TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-25-5p
miRNA Sequence: AGGCGGAGACUUGGGCAAUUG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000024chr51134 ------
NM_000029chr11456 --141 --
NM_000037chr862278 1836 1714 1702 724 542 --12265 32021 767 81
NM_000044chrX386 73 59 ------
NM_000053chr1331807 306 112 11816 ----
NM_000055chr31318 ------
NM_000068chr19150 ------
NM_000081chr111363 ------
NM_000084chrX36453 4928 4810 12716 36166 5374 5359 --
NM_000088chr1731156 451 324 ------
NM_000097chr32489 118 ------
NM_000166chrX----3603 577 89 --
NM_000214chr20--21585 311 11630 --
NM_000216chrX----1340 --
NM_000228chr1137 ------
NM_000244chr11177 --3581 189 44 --
NM_000248chr322658 1038 ------
NM_000259chr1535716 2397 409 ------
NM_000296chr16165 1639 ----
NM_000319chr121252 ------
NM_000325chr4----154 --
NM_000332chr611272 --2447 437 --
NM_000346chr1721949 1581 11485 1363 --
NM_000362chr2253416 2958 2903 1244 748 ------
NM_000367chr612182 --21513 454 --
NM_000378chr11----1185 --
NM_000391chr1141660 1233 260 68 ------
NM_000408chr212596 ------
NM_000411chr2122957 2576 --12159 --
NM_000430chr1733069 2992 2439 ------
NM_000434chr6130 --144 --
NM_000435chr19----1721 --
NM_000445chr831000 951 26 ------
NM_000461chr313274 ------
NM_000474chr71262 ------
NM_000484chr211745 ------
NM_000503chr821779 106 1260 2610 144 --
NM_000530chr1--149 1715 --
NM_000533chrX21241 543 ------
NM_000555chrX47665 7334 6795 5162 ------
NM_000578chr231473 1245 663 --21217 673 11795
NM_000594chr61727 ------
NM_000599chr223761 1277 ------
NM_000609chr1032574 2535 527 ------
NM_000615chr111284 1706 12397 12373
NM_000618chr1255853 5201 5163 4084 56 24169 1209 12566 --
NM_000618chr1255853 5201 5163 4084 56 24169 1209 12566 --
NM_000627chr2136 ------
NM_000635chr1931668 364 294 ------
NM_000641chr191279 11563 ----
NM_000660chr19----1226 --
NM_000665chr71149 --3189 33 28 --
NM_000678chr202591 253 1576 ----
NM_000701chr1144 ------
NM_000719chr1286416 4215 2334 2007 1345 691 360 286 24661 4198 2666 557 --
NM_000721chr132244 1782 221 ------
NM_000723chr172615 86 ------
NM_000739chr7------189
NM_000757chr13868 106 39 --1728 --
NM_000787chr94750 576 321 73 1762 1698 1309
NM_000794chr52146 119 ------
NM_000801chr202968 133 144 ----
NM_000806chr5135 ------
NM_000814chr15----159 --
NM_000818chr101189 ------
NM_000827chr511713 ------
NM_000831chr155779 5628 5523 4025 317 --25897 5108 --
NM_000833chr1611091 ------
NM_000845chr7191 ------
NM_000868chrX1468 11666 ----
NM_000875chr1567033 4633 2802 1992 343 154 --1706 --
NM_000883chr7----1476 --
NM_000883chr7----1476 --
NM_000891chr1713538 --1371 --
NM_000898chrX1167 ------
NM_000899chr122806 422 1774 ----
NM_000908chr52176 30 ------
NM_000921chr121134 ------
NM_000944chr421567 925 ------
NM_000945chr221779 688 ------
NM_000951chr191161 ------
NM_000964chr17----41301 309 54 38 --
NM_000965chr311054 ------
NM_000966chr12----198 1345
NM_000983chr1182 1140 11311 --
NM_001001323chr1212137 1461 ----
NM_001001331chr342607 1837 1046 748 ------
NM_001001344chrX32490 586 512 --1890 --
NM_001001394chr21276 ------
NM_001001433chr2012949 --22652 2346 --
NM_001001502chr51114 ------
NM_001001549chr722609 210 --22378 553 --
NM_001001550chr722609 210 --22378 553 --
NM_001001551chr91339 ------
NM_001001555chr722609 210 --22378 553 --
NM_001001557chr8152 --2762 697 --
NM_001001560chr222736 525 ------
NM_001001669chr522127 1739 12187 11934 --
NM_001001790chr92361 65 ------
NM_001001852chr223317 294 135 ------
NM_001001890chr2153237 3205 1195 499 264 11078 147 --
NM_001001924chr851872 1772 1346 611 467 --1191 --
NM_001001925chr851872 1772 1346 611 467 --1191 --
NM_001001931chr851872 1772 1346 611 467 --1191 --
NM_001001971chr10------164
NM_001001995chrX166 ------
NM_001002814chr833737 3430 3383 ------
NM_001002838chrX11789 ------
NM_001002860chr1411685 13390 ----
NM_001002909chr1741841 337 324 275 --11549 --
NM_001003407chr1065097 5016 4779 1453 1076 965 ----13514
NM_001003408chr1065097 5016 4779 1453 1076 965 ----13514
NM_001003674chr1866921 5947 4711 2201 1868 895 26119 4401 --11726
NM_001003675chr1866921 5947 4711 2201 1868 895 26119 4401 --11726
NM_001003681chr221278 ----11453
NM_001003694chr3186 ------
NM_001003713chr72159 54 ------
NM_001003794chr332496 2344 393 --2428 293 --
NM_001003800chr9----11313 --
NM_001003809chr18196 --2222 65 --
NM_001003891chr221129 ------
NM_001003940chr1513341 --33738 2942 2515 --
NM_001003942chr1513341 --33738 2942 2515 --
NM_001003943chr1513345 --33742 2946 2519 --
NM_001004127chr131911 ------
NM_001004342chr195752 5094 2301 1820 1753 1745 1609 1572 439 13829 45016 1988 1171 963 --
NM_001004354chr92344 48 --1413 --
NM_001004419chr1254436 4256 1013 550 504 ------
NM_001005158chr31391 ------
NM_001005159chr31391 ------
NM_001005266chr151686 ------
NM_001005267chr151686 ------
NM_001005268chr151686 ------
NM_001005269chr151686 ------
NM_001005353chr11223 --1180 --
NM_001005353chr11223 --1180 --
NM_001005375chrY--11345 ----
NM_001005377chr19----122 --
NM_001005386chr2----2701 105 --
NM_001005404chr1744067 3391 3363 1312 ------
NM_001005463chr10122 --1306 --
NM_001005473chr515044 14269 ----
NM_001005505chr31314 --31702 381 50 --
NM_001005732chr21134 ------
NM_001005733chr21134 ------
NM_001005739chr21853 ------
NM_001005910chr32561 23 ------
NM_001005911chr32561 23 ------
NM_001005920chr161262 1764 ----
NM_001006115chr322627 900 12115 ----
NM_001006610chr16--176 ----
NM_001006617chr911065 ------
NM_001006619chr911065 ------
NM_001006620chr911065 ------
NM_001006621chr911065 ------
NM_001006626chr7------189
NM_001006627chr7------189
NM_001006628chr7------189
NM_001006629chr7------189
NM_001006630chr7------189
NM_001006631chr7------189
NM_001006632chr7------189
NM_001006636chr21405 1152 ----
NM_001006946chr251825 1730 1295 190 174 --126 --
NM_001007027chr111227 ------
NM_001007072chr15193 ------
NM_001007102chr621316 1160 ------
NM_001007156chr15--11876 ----
NM_001007226chr1721246 25 11284 --11352
NM_001007227chr1721246 25 11284 --11352
NM_001007228chr1721246 25 11284 --11352
NM_001007229chr1721246 25 11284 --11352
NM_001007230chr1721246 25 11284 --11352
NM_001007246chr211122 ------
NM_001007271chr103978 834 399 1424 --2747 43
NM_001007277chr113895 238 88 ----1226
NM_001007279chr22----2669 110 --
NM_001007527chr51227 ------
NM_001007553chr11409 ------
NM_001007559chr18--11814 11702 --
NM_001008220chr533815 3676 2693 --1115 --
NM_001008222chrX11255 ------
NM_001008239chr1862756 1485 1267 561 407 25 --1295 --
NM_001008270chr7------138
NM_001008392chr333392 3225 103 ------
NM_001008495chr8--12087 ----
NM_001008541chr1022123 578 ------
NM_001008541chr1022123 578 ------
NM_001008660chr1111281 ------
NM_001008701chr1921064 439 --21206 661 --
NM_001008777chr17----1227 --
NM_001008938chr111167 ------
NM_001009566chr121417 44 11458 1180 --
NM_001009944chr16165 1639 ----
NM_001009993chr274389 3750 2882 1725 1656 941 792 ------
NM_001010854chr14--194 ----
NM_001010857chr11109 ------
NM_001010861chr112776 ------
NM_001010867chr176056 4346 2628 2048 1909 1726 712 --22065 358 --
NM_001010926chr1192 1222 ----
NM_001010927chr6------1572
NM_001011515chr41951 ------
NM_001011516chr41951 ------
NM_001011645chrX386 73 59 ------
NM_001011713chr14--21167 572 ----
NM_001011885chr1511653 11145 ----
NM_001012393chr1121436 286 --1611 1325
NM_001012426chr683355 3339 3170 1248 925 889 569 461 12786 ----
NM_001012427chr683355 3339 3170 1248 925 889 569 461 12786 ----
NM_001012643chr191211 --2513 75 --
NM_001012732chr42905 871 ------
NM_001012989chrX--144 ----
NM_001013635chr122483 192 ------
NM_001013690chr1242477 388 136 55 1179 2251 41 --
NM_001013693chr132549 2234 279 1523 21834 391 --
NM_001013693chr132549 2234 279 1523 21834 391 --
NM_001014336chr12----180 --
NM_001014435chr161242 ----1442
NM_001014443chr11239 ------
NM_001014445chr171997 --1741 148
NM_001014797chr1087918 7744 7711 7023 2854 2844 1429 284 15949 ----
NM_001014809chr41654 ------
NM_001014839chr12910 186 ------
NM_001014841chr12910 186 ------
NM_001015045chr42606 119 12084 12344 --
NM_001015055chr22117 29 --1254 --
NM_001015056chr22117 29 --1254 --
NM_001015056chr22117 29 --1254 --
NM_001015877chrX21208 319 11984 ----
NM_001017368chr1732820 2497 2186 ------
NM_001017402chr1137 ------
NM_001017523chr12------11250
NM_001018005chr15167 ------
NM_001018050chr221533 --22491 2369 --
NM_001018052chr221533 --22491 2369 --
NM_001018064chr921342 347 ------
NM_001018070chr111257 161 135 --
NM_001018072chr12------11250
NM_001018108chr1511925 --137 --
NM_001024071chr141173 ------
NM_001024226chr13790 96 38 ------
NM_001024227chr13790 96 38 ------
NM_001024228chr13790 96 38 ------
NM_001024455chrX2432 245 1928 ----
NM_001024649chr531893 1878 918 ------
NM_001024666chrX160 ------
NM_001024668chr121740 ------
NM_001024808chr123480 406 182 ------
NM_001024809chr17----41301 309 54 38 --
NM_001024855chr31157 ------
NM_001024948chr132267 966 273 --1330 --
NM_001025076chr1065670 4982 4888 4839 3964 1348 --14806 --
NM_001025077chr1067028 6340 6246 6197 5322 2706 --16164 --
NM_001025079chr333441 2621 568 1496 ----
NM_001025105chr5----1578 --
NM_001025109chr12963 53 --2932 332 --
NM_001025205chr31398 ------
NM_001025232chr121134 ------
NM_001025234chr11----195 126
NM_001025235chr11----195 126
NM_001025236chr11----195 126
NM_001025237chr11----195 126
NM_001025238chr11----195 126
NM_001025239chr11----195 126
NM_001025266chr324788 609 --33797 1664 162 --
NM_001025366chr61171 1263 11482 --
NM_001025366chr61171 1263 11482 --
NM_001025367chr61171 1263 11482 --
NM_001025367chr61171 1263 11482 --
NM_001025368chr61171 1263 11482 --
NM_001025368chr61171 1263 11482 --
NM_001025369chr61187 1279 11498 --
NM_001025369chr61187 1279 11498 --
NM_001025370chr61171 1263 11482 --
NM_001025370chr61171 1263 11482 --
NM_001025579chr173768 420 262 --1186 --
NM_001025580chrX136 ------
NM_001025780chr911152 --1997 --
NM_001029858chr612123 --21276 944 --
NM_001029863chr642838 2506 1132 1000 ------
NM_001029875chr52530 133 --12029 --
NM_001029882chr1----1117 --
NM_001029882chr1----1117 --
NM_001029989chr15----1989 --
NM_001030007chr1632747 373 249 ------
NM_001031679chr1233361 3159 361 ------
NM_001031680chr141731 1703 638 475 ------
NM_001031695chr222623 202 --13595 --
NM_001031702chr32821 94 ------
NM_001031711chr52696 577 ----11437
NM_001031738chr2----1443 --
NM_001031804chr1623349 44 1859 ----
NM_001031812chr51561 --1672 --
NM_001032280chr61209 1310 ----
NM_001032283chr122410 108 ------
NM_001032284chr122410 108 ------
NM_001032289chrX3696 375 102 ------
NM_001032293chr17--180 ----
NM_001032296chr1332719 2141 84 ------
NM_001033044chr111204 ------
NM_001033056chr111204 ------
NM_001033059chr6------1227
NM_001033081chr12374 278 --11404 --
NM_001033082chr12374 278 --11404 --
NM_001033117chr344591 3806 703 115 14419 ----
NM_001033518chr732320 1137 544 ------
NM_001033519chr732320 1137 544 ------
NM_001033520chr732320 1137 544 ------
NM_001033602chr1332472 2416 1892 ------
NM_001033677chr123357 332 163 ------
NM_001033723chr812541 ------
NM_001033756chr61105 1197 11416 --
NM_001033756chr61105 1197 11416 --
NM_001033925chr101173 12085 ----
NM_001034837chr53293 138 70 ------
NM_001034838chr53293 138 70 ------
NM_001035254chr931705 461 95 --2965 898 --
NM_001035260chr10167 ------
NM_001035267chr121284 --1203 --
NM_001037164chr72325 94 1526 ----
NM_001037174chr2--11851 ----
NM_001037317chr112776 ------
NM_001037324chr32292 174 1793 ----
NM_001037331chr182938 263 ------
NM_001037335chr20------180
NM_001037339chr111198 1391 ----
NM_001037340chr111198 1391 ----
NM_001037341chr111198 1391 ----
NM_001037341chr111198 1391 ----
NM_001037535chrX179 --11080 --
NM_001037536chrX179 --11080 --
NM_001037540chrX179 --11080 --
NM_001037582chr4129 --1592 --
NM_001037633chr51292 ------
NM_001038707chr12574 126 31974 1871 25 1713 1832
NM_001038707chr12574 126 31974 1871 25 1713 1832
NM_001039468chr111272 ------
NM_001039469chr111312 ------
NM_001039538chr223411 249 ------
NM_001039548chr112163 64 ------
NM_001039574chr11749 --1885 --
NM_001039590chrX21092 358 ------
NM_001039591chrX21092 358 ------
NM_001039618chr1155711 5312 5025 325 247 ------
NM_001039690chr1611850 --155 1407
NM_001039762chr1011746 ------
NM_001039840chrX24575 444 12065 ----
NM_001039937chr1321014 748 --12756 --
NM_001040056chr162683 188 ----177
NM_001040108chr1421318 418 ------
NM_001040118chr11134 ------
NM_001040144chr1611850 --155 1407
NM_001040146chr1611850 --155 1407
NM_001040402chr41157 ------
NM_001040429chr131378 ------
NM_001040439chr1621347 411 --1456 --
NM_001040441chr113970 --21907 1053 --
NM_001040455chr1141263 1213 1038 912 --1196 --
NM_001040624chr822452 138 --12130 --
NM_001040625chr822452 138 --12130 --
NM_001040626chr822452 138 --12130 --
NM_001040627chr822452 138 --12130 --
NM_001040628chr822452 138 --12130 --
NM_001040629chr822452 138 --12130 --
NM_001040630chr822452 138 --12130 --
NM_001040653chr31823 ------
NM_001040665chr724953 4658 1845 12015 --
NM_001040666chr71655 ------
NM_001040709chr11303 --1560 --
NM_001040712chr91411 12761 ----
NM_001040715chr161828 ------
NM_001042388chr18--163 ----
NM_001042413chr922850 747 ------
NM_001042425chr61209 1310 ----
NM_001042430chr141374 160 ----
NM_001042472chr20----136 --
NM_001042494chr1512756 12869 23346 2590 --
NM_001042495chr1512756 12869 23346 2590 --
NM_001042496chr1512756 12869 23346 2590 --
NM_001042497chr1512756 12869 23346 2590 --
NM_001042510chr821383 434 ------
NM_001042511chr821383 434 ------
NM_001042537chrX32078 1962 1875 ------
NM_001042599chr247820 7434 5044 226 ------
NM_001042681chr121887 801 ----2842 378
NM_001042682chr121887 801 ----2842 378
NM_001042682chr121887 801 ----2842 378
NM_001042728chr12----198 1345
NM_001042749chrX1389 ------
NM_001042750chrX1389 ------
NM_001042751chrX1389 ------
NM_001043318chr1453443 3006 1385 775 101 12809 22689 1325 --
NM_001043351chr1--1157 41479 488 170 52 --
NM_001044385chr2----13870 --
NM_001044722chr51561 --1672 --
NM_001044723chr51561 --1672 --
NM_001070chr17129 ------
NM_001080418chr1----2478 216 --
NM_001087chr2--166 ----
NM_001095chr1221608 83 1317 31301 1200 168 --
NM_001100108chr127879 605 16670 28243 5684 --
NM_001106chr389666 8213 8028 7167 2520 1377 1141 898 27584 1094 58103 7230 3174 490 483 --
NM_001113490chrX11342 23020 3010 ----
NM_001116chr1632393 2130 2118 1548 --22773 588
NM_001117chr1822015 322 --12074 --
NM_001122631chr113664 556 261 ------
NM_001123chr10--194 ----
NM_001127chr222717 33 ------
NM_001128chr1632747 373 249 ------
NM_001146chr8----11579 --
NM_001157chr10126 ------
NM_001163chr91955 ------
NM_001189chr471048 989 952 946 769 315 174 ------
NM_001190chr191278 ------
NM_001191chr2031392 1182 44 1349 162 --
NM_001194chr193659 170 97 ------
NM_001198chr622252 93 ------
NM_001206chr922126 413 ------
NM_001220chr7122 ------
NM_001222chr102191 50 ------
NM_001256chr1722082 1053 1110 ----
NM_001259chr766099 6092 5466 2198 368 138 11085 11651 --
NM_001260chr13165 ------
NM_001265chr13162 1227 1251 --
NM_001267chr171103 --141 1446
NM_001273chr121106 ------
NM_001280chr192458 64 ------
NM_001283chr72667 111 --2434 69 --
NM_001293chr11--1392 ----
NM_001310chr122980 517 ------
NM_001313chr41654 ------
NM_001331chr1121132 85 --1977 --
NM_001343chr5197 ------
NM_001347chr421547 39 11438 1287 --
NM_001351chr311812 11319 ----
NM_001352chr19----140 --
NM_001364chr1133805 1870 270 11711 23593 3284 --
NM_001365chr172539 165 ------
NM_001389chr212617 201 ------
NM_001396chr21----11915 --
NM_001397chr162443 2309 2180 2100 987 677 --22280 726 11899
NM_001406chr172419 369 1591 ----
NM_001418chr11189 ------
NM_001418chr11189 ------
NM_001419chr1913715 13138 1537 12948
NM_001420chr1943081 2594 2359 1195 --12588 --
NM_001426chr22633 580 ------
NM_001427chr711749 1446 ----
NM_001430chr2----264 32 --
NM_001438chr11328 ------
NM_001447chr51312 --1532 --
NM_001453chr621680 1576 ------
NM_001454chr171258 --1374 --
NM_001458chr7----1628 --
NM_001461chr1--1207 ----
NM_001478chr122920 691 ------
NM_001493chrX2288 70 ------
NM_001497chr962623 2598 1084 206 119 48 ----163
NM_001523chr191116 ------
NM_001525chr12106 40 ------
NM_001530chr141840 ------
NM_001546chr621195 488 ------
NM_001552chr17----2970 104 --
NM_001584chr1111063 1265 ----
NM_001634chr6------1227
NM_001635chr72883 321 ------
NM_001655chr112593 133 --1437 --
NM_001658chr13790 96 38 ------
NM_001659chr1242492 815 677 585 --1821 --
NM_001664chr32411 225 ------
NM_001665chr112200 69 --2385 191 --
NM_001678chr1741780 1414 1344 1201 1180 11271 --
NM_001679chr31192 ------
NM_001682chr1211851 1175 ----
NM_001683chr342607 1837 1046 748 ------
NM_001702chr8----153 --
NM_001703chr11242 ------
NM_001704chr61557 ------
NM_001714chr12--1223 ----
NM_001730chr1311124 ------
NM_001730chr1311124 ------
NM_001731chr121343 1592 ----
NM_001742chr721749 523 ------
NM_001746chr531893 1878 918 ------
NM_001754chr2153237 3205 1195 499 264 11078 147 --
NM_001755chr16--1615 1854 --
NM_001759chr1263868 3705 3278 1595 1088 112 --14703 --
NM_001773chr121329 419 --11298 --
NM_001777chr333441 2621 568 1496 ----
NM_001789chr3----1216 --
NM_001797chr161226 ------
NM_001806chr1922862 2399 ------
NM_001844chr12184 ------
NM_001892chr5----1578 --
NM_001904chr3--1125 160 --
NM_001918chr138097 7142 6969 27097 6592 16986 --
NM_001920chr121773 ------
NM_001921chr42905 871 ------
NM_001938chr1----1364 --
NM_001939chrX32918 1471 364 ------
NM_001945chr5--1463 ----
NM_001949chr632128 979 430 1681 ----
NM_001967chr31382 ------
NM_001968chr41152 ------
NM_001978chr831032 724 140 ------
NM_001981chr12861 313 ------
NM_001999chr5--1554 ----
NM_002006chr424094 589 11819 --1622
NM_002024chrX21790 1376 ------
NM_002025chrX49093 7879 6258 1698 --1911 --
NM_002039chr41667 ------
NM_002040chr211402 ------
NM_002055chr1711472 --272 27 1170
NM_002061chr111702 ------
NM_002065chr111204 ------
NM_002074chr121646 1622 ------
NM_002077chr931785 1777 28 --11513 1430
NM_002084chr51836 ------
NM_002088chr19----175 --
NM_002094chr16185 ------
NM_002103chr193788 290 40 2281 133 1852 --
NM_002115chr5162 --130 --
NM_002126chr1733742 519 390 ------
NM_002140chr91134 ------
NM_002141chr7165 ------
NM_002146chr171199 ------
NM_002147chr17--1266 178 --
NM_002167chr1152 --1113 --
NM_002196chr202401 39 --2225 141 --
NM_002196chr202401 39 --2225 141 --
NM_002205chr121894 --1931 --
NM_002214chr734893 1808 950 --11246 --
NM_002221chr132755 1172 421 ----1777
NM_002222chr311170 ------
NM_002223chr1211308 ------
NM_002226chr14158 ------
NM_002229chr191372 ------
NM_002232chr1161 ------
NM_002247chr10--140 ----
NM_002249chr11375 ----1419
NM_002254chr23665 657 74 --2166 152 --
NM_002264chr333085 1840 1292 23872 3740 ----
NM_002265chr171474 ------
NM_002267chr131641 11625 ----
NM_002268chr31734 ------
NM_002270chr555099 4060 1825 256 71 14941 ----
NM_002293chr122153 105 ------
NM_002313chr1065097 5016 4779 1453 1076 965 ----13514
NM_002315chr11140 ------
NM_002356chr611948 --1260 --
NM_002359chr1733397 1139 486 13020 11124 --
NM_002373chr15------11230
NM_002374chr223411 249 ------
NM_002375chr342209 1832 406 28 --11600 --
NM_002382chr1411183 ------
NM_002387chr5127 --11778 --
NM_002397chr51794 ------
NM_002430chr2252412 1755 781 752 628 1232 ----
NM_002442chr121313 --1213 --
NM_002444chrX11431 ------
NM_002445chr82190 31 ----1317
NM_002466chr20--1112 --1263
NM_002494chr4131 ------
NM_002495chr5123 ------
NM_002501chr1943950 3894 3648 879 --54060 3932 3113 974 565 1600
NM_002505chr6198 --1574 --
NM_002509chr201280 --2770 206 --
NM_002520chr5138 ------
NM_002522chr1722397 868 --22449 807 --
NM_002524chr11251 ----1286
NM_002537chr151950 ------
NM_002545chr1121436 286 --1611 1325
NM_002552chr2--11122 ----
NM_002553chr71415 ------
NM_002556chr1121971 369 --1308 --
NM_002576chr1131212 1051 872 1496 ----
NM_002578chrX159 ------
NM_002581chr92928 130 1184 ----
NM_002582chr161861 ------
NM_002586chr611043 ------
NM_002588chr551686 1594 1570 1409 209 ------
NM_002599chr113820 340 256 ------
NM_002600chr111198 1391 ----
NM_002607chr731121 476 134 ------
NM_002608chr2231255 163 103 ------
NM_002613chr1641323 252 240 28 --23668 3649 --
NM_002622chr52606 343 --3286 203 89 --
NM_002628chr31466 ------
NM_002633chr11506 ------
NM_002634chr173604 360 25 ------
NM_002646chr131630 1475 173 1741 ----
NM_002648chr61523 ------
NM_002657chr2052993 2795 2593 1341 547 21400 1025 13235 22886 845
NM_002670chr3--123 ----
NM_002698chr1912535 --12780 --
NM_002699chr121375 1083 --31059 607 274 --
NM_002707chr2----1133 --
NM_002714chr62717 277 ------
NM_002719chr1431839 1662 141 1811 ----
NM_002720chr161108 ----160
NM_002721chr9135 ------
NM_002731chr11158 ------
NM_002734chr174918 757 618 504 ------
NM_002738chr161257 --121 --
NM_002745chr2244462 4449 4035 567 ------
NM_002747chr1821417 94 11484 ----
NM_002752chr5150 ------
NM_002776chr1911655 --3776 197 133 1319
NM_002825chr7--1469 ----
NM_002827chr2031759 1326 39 --145 11173
NM_002839chr91411 12761 ----
NM_002849chr12--1296 ----
NM_002850chr191403 --150 --
NM_002854chr22----137 --
NM_002855chr1163601 3378 3169 3115 1168 923 --3819 768 203 13069
NM_002859chr1221249 1186 --3670 124 22 --
NM_002861chr17273 38 --2173 127 1517
NM_002867chr12164 77 ------
NM_002868chr1222259 843 ----1142
NM_002871chr141975 589 409 86 ------
NM_002886chr32140 30 1589 ----
NM_002906chr111806 1451 ----
NM_002911chr1941572 1499 1281 390 --31578 1108 261 --
NM_002918chr1931150 1002 786 --1723 --
NM_002924chr13506 428 164 ------
NM_002938chr481997 1628 735 582 530 394 378 68 ------
NM_002942chr31327 ------
NM_002959chr153959 3359 3045 874 431 23617 381 ----
NM_002966chr1166 ------
NM_002977chr222687 303 ------
NM_002996chr1621644 246 --31223 578 394 --
NM_002997chr251825 1730 1295 190 174 --126 --
NM_003002chr11151 ------
NM_003010chr1721947 1882 1747 ----
NM_003011chr91314 ------
NM_003026chr921107 1002 ------
NM_003030chr33210 78 60 ------
NM_003031chr16--176 ----
NM_003036chr12464 259 11236 284 74 --
NM_003039chr1--134 ----
NM_003051chr111937 ------
NM_003074chr32726 292 ------
NM_003075chr121129 ------
NM_003076chr12177 ------
NM_003077chr17----1228 --
NM_003085chr51114 ------
NM_003091chr20132 ------
NM_003106chr311001 ------
NM_003107chr622412 687 --3889 231 141 --
NM_003108chr222153 2002 11771 11810 15999
NM_003110chr17----2319 187 --
NM_003131chr611882 --1468 --
NM_003137chr611493 --146 1225
NM_003139chr112932 706 --1264 --
NM_003144chr612030 ------
NM_003150chr1731870 1549 394 159 ----
NM_003155chr82784 220 ----1264
NM_003156chr111320 --21222 214 --
NM_003165chr921518 148 --11485 --
NM_003173chrX1357 ------
NM_003174chr101738 ------
NM_003175chr1123 ------
NM_003178chr311875 ------
NM_003184chr82223 104 ------
NM_003185chr2011109 --2537 498 --
NM_003189chr123257 3151 13219 1384 --
NM_003199chr1825111 844 ------
NM_003204chr1731614 1472 1302 ------
NM_003216chr2252359 1037 688 577 377 --22060 50 1536
NM_003220chr61209 1310 ----
NM_003222chr20--1446 11197 --
NM_003223chr16--1575 1605 1291
NM_003236chr222376 394 1331 1171 12295
NM_003239chr141706 ------
NM_003246chr1511644 --21276 302 --
NM_003253chr211492 --21503 56 --
NM_003255chr171482 ----1218
NM_003257chr1511095 ------
NM_003262chr325184 3479 --14491 --
NM_003269chr61295 ------
NM_003271chr11----195 126
NM_003290chr19296 45 ------
NM_003315chr17196 ------
NM_003317chr141586 --136 --
NM_003320chr1163075 2803 1471 843 388 169 1102 12706 --
NM_003325chr22----1253 --
NM_003342chr1723042 2696 --1988 --
NM_003348chr12--144 ----
NM_003363chr32524 71 ------
NM_003370chr192262 36 1795 --1238
NM_003371chr941510 786 586 424 ------
NM_003373chr1031944 1285 323 --1329 --
NM_003376chr61171 1263 11482 --
NM_003376chr61171 1263 11482 --
NM_003378chr7164 ------
NM_003392chr331715 1143 1051 ------
NM_003400chr2131 ------
NM_003403chr141281 ------
NM_003404chr2011883 ------
NM_003406chr821720 24 ------
NM_003412chr311013 21068 136 ----
NM_003413chrX41826 1283 383 266 ------
NM_003430chr19----1160 --
NM_003457chr17--180 ----
NM_003458chr363699 3247 1020 519 282 96 22961 1210 11026 --
NM_003459chr2----1707 --
NM_003470chr1621567 708 ------
NM_003478chr11----1123 --
NM_003482chr12----1231 --
NM_003488chr172775 189 ------
NM_003489chr2122632 1030 ------
NM_003558chr92503 69 ------
NM_003563chr1721246 25 11284 --11352
NM_003566chr12----1494 --
NM_003575chr711431 --31458 636 626 --
NM_003576chr1332719 2141 84 ------
NM_003583chr1243575 2908 1473 786 ------
NM_003586chr162129 58 --1489 --
NM_003603chr42451 202 ------
NM_003607chr134253 966 397 --134 --
NM_003613chr152252 28 ------
NM_003615chr3----1820 --
NM_003624chr1921352 44 --1430 1368
NM_003629chr143129 3037 1374 402 ------
NM_003632chr172249 102 1293 3764 729 589 --
NM_003633chr531793 1017 527 11997 ----
NM_003644chr1765991 5935 5529 4417 4388 2462 1913 ----
NM_003653chr171167 ------
NM_003655chr171278 ------
NM_003656chr3130 ------
NM_003660chr191253 --1482 --
NM_003664chr51470 ------
NM_003672chr1----1106 --
NM_003681chr21146076 6045 5996 5840 5518 4816 4359 3787 3752 2053 1147 728 78 46 21816 462 14202 14481
NM_003685chr19------1272
NM_003714chr542737 2300 2278 423 12229 12053 12090
NM_003735chr551686 1594 1570 1409 209 ------
NM_003736chr551686 1594 1570 1409 209 ------
NM_003743chr211392 --31524 378 372 --
NM_003749chr131908 ------
NM_003758chr15--186 ----
NM_003758chr15--186 ----
NM_003760chr11544 ----172
NM_003763chr2012949 --22652 2346 --
NM_003766chr171528 ------
NM_003768chr111161 ------
NM_003779chr11422 ------
NM_003791chr161573 --1223 --
NM_003825chr151584 --1187 --
NM_003861chr1412856 ------
NM_003872chr21244 1573 1428 --
NM_003885chr1721914 1698 ------
NM_003888chr15151 ------
NM_003893chr10----132 --
NM_003901chr1022556 594 ------
NM_003924chr431211 626 239 --1277 --
NM_003936chr221192 279 ------
NM_003938chr191133 --1919 --
NM_003939chr1022517 298 167 ----
NM_003954chr1711324 1103 1282 1220
NM_003955chr1721439 59 --2303 146 11214
NM_003958chr653947 3880 2709 1331 342 13468 2248 87 --
NM_003980chr611022 ------
NM_003988chr1031820 1770 547 --51742 1710 1693 958 41 --
NM_003994chr122806 422 1774 ----
NM_004024chr11530 ------
NM_004037chr1184 1732 1618 1591
NM_004040chr221168 396 ------
NM_004055chr1141587 899 363 303 --3799 633 145 --
NM_004061chr51435 1209 ----
NM_004068chr31398 ------
NM_004081chrY--11345 ----
NM_004093chr133525 400 304 ------
NM_004096chr1011605 21981 785 ----
NM_004098chr101508 ------
NM_004099chr911975 --2703 523 --
NM_004100chr611989 --1335 --
NM_004107chr191146 ------
NM_004114chrX--1144 ----
NM_004116chr2----1143 164
NM_004124chr1413517 12180 ----
NM_004132chr1031131 1068 197 ------
NM_004134chr51614 ------
NM_004161chr221319 518 ------
NM_004163chr18--1121 ----
NM_004171chr1119520 13828 22479 648 --
NM_004172chr511984 ------
NM_004183chr11--1660 --128
NM_004188chr91477 ------
NM_004193chr102351 200 ------
NM_004225chr831292 932 82 ------
NM_004227chr72353 70 ----12230
NM_004238chr2126 ------
NM_004253chr91952 ------
NM_004274chr1412924 --12818 --
NM_004276chr123357 332 163 ------
NM_004290chr52881 544 2509 53 ----
NM_004302chr1242544 2406 530 94 12492 22168 833 22627 2191
NM_004309chr174270 232 130 108 11092 2914 787 --
NM_004311chr1052992 2826 1216 1201 227 --32745 1194 693 --
NM_004319chr1--1203 1327 --
NM_004321chr243383 2955 1289 1239 --12543 12669
NM_004329chr101557 ------
NM_004331chr81269 ------
NM_004338chr1866921 5947 4711 2201 1868 895 26119 4401 --11726
NM_004342chr7--12187 ----
NM_004350chr141731 1703 638 475 ------
NM_004356chr112110 32 --1437 1501
NM_004364chr1931015 167 146 --11089 --
NM_004384chr51561 --1672 --
NM_004392chr1312031 ------
NM_004393chr341531 1485 366 257 --12098 --
NM_004395chr5----198 --
NM_004397chr1111390 --23854 1586 --
NM_004409chr191767 --3583 483 118 --
NM_004411chr71585 ------
NM_004416chr12----1969 163
NM_004419chr101290 ------
NM_004426chr121710 ------
NM_004428chr11652 1805 ----
NM_004429chrX2235 63 1356 ----
NM_004430chr821096 703 ----11701
NM_004431chr11130 --1327 --
NM_004438chr231105 910 788 --194 --
NM_004454chr331576 1487 579 ------
NM_004459chr171725 11396 ----
NM_004464chr421006 444 --13770 --
NM_004472chr53278 182 127 ------
NM_004481chr151890 505 284 276 91 ------
NM_004519chr8--1238 ----
NM_004529chr9--11176 ----
NM_004535chr2011756 ------
NM_004540chr211779 ------
NM_004575chr4265 43 ------
NM_004583chr17----138 --
NM_004588chr1133456 3380 3154 --43221 2804 830 51 --
NM_004598chr5--11037 1920 --
NM_004603chr7----1156 1143
NM_004612chr921584 309 --14099 --
NM_004626chr11295 39 ------
NM_004630chr112820 352 ----1749
NM_004634chr3186 ------
NM_004637chr321250 252 ------
NM_004643chr141600 1248 ----
NM_004655chr1711174 ------
NM_004656chr33965 288 22 ----11105
NM_004663chr1511271 ------
NM_004667chr152177 105 ------
NM_004684chr41270 ------
NM_004687chr171684 --11844 --
NM_004697chr92428 388 1101 ----
NM_004703chr1712493 ------
NM_004710chr172955 902 --148 1388
NM_004716chr113763 717 195 ------
NM_004723chr11817 ------
NM_004726chrX24914 4588 142 ----
NM_004730chr522132 1747 ------
NM_004736chr11375 ------
NM_004737chr2211272 --1187 --
NM_004742chr311811 ------
NM_004745chr866199 5459 5041 2111 1595 36 36727 5936 2510 21559 531 --
NM_004746chr18196 --2222 65 --
NM_004747chr10194 --1201 --
NM_004755chr141112 1325 ----
NM_004758chr171273 --11066 --
NM_004759chr161342 776 720 571 361 293 ------
NM_004762chr172495 285 --12036 21321 100
NM_004775chr1812169 ------
NM_004783chr16------1249
NM_004785chr161495 --1327 --
NM_004798chr2063414 3205 3102 883 865 595 --1923 --
NM_004801chr21250 ------
NM_004805chr21242 ------
NM_004824chr631328 1069 573 ------
NM_004831chr191160 ------
NM_004836chr21101 ------
NM_004840chrX42003 831 558 366 ------
NM_004845chrX64112 3268 3073 2797 171 131 --13722 1431
NM_004850chr2----21783 1618 --
NM_004879chr112773 116 ----1104
NM_004883chr5----124 --
NM_004886chr19----135 --
NM_004889chr72159 54 ------
NM_004898chr422611 1959 ------
NM_004902chr201221 ------
NM_004905chr12274 218 --1181 --
NM_004906chr61196 ------
NM_004907chr192676 241 --1992 --
NM_004924chr191104 --2877 834 --
NM_004925chr9----129 --
NM_004926chr14----1453 --
NM_004932chr52300 79 ----1536
NM_004947chr322052 139 12565 ----
NM_004952chr12958 146 ------
NM_004954chr111272 ------
NM_004956chr723104 462 1161 ----
NM_004973chr631667 1624 495 ------
NM_004976chr1131580 590 283 ------
NM_004978chr131412 1262 426 --11548 --
NM_004979chrX31083 765 106 ------
NM_004981chr221103 --143 --
NM_004991chr3----1124 --
NM_004992chrX78058 7616 7435 2533 1803 1434 1236 17734 11363 --
NM_004992chrX78058 7616 7435 2533 1803 1434 1236 17734 11363 --
NM_004995chr141311 --1248 --
NM_005017chr31225 ------
NM_005028chr1021777 674 ------
NM_005029chr10156 ------
NM_005044chrX34247 3034 46 13410 ----
NM_005056chr1255158 3747 3689 3631 3573 11051 ----
NM_005063chr1022992 797 --1169 1969
NM_005065chr14--21982 1468 --15143
NM_005067chr3--1977 1634 --
NM_005068chr611374 ------
NM_005070chr22249 160 ------
NM_005073chr13----2250 55 --
NM_005076chr141121 972 169 21 --23614 2688 1366
NM_005077chr91368 ------
NM_005094chr92211 56 --1719 --
NM_005095chr11405 11755 11586 --
NM_005096chrX1122 --1420 --
NM_005099chr1----2247 138 1857
NM_005104chr63495 139 33 ------
NM_005112chr41150 ------
NM_005116chr2024029 1282 --23961 852 --
NM_005124chr61101 ------
NM_005126chr3--1285 ----
NM_005134chr18--163 ----
NM_005135chr1512756 12869 23346 2590 --
NM_005157chr941882 568 253 123 --3562 462 215 --
NM_005159chr152895 737 ------
NM_005168chr221729 1495 ------
NM_005171chr12--1423 ----
NM_005180chr1021221 301 ------
NM_005182chr161242 ----1442
NM_005184chr1941229 1136 1099 1066 11080 1304 --
NM_005187chr1641565 1326 808 231 --21490 327 --
NM_005197chr1424912 1621 12378 ----
NM_005206chr1741297 1099 1093 92 --1897 --
NM_005207chr2243420 2831 1353 39 --23403 657 --
NM_005220chr17----2204 62 --
NM_005225chr20149 --1965 --
NM_005230chr121394 ------
NM_005233chr31887 ------
NM_005235chr247820 7434 5044 226 ------
NM_005263chr1173 --1155 --
NM_005276chr1221526 1308 ----1508
NM_005276chr1221526 1308 ----1508
NM_005281chr11756 ----1948
NM_005311chr722609 210 --22378 553 --
NM_005324chr1721956 1303 ------
NM_005328chr81263 2572 156 ----
NM_005329chr1621958 797 --12042 --
NM_005334chrX31420 1212 1081 --21521 318 --
NM_005336chr231477 316 94 ------
NM_005342chrX1534 --11933 --
NM_005384chr9----1185 --
NM_005387chr111263 ------
NM_005388chr91537 ----1340
NM_005392chr94548 331 323 65 --132 --
NM_005398chr1011370 ------
NM_005400chr22482 380 12632 ----
NM_005402chr71668 1747 ----
NM_005415chr2----1495 --
NM_005424chr13292 48 29 ------
NM_005430chr124952 345 246 87 --1374 1314
NM_005433chr18199 135 ----
NM_005436chr1023942 259 ------
NM_005439chr12----2512 218 --
NM_005442chr31620 1469 ----
NM_005443chr41149 ------
NM_005458chr93992 748 422 ------
NM_005465chr111759 ------
NM_005475chr1222877 2155 ------
NM_005479chr1021443 1032 1490 11215 --
NM_005487chr221278 ----11453
NM_005493chr6167 ------
NM_005497chr171951 11129 11695 --
NM_005503chr1521147 777 ----1469
NM_005504chr1235869 2025 1159 ------
NM_005506chr422217 329 --12062 --
NM_005517chr1--1539 ----
NM_005539chr1051362 1281 516 502 140 --2488 442 21067 390
NM_005563chr1----1581 --
NM_005575chr5----161 --
NM_005578chr334084 3348 813 1377 11274 --
NM_005584chr132277 91 --1320 --
NM_005596chr932155 815 371 12517 ----
NM_005599chr111364 1351 ----
NM_005614chr72762 712 ------
NM_005629chrX31044 335 111 --1833 --
NM_005634chrX2626 602 ------
NM_005637chr18--11814 11702 --
NM_005647chrX52750 1224 772 693 602 23229 3166 ----
NM_005652chr161863 --1169 --
NM_005665chr134777 4207 163 --1579 --
NM_005668chr523033 1739 --1741 --
NM_005686chr111414 ----1497
NM_005698chr12235 107 ------
NM_005707chr15----11166 --
NM_005708chr131140 ------
NM_005715chr642250 1973 1788 693 ------
NM_005716chr191493 ------
NM_005717chr1125 ------
NM_005722chr2----2701 105 --
NM_005725chr1--11593 11830 --
NM_005730chr1242850 2687 1240 982 ------
NM_005731chr21111 ------
NM_005738chr72325 94 1526 ----
NM_005746chr712302 ------
NM_005748chr1223046 208 13096 ----
NM_005752chr161997 ------
NM_005768chr121135 1580 ----
NM_005776chr141542 ------
NM_005779chr5--1343 1395 --
NM_005783chr21634 ------
NM_005801chr171123 ------
NM_005808chr333392 3225 103 ------
NM_005822chr61453 ----11795
NM_005826chr11548 ------
NM_005828chr1735062 1930 1514 --43876 3230 342 54 --
NM_005840chrX36455 2457 2450 12665 22397 624 11578
NM_005871chr10129 ------
NM_005876chr21653 1817 ----
NM_005895chr1263580 2926 789 433 307 21 --2632 616 12944
NM_005898chr111199 12923 ----
NM_005906chr62490 36 11378 ----
NM_005909chr523908 249 ------
NM_005910chr1741481 1173 912 739 12701 192 --
NM_005920chr163498 3071 2746 2481 2424 1483 --12843 --
NM_005933chr1132997 2217 1927 --32198 2074 1957 22081 1206
NM_005941chr823779 259 ------
NM_005943chr621325 647 --11257 --
NM_005955chr153787 1953 1313 881 669 --21471 1047 --
NM_005962chr1022123 578 ------
NM_005962chr1022123 578 ------
NM_005964chr1731299 1174 372 ------
NM_005967chr12----2249 108 --
NM_005984chr22----1480 --
NM_006007chr943886 3710 333 313 --13661 --
NM_006011chr1584180 4124 3459 3379 3116 2914 1267 1157 ------
NM_006015chr1----1267 --
NM_006016chr611539 ------
NM_006022chr13176 ------
NM_006030chr31314 --31702 381 50 --
NM_006037chr254201 3228 3039 1924 154 11398 ----
NM_006068chr41275 ------
NM_006077chr102189 54 ------
NM_006078chr22----185 --
NM_006080chr7----12379 --
NM_006091chr1511148 --139 --
NM_006095chr433845 3779 609 ------
NM_006096chr831299 224 72 ------
NM_006099chr1125 --1149 --
NM_006107chr171419 ------
NM_006108chr112963 123 ------
NM_006135chr1--1263 1184 --
NM_006139chr212631 --21955 927 --
NM_006148chr1742644 768 626 52 1163 2524 465 --
NM_006153chr3--1547 ----
NM_006158chr821399 1240 ------
NM_006160chr172536 315 --11471 --
NM_006162chr1811184 ------
NM_006177chr142257 78 --152 --
NM_006178chr171132 ------
NM_006180chr921342 347 ------
NM_006185chr11----164 --
NM_006187chr12--2755 577 21028 349 12079
NM_006191chr121312 ------
NM_006202chr191620 --176 --
NM_006203chr524917 4591 33574 658 104 ----
NM_006206chr4--12569 ----
NM_006226chr2----1443 --
NM_006237chr132740 70 ------
NM_006243chr1----123 --
NM_006245chr6172 ------
NM_006251chr5----13022 --
NM_006252chr126296 6264 11506 ----
NM_006258chr10125 ------
NM_006268chr113364 273 248 ----1919
NM_006270chr19153 1181 ----
NM_006272chr211622 ------
NM_006275chr201672 1546 ----
NM_006279chr11839 --1716 --
NM_006285chr91297 ------
NM_006301chr12----1511 --
NM_006312chr123767 141 117 ------
NM_006315chr463652 3585 3174 1119 615 315 --13432 --
NM_006321chr332119 1900 496 --182 11850
NM_006322chr132932 111 ------
NM_006328chr11----1189 --
NM_006335chr11811 --1333 --
NM_006357chr21117 ------
NM_006359chrX32078 1962 1875 ------
NM_006361chr1731961 1628 93 --11697 --
NM_006364chr141283 ------
NM_006367chr11113 ------
NM_006371chr335205 4925 455 24616 4381 1295 --
NM_006372chr61132 ------
NM_006380chr1712966 11565 13524 12814
NM_006386chr2222087 192 --2625 81 --
NM_006389chr1131139 1076 509 ------
NM_006401chr91157 ------
NM_006421chr8140 ------
NM_006424chr411877 1793 ----
NM_006451chr5--1157 ----
NM_006454chr472825 2806 2711 2533 1045 561 442 ------
NM_006465chr1531682 485 138 1395 ----
NM_006467chr5------1217
NM_006469chr1------11430
NM_006477chr22----1111 --
NM_006480chr52522 65 ------
NM_006482chr1243575 2908 1473 786 ------
NM_006494chr19----1764 --
NM_006497chr171313 ------
NM_006517chrX12112 --21760 1476 --
NM_006532chr192605 540 --11693 --
NM_006540chr8------11162
NM_006546chr1745886 2426 2226 212 16483 --14243
NM_006547chr71268 ------
NM_006548chr3--11493 1148 --
NM_006557chr91625 11479 --11208
NM_006559chr121178 163 ------
NM_006561chr1065670 4982 4888 4839 3964 1348 --14806 --
NM_006562chr10121 --1218 199
NM_006577chr2--11188 ----
NM_006593chr21192 --175 --
NM_006601chr12149 ------
NM_006603chrX1389 ------
NM_006609chr212876 11991 ----
NM_006618chr1----11305 --
NM_006620chr61168 --24842 1513 1694
NM_006625chr1--1845 1971 --
NM_006625chr1--1845 1971 --
NM_006625chr1--1845 1971 --
NM_006628chr1523858 1141 23582 917 24527 3518 11159
NM_006646chr134595 573 369 324 ------
NM_006650chr533815 3676 2693 --1115 --
NM_006651chr461453 1266 1227 537 192 58 --3500 464 207 --
NM_006653chr61302 --251 29 --
NM_006670chr6134 ------
NM_006709chr6------161
NM_006710chr22917 805 ------
NM_006713chr51208 ------
NM_006717chr923307 331 ----1124
NM_006720chr1065097 5016 4779 1453 1076 965 ----13514
NM_006721chr10--194 ----
NM_006722chr322658 1038 ------
NM_006729chrX35341 4639 3416 --14922 --
NM_006738chr1544400 4289 3653 197 --11240 --
NM_006746chrX179 --11080 --
NM_006749chr8----1126 --
NM_006761chr172746 287 --1550 --
NM_006763chr12733 257 --11706 --
NM_006772chr611572 --1309 --
NM_006791chr15135 ------
NM_006802chr111091 2430 203 ----
NM_006807chr171378 ------
NM_006818chr1--1128 ----
NM_006822chr171237 ------
NM_006823chr811284 ------
NM_006832chr141806 ------
NM_006851chr121864 12245 ----
NM_006852chr1712526 --1697 --
NM_006874chr41465 ------
NM_006876chr11----1544 --
NM_006884chr33210 78 60 ------
NM_006885chr1623116 1028 ------
NM_006896chr741064 820 323 25 --1236 --
NM_006897chr122593 410 ------
NM_006902chr113144 140 ----
NM_006908chr71109 ------
NM_006931chr1211667 --11971 --
NM_006939chr141273 ------
NM_006941chr2231144 1033 973 ------
NM_006946chr112384 37 ------
NM_006950chrX----2725 285 --
NM_006981chr912915 1411 ----
NM_006990chr121754 1571 --42422 1786 617 511 --
NM_006996chr12453 40 ------
NM_006999chr551590 328 226 133 37 21926 1269 ----
NM_007007chr1214335 ----14023
NM_007011chr1576657 5623 5331 4543 1840 941 556 14444 36356 5657 465 --
NM_007013chr8------1886
NM_007039chr14----11752 --
NM_007050chr2096814 5826 5247 2859 2493 1507 747 462 156 16927 1594 --
NM_007051chr11120 ------
NM_007067chr1721590 1102 ------
NM_007068chr22----1938 --
NM_007073chr621557 807 ------
NM_007106chr1321855 101 ----12436
NM_007124chr611809 ------
NM_007150chrX31972 1603 1496 --11392 11519
NM_007158chr11409 ------
NM_007166chr1111281 ------
NM_007170chr12652 243 ------
NM_007174chr1232217 1515 70 ------
NM_007181chr191169 ------
NM_007185chr13672 285 77 ------
NM_007192chr1421017 442 1295 ----
NM_007200chr1544400 4289 3653 197 --11240 --
NM_007232chr204967 763 382 305 --1980 2937 728
NM_007236chr1532089 689 682 22004 390 11558 --
NM_007245chr16----2719 136 --
NM_007249chr1348986 6616 3378 2427 22050 610 23259 737 1271
NM_007271chr611218 21450 509 --1400
NM_007283chr332496 2344 393 --2428 293 --
NM_007286chr522128 487 ------
NM_007313chr941882 568 253 123 --3562 462 215 --
NM_007322chr19144 --1430 1368
NM_007327chr92792 441 --31152 1144 25 --
NM_007331chr432537 1093 813 ----1974
NM_007345chr182264 76 ------
NM_007350chr1214331 --1105 --
NM_007361chr141502 ------
NM_007365chr12559 33 --11461 --
NM_007371chr91207 --2617 54 --
NM_007373chr101565 ------
NM_007375chr11536 2700 605 ----
NM_012074chr14------1778
NM_012081chr523263 604 ------
NM_012096chr323157 2307 1288 13001 --
NM_012097chr2--11851 ----
NM_012102chr121887 801 ----2842 378
NM_012104chr112221 48 1861 1136 --
NM_012104chr112221 48 1861 1136 --
NM_012137chr112225 31985 608 576 1591 --
NM_012141chr1321014 748 --12756 --
NM_012154chr82155 135 1577 ----
NM_012156chr2023387 1342 ------
NM_012161chr411135 ------
NM_012164chr966344 6136 6024 2099 782 67 26699 2354 12290 --
NM_012166chr921044 1014 --182 --
NM_012175chr11187 ------
NM_012181chr19128 ----1260
NM_012193chr1124873 4164 --14010 --
NM_012199chr163051 3029 2976 1484 755 655 ------
NM_012202chr11------1262
NM_012218chr191197 12700 ----
NM_012234chr322960 2465 ------
NM_012249chr231388 1195 348 ------
NM_012262chr134675 820 391 14414 ----
NM_012286chrX1450 ------
NM_012288chr634672 4355 3727 --35253 3946 104 --
NM_012294chr743909 3399 2685 2676 ------
NM_012296chr1133108 1483 1069 --22414 196 1111
NM_012297chr41356 ------
NM_012300chr5------11582
NM_012301chr7160 ------
NM_012302chr121100 87 ------
NM_012304chr532486 1924 1791 --1303 --
NM_012308chr114856 607 183 114 --11826 --
NM_012311chr10--158 1591 --
NM_012316chr164276 3873 1910 1856 1320 112 --2413 146 --
NM_012324chr221761 --2660 292 --
NM_012326chr21251 --1737 --
NM_012329chr1731039 534 169 1678 ----
NM_012330chr101245 ------
NM_012342chr101123 ------
NM_012384chr2042449 1895 1810 1626 ------
NM_012394chr1181 ------
NM_012395chr763453 2377 2360 650 315 178 ------
NM_012405chr132530 1305 880 12411 12728 --
NM_012430chr31105 ------
NM_012448chr1732270 2146 492 1460 22476 1679 --
NM_012454chr6------1572
NM_012461chr141668 --1272 1289
NM_012467chr16148 ------
NM_012475chr11239 ------
NM_012479chr732656 971 434 ------
NM_013233chr221151 78 ------
NM_013236chr22----1474 --
NM_013246chr11122 --1707 --
NM_013255chr757365 6261 3098 892 50 16100 ----
NM_013261chr422526 1354 ------
NM_013269chr1254363 4183 940 477 431 ------
NM_013279chr111106 ------
NM_013313chr221323 --22391 796 --
NM_013323chr174913 870 776 123 1857 ----
NM_013354chr81131 1508 ----
NM_013363chr3--135 ----
NM_013365chr222736 525 ------
NM_013372chr1541131 982 938 212 ----12160
NM_013386chr1----1260 --
NM_013392chr22408 272 ------
NM_013410chr11223 --1180 --
NM_013952chr232385 2051 1039 ------
NM_013953chr232385 2051 1039 ------
NM_013958chr8----1102 --
NM_013959chr8----1102 --
NM_013960chr81571 ------
NM_013961chr8----1102 --
NM_013962chr8----1102 --
NM_013981chr5----124 --
NM_013982chr5----124 --
NM_013983chr5----124 --
NM_013992chr232385 2051 1039 ------
NM_014000chr1031944 1285 323 --1329 --
NM_014011chr221757 37 ------
NM_014023chr102846 395 ----12053
NM_014030chr1721001 354 ------
NM_014079chr31286 129 ----
NM_014109chr82461 66 ------
NM_014112chr8--13968 11611 --
NM_014117chr16--12114 ----
NM_014171chr2147 ------
NM_014212chr122902 91 ------
NM_014231chr1231940 1790 1594 --155 --
NM_014232chr17----1441 --
NM_014232chr17----1441 --
NM_014233chr1732138 1658 186 --11572 --
NM_014234chr6125 --146 --
NM_014240chr343511 3502 2788 1437 13235 11593 --
NM_014245chr32945 190 --1788 1739
NM_014250chr221278 ----11453
NM_014253chrX11770 ------
NM_014268chr1831446 980 110 ------
NM_014284chr12910 186 ------
NM_014286chr973510 2906 515 303 264 216 105 --42749 2417 1224 444 --
NM_014289chrX11208 154 ----
NM_014299chr19----22050 732 --
NM_014309chr222613 192 --13585 --
NM_014310chr2271934 1749 497 241 188 163 150 --1672 --
NM_014331chr4131 ------
NM_014333chr1122362 185 ------
NM_014335chr15--156 ----
NM_014342chr112573 140 ------
NM_014351chr2231234 1039 296 ------
NM_014360chr14150 --2633 94 --
NM_014368chr931339 102 25 1120 11887 --
NM_014381chr1421318 418 ------
NM_014393chr82331 303 ------
NM_014396chr71432 --11633 --
NM_014405chr1731708 724 585 22307 1952 2420 23 --
NM_014408chr1----2209 71 --
NM_014417chr19192 --2643 300 --
NM_014423chr524973 363 ------
NM_014431chr10----11586 1448
NM_014454chr6----2876 870 --
NM_014460chr2251136 665 595 244 136 --1372 --
NM_014470chr121707 ------
NM_014488chr11--1643 ----
NM_014494chr162629 111 --1417 --
NM_014496chrX1255 ------
NM_014517chr3----11247 --
NM_014520chr17141 ------
NM_014554chr122158 96 1273 ----
NM_014562chr24683 631 564 48 ------
NM_014572chr132459 113 ------
NM_014574chr141103 ------
NM_014575chr31432 ------
NM_014577chr22----1168 --
NM_014592chr53293 138 70 ------
NM_014613chr5--1696 12925 --
NM_014614chr22100 79 ------
NM_014618chr91327 ------
NM_014653chr1241721 1433 543 198 ------
NM_014661chr1083831 2826 2636 1309 998 987 494 289 --13334 1788
NM_014667chr322302 1535 ------
NM_014682chr81364 ------
NM_014693chr32292 174 1793 ----
NM_014701chr15--12222 11206 --
NM_014705chr7--11613 ----
NM_014707chr71468 ------
NM_014709chr21109 ------
NM_014711chr162373 68 ------
NM_014712chr163451 428 174 ------
NM_014723chr2032882 2140 2047 --23059 1128 --
NM_014726chr17----2292 34 --
NM_014729chr811635 ------
NM_014730chr1224675 879 --13594 --
NM_014730chr1224675 879 --13594 --
NM_014736chr15----11014 --
NM_014739chr6----14088 --
NM_014752chr111540 ------
NM_014756chr111167 ------
NM_014762chr11923 --1810 --
NM_014764chr121454 ------
NM_014767chr1063627 3415 3168 2515 1262 482 --22350 1030 --
NM_014772chr1833439 1196 889 --13583 --
NM_014776chr1222746 2485 ------
NM_014779chr31818 ------
NM_014784chr12285 25 ------
NM_014807chr111520 ------
NM_014810chr12640 56 1490 22557 1265 --
NM_014824chr1121299 1250 ------
NM_014826chr134253 966 397 --134 --
NM_014827chr111650 ------
NM_014830chr1223154 1207 --12657 --
NM_014832chr1321705 1565 ------
NM_014835chr2041723 1685 746 184 ------
NM_014839chr112162 ------
NM_014840chr122848 779 22784 185 --12505
NM_014850chr344591 3806 703 115 14419 ----
NM_014853chr1721446 257 1929 11007 --
NM_014858chr12989 460 --1361 --
NM_014869chr321284 83 ------
NM_014873chr124010 1442 --11285 --
NM_014876chr222810 78 ------
NM_014877chr1756616 6143 5622 4705 2423 --15987 16322
NM_014883chr42606 119 12084 12344 --
NM_014892chr6--198 ----
NM_014893chrY--1572 132 --
NM_014897chr1722701 882 --1103 1122
NM_014901chr541777 319 210 105 --1420 --
NM_014904chr10--1286 ----
NM_014906chr1713940 ------
NM_014909chr1483621 3507 3394 3178 2801 977 580 473 11449 2749 362 1922
NM_014917chr1----1377 --
NM_014918chr151543 ----11186
NM_014921chr1921064 439 --21206 661 --
NM_014924chr1433151 2104 1059 2476 283 ----
NM_014926chr31238 ------
NM_014931chr19136 ------
NM_014934chr1343544 3291 224 92 ------
NM_014938chr1242356 2021 804 463 --3434 256 120 --
NM_014939chr1811227 ------
NM_014944chr121417 44 11458 1180 --
NM_014946chr211132 ------
NM_014947chr111153 --1996 --
NM_014961chr421372 775 1410 1757 --
NM_014962chr201180 ------
NM_014969chr11169 ------
NM_014974chr1021523 54 --11754 --
NM_014978chr1011311 --1374 1259
NM_014982chr1455120 3637 3619 914 889 14637 ----
NM_014988chr422682 2402 ------
NM_014989chr621859 1334 ------
NM_014990chr14--1256 ----
NM_014991chr422754 90 ------
NM_014992chr14------1707
NM_014997chr721941 1133 --12585 --
NM_015000chr1222317 304 ------
NM_015001chr1145 ------
NM_015002chr1211487 --1197 --
NM_015018chr6167 ------
NM_015020chr1622850 72 --1358 --
NM_015023chr121557 312 --31812 672 49 11260
NM_015025chr212020 1233 ----
NM_015032chr132980 428 1585 --12861
NM_015033chr952707 1197 863 351 105 12984 33077 2427 50 12723
NM_015035chr2066351 2530 1769 1707 583 79 --25541 1459 --
NM_015039chr11278 14226 --13983
NM_015042chr1533780 1337 673 1989 13973 --
NM_015044chr1622608 284 13217 ----
NM_015045chr1012014 ------
NM_015051chr912352 ------
NM_015057chr13177 ------
NM_015059chr1553654 3568 3215 662 584 --33931 1357 216 --
NM_015069chr162245 28 ------
NM_015075chrX--11968 31979 175 36 --
NM_015076chr623664 2977 ------
NM_015080chr111233 ------
NM_015090chr175465 4440 4229 2397 1903 1234 306 22321 130 25714 617 --
NM_015092chr1623274 753 1270 ----
NM_015097chr32725 522 ------
NM_015100chr111851 --11990 --
NM_015102chr1190 ------
NM_015103chr32941 260 ------
NM_015107chrX21673 86 --2936 524 --
NM_015113chr1762031 1999 1970 1588 921 354 138 ----
NM_015115chr41157 ------
NM_015125chr19----1463 --
NM_015132chr7----11886 --
NM_015133chr1621347 411 --1456 --
NM_015138chr1532703 498 310 ------
NM_015144chr1623627 530 13885 ----
NM_015151chr211310 1193 ----
NM_015155chr1063037 2472 2233 915 891 367 12292 ----
NM_015156chr1443508 1056 721 154 13492 1224 --
NM_015163chr1441320 525 203 135 1599 3186 159 43 --
NM_015170chr82261 228 ------
NM_015171chr161441 --1139 --
NM_015178chr8368 60 47 --1612 --
NM_015185chrX52905 2608 2341 1005 280 ------
NM_015194chr173469 399 156 ------
NM_015197chr1443040 2433 346 188 ------
NM_015199chr322557 2315 12280 ----
NM_015200chr41548 --1126 --
NM_015205chr1334364 1417 1127 14219 21114 1090 --
NM_015215chr11142 ------
NM_015226chr1652995 1130 666 451 280 13393 13014 --
NM_015229chr1721069 1032 ------
NM_015233chr1332472 2416 1892 ------
NM_015242chr11134 ------
NM_015252chr21599 ------
NM_015265chr2----1309 --
NM_015272chr1611656 ------
NM_015277chr181271 ------
NM_015285chr1842489 2296 2096 212 ------
NM_015288chr532754 2734 84 --2655 119 --
NM_015291chr12819 719 ------
NM_015299chr1473618 1588 1251 1039 690 588 79 ------
NM_015313chr112582 111 ------
NM_015315chr532245 1188 341 1576 ----
NM_015316chr143557 382 204 --1982 --
NM_015317chr212409 12578 ----
NM_015327chr131183 977 469 ------
NM_015328chr742773 2689 2068 1192 ------
NM_015335chr12176 1843 ----
NM_015338chr2031857 755 653 ------
NM_015339chr201281 ------
NM_015343chr171110 --1129 --
NM_015344chr82591 369 11559 ----
NM_015346chr1421639 1309 --1109 --
NM_015365chrX136 ------
NM_015397chr911418 ------
NM_015416chr121740 ------
NM_015443chr173453 276 63 ----1521
NM_015444chr3127 ------
NM_015446chr111584 ------
NM_015453chr321776 834 11740 ----
NM_015455chr534104 3568 608 ------
NM_015457chr11133 ------
NM_015460chr3----1206 --
NM_015461chr181724 ------
NM_015481chr1251116 946 828 818 766 ------
NM_015483chr71976 ------
NM_015488chr261616 1529 1473 1302 1173 1156 --31366 625 517 1353
NM_015520chr311864 132 ----
NM_015534chr13806 154 90 ------
NM_015542chr10------1171
NM_015550chr743302 3127 1056 847 --13566 --
NM_015553chr624259 777 --44269 4118 3414 3396 --
NM_015564chr51564 ------
NM_015565chr21164 ------
NM_015568chr20104158 3993 3956 3839 3523 3216 2757 693 248 112 1208 ----
NM_015569chr124671 4412 13368 ----
NM_015575chr232424 101 39 ------
NM_015576chr332161 2011 78 ------
NM_015578chr191146 ------
NM_015609chr162894 2664 2425 1054 1031 693 159 22704 144 --
NM_015610chr732320 1137 544 ------
NM_015626chr1711006 ------
NM_015645chr111308 --1134 --
NM_015649chr19----133 --
NM_015658chr1----3366 333 326 --
NM_015678chr131102 ------
NM_015680chr22228 84 ------
NM_015686chrX12506 --12414 --
NM_015713chr843129 1364 277 64 ------
NM_015719chr192566 123 ------
NM_015831chr71893 --4933 847 777 772 --
NM_015845chr181208 ------
NM_015850chr832292 1606 84 11886 1477 --
NM_015872chr121215 706 --21373 592 --
NM_015889chr221129 ------
NM_015898chr1922070 220 ------
NM_015955chr21351 ------
NM_015967chr1--1809 ----
NM_015975chrX21186 273 ------
NM_015982chr17--149 ----
NM_016003chr732320 1137 544 ------
NM_016009chr11963 1141 14250 --
NM_016022chr13368 325 287 ------
NM_016032chrX11255 ------
NM_016037chr1----1863 --
NM_016038chr7--179 ----
NM_016063chr6----1561 --
NM_016076chr121289 663 ------
NM_016084chr171123 --1451 --
NM_016096chr821383 434 ------
NM_016097chr181716 ------
NM_016098chr61167 ------
NM_016131chr21476 ------
NM_016132chr1533077 2145 756 --1513 --
NM_016141chr31812 --158 --
NM_016152chr311054 ------
NM_016169chr1052682 2552 1109 678 541 ------
NM_016195chr101105 ------
NM_016206chr347625 3052 1831 1784 --17605 16738
NM_016216chr31614 --1114 --
NM_016235chr1621269 948 ------
NM_016257chr123058 2498 11350 1129 --
NM_016260chr225633 5220 --1166 17288
NM_016284chr161125 ------
NM_016287chr1----1270 --
NM_016315chr211764 ------
NM_016329chr31391 ------
NM_016333chr161184 ------
NM_016396chr151617 1291 ----
NM_016424chr1711924 ------
NM_016431chr221761 --2660 292 --
NM_016463chr5131 ------
NM_016485chr621792 785 ------
NM_016486chr1----3120 78 38 --
NM_016516chr21853 ------
NM_016522chr1131339 1299 1080 --1338 --
NM_016526chr1121966 1696 ----12451
NM_016544chr21829 11206 ----
NM_016545chr1----1343 --
NM_016547chr13593 528 229 --1463 --
NM_016575chr1224105 1491 12200 11335 --
NM_016588chr62704 247 ------
NM_016603chr51766 ------
NM_016604chr51450 ------
NM_016605chr562712 2043 1949 914 637 301 --1945 --
NM_016607chrX--11666 ----
NM_016621chr1143724 3386 747 668 --24046 3143 --
NM_016641chr1631343 1306 678 ------
NM_016823chr1731167 969 963 ------
NM_016827chr3--136 ----
NM_016830chr121152 ------
NM_016834chr1741481 1173 912 739 12701 192 --
NM_016835chr1741481 1173 912 739 12701 192 --
NM_016841chr1741481 1173 912 739 12701 192 --
NM_016936chr1631539 1521 350 --11766 --
NM_016938chr11----1401 --
NM_016952chr1142868 2854 2825 1456 --2678 521 --
NM_017447chr2114375 ------
NM_017450chr1731311 189 42 ----11332
NM_017456chr172495 285 --12036 21321 100
NM_017490chr111272 ------
NM_017491chr41150 ------
NM_017519chr6----1119 --
NM_017548chr32248 81 ------
NM_017563chr334032 764 357 12322 15968 --
NM_017582chr11627 --1127 --
NM_017594chr913298 1199 11308 11343
NM_017602chrX--1922 --1203
NM_017607chr19--147 ----
NM_017610chr151124 11830 ----
NM_017626chr102553 255 --11660 --
NM_017629chr11583 ------
NM_017633chr6----23706 2430 12576
NM_017637chr938762 6018 3682 --17787 --
NM_017638chr1----2850 160 --
NM_017643chr1721238 974 ----22054 843
NM_017649chr103411 245 65 2831 96 1307 --
NM_017658chr1434162 2920 1584 ------
NM_017670chr115874 746 726 687 182 ----143
NM_017680chr9--1745 ----
NM_017684chr15167 --1486 --
NM_017700chr43401 227 121 ------
NM_017714chr201261 ------
NM_017715chr7----1568 --
NM_017737chr13700 431 417 ------
NM_017744chr121704 955 --11682 --
NM_017758chr1731030 482 389 --21510 1090 --
NM_017772chr631131 468 260 ------
NM_017778chr811521 1110 11167 --
NM_017780chr81266 ------
NM_017784chr32936 168 ------
NM_017790chr9124 --1403 --
NM_017797chr194935 401 327 32 ------
NM_017799chr1411673 ------
NM_017811chr923109 2208 ------
NM_017848chrX11745 ------
NM_017849chr253088 2623 1980 854 47 --32359 611 144 12052
NM_017857chr111216 --1103 --
NM_017873chr92615 490 --11164 --
NM_017893chr103404 370 335 ----1452
NM_017902chr1035247 1552 522 --1234 11319
NM_017919chr911682 11003 1620 21470 73
NM_017933chr22361 329 ------
NM_017944chr1112279 1791 ----
NM_017953chr12482 56 ------
NM_017964chr2------1382
NM_017975chr151252 --1176 --
NM_017988chr121672 ------
NM_018008chr3----1255 --
NM_018011chr131146 ------
NM_018027chr102874 237 ----1372
NM_018028chr192200 75 --1915 --
NM_018071chr141112 ------
NM_018084chr2--12347 ----
NM_018092chr161613 ------
NM_018096chr171997 --1741 148
NM_018107chr141195 ------
NM_018111chr19----127 --
NM_018184chr331908 1854 631 ------
NM_018198chr121445 462 --21416 285 --
NM_018200chr15--21916 1813 ----
NM_018211chr1249 38 ------
NM_018214chr6140 ------
NM_018222chr1121214 384 ------
NM_018240chr12852 29 ------
NM_018243chr423374 1444 ----164
NM_018300chr191426 ------
NM_018312chr1131844 848 108 ------
NM_018317chr4171 ------
NM_018362chr1123409 2966 ----23785 3248
NM_018371chr81607 11196 1181 --
NM_018375chr1421716 404 ------
NM_018419chr20181 ------
NM_018423chr121277 ------
NM_018424chr911926 ------
NM_018440chr836857 3430 560 28539 7692 25731 975 --
NM_018469chr1721342 126 --1133 --
NM_018486chrX1481 ------
NM_018509chr1711464 ------
NM_018553chr1721816 1255 --1126 11655
NM_018557chr22488 361 ------
NM_018569chr41196 ------
NM_018584chr12424 205 ------
NM_018590chr1011489 ------
NM_018639chr122938 403 --1384 --
NM_018648chr15154 130 ----
NM_018650chr1189 ------
NM_018667chr1631964 1794 158 1970 22210 1873 128
NM_018684chrX11289 ------
NM_018700chr51178 ------
NM_018712chr1121271 63 ------
NM_018717chr431096 733 664 1874 1292 --
NM_018718chr71382 --1549 --
NM_018719chr711126 1251 ----
NM_018841chr113509 --11022 --
NM_018890chr71109 ------
NM_018898chr512091 --2317 267 --
NM_018899chr512091 --2317 267 --
NM_018900chr512091 --2317 267 --
NM_018901chr512091 --2317 267 --
NM_018902chr512091 --2317 267 --
NM_018903chr512091 --2317 267 --
NM_018904chr512091 --2317 267 --
NM_018905chr512091 --2317 267 --
NM_018906chr512091 --2317 267 --
NM_018907chr512091 --2317 267 --
NM_018908chr512091 --2317 267 --
NM_018909chr512091 --2317 267 --
NM_018910chr512091 --2317 267 --
NM_018911chr512091 --2317 267 --
NM_018912chr551686 1594 1570 1409 209 ------
NM_018913chr551686 1594 1570 1409 209 ------
NM_018914chr551686 1594 1570 1409 209 ------
NM_018915chr551686 1594 1570 1409 209 ------
NM_018916chr551686 1594 1570 1409 209 ------
NM_018917chr551686 1594 1570 1409 209 ------
NM_018918chr551686 1594 1570 1409 209 ------
NM_018919chr551686 1594 1570 1409 209 ------
NM_018920chr551686 1594 1570 1409 209 ------
NM_018921chr551686 1594 1570 1409 209 ------
NM_018922chr551686 1594 1570 1409 209 ------
NM_018923chr551686 1594 1570 1409 209 ------
NM_018924chr551686 1594 1570 1409 209 ------
NM_018925chr551686 1594 1570 1409 209 ------
NM_018926chr551686 1594 1570 1409 209 ------
NM_018927chr551686 1594 1570 1409 209 ------
NM_018928chr551686 1594 1570 1409 209 ------
NM_018929chr551686 1594 1570 1409 209 ------
NM_018944chr21127 ------
NM_018945chr643047 1131 664 312 ------
NM_018951chr71459 --171 --
NM_018955chr17147 ------
NM_018964chr2121036 848 ------
NM_018970chr722218 47 ------
NM_018977chrX1910 --1882 --
NM_018979chr1212108 1930 ----
NM_018994chr11533 ------
NM_018999chr1011987 --1527 1310
NM_019008chr2241449 435 340 51 21477 1111 33348 2789 218 13282
NM_019009chr1162474 2363 2316 1765 771 743 22233 320 2722 681 --
NM_019015chr72138 43 ------
NM_019022chr1833188 2057 769 ------
NM_019035chr411945 ------
NM_019046chr101353 --2803 359 --
NM_019048chr2167 ------
NM_019057chr5179 ------
NM_019059chr71515 ------
NM_019066chr15--1140 ----
NM_019091chr2199 ------
NM_019096chr63764 356 279 1125 ----
NM_019116chr1632877 1479 1344 23518 317 13101 --
NM_019593chr2012224 12314 22734 2113 12152
NM_019606chr71146 ------
NM_019854chr123761 645 56 --3198 193 121 1164
NM_019885chr23445 342 266 --21192 1001 --
NM_020039chr1221608 83 1317 31301 1200 168 --
NM_020122chr255431 1456 573 526 225 --1613 --
NM_020130chr81263 ------
NM_020137chrX1348 ------
NM_020144chr711636 1267 ----
NM_020151chr231491 329 63 ------
NM_020152chr21----1707 --
NM_020156chr71379 ------
NM_020159chr411169 ------
NM_020177chr5--1248 --12381
NM_020182chr2052918 2761 1125 818 55 ------
NM_020194chr2181 ------
NM_020198chr1711095 ------
NM_020211chr1511241 --134 11329
NM_020214chr15149 ------
NM_020239chr12574 126 31974 1871 25 1713 1832
NM_020246chr71377 ------
NM_020309chr191247 ------
NM_020337chr432557 743 120 ------
NM_020338chr1062767 2757 2705 2280 333 36 1692 11004 --
NM_020381chr61771 --1615 --
NM_020382chr121550 ------
NM_020390chr31395 --11002 --
NM_020416chr442413 787 736 523 ------
NM_020418chr3157 ------
NM_020420chrY--11345 ----
NM_020441chr111257 161 135 --
NM_020443chr135345 2317 1934 12524 15818 16366
NM_020449chrX1738 ------
NM_020457chr16----2495 194 --
NM_020465chr1631709 1439 208 --1601 1675
NM_020474chr181110 167 ----
NM_020475chr862215 1773 1651 1639 661 479 --12202 21958 704
NM_020476chr862215 1773 1651 1639 661 479 --12202 21958 704
NM_020477chr862215 1773 1651 1639 661 479 --12202 21958 704
NM_020478chr862278 1836 1714 1702 724 542 --12265 32021 767 81
NM_020480chr862215 1773 1651 1639 661 479 --12202 21958 704
NM_020482chr61238 ------
NM_020526chr121845 1788 --2645 106 1143
NM_020530chr221106 ------
NM_020546chr543044 961 512 119 2551 185 1983 --
NM_020647chr8159 12187 ----
NM_020654chr31631 ------
NM_020655chr1631404 1168 223 --11373 --
NM_020699chr131297 1229 218 ------
NM_020703chr1129 --1391 --
NM_020704chr7----32326 1602 61 1686
NM_020708chr2051004 841 760 391 231 11749 3752 733 469 --
NM_020713chr2032461 2383 121 1994 1339 12395
NM_020718chr1634428 4414 520 21058 195 ----
NM_020728chr732074 559 263 1210 12885 --
NM_020732chr6----1119 --
NM_020742chrX----132 11849
NM_020748chr1711420 ------
NM_020749chr851872 1772 1346 611 467 --1191 --
NM_020752chr1022933 278 ------
NM_020753chr17----1212 --
NM_020755chr61260 ------
NM_020765chr1188 ------
NM_020766chrX44584 4232 1573 832 14526 ----
NM_020768chr522371 517 ------
NM_020772chr1758207 7149 2346 1960 1716 --15990 1932
NM_020778chr1553894 1821 744 472 326 --14004 --
NM_020791chr17127 142 ----
NM_020804chr612516 --32177 509 343 --
NM_020808chr12761 278 ------
NM_020821chr15167 --1486 --
NM_020825chr1653468 2846 2496 404 97 1440 23611 298 --
NM_020845chr1232461 737 660 ------
NM_020850chr1622359 1089 --1167 --
NM_020860chr41257 ------
NM_020871chrX--188 ----
NM_020888chr1--1704 12011 --
NM_020897chr12451 133 --21229 1187 --
NM_020899chr1722510 825 --1694 --
NM_020909chr243211 160 135 40 ------
NM_020918chr101176 ------
NM_020922chrX11789 ------
NM_020925chr111313 ------
NM_020927chr1612248 12134 ----
NM_020935chr223779 70 1859 ----
NM_020947chr16112105 1916 513 494 475 456 437 418 399 380 361 11877 ----
NM_020948chr11153 12729 ----
NM_020956chr1934438 4337 4025 --63789 3648 1125 1047 89 75 --
NM_020962chr1552126 823 762 621 576 --11545 --
NM_020964chr1863611 3477 3072 1563 1518 1439 --23454 3098 --
NM_020967chr202149 93 ------
NM_020981chr21606 ------
NM_020993chr123480 406 182 ------
NM_021012chr1773089 3001 2001 1169 1140 334 273 22032 524 32811 2147 896 --
NM_021025chr51181 ------
NM_021061chr844507 4056 3783 1677 --21552 718 --
NM_021069chr42451 202 ------
NM_021072chr51443 ------
NM_021079chr1743108 2614 2254 213 --12279 12549
NM_021083chrX13598 ------
NM_021104chr121284 --1203 --
NM_021111chr9--2150 123 ----
NM_021120chrX21208 905 ------
NM_021155chr1952959 2256 1055 811 767 --1653 --
NM_021183chrX12377 ------
NM_021188chr141119 ----1520
NM_021189chr12883 238 ------
NM_021195chr163580 184 95 --2499 25 --
NM_021198chr22963 303 --1536 --
NM_021213chr1731004 991 968 ------
NM_021219chr21170 ------
NM_021238chr121161 1335 ----
NM_021249chr1421705 1498 --11628 --
NM_021260chr144445 360 346 117 11410 ----
NM_021569chr92792 441 --31152 1144 25 --
NM_021625chr12----2165 30 --
NM_021629chr333623 3456 1910 ------
NM_021631chr8124 ------
NM_021638chr434412 1904 1352 --183 --
NM_021643chr21281 --1345 --
NM_021649chr5--11157 ----
NM_021705chr6198 --1574 --
NM_021724chr17252 22 ------
NM_021728chr141666 ------
NM_021738chr101738 ------
NM_021784chr201185 ------
NM_021912chr15----159 --
NM_021914chr141940 ------
NM_021939chr172741 96 ------
NM_021943chr631742 1473 855 31828 778 771 21899 756 --
NM_021949chrX32785 881 807 ------
NM_021961chr1136440 1095 315 26816 5181 11965 --
NM_021964chr311653 21959 1535 ----
NM_021970chr41631 ------
NM_021973chr41583 --196 --
NM_021991chr172135 44 ------
NM_022037chr2--1198 ----
NM_022042chr4129 --1214 --
NM_022048chr1546005 4998 1373 494 --1193 --
NM_022075chr11121 ------
NM_022085chr6----11419 --
NM_022130chr51374 ------
NM_022166chr16114587 4385 4115 2547 2335 2091 1748 1471 1407 1319 511 --24965 2348 --
NM_022168chr21120 ------
NM_022169chr112328 320 1576 ----
NM_022170chr721501 229 ------
NM_022173chr2--1198 ----
NM_022454chr8--1160 ----
NM_022458chr712131 22891 25 ----
NM_022459chr1336060 1452 1056 ------
NM_022464chr51292 ------
NM_022477chr20----21178 155 11697
NM_022497chr352884 2670 775 463 206 11505 1360 --
NM_022553chr6128 ------
NM_022572chr261616 1529 1473 1302 1173 1156 --31366 625 517 1353
NM_022574chr722103 651 --1866 11416
NM_022719chr2221387 706 12551 ----
NM_022749chr831306 966 553 --21198 43 --
NM_022750chr7----138 --
NM_022753chr132436 822 339 ------
NM_022755chr912281 ------
NM_022763chr3----22842 898 --
NM_022776chr31386 ------
NM_022780chr241616 1574 597 556 ------
NM_022821chr1--166 ----
NM_022831chr111598 ------
NM_022836chr1----1569 --
NM_022841chr1512308 ------
NM_022845chr16--1569 1808 --
NM_022898chr1424229 79 24780 3464 ----
NM_022910chr1631709 1439 208 --1601 1675
NM_022912chr222767 1104 12177 1109 --
NM_022918chr1112188 ------
NM_023012chr121312 ------
NM_023018chr13308 143 33 11385 11224 --
NM_023039chr5125 ------
NM_023067chr33522 413 264 ------
NM_023075chr181106 --1728 --
NM_023105chr832292 1606 84 11886 1477 --
NM_023106chr832292 1606 84 11886 1477 --
NM_023110chr832292 1606 84 11886 1477 --
NM_023111chr832292 1606 84 11886 1477 --
NM_023926chr191138 --1121 --
NM_024007chr5----1910 --
NM_024015chr171117 --1408 1879
NM_024038chr19139 ------
NM_024045chr10145 ------
NM_024050chr191606 --1489 --
NM_024060chr111309 ------
NM_024087chrX1631 ------
NM_024090chr421868 1209 ------
NM_024117chr911065 ------
NM_024293chr2----1142 --
NM_024298chr19----1178 124
NM_024328chr141251 1191 ----
NM_024336chr161273 ------
NM_024337chr51138 ------
NM_024345chr924089 225 1905 ----
NM_024424chr11----1185 --
NM_024425chr11----1185 --
NM_024426chr11----1185 --
NM_024507chr16169 --141 --
NM_024511chr422376 314 --22175 399 --
NM_024513chr352460 924 387 368 167 23798 3698 13561 1265
NM_024523chr721022 908 1153 ----
NM_024551chr122274 143 ------
NM_024551chr122274 143 ------
NM_024556chr112325 193 ------
NM_024567chr81699 --1267 --
NM_024599chr173161 68 49 --1471 --
NM_024607chr843148 492 334 53 --11225 1440
NM_024617chr9------1792
NM_024628chr321100 238 11040 ----
NM_024643chr141346 132 ----
NM_024645chr821588 528 11410 149 --
NM_024659chr21405 1152 ----
NM_024665chr334068 3714 3018 1849 ----
NM_024674chr112325 1943 22171 970 --
NM_024676chr12945 260 --1219 --
NM_024692chr221440 596 ------
NM_024704chr20196 --1188 --
NM_024705chr136808 350 324 316 251 51 ------
NM_024713chr1511316 ------
NM_024721chr81646 ------
NM_024742chr1621502 780 --1396 --
NM_024749chr1148 ------
NM_024757chr92440 79 ------
NM_024759chr81746 ------
NM_024761chr965135 3268 1834 1121 308 282 --1669 11089
NM_024811chr112760 659 --1148 --
NM_024830chr551864 1592 722 435 367 --185 --
NM_024887chr121757 858 --139 --
NM_024939chr161168 ------
NM_024947chr339447 8292 1144 ------
NM_024953chr12133 ------
NM_024954chr10----1485 --
NM_024989chr218134 11444 26227 2426 --
NM_025004chr111271 ------
NM_025048chr61187 --127 --
NM_025054chr8----11379 --
NM_025073chr154272 4100 3718 3124 1567 ------
NM_025076chr21243 ------
NM_025083chr1531577 1330 27 ------
NM_025134chr16--11972 ----
NM_025160chr133253 1413 482 --13376 --
NM_025165chr15129 ------
NM_025176chr201155 ------
NM_025179chr183222 3079 1876 1374 1362 1275 642 293 13430 ----
NM_025191chr11665 ------
NM_025195chr841823 538 262 244 21212 423 ----
NM_025202chr241051 408 396 226 --3659 235 23 --
NM_025222chr32356 254 --12528 --
NM_025224chr2042114 812 727 116 --2798 40 --
NM_025237chr1731150 1125 72 ----1487
NM_025238chr1511450 ------
NM_025251chr83814 159 58 --1258 --
NM_025256chr6------161
NM_030576chr174537 215 146 28 ------
NM_030621chr1422828 420 ------
NM_030627chr513230 ------
NM_030634chr112361 12253 1419 --
NM_030645chr141273 1100 1094 251 21241 34 1257 --
NM_030647chr775523 4875 4089 4067 715 648 70 ------
NM_030651chr62574 28 --1135 --
NM_030661chr721409 139 --1128 --
NM_030751chr1021696 461 ------
NM_030751chr1021696 461 ------
NM_030761chr132642 2088 1944 ------
NM_030763chrX2894 850 ------
NM_030782chr51398 ------
NM_030806chr178335 8131 7628 7473 7037 2625 539 --28616 3163 17193
NM_030808chr173682 334 176 --1100 --
NM_030809chr1231949 1666 504 ------
NM_030810chr6----11419 --
NM_030881chr2222087 192 --2625 81 --
NM_030884chr342209 1832 406 28 --11600 --
NM_030915chr221717 702 ------
NM_030923chr21138 ------
NM_030937chr1----1925 --
NM_030957chr191209 --2521 43 --
NM_030963chr6158 ------
NM_030964chr543396 2957 643 117 --2375 30 --
NM_030981chr114951 938 796 152 --1851 --
NM_031205chr123357 332 163 ------
NM_031262chr9177 ------
NM_031263chr91134 ------
NM_031268chr1641323 252 240 28 --23668 3649 --
NM_031286chr1------1332
NM_031309chr862023 874 760 521 352 64 21902 1628 --1650
NM_031407chrX121 ------
NM_031411chr512091 --2317 267 --
NM_031417chr195804 419 233 203 45 1166 ----
NM_031418chr1122591 1035 --1284 --
NM_031426chr92923 159 ------
NM_031427chr1413607 --14408 11278
NM_031445chr242692 2524 856 141 ----1735
NM_031453chr10--21932 191 ----
NM_031483chr2012212 1971 162 --
NM_031492chr11167 ------
NM_031845chr223411 249 ------
NM_031847chr223411 249 ------
NM_031849chr512091 --2317 267 --
NM_031857chr512091 --2317 267 --
NM_031860chr512091 --2317 267 --
NM_031890chr2292722 2600 2348 2273 2137 962 787 592 266 ------
NM_031892chrX160 1731 ----
NM_031918chr192572 167 143 ----
NM_031922chr61493 ------
NM_031936chr11112 ------
NM_031948chr16138 ------
NM_031992chr721501 229 ------
NM_032012chr921377 1181 13734 176 1854
NM_032013chr20----21178 155 11697
NM_032017chr12739 476 --11554 --
NM_032041chr822452 138 --12130 --
NM_032042chr532792 1045 648 ------
NM_032052chr221166 --1939 --
NM_032088chr551686 1594 1570 1409 209 ------
NM_032092chr551686 1594 1570 1409 209 ------
NM_032108chr192703 330 --1949 1148
NM_032109chr51451 --3196 115 27 --
NM_032121chrX1882 1837 1724 --
NM_032124chr181318 ------
NM_032153chr342009 1949 776 37 ----1108
NM_032160chr1833849 3319 2848 1778 13694 --
NM_032177chr5--1364 ----
NM_032178chr16--130 ----
NM_032181chr2192 ------
NM_032199chr1023504 257 ------
NM_032207chr1921086 456 --2803 307 --
NM_032246chr151171 ------
NM_032268chr1653246 2684 2628 2452 2182 --12479 --
NM_032271chr1621516 92 ------
NM_032281chr1943081 2594 2359 1195 --12588 --
NM_032283chr131539 172 45 11430 --11235
NM_032289chr51452 ------
NM_032298chr19--1429 ----
NM_032320chr111662 ------
NM_032321chr212817 ------
NM_032329chr284008 3800 3558 857 729 489 402 113 1828 1581 11731
NM_032375chr192310 35 --1232 1143
NM_032403chr551686 1594 1570 1409 209 ------
NM_032408chr71983 --1993 --
NM_032410chr8--1331 ----
NM_032412chr52335 37 ------
NM_032420chr52677 263 ------
NM_032424chr1111024 ------
NM_032430chr191458 ------
NM_032431chr11129 ------
NM_032438chr621316 1160 ------
NM_032440chr1021068 818 ------
NM_032457chr423922 134 ------
NM_032458chrX1649 12314 ----
NM_032499chr152407 92 ------
NM_032510chr182417 76 22435 177 1997 --
NM_032514chr203418 298 290 --2321 154 --
NM_032521chr2021103 560 1682 12225 --
NM_032538chr642159 364 224 129 --42771 2034 409 300 --
NM_032539chrX1549 ------
NM_032560chr14--1382 ----
NM_032575chr1631514 627 393 --11632 --
NM_032590chr12------1763
NM_032622chr4--1345 ----
NM_032632chr14--135 ----
NM_032638chr31192 ------
NM_032682chr322434 1208 ------
NM_032687chr8299 31 ------
NM_032689chr1941495 1447 1244 448 ------
NM_032711chr1733397 1139 486 13020 11124 --
NM_032728chr91896 ------
NM_032731chr1721512 439 ----21488 1013
NM_032737chr191180 --3904 572 192 --
NM_032784chr61225 ------
NM_032789chr82121 49 ------
NM_032808chr152840 658 --1136 --
NM_032828chr1974873 3354 1744 1278 964 832 419 14279 34082 1301 806 --
NM_032833chr111836 --11678 --
NM_032840chr12144 --1123 --
NM_032846chr1411219 --1409 --
NM_032873chr1144449 3618 3527 3511 ------
NM_032900chr1042901 1331 1196 1108 --13359 11575
NM_032961chr41425 ------
NM_032968chrX1575 1818 13287 --
NM_032969chrX1575 1818 13287 --
NM_032973chrY1575 --13282 --
NM_032982chr7197 --2434 152 --
NM_032995chr231335 645 482 --31209 1095 460 --
NM_033008chr3157 ------
NM_033009chr3157 ------
NM_033010chr3157 ------
NM_033016chr2231255 163 103 ------
NM_033017chr72142 76 --2684 646 --
NM_033023chr731097 452 110 ------
NM_033030chr21332 1582 ----
NM_033046chr22117 29 --1254 --
NM_033055chr12312 133 ------
NM_033058chr81144 ------
NM_033117chr9160 ------
NM_033129chr2021662 540 --41978 1650 1631 1561 --
NM_033132chr131438 1521 ----
NM_033133chr1733649 1365 169 --2864 346 --
NM_033138chr7--12187 ----
NM_033139chr7--12187 ----
NM_033140chr7--12187 ----
NM_033143chr432910 1337 775 1175 14101 --
NM_033150chr12184 ------
NM_033157chr7--12187 ----
NM_033208chr16--125 ----
NM_033211chr51612 ------
NM_033221chr962112 646 596 502 262 35 ------
NM_033224chr736835 2053 700 --15349 --
NM_033225chr832537 2492 1980 ------
NM_033259chr33694 571 164 ------
NM_033266chr16132 ------
NM_033274chr533297 3025 354 --1769 --
NM_033285chr821582 1447 --1893 11325
NM_033290chrX22685 2626 ------
NM_033315chr1742035 725 400 171 --21490 463 --
NM_033326chr11----1861 11848
NM_033375chr171597 ----11251
NM_033389chr1763808 3392 1734 828 613 539 ------
NM_033405chr20------180
NM_033419chr1731498 1189 21 --11528 --
NM_033420chr192781 442 --2944 161 --
NM_033449chr511741 --12009 --
NM_033503chr1513341 --33738 2942 2515 --
NM_033516chr911152 --1222 --
NM_033535chr411135 ------
NM_033540chr31315 ------
NM_033546chr18--1151 ----
NM_033549chr53954 948 277 ------
NM_033551chr532245 1188 341 1576 ----
NM_033624chr1211487 --1197 --
NM_033631chr163891 2893 1087 701 31 25 --1878 --
NM_033637chr1022517 298 167 ----
NM_033642chrX--1144 ----
NM_033644chr5------11582
NM_033645chr5------11582
NM_033656chr2115136 14137 ----
NM_044472chr11103 ------
NM_052834chr1842489 2296 2096 212 ------
NM_052837chr12235 107 ------
NM_052840chr151289 ------
NM_052855chr171417 1141 ----
NM_052872chr6162 ------
NM_052880chr2211458 ------
NM_052898chr811358 ------
NM_052900chr8--1476 ----
NM_052906chr2234989 3302 284 --24700 3582 14709
NM_052910chr1321502 1381 22103 676 21576 556 --
NM_052925chr193727 657 272 1899 2978 676 --
NM_052937chr81638 ------
NM_052954chr211165 ------
NM_052971chr5151 ------
NM_052978chr143582 501 71 ------
NM_052998chr11146 ------
NM_053016chr945707 5433 4927 1134 ------
NM_053024chr31169 ------
NM_053064chr1412540 ------
NM_054016chr1----1761 --
NM_054016chr1----1761 --
NM_054016chr1----1761 --
NM_054033chr2------1193
NM_057089chr71465 ------
NM_057169chr1222746 2485 ------
NM_057170chr1222746 2485 ------
NM_057175chr4------11949
NM_057178chr1732820 2497 2186 ------
NM_058164chr192283 67 --2289 145 --
NM_058172chr4--1190 1145 --
NM_058175chr212560 311 --1782 --
NM_058243chr192233 177 ----1318
NM_078470chr103845 679 363 22634 258 ----
NM_080415chr171900 --1930 --
NM_080491chr1133108 1483 1069 --22414 196 1111
NM_080546chr9--1251 ----
NM_080599chr10------1171
NM_080607chr202824 29 --1776 --
NM_080616chr201592 ------
NM_080647chr222457 52 ------
NM_080654chr11185 ------
NM_080664chr142536 141 ------
NM_080671chr252149 1922 1846 830 350 11715 ----
NM_080759chr1312031 ------
NM_080760chr1312031 ------
NM_080872chr823930 78 --13651 --
NM_080881chr5----198 --
NM_130386chr18--1158 --1252
NM_130391chr91411 12761 ----
NM_130392chr91411 12761 ----
NM_130393chr91411 12761 ----
NM_130436chr21----11915 --
NM_130438chr21----12492 --
NM_130439chr1022123 578 ------
NM_130439chr1022123 578 ------
NM_130463chr6--130 ----
NM_130798chr151584 --1187 --
NM_130799chr11177 --3581 189 44 --
NM_130800chr11177 --3581 189 44 --
NM_130801chr11177 --3581 189 44 --
NM_130802chr11177 --3581 189 44 --
NM_130803chr11177 --3581 189 44 --
NM_130804chr11177 --3581 189 44 --
NM_130830chr333784 2791 67 --21380 398 --
NM_130846chr12--1296 ----
NM_133170chr2096814 5826 5247 2859 2493 1507 747 462 156 16927 1594 --
NM_133171chr20--1909 1211 --
NM_133264chr1753649 2691 941 711 284 --13823 --
NM_133265chrX11342 23020 3010 ----
NM_133334chr486183 5860 4719 3981 1754 1222 982 679 24070 198 13955 --
NM_133433chr51172 ------
NM_133444chr191380 --3576 437 187 --
NM_133452chr193964 925 844 --1285 1867
NM_133477chr42772 527 ------
NM_133478chr221001 311 ------
NM_133499chrX--153 2795 355 --
NM_133503chr121773 ------
NM_133504chr121773 ------
NM_133505chr121773 ------
NM_133506chr121773 ------
NM_133507chr122951 38 ----1155
NM_133625chr31122 ------
NM_133634chr211143 11236 2563 521 1755
NM_133642chr2211272 --1187 --
NM_133647chr1512756 12869 23346 2590 --
NM_134265chr1711006 ------
NM_134325chr141599 547 261 68 21513 666 ----
NM_138282chr6--130 ----
NM_138300chr121599 340 ------
NM_138316chr10----11314 --
NM_138328chr1722496 1212 --33252 2188 2064 --
NM_138335chr41272 ------
NM_138338chr221533 --22491 2369 --
NM_138349chr172208 189 ----165
NM_138353chr19140 ------
NM_138357chr101490 --11568 --
NM_138370chr21669 ------
NM_138415chr2211705 --2716 563 --
NM_138423chr1522302 2236 --1493 --
NM_138426chr712093 ------
NM_138457chr683355 3339 3170 1248 925 889 569 461 12786 ----
NM_138459chr61577 ------
NM_138468chr225990 710 12074 34893 3993 1632 --
NM_138473chr1254476 4363 4335 4067 622 ------
NM_138479chr1----1283 --
NM_138576chr1424229 79 24780 3464 ----
NM_138578chr2031392 1182 44 1349 162 --
NM_138638chr141940 ------
NM_138689chr111228 ------
NM_138693chr71121 --170 --
NM_138727chr121704 955 --11682 --
NM_138728chr121704 955 --11682 --
NM_138729chr1129 ------
NM_138732chr111233 ------
NM_138734chr111233 ------
NM_138735chr21250 ------
NM_138783chr19139 ------
NM_138927chr211192 ------
NM_138939chr3176 ------
NM_138940chr3176 ------
NM_138961chr11----1118 --
NM_138971chr112221 48 1861 1136 --
NM_138971chr112221 48 1861 1136 --
NM_138972chr112221 48 1861 1136 --
NM_138972chr112221 48 1861 1136 --
NM_138973chr112221 48 1861 1136 --
NM_138973chr112221 48 1861 1136 --
NM_139014chr62936 894 ------
NM_139015chr1211372 ------
NM_139067chr121129 ------
NM_139068chr51181 ------
NM_139069chr51181 ------
NM_139070chr5150 ------
NM_139071chr12177 ------
NM_139131chr111263 ------
NM_139135chr1----1267 --
NM_139136chr121253 ------
NM_139155chr101120 ------
NM_139156chr1184 1732 1618 1591
NM_139159chr1951077 1021 338 201 52 ----11178
NM_139167chr8149 1143 ----
NM_139170chr16129 --2542 506 --
NM_139181chr11134 ------
NM_139207chr121392 1185 ----
NM_139211chr4----161 --
NM_139212chr4----161 --
NM_139244chr6--1363 ----
NM_139246chr921468 643 1425 ----
NM_139276chr1731870 1549 394 159 ----
NM_139316chr72883 321 ------
NM_139323chr2011883 ------
NM_144498chr2041723 1685 746 184 ------
NM_144499chr311176 ------
NM_144571chr412481 ----26594 5687
NM_144578chr1425091 1293 14091 ----
NM_144586chr22471 314 ------
NM_144593chr12135 ------
NM_144600chr16----1303 --
NM_144635chr32413 135 ------
NM_144667chr1231099 177 114 ------
NM_144691chr19----1257 --
NM_144726chr52953 230 ------
NM_144767chr1544400 4289 3653 197 --11240 --
NM_144949chr221757 37 ------
NM_144963chr8135 ----12540
NM_145047chr1----125 --
NM_145055chr1862756 1485 1267 561 407 25 --1295 --
NM_145056chr192104 40 ------
NM_145112chr1411183 ------
NM_145113chr1411455 --1188 --
NM_145159chr14158 ------
NM_145204chr152145 44 ------
NM_145234chrX----1700 --
NM_145239chr161325 ----1179
NM_145251chr1421272 136 1529 ----
NM_145260chr21285 --1647 --
NM_145263chr4181 ------
NM_145284chrX21929 355 ------
NM_145305chrX----11029 --
NM_145320chr743302 3127 1056 847 --13566 --
NM_145321chr743302 3127 1056 847 --13566 --
NM_145322chr743302 3127 1056 847 --13566 --
NM_145349chr1741634 1493 679 195 1627 21834 446 1118
NM_145351chr1732126 1985 687 --22326 938 1610
NM_145659chr16177 ------
NM_145690chr821720 24 ------
NM_145730chr222717 33 ------
NM_145800chrX1754 ------
NM_145802chrX1703 ------
NM_145808chr722153 463 186 ----
NM_145868chr10126 ------
NM_145869chr10126 ------
NM_145888chr1911655 --3776 197 133 1319
NM_145891chr1621628 1615 11455 ----
NM_145892chr1621628 1615 11455 ----
NM_145893chr1621750 1737 11577 ----
NM_147147chr621557 807 ------
NM_147189chr812252 1208 11953 --
NM_147192chr141261 467 331 183 --1135 --
NM_147202chr922633 87 1740 --12007
NM_147204chr12----2165 30 --
NM_147223chr211575 --31707 561 555 11506
NM_147233chr211392 --31524 378 372 --
NM_148977chr10----11314 --
NM_148978chr10----11314 --
NM_152233chr1421705 1498 --11628 --
NM_152237chr22----31581 1125 535 --
NM_152244chr174913 870 776 123 1857 ----
NM_152253chr2244270 3613 3394 68 2921 575 ----
NM_152263chr125794 33 --35910 5643 2219 --
NM_152272chr821196 1172 ----11003
NM_152277chr5273 36 ------
NM_152284chr8192 ------
NM_152342chr16172 --139 --
NM_152344chr171965 --1304 --
NM_152345chr171423 ------
NM_152371chr171880 1733 1506 771 280 176 126 ------
NM_152380chr13577 224 54 ------
NM_152384chr21317 1621 91693 1656 1517 1480 1342 1305 824 784 717 --
NM_152388chr2----13870 --
NM_152414chr811442 ------
NM_152470chr1823498 215 --12887 --
NM_152487chr11496 ------
NM_152493chr111627 --21268 547 --
NM_152545chr41264 ------
NM_152550chr5160 1439 ----
NM_152553chr62399 172 ------
NM_152588chr12--11185 ----
NM_152600chr19----231 23 --
NM_152622chr51248 12376 ----
NM_152624chr521348 498 ------
NM_152629chr922850 747 ------
NM_152667chr2011312 --11009 --
NM_152699chr323391 2338 --23506 2934 --
NM_152713chr11129 ------
NM_152721chr181470 --172 --
NM_152733chr625504 999 --46338 1191 1118 100 11646
NM_152739chr7272 62 ----1441
NM_152740chr71220 ----1554
NM_152744chr752379 2236 794 681 197 --22874 323 --
NM_152745chr72973 169 ------
NM_152753chr641896 757 620 455 1404 1187 --
NM_152754chr722746 2670 ------
NM_152756chr523486 125 ------
NM_152758chr81169 ------
NM_152774chr711814 ------
NM_152787chrX13907 ----11399
NM_152855chr221340 ------
NM_152862chr21111 ------
NM_152868chr221103 --143 --
NM_152924chr1576657 5623 5331 4543 1840 941 556 14444 36356 5657 465 --
NM_152988chr1941566 296 269 241 --21611 1537 11810
NM_152996chr11153 1426 ----
NM_152999chr724953 4658 1845 12015 --
NM_153000chr18----1197 --
NM_153029chr1653856 3528 3154 2949 243 13954 43643 3546 2798 480 13876
NM_153184chr3--11402 ----
NM_153188chr555099 4060 1825 256 71 14941 ----
NM_153208chr161812 ------
NM_153215chr3------1354
NM_153262chr11681 --1675 --
NM_153273chr322627 900 12115 ----
NM_153332chr832529 727 538 ------
NM_153334chr223557 308 40 --1537 --
NM_153342chr2----1443 --
NM_153350chr1621135 693 --1175 1290
NM_153367chr101929 --23781 767 --
NM_153371chr131706 --1550 --
NM_153426chr4----154 --
NM_153427chr4----154 --
NM_153453chr6178 --1807 --
NM_153456chr1332396 2363 171 15427 11150 11920
NM_153613chr15174 ------
NM_153619chr152448 128 1458 ----
NM_153620chr7----1336 --
NM_153631chr721409 139 --1128 --
NM_153632chr721409 139 --1128 --
NM_153649chr1--1157 41479 488 170 52 --
NM_153675chr201185 ------
NM_153712chr231150 657 627 ----1452
NM_153715chr71459 --171 --
NM_153748chr121253 ------
NM_153809chr91535 ------
NM_153810chr1021390 549 ----11417
NM_170589chr153462 402 155 ------
NM_170600chr9123 ------
NM_170607chr1741404 1247 1009 630 ------
NM_170665chr1284167 3556 3488 3016 1844 980 953 546 ------
NM_170679chr51299 ----11069
NM_170696chr15151 ------
NM_170697chr15151 ------
NM_170706chr11278 14226 --13983
NM_170707chr12364 287 ------
NM_170708chr12364 287 ------
NM_170711chr192619 85 ------
NM_170743chr152455 2180 1801 626 87 --2990 673 --
NM_170751chr631328 1069 573 ------
NM_170752chr631328 1069 573 ------
NM_170782chr11375 ----1419
NM_172020chr741862 1248 816 289 ----1664
NM_172037chr821094 405 ------
NM_172058chr821779 106 1260 2610 144 --
NM_172059chr821779 106 1260 2610 144 --
NM_172060chr821779 106 1260 2610 144 --
NM_172070chr2--1397 --1425
NM_172071chr146369 4858 2143 857 ------
NM_172078chr7122 ------
NM_172079chr7122 ------
NM_172080chr7122 ------
NM_172081chr7122 ------
NM_172082chr7122 ------
NM_172083chr7122 ------
NM_172084chr7122 ------
NM_172103chr611989 --1335 --
NM_172105chr611989 --1335 --
NM_172127chr411962 ------
NM_172169chr102191 50 ------
NM_172170chr102191 50 ------
NM_172171chr102191 50 ------
NM_172173chr102191 50 ------
NM_172196chr21142 ------
NM_172208chr6----2916 396 --
NM_172211chr13868 106 39 --1728 --
NM_172225chr141261 467 331 183 --1135 --
NM_172230chr11129 ------
NM_172337chr141666 ------
NM_172387chr1811137 ------
NM_172388chr1811184 ------
NM_172389chr1811184 ------
NM_173064chr152455 2180 1801 626 87 --2990 673 --
NM_173075chr4--11704 --172
NM_173078chrX1447 ------
NM_173156chr111895 --1205 --
NM_173163chr161198 ------
NM_173165chr16179 ------
NM_173198chr912915 1411 ----
NM_173200chr912915 1411 ----
NM_173358chrX1404 ------
NM_173470chrX22140 503 ------
NM_173475chr16--136 1121 11122
NM_173491chr511428 ------
NM_173495chrX22064 1028 1685 ----
NM_173508chr1--11011 ----
NM_173510chr2232415 1920 1058 ------
NM_173511chr213683 --1165 --
NM_173532chr11153 ------
NM_173559chr6--1160 ----
NM_173567chr11222 ------
NM_173595chr1274296 4272 3913 3336 2087 1039 697 1239 34726 4326 1514 --
NM_173602chr122404 383 --13300 12716
NM_173609chr151686 ------
NM_173614chr161178 ------
NM_173633chr192152 67 ------
NM_173642chr168804 7277 6336 2545 480 285 --22959 2509 11740
NM_173647chr211011 ------
NM_173648chr2198 ------
NM_173667chr52596 297 ------
NM_173674chr6145 ------
NM_173681chr71140 --1820 --
NM_173814chr15136 1116 ----
NM_173832chr8103807 3701 3207 2674 2468 842 499 449 431 60 --1478 --
NM_173851chr823259 1266 ------
NM_173854chr1133 --22027 1561 --
NM_174890chr10128 ------
NM_174893chr172189 31 ------
NM_174916chr151913 1596 ----
NM_174921chr41801 ------
NM_174955chr1741401 523 371 206 --125 --
NM_174963chr11839 --1716 --
NM_174964chr11839 --1716 --
NM_174965chr11858 --1735 --
NM_174966chr11839 --1716 --
NM_174967chr11858 --1735 --
NM_174968chr11839 --1716 --
NM_174969chr11839 --1716 --
NM_174970chr11858 --1735 --
NM_174971chr11839 --1716 --
NM_175056chr3173 ------
NM_175061chr711832 ------
NM_175575chr1721204 1197 --21223 811 --
NM_175607chr31205 ------
NM_175610chr1511095 ------
NM_175612chr31205 ------
NM_175733chr1141699 1682 1644 353 --12179 --
NM_175736chr12127115 5720 5680 5618 5022 2997 2530 1660 1092 632 616 117 --52636 2540 1859 772 553 11296
NM_175854chr1312375 ------
NM_175858chr211315 ------
NM_175863chr6----1119 --
NM_175884chr72210 55 ------
NM_175898chr1571581 1410 1245 1053 563 283 91 11366 41255 589 581 345 --
NM_175920chr5----161 --
NM_175931chr1641565 1326 808 231 --21490 327 --
NM_176792chr1031426 402 321 ------
NM_176812chr201158 ------
NM_177438chr1422828 420 ------
NM_177539chr11652 --2788 675 --
NM_177947chrX--11666 ----
NM_177948chrX--11666 ----
NM_177972chr1163075 2803 1471 843 388 169 1102 12706 --
NM_177974chr1522302 2236 --1493 --
NM_177983chr2----1133 --
NM_177985chr2--11851 ----
NM_177996chr2023387 1342 ------
NM_178026chr20127 ------
NM_178126chr1721414 516 --21741 845 --
NM_178140chr532786 2127 2016 ------
NM_178151chrX47665 7334 6795 5162 ------
NM_178152chrX47665 7334 6795 5162 ------
NM_178153chrX47665 7334 6795 5162 ------
NM_178169chr121190 --1112 --
NM_178313chr2--1642 11512 --
NM_178441chr144445 360 346 117 11410 ----
NM_178450chr5------1160
NM_178502chr12136 --2550 76 1533
NM_178509chr1724082 895 ----1911
NM_178557chr451246 618 446 353 44 ------
NM_178565chr81253 --1104 --
NM_178568chr17--11104 ----
NM_178582chr201971 ----1399
NM_178585chr422754 90 ------
NM_178586chr1431839 1662 141 1811 ----
NM_178830chr192546 47 ------
NM_178835chr42586 573 1134 ----
NM_178863chr162389 89 ------
NM_178864chr11----1471 --
NM_180976chr6172 ------
NM_180977chr6172 ------
NM_181054chr141986 ------
NM_181332chrX----132 11849
NM_181351chr111284 1706 12397 12373
NM_181442chr201281 ------
NM_181443chr201180 ------
NM_181458chr2148 ------
NM_181481chr1866921 5947 4711 2201 1868 895 26119 4401 --11726
NM_181482chr1866921 5947 4711 2201 1868 895 26119 4401 --11726
NM_181483chr1866921 5947 4711 2201 1868 895 26119 4401 --11726
NM_181489chr354748 2366 2148 1318 251 11952 12674 --
NM_181491chr973174 2523 2500 2346 2005 899 666 --22386 781 --
NM_181492chr22------11228
NM_181504chr522666 303 ------
NM_181509chr203418 298 290 --2321 154 --
NM_181523chr522666 303 ------
NM_181524chr522666 303 ------
NM_181670chr12276 68 --1293 --
NM_181671chr172212 116 ------
NM_181672chrX22010 213 ------
NM_181673chrX22010 213 ------
NM_181741chr2--11122 ----
NM_181742chr2--11122 ----
NM_181746chr11121 ------
NM_181784chr21658 11637 --1258
NM_181836chr51275 ------
NM_181839chr811284 ------
NM_181843chr112143 126 --141 --
NM_181844chr1741695 608 457 179 ------
NM_181876chr442413 787 736 523 ------
NM_182485chr41381 ------
NM_182488chr13132 ------
NM_182511chr1811169 --154 1109
NM_182553chr112499 453 ----1237
NM_182641chr171725 11396 ----
NM_182645chr6178 --1807 --
NM_182646chr41381 ------
NM_182678chr21117 ------
NM_182685chr11652 1805 ----
NM_182687chr16----1196 --
NM_182700chr72677 131 11719 --11330
NM_182757chr631082 534 114 23115 2977 ----
NM_182764chr20--1909 1211 --
NM_182765chr10--12184 ----
NM_182767chr1211480 ------
NM_182789chr5--1157 ----
NM_182895chr223557 308 40 --1537 --
NM_182907chr622252 93 ------
NM_182920chr311235 ------
NM_182948chr11158 ------
NM_182972chr11844 ------
NM_183078chr653853 3786 2615 1237 248 13374 1154 --
NM_183237chr321007 252 --1850 2801 28
NM_183243chr7----1476 --
NM_183243chr7----1476 --
NM_183323chr5--1157 ----
NM_183397chr2024817 4072 --24942 3547 14803
NM_183398chr52881 544 2509 53 ----
NM_183399chr52881 544 2509 53 ----
NM_183400chr52881 544 2509 53 ----
NM_183401chr52881 544 2509 53 ----
NM_183422chr13176 ------
NM_184085chr8132 ------
NM_184086chr8132 ------
NM_184087chr8132 ------
NM_184234chr201221 ------
NM_194247chr2--1120 ----
NM_194278chr1453443 3006 1385 775 101 12809 22689 1325 --
NM_194282chr411182 --11026 --
NM_194285chr11140 ------
NM_194301chr14--184 ----
NM_194313chr911507 --1518 177
NM_194314chr112168 11605 ----
NM_194356chr1211840 ----137
NM_197941chr51955 12683 ----
NM_197956chr91608 128 ----
NM_197970chr21332 1582 ----
NM_198074chr11321 --21303 447 --
NM_198081chr63407 379 59 ----1598
NM_198097chr7142 ------
NM_198098chr731818 1699 1258 1126 ----
NM_198123chr8--1476 ----
NM_198124chr8--1476 ----
NM_198158chr322658 1038 ------
NM_198159chr322658 1038 ------
NM_198177chr322658 1038 ------
NM_198178chr322658 1038 ------
NM_198181chr1512787 ------
NM_198189chr22917 805 ------
NM_198204chr1741404 1247 1009 630 ------
NM_198205chr1741404 1247 1009 630 ------
NM_198215chr10------164
NM_198236chr12285 25 ------
NM_198256chr211424 ------
NM_198261chr121312 ------
NM_198262chr121312 ------
NM_198334chr11170 1128 ----
NM_198335chr11170 1128 ----
NM_198392chr642004 918 787 66 --283 38 1140
NM_198503chr11565 ------
NM_198504chr3132 ------
NM_198513chr8----1138 --
NM_198530chr17------1475
NM_198560chr373628 2986 967 828 764 551 57 23161 508 13180 --
NM_198563chr31110 --2129 92 --
NM_198581chr256518 6130 5707 2932 54 --66495 5550 5220 4923 1534 280 --
NM_198595chr434412 1904 1352 --183 --
NM_198793chr333437 2617 564 1492 ----
NM_198829chr71109 ------
NM_198850chr19----143 --
NM_198859chr374657 4167 4059 3504 1927 1114 691 11669 --25072 3888
NM_198867chr192341 79 --127 --
NM_198900chr12127115 5720 5680 5618 5022 2997 2530 1660 1092 632 616 117 --52636 2540 1859 772 553 11296
NM_198956chr72677 131 11719 --11330
NM_198968chr1343544 3291 224 92 ------
NM_198990chr712286 ------
NM_199003chr811129 ------
NM_199054chr1931594 1454 350 --31662 1521 105 --
NM_199076chr103411 245 65 2831 96 1307 --
NM_199129chr20--2433 63 --1250
NM_199160chr921280 43 161 11828 --
NM_199168chr101411 129 ----
NM_199169chr2052918 2761 1125 818 55 ------
NM_199170chr2052918 2761 1125 818 55 ------
NM_199171chr2052918 2761 1125 818 55 ------
NM_199183chr3136 ------
NM_199185chr5138 ------
NM_199245chr1242346 2196 2000 363 --1461 --
NM_199351chr11126 ------
NM_199423chr1621283 248 1411 ----
NM_199436chr211132 ------
NM_199478chrX21241 543 ------
NM_201266chr21244 1573 1428 --
NM_201279chr21244 1573 1428 --
NM_201280chr62539 87 ------
NM_201378chr831000 951 26 ------
NM_201379chr831000 951 26 ------
NM_201380chr831000 951 26 ------
NM_201381chr831000 951 26 ------
NM_201382chr831000 951 26 ------
NM_201383chr831000 951 26 ------
NM_201384chr831000 951 26 ------
NM_201413chr211745 ------
NM_201414chr211745 ------
NM_201432chr1765991 5935 5529 4417 4388 2462 1913 ----
NM_201433chr1765991 5935 5529 4417 4388 2462 1913 ----
NM_201434chr17----138 --
NM_201521chr61363 ------
NM_201522chr61363 ------
NM_201523chr61363 ------
NM_201567chr3----1216 --
NM_201568chr111895 --1205 --
NM_201569chr111895 --1205 --
NM_201574chr22249 160 ------
NM_201599chrX1122 --1420 --
NM_201627chr52350 344 ------
NM_201995chr11----1113 --
NM_201999chr41465 ------
NM_202467chr191493 ------
NM_202468chr191493 ------
NM_202469chr191493 ------
NM_202470chr191493 ------
NM_202494chr191493 ------
NM_203301chr14----1300 --
NM_203304chr191271 ------
NM_203305chr931705 461 95 --2965 898 --
NM_203327chr2024029 1282 --23961 852 --
NM_203346chr231477 316 94 ------
NM_203350chr11693 ------
NM_203364chr1111203 ------
NM_203394chr1222619 205 ------
NM_203399chr1----1581 --
NM_203401chr1----1581 --
NM_203403chr911052 --160 --
NM_203404chr1184 1732 1618 1591
NM_203434chr91459 ----11127
NM_203458chr121528 1409 ------
NM_203464chr11223 --1180 --
NM_203504chr41356 ------
NM_203505chr41356 ------
NM_205861chr121757 858 --139 --
NM_206594chr11328 ------
NM_206595chr11328 ------
NM_206839chr15135 ------
NM_206853chr6----13462 --
NM_206854chr623356 580 --14723 --
NM_206855chr624321 1545 --15688 --
NM_206907chr5----13022 --
NM_206914chr1231661 1587 173 --11834 --
NM_206943chr2136 ------
NM_207113chr7166 --1274 1250
NM_207123chr41667 ------
NM_207171chr111851 --11990 --
NM_207366chr7----1426 --
NM_207396chr121230 636 --2478 174 --
NM_207406chr495534 4614 2457 2121 1885 1057 985 360 311 1101 ----
NM_207422chrX124 ------
NM_207429chr111625 --1470 --
NM_207645chr11----1154 --
NM_212460chr72325 94 1526 ----
NM_212464chr151760 ------
NM_212467chr152957 306 --11025 --
NM_212471chr174918 757 618 504 ------
NM_212472chr174918 757 618 504 ------
NM_212558chr921459 74 --14197 --
NM_213606chr10----21879 624 --
NM_213613chr4129 --1214 --
NM_213651chr1----1260 --
NM_213662chr1731964 1643 488 1153 ----