chr2----1515 --
NM_018584chr12819 197 --1987 --
NM_018602chr1531721 1063 136 ------
NM_018638chr1234925 1349 33 ----12049
NM_018640chr1232730 2644 451 ------
NM_018650chr1--1685 ----
NM_018657chr31622 ------
NM_018667chr1651907 1865 807 547 513 --41983 1052 782 169 159
NM_018685chr721155 312 ------
NM_018695chr51701 ------
NM_018700chr5189 ------
NM_018704chr12643 167 --1613 21990 73
NM_018710chr811208 ------
NM_018711chr121491 --121 --
NM_018717chr462456 1915 1839 688 448 113 11147 ----
NM_018890chr71989 ------
NM_018898chr52382 100 ------
NM_018899chr52382 100 ------
NM_018900chr52382 100 ------
NM_018901chr52382 100 ------
NM_018902chr52382 100 ------
NM_018903chr52382 100 ------
NM_018904chr52382 100 ------
NM_018905chr52382 100 ------
NM_018906chr52382 100 ------
NM_018907chr52382 100 ------
NM_018908chr52382 100 ------
NM_018909chr52382 100 ------
NM_018910chr52382 100 ------
NM_018911chr52382 100 ------
NM_018945chr653532 2911 2487 367 101 ------
NM_018947chr784963 4455 4385 4268 4081 3969 1478 1414 24356 3547 24629 1983 --
NM_018948chr12413 392 11309 ----
NM_018959chr191549 ------
NM_018970chr742781 1269 786 52 --12794 --
NM_018999chr1054304 3999 3272 1032 916 ------
NM_019000chr521538 1417 ------
NM_019001chr333521 1942 430 ------
NM_019004chr742132 1575 1554 499 ------
NM_019006chr152592 29 ------
NM_019027chr412347 --1676 --
NM_019044chr274477 3251 3129 2966 964 559 483 1769 22878 1601 21513 852
NM_019046chr105847 784 754 116 52 ------
NM_019053chr1021122 58 ------
NM_019058chr102662 334 ------
NM_019064chr172807 120 ------
NM_019072chr521616 458 ----12601
NM_019102chr72143 26 ------
NM_019102chr72143 26 ------
NM_019106chr2232657 2163 459 33249 2583 373 11016 --
NM_019116chr1683202 3048 2954 2290 890 794 744 640 22859 1504 1852 22998 2401
NM_019556chrX21117 206 ------
NM_019558chr2------1274
NM_019593chr20170 --12192 --
NM_019596chr2142674 2039 725 605 1649 ----
NM_019848chrX1144 ------
NM_019857chrX1613 1416 ----
NM_019859chr101262 --2355 72 --
NM_019860chr101310 --2403 120 --
NM_020039chr121324 --11697 --
NM_020064chr92568 540 --1486 1475
NM_020116chr4----11585 --
NM_020130chr831339 528 503 ------
NM_020132chr2154327 3132 1878 1135 703 1139 1966 13580
NM_020144chr711556 ----1374
NM_020151chr22422 317 ----2623 256
NM_020154chr15--199 ----
NM_020156chr71165 ------
NM_020177chr512617 1988 ----
NM_020178chr1721025 943 ------
NM_020179chr11----1105 --
NM_020184chr24741 584 171 52 22085 220 --1665
NM_020188chr161258 ------
NM_020193chr111349 ------
NM_020199chr52186 107 11147 ----
NM_020200chr1021074 441 --1274 --
NM_020235chr3176 ------
NM_020239chr122088 1761 ------
NM_020245chr634915 4668 4127 13894 21542 306 --
NM_020248chr151776 916 827 801 73 --32124 721 65 --
NM_020309chr19163 ------
NM_020310chr176975 951 944 866 725 524 --21807 833 1157
NM_020338chr1043225 2370 476 243 11494 11284 1742
NM_020342chr22665 131 ------
NM_020346chr11--1286 ----
NM_020354chr103863 764 29 --1849 --
NM_020373chr121535 ----1430
NM_020390chr323255 292 21545 1203 1942 --
NM_020416chr451020 951 826 473 152 12059 1731 --
NM_020420chrY1518 21439 673 ----
NM_020423chr11495 ------
NM_020424chr161185 2816 36 ----
NM_020429chr72449 366 1592 33095 2686 328 --
NM_020432chr731956 1644 677 ------
NM_020440chr162821 2328 718 596 452 161 13013 13024 12194
NM_020443chr175858 5626 2479 2384 2214 1540 314 26105 6017 46951 5494 1904 1631 --
NM_020449chrX171 ------
NM_020452chr112078 ------
NM_020463chr221376 60 ------
NM_020474chr1851776 1690 1369 701 44 ------
NM_020651chr22219 158 ------
NM_020654chr31257 ------
NM_020673chr2057204 5589 5160 1475 104 26365 5319 22180 1977 --
NM_020699chr1105328 5027 4993 4546 4429 4155 3723 1946 1911 1171 34834 1076 805 14282 --
NM_020703chr1--1527 ----
NM_020704chr762550 2306 2276 1849 781 119 ------
NM_020708chr2042178 1677 1644 859 --11990 --
NM_020715chr1432213 1437 744 1600 ----
NM_020718chr1655815 5355 4180 1846 412 1106 --15432
NM_020728chr752866 2049 1063 882 673 22837 2463 ----
NM_020732chr6------1407
NM_020737chr61236 --1230 --
NM_020738chr22489 294 1600 1638 11439
NM_020740chr17198 ------
NM_020748chr172388 352 11462 1234 --
NM_020766chrX44255 3495 1768 485 13572 ----
NM_020771chr611408 ------
NM_020772chr1748300 7307 2058 1988 36883 6339 5227 11145 --
NM_020791chr171110 1455 --11223
NM_020796chr532733 2278 859 1296 2887 172 --
NM_020800chr311384 ------
NM_020804chr642183 2051 1881 633 --32281 1747 292 --
NM_020807chr1641801 1521 644 50 1536 137 --
NM_020813chr1951029 872 805 489 273 12107 1634 12037
NM_020819chr611015 ------
NM_020821chr153781 526 350 1691 ----
NM_020824chr101511 ------
NM_020830chr222306 916 1281 ----
NM_020831chr2231004 686 99 ------
NM_020841chr1223788 3003 23732 203 ----
NM_020845chr1252486 936 328 96 77 --22347 2153 12428
NM_020850chr1622548 554 2675 628 42428 2285 1241 360 1326
NM_020859chr463027 2917 1216 703 625 570 ----12899
NM_020866chr131301 ----1734
NM_020868chr2--1785 1407 --
NM_020871chrX2999 718 ------
NM_020888chr162024 1979 1876 1579 1338 342 --11788 --
NM_020899chr1772263 2214 1743 848 775 714 285 ------
NM_020909chr264146 3521 3478 2935 1502 1146 --13791 --
NM_020918chr101928 1456 ----
NM_020922chrX2710 297 ------
NM_020925chr1--1132 --1320
NM_020927chr162808 497 1574 --1133
NM_020935chr284337 4270 3734 1628 1598 1380 1241 1088 24443 352 13089 --
NM_020940chr1032407 2264 1129 --12895 --
NM_020946chr951566 1524 512 458 221 ----21506 295
NM_020947chr1621694 794 --11971 --
NM_020948chr142609 633 438 119 --2798 713 --
NM_020951chr1922322 857 32096 1910 1608 ----
NM_020956chr19103872 3816 3652 3520 3338 3062 921 424 260 238 126 23471 293 --
NM_020962chr152370 274 --12315 11555
NM_020971chr19--1301 1269 --
NM_020975chr1041945 1860 787 561 --1227 --
NM_020983chr1232227 505 363 11959 31559 383 95 --
NM_020988chr161200 ------
NM_020995chr16------1138
NM_021007chr211784 ------
NM_021012chr1782837 2565 1058 1019 765 612 324 79 12504 32996 2266 1006 --
NM_021020chr883125 2859 2618 1092 1023 795 721 510 --13070 33290 3152 471
NM_021033chr133295 162 135 ------
NM_021061chr844211 3768 3128 2818 --13503 --
NM_021069chr431433 833 169 ----1748
NM_021083chrX63578 3185 292 189 123 75 ------
NM_021090chr22114719 4422 4327 3976 3426 1635 1251 1137 1105 521 66 --1863 2778 551
NM_021097chr231880 1215 516 ------
NM_021101chr331668 1636 1579 ------
NM_021111chr911076 ------
NM_021116chr7139057 7812 7404 6499 6469 6381 6116 5866 3241 3017 2995 2143 489 17581 58449 8111 2291 2261 1399 11686
NM_021133chr131298 584 565 1389 174 --
NM_021136chr14--1181 ----
NM_021148chr722394 637 --11938 --
NM_021155chr1942864 2815 2744 197 22993 854 12468 11837
NM_021158chr202695 289 1596 --185
NM_021161chr14129 --1480 --
NM_021163chr733497 775 417 --13838 --
NM_021183chrX31748 1689 420 --1105 --
NM_021191chr1222181 1942 32368 2309 67 1259 --
NM_021198chr24992 317 191 96 ----1917
NM_021202chr2072729 2599 2550 2337 1182 938 527 --1492 --
NM_021205chr132863 2015 179 ------
NM_021215chr2051856 1666 1583 397 169 --11962 --
NM_021239chr1421378 1323 ------
NM_021249chr1441471 1395 1316 1260 ------
NM_021252chr1022110 1276 11626 ----
NM_021255chr1424146 2775 ------
NM_021260chr1471314 1259 1002 886 521 402 151 ------
NM_021622chr1012231 11469 ----
NM_021625chr12----1398 --
NM_021627chr3----2906 118 --
NM_021633chr111344 ----11222
NM_021635chr621970 1940 1253 --1430
NM_021637chrX21186 960 --11067 --
NM_021638chr484333 3166 1696 1223 1105 1082 447 361 13346 33947 1987 129 23310 1757
NM_021647chr474273 4103 1319 1313 802 790 329 ----12956
NM_021724chr17----1293 --
NM_021728chr143763 725 47 ------
NM_021738chr101583 ------
NM_021783chrX51968 1876 786 722 22 12376 --1695
NM_021809chr2072450 2297 2201 2024 1739 594 319 11618 11941 11754
NM_021813chr654591 3584 1861 866 754 25232 4374 --14478
NM_021817chr11313 ------
NM_021821chr121842 ------
NM_021872chr2051143 1047 928 757 66 ----11109
NM_021873chr2051143 1047 928 757 66 ----11109
NM_021908chr72825 712 ------
NM_021911chr573598 2044 2034 1474 601 540 250 13765 ----
NM_021912chr1521584 43 43747 2845 625 506 12856 --
NM_021913chr1921798 326 21780 695 ----
NM_021914chr1431835 712 430 --1113 --
NM_021923chr421493 270 ------
NM_021940chr61451 ------
NM_021943chr64528 349 252 91 ------
NM_021946chrX31212 571 394 --31248 976 339 --
NM_021956chr61246 ------
NM_021961chr1135904 4566 2912 16321 22672 2395 --
NM_021964chr342563 2253 2239 412 --15690 --
NM_021984chrX1488 1232 21369 193 11191
NM_021987chrX1488 1232 21369 193 11191
NM_021990chrX1488 1232 21369 193 11191
NM_021998chrX1455 ------
NM_022006chr193355 112 40 ------
NM_022039chr101539 --1112 2552 29
NM_022041chr162151 102 1663 --1871
NM_022048chr15105541 5499 5466 5217 4698 2541 2061 958 474 210 46374 5307 1096 397 11387 --
NM_022064chr3172 --2176 59 --
NM_022073chr1411208 ------
NM_022080chr2022784 1939 32745 2363 111 ----
NM_022114chr133240 779 572 --14078 13646
NM_022118chr131571 ------
NM_022143chr7----1638 --
NM_022153chr10113329 3279 2458 2311 1331 1264 1237 1138 895 336 120 158 42350 1374 1369 1029 1380
NM_022166chr1646099 4694 642 455 22075 23 31941 807 682 22419 989
NM_022170chr751656 1421 1226 179 61 ------
NM_022340chr363511 2801 1029 999 332 28 12891 2749 469 13502
NM_022373chr71181 ------
NM_022456chr12126935 6321 5390 2863 2812 2787 2286 2162 2153 638 402 95 22729 2518 26454 6284 15318
NM_022458chr732112 1950 1205 1604 12246 --
NM_022459chr1365894 5721 3993 2349 501 72 34748 1702 1664 14391 --
NM_022465chr1232136 2108 247 --11173 --
NM_022470chr331227 792 239 ------
NM_022477chr20--11377 ----
NM_022483chr531877 1790 525 ------
NM_022485chr31150 --145 --
NM_022497chr383781 2591 1052 1027 833 420 382 294 22618 575 1182 11220
NM_022648chr274194 3976 3563 3339 3129 1153 969 33743 1462 103 11336 11419
NM_022650chr5--1127 1244 --
NM_022658chr12--11359 1295 --
NM_022719chr22123390 3001 2906 2896 1485 1398 1321 1186 1043 964 577 450 12851 33696 1459 552 1101
NM_022728chr7177 ------
NM_022735chr1--1266 ----
NM_022737chr192834 236 --179 --
NM_022739chr17--1803 ----
NM_022758chr632624 2383 378 12234 23004 2253 --
NM_022763chr322273 632 ------
NM_022766chr2262616 2193 2028 1771 1687 933 11999 1369 --
NM_022768chr12367 136 ------
NM_022776chr321249 82 ------
NM_022781chr932997 2926 2845 ----13112
NM_022802chr102577 407 ------
NM_022817chr222195 1439 11599 12126 --
NM_022824chr541437 732 318 186 ------
NM_022828chr51381 --11220 --
NM_022838chrX1247 ------
NM_022842chr332393 643 29 ----1283
NM_022893chr22416 308 1605 ----
NM_022898chr1444732 4537 1628 365 --13242 --
NM_022899chr341228 610 451 179 --1983 --
NM_022912chr232825 2645 1029 174 ----
NM_022970chr1021062 58 ------
NM_022977chrX1677 ------
NM_023000chr141628 ------
NM_023001chr141628 ------
NM_023010chrX2740 613 ------
NM_023011chr132324 187 ------
NM_023015chr12714 154 ------
NM_023075chr182709 653 1680 ----
NM_023076chr1621177 31 --22256 701 --
NM_023105chr831536 1506 663 --2345 69 12074
NM_023106chr831536 1506 663 --2345 69 12074
NM_023110chr831536 1506 663 --2345 69 12074
NM_023111chr831536 1506 663 --2345 69 12074
NM_023923chr152497 1395 1231 1063 959 53214 2873 2739 2468 929 --13480
NM_023928chr123981 756 741 --1227 1327
NM_024016chr17--1196 1300 --
NM_024034chr203328 123 64 ------
NM_024043chr162177 62 --31411 1193 302 11225
NM_024045chr10131 ------
NM_024111chr153265 98 89 --2570 559 1636
NM_024294chr632624 2383 378 12234 23004 2253 --
NM_024297chr17----156 --
NM_024306chr161985 --1328 --
NM_024312chr1241240 473 202 43 ------
NM_024336chr161363 ------
NM_024345chr945065 4591 795 545 --11393 11006
NM_024430chr1811422 11582 1589 1349
NM_024501chr21546 ------
NM_024511chr453519 2371 1160 881 192 1596 12971 --
NM_024522chr161591 754 694 294 184 38 --21509 513 21742 594
NM_024524chr3--11210 12213 --
NM_024529chr1------1336
NM_024586chr11493 ------
NM_024594chr541880 1514 1444 240 ------
NM_024607chr843059 1806 1719 1206 13867 1508 --
NM_024639chr62706 298 --1238 --
NM_024645chr831379 1139 1046 ------
NM_024646chr123522 1521 32959 2457 192 12715 --
NM_024657chrX1505 ------
NM_024659chr2----1115 --
NM_024665chr324368 1651 ------
NM_024692chr231882 1785 1175 ----1671
NM_024704chr2031116 748 167 1317 1335 --
NM_024713chr1521426 1287 ------
NM_024721chr81580 12012 ----
NM_024726chr22163 61 ------
NM_024740chr1133351 3050 137 13210 ----
NM_024753chr2184 1678 ----
NM_024761chr955337 5060 1035 181 56 11136 ----
NM_024770chr2136753 6689 6593 6288 5890 5350 4368 2140 1539 869 843 708 135 11705 --15398
NM_024825chr193304 274 248 ------
NM_024835chr171325 ------
NM_024837chr151496 11670 ----
NM_024884chr14133578 1659 1046 813 800 770 744 683 631 541 515 418 260 24131 3740 14195 --
NM_024900chr43572 298 169 11575 ----
NM_024900chr43572 298 169 11575 ----
NM_024920chr4------11137
NM_024921chrX1720 11442 ----
NM_024922chr1631639 482 310 --21648 1399 22016 1368
NM_024930chr51361 22449 1941 ----
NM_024939chr1621190 429 --31201 422 61 1252
NM_024946chr1621288 1177 ------
NM_024947chr379550 9389 7030 3287 3225 2645 1676 28334 7583 12665 --
NM_024949chr474983 4262 3788 3050 1839 1704 328 14467 11584 --
NM_024989chr248088 7655 2719 1651 25072 2459 12964 --
NM_024991chr1061983 1261 1080 721 376 202 177 --1481
NM_024997chr1621211 105 ------
NM_025054chr811551 1920 14028 2666 65
NM_025058chr11712 1649 3624 245 42 --
NM_025061chr192751 159 ------
NM_025073chr134478 1910 312 14142 ----
NM_025074chr422995 1972 --22349 431 1153
NM_025083chr1551344 802 793 268 214 21465 354 41878 1572 579 327 --
NM_025106chr131378 753 298 --154 --
NM_025133chr2--1417 ----
NM_025134chr1622496 597 --1713 --
NM_025135chr18133 --1368 --
NM_025146chr342308 2253 1034 501 12277 ----
NM_025154chr711052 ------
NM_025160chr123970 2632 ------
NM_025164chr1122034 757 ------
NM_025165chr15123 ------
NM_025179chr174015 3836 3789 3719 1862 1483 954 11047 34450 1306 763 --
NM_025187chr166877 558 492 250 167 63 --11170 --
NM_025195chr831806 328 176 1411 1751 --
NM_025208chr11----1135 --
NM_025221chr42203 161 ------
NM_025222chr362578 2508 2256 2218 902 100 1885 ----
NM_030594chr151509 --11225 1939
NM_030621chr1422692 1582 ------
NM_030625chr1021872 1689 ------
NM_030627chr51605 ------
NM_030628chr11135 ------
NM_030634chr11852 22008 113 182 --
NM_030637chr141212 ------
NM_030647chr714657 --12036 --
NM_030648chr425374 1507 11943 25178 4189 11458
NM_030650chr254263 3978 3396 1514 757 ----1670
NM_030664chr103952 365 200 ------
NM_030670chr1231872 514 419 11566 ----
NM_030671chr1231872 514 419 11566 ----
NM_030674chr1264370 3863 2221 1632 1560 1234 15755 25676 4874 1801
NM_030758chr2221106 1088 --2582 248 --
NM_030762chr12------2708 394
NM_030767chr932458 2168 1982 --22626 2049 --
NM_030806chr1139283 8645 6691 6277 3712 3599 3314 2861 1570 1199 1050 834 496 27640 6954 47937 7228 3185 471 --
NM_030816chr153245 3229 2727 780 151 ------
NM_030881chr2242052 1947 694 385 1319 ----
NM_030885chr32622 171 1678 1515 --
NM_030906chr11----197 --
NM_030915chr232092 456 88 11483 12179 --
NM_030918chr185222 5027 4702 4393 1947 1915 1039 252 64382 3578 3336 2111 675 28 24510 1104 --
NM_030927chr1031415 520 409 --1513 2605 31
NM_030934chr121813 138 ------
NM_030958chr81360 ------
NM_030964chr563035 2762 1347 888 620 450 ----21133 765
NM_030965chr1------2556 73
NM_030979chr131412 ------
NM_030981chr1161236 1100 773 476 125 102 --1166 --
NM_031208chr163953 351 325 ------
NM_031243chr711807 ------
NM_031272chr17136 ------
NM_031293chr162180 21 ------
NM_031306chr15827 778 753 264 163 1936 2909 891 --
NM_031309chr862251 2197 1790 1780 1592 846 11693 21852 1623 --
NM_031314chr1411733 ------
NM_031369chr41173 ------
NM_031370chr41173 ------
NM_031372chr421424 1362 ----11135
NM_031411chr52382 100 ------
NM_031419chr311480 11093 11038 --
NM_031442chrX2920 470 ------
NM_031445chr243406 2778 708 422 ------
NM_031469chr623306 1426 ------
NM_031844chr173821 3436 3411 2853 2712 2508 1327 22737 923 ----
NM_031845chr262931 2630 613 379 68 45 ------
NM_031847chr262931 2630 613 379 68 45 ------
NM_031849chr52382 100 ------
NM_031857chr52382 100 ------
NM_031858chr171322 ------
NM_031860chr52382 100 ------
NM_031862chr171322 ------
NM_031886chr19102124 2094 1711 1593 845 793 752 607 361 257 11682 32456 2338 138 --
NM_031890chr2272802 2617 2457 2002 1076 1065 1016 --42386 2206 630 327 12316
NM_031892chrX----140 --
NM_031911chr442512 1960 539 288 ----12338
NM_031946chr72399 174 1470 ----
NM_031953chr41473 ------
NM_031992chr751656 1421 1226 179 61 ------
NM_032012chr954211 4085 1987 1569 1485 23480 1656 11630 11596
NM_032013chr20--11377 ----
NM_032017chr161605 1564 1372 1305 665 298 --21920 77 11787
NM_032027chr1128 ------
NM_032041chr832457 2124 1751 22235 642 --12156
NM_032042chr52229 218 --22289 973 --
NM_032047chr3------140
NM_032102chr1163078 2991 2848 2575 2241 2154 --1652 12526
NM_032105chr187857 6622 6037 5647 2406 1756 1324 551 ------
NM_032121chrX41831 1083 868 703 1924 ----
NM_032128chr41797 ------
NM_032139chr19163 --1956 --
NM_032144chr23542 524 421 ------
NM_032169chr33547 264 99 --1570 --
NM_032174chr11604 ----21470 45
NM_032182chr1011134 1455 11322 --
NM_032193chr11132073 2010 1997 1850 1388 1364 742 680 489 459 448 143 109 --2425 392 --
NM_032199chr1083460 2874 986 761 345 319 266 205 ----13754
NM_032208chr253619 2323 1302 1043 23 --13429 13570
NM_032221chr201407 ------
NM_032246chr1521162 1142 ------
NM_032256chr122930 426 ------
NM_032316chr392418 2130 942 826 661 631 354 278 179 160 2585 569 1126
NM_032319chr2----141 --
NM_032320chr11--1615 ----
NM_032364chr121231 --1344 --
NM_032373chr1025425 4116 21664 485 15118 --
NM_032379chr11169 ------
NM_032389chr1141178 938 900 817 --2877 204 1960
NM_032408chr71879 ------
NM_032431chr11139 ------
NM_032434chr2177 ------
NM_032438chr62261 178 ----1233
NM_032440chr1012965 --11943 --
NM_032442chr17157 ------
NM_032449chr152734 2704 2678 2616 143 31940 1903 756 ----
NM_032457chr423261 2515 23788 1543 ----
NM_032458chrX52512 1032 947 511 493 ------
NM_032466chr831630 1317 97 ------
NM_032468chr831630 1317 97 ------
NM_032491chr121980 ------
NM_032510chr182713 226 ------
NM_032521chr2042462 713 610 578 23050 1145 ----
NM_032538chr632372 1002 838 12254 22408 1979 12213
NM_032550chr10192 ------
NM_032552chr941359 1288 355 54 --21375 529 21318 630
NM_032558chr921090 983 ------
NM_032569chr163574 508 228 1519 ----
NM_032588chr12515 436 ------
NM_032590chr123852 310 175 1889 ----
NM_032622chr41992 ------
NM_032632chr142730 138 ------
NM_032638chr32565 523 --1385 1530
NM_032682chr352594 1409 1312 1195 664 ------
NM_032689chr191660 --11271 11462
NM_032711chr1753717 3265 1311 1060 539 --54240 1426 569 346 165 23724 3653
NM_032717chr41222 --1937 --
NM_032737chr1962591 2101 2063 1874 1717 580 1529 12375 --
NM_032765chr521006 806 ----1988
NM_032772chr101379 ------
NM_032778chr333229 2500 2101 --168 --
NM_032780chr1131216 251 172 --2901 271 --
NM_032788chr231351 1251 1110 --11116 --
NM_032793chr1176 1353 ----
NM_032804chr1052311 754 522 82 28 22354 506 ----
NM_032809chr971600 1474 1328 1257 1034 578 552 --1590 2527 388
NM_032826chr775446 5399 3331 1935 1817 1756 971 --45286 4883 572 299 1108
NM_032827chr24959 830 71 37 1421 2397 80 11041
NM_032828chr1981970 1758 1420 1287 555 414 257 217 33396 3263 1178 24131 1866 23852 706
NM_032840chr1221120 849 --31136 210 204 151
NM_032842chr72504 313 ----174
NM_032864chr131535 1496 157 ------
NM_032867chr111648 ------
NM_032875chr173536 97 32 ------
NM_032876chr1452132 2098 830 364 57 1456 1238 11475
NM_032884chr1--1363 ----
NM_032900chr1033618 3096 538 12429 13789 --
NM_032905chr101248 ------
NM_032906chr41809 ------
NM_032918chr121114 1907 --1428
NM_032924chr7----21025 38 --
NM_032943chr11169 ------
NM_032947chr53903 360 296 ------
NM_032961chr41114 11347 1297 --
NM_032982chr752497 2218 2038 1696 737 11712 21948 719 --
NM_032998chr12957 188 1999 1254 --
NM_033020chr113691 11315 11024 --
NM_033025chr193918 689 253 1377 ----
NM_033027chr331044 914 270 --31169 1107 395 --
NM_033055chr11336 1420 ----
NM_033105chr81180 ------
NM_033132chr131495 ------
NM_033133chr1753250 2770 617 598 484 --22324 974 1259
NM_033135chr11----1135 --
NM_033141chr1432219 1697 1371 12190 1635 11863
NM_033143chr444155 3804 1475 782 ------
NM_033150chr121288 1274 ----
NM_033181chr673707 3447 3303 1436 1422 840 708 ------
NM_033211chr51592 ------
NM_033224chr777128 7016 6328 6136 6040 3168 1725 56877 5301 2435 987 86 11094 --
NM_033225chr822589 356 12237 ----
NM_033266chr163390 145 128 --156 --
NM_033272chr21164 ------
NM_033274chr552936 2409 1343 1161 33 13583 2705 101 --
NM_033285chr843511 3283 3097 1017 24283 3393 --11472
NM_033290chrX42850 1482 1364 961 --12693 --
NM_033315chr1732164 1779 640 --22089 1420 --
NM_033316chr31113 ------
NM_033340chr102950 28 ------
NM_033360chr1221144 1027 11078 --13646
NM_033386chr224358 352 313 51 --1454 2417 174
NM_033387chr951910 969 920 810 634 11737 22457 2239 --
NM_033389chr1753737 3044 1805 964 956 ------
NM_033421chr2061785 1532 1288 578 292 179 1164 ----
NM_033426chr1472454 2292 2120 2106 525 232 175 1393 ----
NM_033428chr911875 --12041 --
NM_033429chr1551220 826 751 399 225 --131 --
NM_033449chr521661 446 --31808 1360 498 --
NM_033495chrX1874 ------
NM_033505chr2105868 5707 5150 5100 5075 2457 2186 1063 760 219 26307 1525 ----
NM_033512chr862671 1980 1077 613 392 35 1330 2971 688 --
NM_033514chr21124 --144 196
NM_033515chr611087 ----158
NM_033535chr43860 102 40 11144 ----
NM_033540chr341098 955 345 283 ------
NM_033542chr2021859 37 1284 11932 --
NM_033551chr553350 2715 1011 177 134 --22874 494 --
NM_033626chrX4649 578 468 218 11656 1620 --
NM_033642chrX2923 192 ------
NM_033644chr552239 1856 1699 874 94 ------
NM_033645chr552239 1856 1699 874 94 ------
NM_033656chr2145633 5280 5001 4705 25848 5319 13938 --
NM_052849chr151568 --2802 297 --
NM_052855chr17126 ----156
NM_052879chr1222925 959 --13597 --
NM_052885chr1214686 24194 731 ----
NM_052897chr12147 --2647 55 1162
NM_052900chr8--2725 548 --1433
NM_052906chr22104869 4856 4632 3606 3346 3325 3176 1941 1562 1182 --24681 4472 --
NM_052907chr1231518 564 408 ----21633 1529
NM_052911chr181882 ------
NM_052918chr1023313 2841 --21162 644 --
NM_052925chr1921039 72 ------
NM_052926chrX3907 378 274 ------
NM_052928chr1731606 595 297 --11085 --
NM_052934chr131515 232 67 1356 ----
NM_052936chrX------1139
NM_053016chr997869 6846 6790 6648 6335 6281 3216 2058 29 36514 5949 2943 11242 16130
NM_053044chr44886 835 381 145 --2754 594 --
NM_054016chr131360 742 491 1713 ----
NM_054016chr131360 742 491 1713 ----
NM_054016chr131360 742 491 1713 ----
NM_057158chr82645 84 ------
NM_057161chr64499 396 389 198 --2339 32 --
NM_057169chr1242932 2793 2200 1048 ------
NM_057170chr1242932 2793 2200 1048 ------
NM_057175chr422321 423 12637 ----
NM_058170chr111111 --1155 --
NM_058240chr141683 1437 ----
NM_058241chr211908 ------
NM_058241chr211908 ------
NM_058243chr191862 ------
NM_078476chr621510 63 ----11541
NM_078485chr62638 298 ------
NM_078487chr933231 869 682 ------
NM_080599chr102386 297 1336 ----
NM_080617chr20153 --1749 --
NM_080621chr2021088 916 --21062 247 1395
NM_080626chr121108 1369 ----
NM_080632chrX2740 613 ------
NM_080645chr6194 ------
NM_080717chr1221440 246 ------
NM_080738chr162007 1769 1722 1689 717 456 --11573 --
NM_080743chr682317 2118 2051 1875 1850 1788 1019 714 1463 ----
NM_080759chr1332598 1856 370 ------
NM_080760chr1332598 1856 370 ------
NM_080792chr202612 181 --1743 21829 1711
NM_080862chr32950 902 ------
NM_080867chr1411377 23843 3449 1931 --
NM_080872chr842744 1126 818 541 1305 ----
NM_080927chr323199 1058 --12247 --
NM_100264chr103718 108 73 ------
NM_100486chr103718 108 73 ------
NM_130385chr1143212 2811 2191 825 12615 1919 --
NM_130391chr912195 ----167
NM_130392chr912195 ----167
NM_130393chr912195 ----167
NM_130435chr1042660 1001 915 849 --12304 --
NM_130436chr2131830 808 623 ------
NM_130438chr2132407 2279 1200 ------
NM_130439chr1022139 1608 1480 1394 31996 878 46
NM_130439chr1022139 1608 1480 1394 31996 878 46
NM_130459chr941627 1192 659 33 --51433 1408 1057 498 213 1428
NM_130797chr751677 1526 1389 1308 675 ------
NM_130838chr151365 --11421 11723
NM_130839chr151365 --11421 11723
NM_133170chr20157728 7201 7166 6869 6612 6560 5437 5372 2727 1987 1579 1078 1059 316 80 22208 1282 35624 2777 629 37537 5497 2327
NM_133264chr1743641 3535 1125 912 13134 1918 --
NM_133265chrX42970 2901 2430 754 ----13609
NM_133266chr112349 134 --228 21 --
NM_133330chr41738 --42400 928 755 206 1161
NM_133331chr41738 --42400 928 755 206 1161
NM_133335chr41738 --42400 928 755 206 1161
NM_133372chr532450 2368 2329 22085 115 ----
NM_133445chr932966 2448 1377 --147 1748
NM_133468chr742444 2206 2115 786 1402 ----
NM_133486chrX1362 ------
NM_133646chr295383 5302 4789 4012 2114 1738 828 654 485 1625 ----
NM_133647chr1553287 1496 1097 251 137 22798 2481 1142 1286
NM_134265chr172390 147 ------
NM_134442chr241768 1738 414 396 --1354 --
NM_138270chrX43025 518 408 220 ----13374
NM_138288chr14--11507 11716 --
NM_138316chr1021322 1248 1176 ----
NM_138317chr14129 --1480 --
NM_138318chr14129 --1480 --
NM_138319chr1531222 483 141 ----1428
NM_138328chr1783395 2214 2193 2134 1111 559 343 291 ----1123
NM_138333chr922011 1671 ------
NM_138348chr5106356 6325 5434 4997 4839 2536 2293 1282 115 59 26259 1221 32643 1434 1160 --
NM_138423chr152923 284 1717 ----
NM_138426chr722327 2035 ------
NM_138437chrX2312 53 ------
NM_138444chr1341591 1423 1212 190 13034 1565 --
NM_138473chr1233937 1195 954 134 1548 --
NM_138479chr151322 1310 752 686 288 --11299 --
NM_138569chr61117 ------
NM_138576chr1444732 4537 1628 365 --13242 --
NM_138621chr211269 1816 --22685 449
NM_138638chr1431835 712 430 --1113 --
NM_138703chrX132 ------
NM_138713chr1638023 6368 2009 23316 2366 --16279
NM_138714chr1638023 6368 2009 23316 2366 --16279
NM_138782chr5--31832 493 158 ----
NM_138795chr121153 547 21485 1302 21563 1406 1275
NM_138967chr1572479 2443 960 879 869 690 444 --31751 779 722 22454 1841
NM_138970chr1422308 399 ------
NM_138981chr41818 ------
NM_138992chr212169 32 ------
NM_138995chr231096 508 460 --1204 --
NM_139012chr622152 708 11761 1668 11832
NM_139014chr632232 788 82 11841 1748 11912
NM_139071chr1231257 316 49 --31686 1476 561 --
NM_139076chr421449 371 31210 1030 83 --1473
NM_139125chr321039 36 --41221 389 235 207 --
NM_139159chr19178 ------
NM_139242chr1531549 1278 210 2933 367 11415 --
NM_139244chr6--1611 ----
NM_139276chr1741545 852 159 150 1816 12134 --
NM_139280chr1751069 293 285 201 119 1940 21356 1240 --
NM_139283chr1211027 ------
NM_144563chr22327 34 ------
NM_144563chr22327 34 ------
NM_144567chr122446 206 12004 --1578
NM_144571chr435675 5101 2715 36232 4365 359 ----
NM_144576chr121614 ------
NM_144578chr1444971 4961 589 462 --11157 14173
NM_144586chr23950 500 72 ------
NM_144590chr1042560 838 561 443 183 ----
NM_144598chr151131 ------
NM_144605chr16292 28 --138 --
NM_144611chr172540 53 ------
NM_144633chr32277 95 ----11154
NM_144636chr32551 22 ------
NM_144642chr321257 466 ------
NM_144703chr2041018 978 745 174 --1796 --
NM_144710chr241464 991 258 202 ------
NM_144723chr51249 ------
NM_144778chr131717 ------
NM_144949chr212130 ------
NM_144963chr812619 11022 ----
NM_144965chr91137 ------
NM_144967chrX----11027 --
NM_144973chr1284546 3468 3365 3239 2067 1875 1467 917 186 ----
NM_145008chr111862 ------
NM_145011chr1011956 --12142 --
NM_145018chr111208 ------
NM_145021chr103571 527 281 1177 ----
NM_145024chr16----177 --
NM_145065chr1111160 --1366 --
NM_145113chr1421134 585 --1226 --
NM_145117chr111388 11138 --189
NM_145176chr633192 2336 223 12880 ----
NM_145206chr1052705 1208 743 521 47 1351 32807 2800 640 --
NM_145251chr141148 ------
NM_145259chr245629 5461 2573 1805 14613 --16231
NM_145284chrX3545 302 173 ------
NM_145307chr1034497 2953 631 11804 ----
NM_145309chr113451 79 71 1870 11135 --
NM_145313chr1071628 1058 570 506 484 469 361 11221 31300 1277 1065 --
NM_145320chr7--22678 2597 1787 --
NM_145321chr7--22678 2597 1787 --
NM_145322chr7--22678 2597 1787 --
NM_145332chr61961 ------
NM_145333chr61961 ------
NM_145349chr1711579 12033 3487 242 213 1456
NM_145351chr1752071 1845 1677 316 165 12525 4979 734 705 280 1948
NM_145690chr811977 ------
NM_145731chr221220 ------
NM_145738chr221220 ------
NM_145793chr101755 ------
NM_145861chr162007 1769 1722 1689 717 456 --11573 --
NM_145891chr1631511 627 60 ------
NM_145892chr1631511 627 60 ------
NM_145893chr1621633 182 ------
NM_145912chr22124631 4516 4490 3528 3419 3066 3036 1869 1540 1458 1317 80 --54246 3594 3265 1642 398 21157 501
NM_147150chr953768 1527 1157 1006 342 33073 2811 1508 ----
NM_147175chrX11339 --11700 11954
NM_147181chr42203 161 ------
NM_147182chr42203 161 ------
NM_147183chr42203 161 ------
NM_147189chr82515 85 1939 ----
NM_147204chr12----1398 --
NM_147223chr2--1447 11661 11535
NM_148174chr811844 ------
NM_148571chr1721459 807 32091 1512 774 ----
NM_148904chr11493 ------
NM_148905chr11493 ------
NM_148906chr11493 ------
NM_148907chr11493 ------
NM_148908chr11493 ------
NM_148909chr11493 ------
NM_148921chr1741831 1807 1655 564 ----22191 2083
NM_148957chr133705 297 77 --1845 1167
NM_148977chr1021322 1248 1176 ----
NM_148978chr1021322 1248 1176 ----
NM_152221chr2221231 890 ------
NM_152233chr1441471 1395 1316 1260 ------
NM_152240chr331227 792 239 ------
NM_152253chr22104275 4092 3756 3158 3131 3110 1617 1568 338 263 --31574 959 291 --
NM_152263chr195254 4779 4234 4146 3680 1670 1459 1216 1097 35836 5125 2418 ----
NM_152272chr81885 ----1966
NM_152277chr532039 1976 626 ------
NM_152280chr132838 2649 2364 --12234 --
NM_152292chr411527 ------
NM_152305chr31318 --11467 --
NM_152330chr1432535 1711 1019 ------
NM_152344chr1711359 ------
NM_152375chr142476 2336 2140 174 --21605 455 1421
NM_152388chr2103382 3197 2791 1611 1390 1040 1019 797 741 701 13296 --23987 2705
NM_152409chr543628 2736 643 98 23217 1123 ----
NM_152414chr821401 1028 ----1519
NM_152420chr91637 ------
NM_152422chr921532 247 ------
NM_152424chrX3936 884 38 1116 24594 1321 --
NM_152437chr1242255 2229 831 199 11890 --1321
NM_152442chr1221308 1014 11390 125 --
NM_152450chr1532064 461 158 11886 11844 --
NM_152470chr1852856 2823 2603 1213 224 --12656 189
NM_152519chr2--1796 ----
NM_152520chr21286 ------
NM_152529chr294071 4000 3978 3313 2879 2683 1415 605 575 14056 1105 --
NM_152542chr45859 829 740 212 47 ------
NM_152581chrX11466 11388 1416 --
NM_152594chr153860 111 24 ------
NM_152621chr41253 ------
NM_152622chr513457 ------
NM_152629chr933148 1245 854 13996 14066 1986
NM_152638chr122963 373 21282 974 ----
NM_152641chr121161 1559 ----
NM_152665chr11484 ------
NM_152667chr20148 21257 1207 11018 --
NM_152682chr431236 1190 250 ------
NM_152688chr61359 ------
NM_152699chr353438 3416 3294 1502 529 22966 115 12348 --
NM_152713chr11136 ----1161
NM_152738chr6--1391 ----
NM_152744chr753413 3226 2947 1331 512 --33418 2785 88 12881
NM_152745chr71938 ------
NM_152756chr533043 2637 199 ------
NM_152758chr8----11879 --
NM_152780chrX3313 247 209 ------
NM_152787chrX53392 1256 925 322 42 ------
NM_152793chr774869 4429 1776 599 363 172 33 --13752 --
NM_152835chr132513 1004 861 21872 1048 ----
NM_152857chr621003 698 1109 ----
NM_152858chr621003 698 1109 ----
NM_152903chr133872 662 530 ----1762
NM_152924chr1596195 5927 5637 5607 1653 1645 1286 925 917 1539 25792 1024 --
NM_152989chr1221316 712 11496 ----
NM_152991chr11----2655 266 --
NM_153000chr182436 219 ----1154
NM_153015chr8------1891
NM_153020chr61234 ------
NM_153029chr1664078 4007 3607 1543 1187 1108 --33927 3765 22 --
NM_153035chr183249 2888 2562 1301 1270 490 423 47 ----127
NM_153040chr15168 ------
NM_153042chr62479 450 ------
NM_153050chr22114719 4422 4327 3976 3426 1635 1251 1137 1105 521 66 --1863 2778 551
NM_153051chr22114719 4422 4327 3976 3426 1635 1251 1137 1105 521 66 --1863 2778 551
NM_153182chr333229 2500 2101 --168 --
NM_153183chrX189 ------
NM_153184chr3122 ------
NM_153188chr535148 4443 2043 23983 684 ----
NM_153207chr1222727 253 --12921 --
NM_153223chr511007 1351 ----
NM_153251chr131264 ------
NM_153260chr1561526 1174 1143 1055 591 383 1224 --169
NM_153321chr172261 32 ------
NM_153322chr172261 32 ------
NM_153347chr1132447 2377 1948 11759 1895 12393
NM_153350chr1651470 1254 371 215 46 ------
NM_153367chr1043862 3830 2855 1546 --31159 807 128 23523 481
NM_153499chr1222606 2329 --132 --
NM_153500chr1222606 2329 --132 --
NM_153619chr1512603 --1343 --
NM_153620chr751641 1557 1404 1380 626 ------
NM_153649chr131437 206 194 11679 11804 --
NM_153689chr251902 904 738 678 344 ------
NM_153758chr11323 1291 ----
NM_153810chr1064940 4445 3832 1831 1286 606 ------
NM_153812chr152103 1447 781 584 76 ------
NM_170606chr7--1612 ----
NM_170665chr1254377 3068 3058 1243 480 1313 12965 13625
NM_170679chr531237 456 158 ------
NM_170696chr1541600 1576 1182 466 194 21147 442 --
NM_170697chr1541600 1576 1182 466 194 21147 442 --
NM_170711chr191725 ------
NM_170746chr111449 --132 --
NM_170751chr621095 41 --11204 --
NM_170752chr621095 41 --11204 --
NM_170774chr20103901 1605 1526 1457 1344 1243 1164 402 349 25 13576 12634 --
NM_171998chrX5447 354 259 172 116 1208 12208 --
NM_172020chr741987 1893 1774 806 --11780 11845
NM_172069chr2--22015 1874 1597 --
NM_172071chr156821 4964 2318 1046 531 16642 --15139
NM_172097chr151193 ------
NM_172103chr62818 267 ------
NM_172105chr62818 267 ------
NM_172127chr42690 139 11764 1106 --
NM_172128chr42646 95 11720 162 --
NM_172159chr31955 ------
NM_172160chr31955 ------
NM_172163chr12144 135 ------
NM_172226chr1222606 2329 --132 --
NM_172230chr11139 ------
NM_172240chr1211288 ------
NM_172337chr143763 725 47 ------
NM_172373chr1321031 1010 ------
NM_172375chr14------1475
NM_173075chr421733 1242 --11537 --
NM_173156chr141890 1616 759 149 ------
NM_173171chr211065 11194 1807 --
NM_173172chr211373 11502 11115 --
NM_173173chr211065 11194 1807 --
NM_173191chr1031041 490 280 ----1497
NM_173192chr1031041 490 280 ----1497
NM_173193chr1031041 490 280 ----1497
NM_173194chr1031041 490 280 ----1497
NM_173195chr1031041 490 280 ----1497
NM_173198chr922269 24 ------
NM_173200chr922269 24 ------
NM_173201chr16----1226 --
NM_173214chr1638023 6368 2009 23316 2366 --16279
NM_173353chr121608 ------
NM_173462chr1441629 1248 755 444 1603 ----
NM_173468chr424319 844 13750 ----
NM_173469chr152348 201 ------
NM_173470chrX42388 2156 1861 196 32575 1151 941 ----
NM_173476chr1682115 2087 1983 1501 888 592 369 233 12313 31770 1550 554 11956
NM_173510chr2252612 2582 2124 1963 428 11100 12390 --
NM_173511chr2--1864 13199 --
NM_173519chr83706 656 162 ------
NM_173552chr32300 224 ------
NM_173557chr183202 109 48 ------
NM_173560chr61209 ------
NM_173576chr10--11920 12205 --
NM_173582chr1185911 5350 3975 1999 1591 1491 1461 1240 35939 5321 5055 ----
NM_173595chr1275149 4921 4229 3720 3503 1309 1255 --1642 --
NM_173642chr159071 7882 2413 2216 118 22911 762 36539 1470 641 15814
NM_173681chr741625 1519 464 150 --2707 639 --
NM_173683chr81485 ------
NM_173694chrX--12225 ----
NM_173808chr123932 552 ------
NM_173822chr2--12126 1504 --
NM_173832chr863725 3708 3605 2442 2409 871 --32871 774 636 1663
NM_173851chr843968 2822 2595 250 11088 11593 --
NM_173872chr41888 1352 ----
NM_174911chr843117 2487 1422 392 --3489 121 101 --
NM_174934chr1152826 2742 900 286 64 2812 796 32781 911 824 23135 1131
NM_175610chr1511076 ------
NM_175623chr12126935 6321 5390 2863 2812 2787 2286 2162 2153 638 402 95 22729 2518 26454 6284 15318
NM_175624chr12127030 6416 5485 2958 2907 2882 2381 2257 2248 733 497 190 22824 2613 26549 6379 15413
NM_175625chr12127030 6416 5485 2958 2907 2882 2381 2257 2248 733 497 190 22824 2613 26549 6379 15413
NM_175852chr142208 341 274 79 --22819 2675 12371
NM_175856chr51647 ------
NM_175859chrX1613 1416 ----
NM_175861chr1265925 5330 4453 1044 673 560 14161 12057 11536
NM_175863chr6------1407
NM_175866chr141360 572 507 177 ------
NM_175873chr531489 1170 145 --11198 --
NM_175921chr534300 3940 1290 ----11423
NM_175924chr321013 359 1386 1100 --
NM_176081chr1065673 5441 4628 4423 1946 730 24146 4062 24489 3804 --
NM_176083chr1065673 5441 4628 4423 1946 730 24146 4062 24489 3804 --
NM_176812chr201280 --123 --
NM_176863chr1731840 1789 33 --1784 --
NM_176871chr8143342 3256 3206 3047 2910 2518 1024 913 805 797 704 484 326 46 12865 32757 2457 880 12769
NM_177402chr11351 1836 ----
NM_177414chr131138 1106 430 --121 --
NM_177424chr131712 1612 1287 --31688 582 28 --
NM_177438chr1422692 1582 ------
NM_177452chr141785 ------
NM_177966chr311268 1609 ----
NM_177968chr222034 479 12123 ----
NM_177974chr152923 284 1717 ----
NM_177983chr2162 --142 --
NM_177985chr2----1649 --
NM_177995chr921532 247 ------
NM_178010chr1221316 712 11496 ----
NM_178135chr411020 11178 ----
NM_178151chrX56215 2832 2299 2280 1638 15204 24930 2569 26333 184
NM_178152chrX56215 2832 2299 2280 1638 15204 24930 2569 26333 184
NM_178153chrX56215 2832 2299 2280 1638 15204 24930 2569 26333 184
NM_178190chr11119 ----125
NM_178191chr121481 1460 --1634 11366
NM_178270chrX------1139
NM_178313chr22217 150 ------
NM_178426chr132244 1615 566 ------
NM_178427chr132144 1515 466 ------
NM_178441chr1471314 1259 1002 886 521 402 151 ------
NM_178450chr54648 635 500 76 ------
NM_178496chr31428 ------
NM_178562chr7--1605 1364 1753
NM_178584chr241464 991 258 202 ------
NM_178831chr732158 2060 1076 --22150 460 22121 1095
NM_178857chr8174 ------
NM_181054chr1411015 --1149 --
NM_181349chr72449 366 1592 33095 2686 328 --
NM_181354chr81523 ------
NM_181358chr133396 1670 947 --13526 14048
NM_181361chr31348 --1440 --
NM_181481chr1866935 6502 4865 4651 1772 1741 26813 5418 161 --
NM_181482chr1866935 6502 4865 4651 1772 1741 26813 5418 161 --
NM_181483chr1866935 6502 4865 4651 1772 1741 26813 5418 161 --
NM_181486chr1221440 246 ------
NM_181489chr395923 5504 5122 2650 2130 2039 1136 688 582 35593 5000 2706 26678 2527 --
NM_181492chr2221146 946 ------
NM_181504chr523353 94 13671 11184 --
NM_181521chr1695165 4757 2602 1669 1637 1581 1199 979 441 --46367 6343 1907 1551 26687 287
NM_181523chr523353 94 13671 11184 --
NM_181524chr523353 94 13671 11184 --
NM_181655chr17----1202 --
NM_181659chr2043398 713 152 117 1364 ----
NM_181659chr2043398 713 152 117 1364 ----
NM_181671chr171309 ------
NM_181672chrX21576 555 --139 --
NM_181673chrX21576 555 --139 --
NM_181704chr211314 ------
NM_181713chr23633 623 377 ------
NM_181809chr163749 3392 3002 1441 669 420 33212 1392 827 33157 1618 882 13592
NM_181825chr225746 666 595 162 80 --1112 --
NM_181828chr2242731 2591 1428 197 23111 2362 33672 998 287 --
NM_181829chr2242731 2591 1428 197 23111 2362 33672 998 287 --
NM_181830chr2242731 2591 1428 197 23111 2362 33672 998 287 --
NM_181832chr2242746 2606 1443 212 23126 2377 33687 1013 302 --
NM_181839chr811329 ------
NM_181876chr451020 951 826 473 152 12059 1731 --
NM_181897chr352120 2058 2013 1989 1928 22147 410 2615 353 --
NM_182314chrX21308 1279 ------
NM_182484chr211314 ------
NM_182503chr685256 5093 4591 2201 1662 1195 1041 701 25029 4399 14849 --
NM_182515chr1986697 4770 4610 4379 4225 1838 1462 1019 35310 1997 69 --21043 100
NM_182526chr14102862 2822 2618 2066 1989 1093 879 497 404 278 12714 22586 476 --
NM_182527chr2252009 1677 1550 871 551 11948 41974 1535 503 97 1615
NM_182678chr21398 ------
NM_182679chr11703 ------
NM_182687chr16148 --198 --
NM_182691chr72364 97 ----130
NM_182692chr72364 97 ----130
NM_182697chr731576 1445 255 ------
NM_182760chr3--1886 1352 1273
NM_182767chr1221338 157 ------
NM_182830chr1431867 698 223 11445 ----
NM_182907chr612273 21573 51 ----
NM_182936chr141683 1437 ----
NM_182943chr321050 942 1131 1191 --
NM_182948chr121127 120 --125 --
NM_182964chr111388 11138 --189
NM_182970chr2063848 3150 3132 796 533 149 --33183 2850 1466 12642
NM_182972chr11829 ------
NM_183002chr141683 1437 ----
NM_183004chr1453622 3373 3154 2573 1239 1729 ----
NM_183006chr2011177 --21316 1266 1117
NM_183043chr13167 ------
NM_183044chr13167 ------
NM_183078chr632366 560 397 11086 23694 2646 12528
NM_183243chr72495 81 --1446 --
NM_183243chr72495 81 --1446 --
NM_183353chrX21125 473 2801 119 ----
NM_183380chr6133 ------
NM_183381chr31631 ------
NM_183383chr31631 ------
NM_183384chr31631 ------
NM_183419chr821281 574 ------
NM_183422chr131913 ------
NM_184234chr201743 ------
NM_194071chr7125313 5224 5195 5050 4841 4650 3748 3548 2010 1984 972 944 34328 3385 2172 24796 1905 15208
NM_194247chr253347 3226 1506 1313 1010 --1808 --
NM_194277chrX------130
NM_194278chr1463172 2729 1331 1051 460 273 --21028 490 --
NM_194285chr1133216 599 152 1269 11124 --
NM_194291chr812779 22948 2415 ----
NM_194292chr131729 656 110 --11143 --
NM_194314chr155320 4177 3851 1691 715 ------
NM_194328chr932997 2926 2845 ----13112
NM_194329chr932997 2926 2845 ----13112
NM_194330chr932997 2926 2845 ----13112
NM_194332chr932997 2926 2845 ----13112
NM_194434chr1854635 4298 1106 539 246 ------
NM_197941chr532466 982 903 22621 637 11904 12590
NM_198040chr14866 345 144 50 11055 21144 889 --
NM_198074chr12430 105 --1435 --
NM_198086chr1452132 2098 830 364 57 1456 1238 11475
NM_198123chr8--2725 548 --1433
NM_198124chr8--2725 548 --1433
NM_198128chr1811682 ----22220 416
NM_198141chr1551181 946 479 403 339 1326 ----
NM_198158chr352665 2617 1940 862 272 ------
NM_198159chr352665 2617 1940 862 272 ------
NM_198177chr352665 2617 1940 862 272 ------
NM_198178chr352665 2617 1940 862 272 ------
NM_198215chr101907 ------
NM_198217chr131797 ------
NM_198218chr131797 ------
NM_198219chr131797 ------
NM_198225chr1031516 1240 187 ------
NM_198256chr271964 1694 1429 1367 491 171 30 --21743 1393 --
NM_198268chr133396 1670 947 --13526 14048
NM_198269chr133396 1670 947 --13526 14048
NM_198270chrX21322 637 ------
NM_198291chr2071775 1389 1362 1276 543 438 43 11656 21926 1436 --
NM_198320chr1265100 3279 3206 2061 1511 629 13812 11047 --
NM_198391chr2021213 308 ------
NM_198393chr17136 ------
NM_198395chr51962 ------
NM_198399chr311814 --2595 324 --
NM_198401chr811452 1583 ----
NM_198404chr131861 1138 ----
NM_198467chr71511 1460 ----
NM_198468chr61970 33922 2988 1054 ----
NM_198474chr1111142 ------
NM_198503chr11438 ------
NM_198513chr8--1437 1723 --
NM_198527chr15----1443 --
NM_198595chr484333 3166 1696 1223 1105 1082 447 361 13346 33947 1987 129 23310 1757
NM_198597chr102883 151 --1769 --
NM_198679chr942226 2111 569 205 12458 32362 858 733 1989
NM_198715chr185787 5774 4755 4736 4316 784 707 224 ------
NM_198793chr322802 992 ------
NM_198829chr71989 ------
NM_198859chr344835 3522 1350 530 ------
NM_198896chr1141611 690 672 572 ------
NM_198902chr152681 57 --2575 21 --
NM_198903chr5----142 --
NM_198904chr511574 21498 1335 142 --
NM_198995chr181563 ------
NM_199003chr821426 1204 ------
NM_199129chr205465 315 222 116 82 1166 1122 --
NM_199132chr1911843 11742 ----
NM_199188chr1222925 959 --13597 --
NM_199190chr1222925 959 --13597 --
NM_199229chr22666 109 ------
NM_199320chr41962 1813 --1101
NM_199320chr41962 1813 --1101
NM_199324chr423484 492 ------
NM_199328chr21------11018
NM_199355chr162109 88 ------
NM_199421chr1411377 23843 3449 1931 --
NM_199454chr133240 779 572 --14078 13646
NM_199461chr1033610 2494 2464 --1425 11057
NM_199462chr1124687 4372 3801 3565 1990 1960 1392 1129 947 917 435 183 14343 ----
NM_199487chr2021248 937 11078 --11276
NM_199511chr3--1850 ----
NM_199512chr3--1850 ----
NM_201263chr122043 1832 ------
NM_201266chr232482 2179 1128 22671 2352 12587 12942
NM_201279chr232482 2179 1128 22671 2352 12587 12942
NM_201280chr621306 571 ------
NM_201428chr111101 ------
NM_201429chr111101 ------
NM_201430chr11127 ------
NM_201432chr1785396 5326 5061 4279 2050 1296 666 48 24314 2095 25483 4410 1102
NM_201433chr1785396 5326 5061 4279 2050 1296 666 48 24314 2095 25483 4410 1102
NM_201434chr17--1165 1641 --
NM_201568chr141890 1616 759 149 ------
NM_201569chr141890 1616 759 149 ------
NM_201591chr41137 ------
NM_201592chr41137 ------
NM_201632chr521621 638 11309 1556 --
NM_201634chr521720 737 11408 1655 --
NM_201995chr112706 588 --1486 --
NM_201998chr113771 653 67 --1551 --
NM_203283chr41502 1644 ----
NM_203284chr41502 1644 ----
NM_203301chr1421143 291 ------
NM_203304chr191157 --1807 --
NM_203327chr2023824 61 13510 ----
NM_203341chr1152 ------
NM_203349chr1521945 484 ------
NM_203350chr121400 1078 11733 ----
NM_203372chr2136 ------
NM_203390chr81258 --11483 --
NM_203394chr1232275 375 87 ------
NM_203406chr511979 11823 ----
NM_203413chr172951 173 21042 843 1379 2391 193
NM_203434chr91510 --1113 --
NM_203446chr2122092 1849 ------
NM_203459chr122487 707 ------
NM_205768chr12771 324 ------
NM_205833chrX2730 256 163 ----
NM_206594chr131262 1201 717 11436 ----
NM_206595chr131262 1201 717 11436 ----
NM_206852chr14--1181 ----
NM_206853chr633541 3394 3036 11310 ----
NM_206854chr634802 4655 4297 ------
NM_206855chr655767 5620 5262 402 269 ------
NM_206857chr14--1181 ----
NM_206876chr243116 1436 654 384 12659 ----
NM_206900chr191162 --1379 --
NM_206901chr191162 --1379 --
NM_206907chr53983 617 422 1774 ----
NM_206909chr8167725 7398 7345 7305 7188 6805 6797 5979 5620 5598 5507 3349 3131 2116 1310 475 38196 2425 2293 37090 6761 6465 17299
NM_206927chr11169 ------
NM_206928chr11169 ------
NM_206929chr11169 ------
NM_206930chr11169 ------
NM_207015chr322430 475 ------
NM_207043chr122129 2103 --22077 341 --
NM_207044chr122129 2103 --22077 341 --
NM_207047chr122129 2103 --22077 341 --
NM_207111chr752230 1013 868 784 22 1401 1329 --
NM_207116chr752230 1013 868 784 22 1401 1329 --
NM_207123chr41870 ------
NM_207170chr11722 ------
NM_207171chr121709 1525 11361 --1205
NM_207299chr91422 ------
NM_207304chr131604 ------
NM_207317chr51403 ------
NM_207337chr12--3881 352 227 ----
NM_207361chr1346047 5739 5431 1335 15900 1880 --
NM_207371chr103992 627 497 1379 ----
NM_207380chr1592790 2630 1113 1103 1017 571 515 431 116 --21251 285 11131
NM_207387chr1721699 52 ----2612 399
NM_207404chr31307 22268 2210 ----
NM_207406chr475816 5125 4178 2518 2488 320 278 25076 4451 1991 --
NM_207429chr1152329 937 510 330 133 1667 ----
NM_207517chr1531590 1541 1521 --11450 --
NM_207577chr113459 187 126 ------
NM_212543chr31114 --1596 --
NM_212551chr131126 234 96 ------
NM_213569chr10123 ------
NM_213594chr121980 ------
NM_213648chr521621 638 11309 1556 --
NM_213662chr1761639 1532 946 253 244 42 1910 12228 --