TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-2681-5p
miRNA Sequence: GUUUUACCACCUCCAGGAGACU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000084chrX75712 4847 4511 1002 771 102 24 46846 2160 1054 964 36364 5059 1717 14491
NM_000092chr274487 4441 4387 3740 3557 3045 1390 --22887 521 21744 1135
NM_000112chr5115517 5236 4623 4168 4161 3606 1748 1484 706 356 276 24476 1551 --11152
NM_000217chr1294911 4816 4499 4409 4130 3929 815 425 174 55051 4538 3957 1686 1356 21212 297 1560
NM_000252chrX71477 1316 1211 1162 1100 431 104 174 --1595
NM_000332chr666920 6426 5347 4708 923 814 25708 5236 12502 27083 4655
NM_000430chr1783791 3735 3710 3672 3313 1219 827 169 33330 2735 637 23162 2693 --
NM_000618chr1295925 4771 2537 1766 1699 1466 959 882 213 25710 1647 16232 --
NM_000618chr1295925 4771 2537 1766 1699 1466 959 882 213 25710 1647 16232 --
NM_000809chr4169119 8287 8042 7611 7454 7354 6183 6002 3638 3254 2981 1889 1211 1116 804 530 88628 3447 2615 2272 1354 1053 1029 168 ----
NM_000899chr12124282 3540 3333 3312 3306 3129 3081 1486 1290 928 899 190 43807 2788 2736 524 ----
NM_000926chr1188885 8815 7543 6330 5955 3257 1120 856 49215 8715 2727 533 29142 7181 26847 5846
NM_001001419chr5105096 4653 4453 4102 3372 3286 1881 661 563 210 14529 23274 1397 --
NM_001001420chr5105096 4653 4453 4102 3372 3286 1881 661 563 210 14529 23274 1397 --
NM_001001668chr1972901 2867 2764 1455 1302 773 405 23438 1255 3872 663 308 --
NM_001001928chr22128297 6081 5994 5548 3256 2772 1872 1629 1382 1060 995 469 1480 27071 691 27121 5910
NM_001003652chr1847962 7559 7047 6424 67249 6726 2244 1521 847 535 35303 2526 1800 --
NM_001003712chr12144039 3662 3587 2754 2614 2550 1632 1490 1470 1430 1422 1050 943 668 12576 ----
NM_001004419chr12104622 3748 2954 2915 2866 1723 1280 1040 983 232 33914 3844 1752 11849 --
NM_001005473chr586638 5258 5056 4930 4371 4362 2239 796 56611 6542 5908 2356 2181 35239 1217 725 --
NM_001007214chr141366 393 260 125 31586 1360 383 21848 1268 11280
NM_001007466chr655186 3830 3415 1714 501 14642 --34102 746 699
NM_001008738chr542812 725 620 202 22491 1134 --2273 44
NM_001008925chr493523 3000 2239 2178 1359 848 789 161 119 11162 --12783
NM_001009899chr384344 4088 4053 4012 1139 1132 370 23 15422 24370 788 16077
NM_001011666chr796346 6233 5528 5296 4898 4416 2141 1781 389 35975 5362 4425 --11191
NM_001013620chr1267750 7215 6838 6622 6087 3396 78080 7473 7277 5928 2515 159 27 15405 46484 5667 3177 2416
NM_001014797chr10116859 6683 6418 6194 5631 2732 2695 1899 1348 1093 652 48190 3258 3190 2701 27360 6260 12541
NM_001024956chr1174523 4480 4440 1993 1096 1070 901 35555 766 426 34532 4426 4061 13771
NM_001025077chr1097480 6973 6902 6352 5041 4688 2664 1902 49 87352 5811 5415 2434 1607 1262 849 747 16009 --
NM_001025580chrX104069 3288 3227 2652 1165 967 944 471 275 128 11326 --31152 624 172
NM_001030055chr1464117 3792 3257 1702 1301 1228 31332 935 865 --23381 3233
NM_001033045chr264387 4312 3534 2832 185 126 32969 2744 134 23158 1294 --
NM_001039547chr387740 6933 6872 6456 5971 1186 398 195 37901 5320 1605 47476 7351 5581 2154 --
NM_001039585chr183762 3085 2667 1296 674 617 467 30 14090 24100 2710 23943 3712
NM_001039618chr11165869 5863 5792 5722 5705 4563 3745 3726 1682 1294 1270 1080 1059 637 629 292 14092 15742 --
NM_001039693chr254072 2644 1450 1437 652 24000 243 12566 11462
NM_001039840chrX65608 4336 4185 4022 2114 584 34425 3834 695 21802 117 15188
NM_001040284chr16105547 5094 5042 4077 3856 3595 2341 1724 1027 290 1797 24003 1520 15439
NM_001040429chr1383628 3497 2559 2368 1379 1074 648 545 53189 3038 988 936 681 1864 --
NM_001040712chr943437 2745 2476 660 53081 2208 1015 689 520 --12877
NM_001042494chr1593695 3312 2942 2919 2844 2558 1413 725 160 12984 22418 304 21461 732
NM_001042495chr1593695 3312 2942 2919 2844 2558 1413 725 160 12984 22418 304 21461 732
NM_001042496chr1593695 3312 2942 2919 2844 2558 1413 725 160 12984 22418 304 21461 732
NM_001042497chr1593695 3312 2942 2919 2844 2558 1413 725 160 12984 22418 304 21461 732
NM_001042599chr297112 5609 2416 2153 1695 1516 1415 941 780 31852 1346 566 46010 5839 5001 3070 12481
NM_001099678chr3156330 6187 5718 4599 4512 4408 2427 2133 2013 1941 1727 1675 800 776 24 56073 4362 4289 1441 946 2582 403 26344 1907
NM_001100108chr1107742 7445 6617 6450 3297 3088 2308 1356 1130 201 47940 2183 1863 635 26154 5512 --
NM_001167chrX96611 5955 2552 1728 1297 1144 1098 1025 653 36477 1737 428 11291 14831
NM_001173chr1464117 3792 3257 1702 1301 1228 31332 935 865 --23381 3233
NM_001204chr267762 7227 6964 1003 964 26 26998 2658 36689 6113 2756 --
NM_001412chrX53443 3357 2853 2675 787 73730 2982 2340 1006 928 738 305 22658 233 --
NM_001821chr174499 4276 4164 2968 700 447 430 44809 3956 1609 1492 11559 11242
NM_001918chr188356 7836 6169 5850 3617 2863 2414 2124 68911 8810 8453 3609 3594 1741 48525 2459 1716 397 11161
NM_002006chr494342 4140 4056 951 922 683 185 139 75 45778 5661 840 164 12010 21636 1140
NM_002025chrX109005 7827 6040 3618 3520 2810 2390 2111 1499 946 29223 142 23605 3063 --
NM_002092chr4125046 5031 4709 4486 3303 3123 1967 1776 755 433 416 31 1323 --1821
NM_002130chr541702 1402 1247 252 1382 3501 491 480 --
NM_002203chr5103671 3386 3355 3240 3232 3028 1399 1248 766 112 23967 1189 1579 23708 3197
NM_002210chr252685 2326 1369 1195 617 23537 87 22540 529 12402
NM_002270chr5105248 4154 3789 3684 1556 1343 1301 670 582 112 44424 2102 1702 444 11290 --
NM_002310chr5106510 6166 5968 5408 4511 2561 2005 428 312 114 26361 4847 15765 --
NM_002336chr1284974 4316 4003 1996 1901 1864 1165 761 31958 487 39 24117 639 --
NM_002481chr176771 6239 5709 4934 1209 867 352 --26128 2148 37602 7292 5217
NM_002839chr943437 2745 2476 660 53081 2208 1015 689 520 --12877
NM_003034chr12128089 6300 5975 2925 2504 2067 1705 1602 1106 885 501 235 58028 5702 1744 1545 1462 5976 364 342 260 246 17899
NM_003108chr2117100 6930 6861 6141 5968 5282 4609 2215 1780 1019 227 37142 6242 987 16946 11224
NM_003199chr1895359 5340 5276 4653 4436 4117 1940 1260 683 45333 2096 912 723 --13796
NM_003392chr344151 4112 3980 1009 2902 783 13953 2411 338
NM_003430chr1931701 1067 282 --41332 1304 679 478 11315
NM_003468chr243851 3603 2851 2693 14153 34250 2973 939 14375
NM_003583chr1243873 3447 2783 2415 83758 3721 3135 2892 1430 1368 710 145 23487 1325 --
NM_003913chr694190 3704 3694 2644 1343 1334 1195 536 191 12935 1980 13801
NM_003994chr12124282 3540 3333 3312 3306 3129 3081 1486 1290 928 899 190 43807 2788 2736 524 ----
NM_004087chr342000 1917 1692 1479 11627 1277 11487
NM_004133chr872571 1795 1787 1713 687 475 179 21675 41 --1527
NM_004171chr11169580 8432 8400 8106 7750 7583 7116 3504 2351 2300 1557 858 775 575 494 347 58776 5926 3456 1923 1188 49110 8726 7783 6794 --
NM_004501chr1134124 3679 2633 2493 1648 1592 1237 662 642 519 305 267 199 ------
NM_004731chr1221927 1901 11447 1349 2639 559
NM_004745chr856190 2483 2162 1434 1048 46707 2681 1787 1019 24978 2540 34498 1073 381
NM_004857chr1464682 3539 1927 1340 456 227 84759 4650 4605 3446 1425 1354 1078 992 1736 --
NM_004863chr1443944 1024 284 105 22135 170 21617 1297 23643 1853
NM_004904chr796346 6233 5528 5296 4898 4416 2141 1781 389 35975 5362 4425 --11191
NM_005036chr22128297 6081 5994 5548 3256 2772 1872 1629 1382 1060 995 469 1480 27071 691 27121 5910
NM_005065chr14105224 4453 4021 3939 3884 3831 3653 1717 1632 1296 44995 4971 3424 409 14572 --
NM_005135chr1593695 3312 2942 2919 2844 2558 1413 725 160 12984 22418 304 21461 732
NM_005235chr297112 5609 2416 2153 1695 1516 1415 941 780 31852 1346 566 46010 5839 5001 3070 12481
NM_005497chr1795962 5394 4488 4433 4130 1539 1505 588 44 --45228 4324 3837 1370 --
NM_005504chr1276452 6338 5295 4857 2216 1854 533 36298 5158 2299 16419 25134 1425
NM_005591chr1182334 2059 1894 832 806 516 383 188 41762 1054 219 119 ----
NM_005901chr1847962 7559 7047 6424 67249 6726 2244 1521 847 535 35303 2526 1800 --
NM_005903chr5105096 4653 4453 4102 3372 3286 1881 661 563 210 14529 23274 1397 --
NM_005941chr873860 3767 3691 3662 3372 2579 279 12555 --11098
NM_005955chr175419 5296 5284 3420 3378 1752 1600 45494 5333 3706 1788 --14043
NM_006007chr9114516 4501 4206 3679 2923 1777 629 605 599 526 250 24351 3262 ----
NM_006047chr20133300 3251 3185 2972 2863 2607 2497 1265 938 348 259 200 28 23290 2302 1446 12554
NM_006141chr16102679 2625 2309 2274 1854 1769 541 289 283 163 --1349 --
NM_006203chr565167 5067 4450 4241 572 246 21258 42 --21794 1369
NM_006252chr1116986 6975 6406 5880 5762 2437 1328 1293 471 456 370 46206 4598 2698 184 26764 4963 15690
NM_006283chr874921 3541 3051 1504 1166 1059 1005 33991 3749 575 13384 13151
NM_006482chr1243873 3447 2783 2415 83758 3721 3135 2892 1430 1368 710 145 23487 1325 --
NM_006544chr1495694 4966 4959 4948 2384 1859 1492 708 122 85643 5551 4150 1749 1163 835 735 248 32373 677 405 --
NM_006599chr1677220 7117 7091 5325 2669 2091 433 27742 730 36919 5430 5214 --
NM_006620chr664153 3962 923 616 553 39 24697 3189 11207 13353
NM_006626chr972370 2319 2308 1818 824 708 181 22090 736 12207 1405
NM_006729chrX55556 3501 1277 576 502 51430 1399 289 235 39 35474 4524 3584 11991
NM_006873chr282831 2585 1058 995 888 566 478 403 22917 1149 13571 12558
NM_006918chr1174523 4480 4440 1993 1096 1070 901 35555 766 426 34532 4426 4061 13771
NM_007006chr1663506 2344 331 150 68 25 23300 1126 12725 2748 83
NM_007038chr21156077 6045 5774 5732 5668 5397 5279 4709 4484 4016 1536 1074 778 264 65 11864 15974 --
NM_007137chrX53385 1931 1717 1695 224 23375 1281 24553 3834 21670 1652
NM_007249chr13139149 9117 8395 7852 7287 6740 6588 6112 6080 2959 2634 2458 30 58669 7239 6560 1091 499 26269 920 --
NM_007350chr1243693 1189 812 258 63965 3449 3054 2918 1806 1246 11327 34170 3520 2984
NM_012096chr363374 2891 2719 1143 1126 859 33299 933 815 42793 2318 1365 55 --
NM_012164chr9117502 7164 7077 6524 5613 5533 2697 2184 1968 1300 882 31637 1021 311 35875 5654 5590 16846
NM_012214chr265948 5267 5112 4546 4141 870 12122 46455 4682 1359 1058 25887 4495
NM_012281chr772305 2260 1984 1837 1831 1743 126 51568 1504 839 559 47 1823 --
NM_012464chr492398 2387 2313 2247 1882 734 484 477 125 22724 2539 22355 230 --
NM_013231chr1464408 4166 4141 4122 2981 935 21560 512 2432 414 23343 495
NM_013255chr7148825 8763 8047 7855 7053 6572 6541 3385 3021 2512 1943 1636 216 84 27616 2939 12138 --
NM_013269chr12104549 3675 2881 2842 2793 1650 1207 967 910 159 33841 3771 1679 11776 --
NM_014155chr11126796 6284 6128 6050 5948 5845 4568 1690 775 750 720 132 42856 2791 2631 1131 22518 842 --
NM_014331chr477501 6654 6477 2875 2736 2677 2309 41956 659 411 375 27611 1821 36849 6686 2202
NM_014674chr363939 3774 3114 2536 1267 1253 32897 2731 1439 11206 23625 3391
NM_014721chr697217 6693 4852 4668 4630 2102 2095 1598 119 32877 2456 2371 35917 346 240 --
NM_014739chr6124140 3516 3129 3117 2947 2772 2625 1667 1167 1123 520 315 42917 1228 980 202 ----
NM_014829chr582128 2040 1929 1526 1496 936 887 628 21834 580 1399 1148
NM_014864chr183926 3817 3395 3195 3069 1713 1653 23 1157 44327 4197 3748 653 --
NM_014873chr194743 4712 4435 4083 3479 3334 3078 1922 1666 --21861 1522 13124
NM_014877chr17127543 7171 6739 6715 5633 5146 5103 3080 1529 852 223 56 45477 2651 966 676 11252 11544
NM_014906chr1764093 3657 2800 568 557 71 22578 62 22694 510 13044
NM_014923chr1362256 2163 888 497 445 157 32361 1577 381 11840 11636
NM_014953chr1334295 4065 3404 54193 1680 1496 355 275 11215 1574
NM_014982chr1475075 5069 1706 1387 1217 1056 488 45176 5083 3472 441 11478 --
NM_014991chr463228 3146 2864 1090 740 195 ----22819 1041
NM_015087chr1332587 851 562 1815 1262 22522 940
NM_015092chr1694221 4184 4104 3868 3787 3392 1138 602 225 21251 523 34059 3839 1613 --
NM_015208chr18103599 3593 3340 2849 2648 1181 1078 931 616 110 23401 3080 23903 1489 1691
NM_015215chr183068 3011 2766 2578 2386 2045 1264 674 ----22067 1033
NM_015310chr897921 7849 6612 6178 6127 1632 1387 445 376 35943 1814 498 57543 6773 5403 1855 469 --
NM_015313chr1173820 1661 1412 1223 1121 928 504 21934 959 14272 11032
NM_015336chr12112682 2629 2511 2359 2228 1657 1645 1062 631 306 125 21861 207 ----
NM_015365chrX104069 3288 3227 2652 1165 967 944 471 275 128 11326 --31152 624 172
NM_015569chr144656 3820 3578 1864 64828 4236 3702 1539 1081 958 24155 3695 23572 1637
NM_015879chr1888470 8092 7924 6999 6479 5997 3155 1675 21375 433 26756 1644 --
NM_016206chr368003 7020 6883 6019 5953 1636 68328 7920 1537 678 475 407 28222 5959 --
NM_016217chr6103661 3097 3011 2750 1002 848 675 650 610 289 13530 12388 --
NM_016530chr1554101 3558 3162 2725 1239 23988 2683 --22951 1088
NM_016929chr694510 4394 3704 3645 3155 3041 3004 960 919 33573 3022 1036 34197 1537 1161 11314
NM_016953chr285332 5058 4974 4236 2454 2061 550 345 76047 5696 5297 4507 3763 2443 961 22176 1981 11043
NM_017420chr1473409 3135 2976 2861 2692 1504 175 11409 1249 23156 2594
NM_017447chr21113585 3548 3325 3076 1745 1322 1245 944 914 685 647 1425 1971 14287
NM_017628chr495119 4769 4564 3221 1805 643 173 89 28 11707 24358 336 --
NM_017637chr9117921 7166 6870 6843 6837 6555 2549 1426 1289 1196 558 12203 28305 7186 22397 257
NM_017850chr131401 1003 986 1994 ----
NM_017919chr995777 5270 4462 4220 3817 2146 1625 780 540 65553 4987 3966 560 318 277 1231 1872
NM_018027chr1073146 3076 3029 2813 2590 1127 807 --22758 911 22848 1327
NM_018085chr186743 6574 5110 3252 2953 1271 971 891 15430 47245 6200 5408 2886 12901
NM_018155chr362685 2169 1137 844 681 413 33226 951 187 --12809
NM_018409chr441039 998 825 745 3990 817 359 32792 883 526 13271
NM_018440chr8108109 6769 6694 6599 6466 6032 2971 1986 1603 625 57880 7452 5847 3016 2374 --28033 1400
NM_018566chr1134511 4483 4191 3928 3672 1618 1047 943 758 619 433 326 202 35168 4860 4770 --14371
NM_018638chr1241967 1740 1613 465 45516 4641 3585 922 33805 1261 553 14266
NM_020122chr2105571 5139 4032 2161 2037 1089 706 691 441 195 25277 1146 35595 4798 2251 --
NM_020245chr655092 3736 3321 1620 407 14548 --34008 652 605
NM_020648chr1842431 604 562 35 22077 113 --22304 1036
NM_020673chr20157612 7345 7159 6980 6806 5916 5854 5580 5011 4805 2975 2523 882 714 331 37760 1755 201 34834 3044 1202 11436
NM_020718chr1695640 4459 4382 2523 2281 2151 1807 542 379 34207 2532 34 1926 1691
NM_020727chr2193355 3220 3029 2795 2637 2478 1008 559 59 33244 2950 2571 13943 --
NM_020766chrX53840 3290 1843 1726 479 34426 375 268 13542 23897 2803
NM_020774chr1885921 5444 4630 4239 3966 1673 888 462 25172 4373 21776 1582 --
NM_020782chr1294670 3605 3589 3547 3355 3227 1834 1628 1005 44542 4118 4035 4027 21096 307 2341 95
NM_020841chr12144039 3662 3587 2754 2614 2550 1632 1490 1470 1430 1422 1050 943 668 12576 ----
NM_020844chr897495 7325 6303 6243 5709 4807 1871 1285 444 16724 11386 22362 1890
NM_020890chr32437 424 3443 431 130 ----
NM_021072chr552342 2168 1650 276 140 21988 148 1767 --
NM_021097chr242872 2222 592 410 2882 154 --21097 441
NM_021116chr788799 8628 7477 6955 6648 5504 2663 1818 28307 8259 37678 7296 6340 13395
NM_021163chr7103765 3234 2688 2633 1243 854 779 756 359 322 32767 2472 1365 21280 673 12589
NM_021183chrX92538 2501 2495 2436 1966 944 860 481 113 31809 1694 548 12443 --
NM_021629chr3114955 4702 4568 4426 4301 1045 961 857 286 247 97 34188 1566 71 33289 1817 1393 --
NM_021942chr41270 1909 --2822 94
NM_021961chr1187441 7001 5720 4826 1672 1070 448 289 77266 6696 5959 5809 5735 5697 224 1632 1343
NM_021964chr386033 5541 5186 4235 2454 1072 809 350 66391 6071 5642 4638 1576 964 15010 --
NM_022459chr13136222 6210 6117 5944 5237 4555 4058 3846 2085 1641 1418 1037 151 55311 4070 2091 941 861 26193 5802 1443
NM_023016chr242889 2880 2863 2229 22904 453 --32130 2082 1777
NM_023929chr882682 2190 1978 1888 1823 1025 960 250 1125 --11840
NM_024345chr995881 5820 5260 5110 4875 4856 4340 3959 661 54601 4173 3760 1376 972 11642 --
NM_024423chr1854267 3999 3277 417 280 2393 132 24296 3025 1860
NM_024563chr521658 1652 11749 --21645 651
NM_024639chr632834 852 342 1464 1726 42400 963 685 517
NM_024665chr3104441 4098 3964 3691 3444 3180 1087 729 716 603 43242 2897 1736 971 --21866 953
NM_024744chr24999 765 680 64 1790 --22492 488
NM_024770chr285994 5786 5777 4928 4268 2013 1834 1023 65820 5049 4636 4386 2271 340 --16212
NM_024947chr3119252 7866 7820 7812 7791 6873 6843 3312 3004 2130 1400 49274 7756 2950 840 46997 1684 202 64 16150
NM_024989chr265534 5521 5225 3162 701 586 57009 6361 6093 5294 743 26879 5755 16517
NM_025054chr854048 3898 3605 2786 1458 23920 3787 --23191 789
NM_025146chr332350 2166 240 32284 1699 540 --22246 1691
NM_025191chr163468 3095 2828 857 635 45 23535 2992 13196 2696 527
NM_030625chr1041794 1710 558 366 11732 2931 188 1122
NM_030627chr573762 3156 3125 2665 1431 772 706 44067 3652 2807 763 --12589
NM_030647chr7105659 5211 4576 4317 4099 3879 2089 1934 1278 747 3792 438 109 35189 5016 217 45609 4006 2457 319
NM_031427chr1485368 5091 4998 3976 2263 2148 1364 1190 14572 34768 4234 1625 1543
NM_031435chr12123355 3272 2927 2618 2606 1044 932 703 662 636 582 529 22645 54 ----
NM_031844chr1134124 3679 2633 2493 1648 1592 1237 662 642 519 305 267 199 ------
NM_032105chr176904 6372 5842 5067 1342 1000 485 --26261 2281 37735 7425 5350
NM_032208chr243316 2646 691 264 23362 312 33220 1020 334 1525
NM_032373chr10115689 5630 5597 5497 5096 3575 1868 1617 1501 1479 343 34661 2247 519 44392 4352 3992 3760 44618 4412 1710 254
NM_032859chr1353181 1099 629 585 395 43196 2714 1281 731 12740 33439 3389 2577
NM_033224chr7107495 7001 6405 5866 2843 2244 2006 753 254 159 67999 7930 7672 4986 2548 1513 15176 16098
NM_033225chr853041 2943 2756 2471 1043 11225 --12803
NM_033430chr411377 34179 580 465 1717 33627 1648 1041
NM_033437chr411377 34179 580 465 1717 33627 1648 1041
NM_033505chr276759 6679 4969 2180 1570 1228 840 45684 2589 1954 1449 15579 12108
NM_033656chr21145152 5105 4551 4406 4110 4002 3744 1635 1444 1331 1192 858 676 540 --24589 55 14172
NM_052832chr872082 2014 952 516 509 386 257 2220 193 12387 --
NM_052879chr1243245 1148 682 416 31527 1309 1155 --13214
NM_053016chr986305 5332 2578 2551 2302 2287 1380 620 26027 4833 27748 2295 25541 1737
NM_080743chr652200 1763 1702 604 518 21933 376 21031 591 12483
NM_080764chr2283289 2396 2128 1259 1176 1057 1040 107 --23249 1109 12469
NM_080867chr1495119 4841 4723 4604 4244 3357 2011 496 406 11295 33953 1954 1936 --
NM_130391chr943437 2745 2476 660 53081 2208 1015 689 520 --12877
NM_130392chr943437 2745 2476 660 53081 2208 1015 689 520 --12877
NM_130393chr943437 2745 2476 660 53081 2208 1015 689 520 --12877
NM_133334chr475964 4275 2156 2047 1314 954 781 11414 1170 34340 2182 1442
NM_133372chr542812 725 620 202 22491 1134 --2273 44
NM_133445chr963236 2759 2737 2337 677 633 1658 32661 928 491 23353 2894
NM_133496chr164567 4017 2844 1547 1019 133 1371 24278 3543 14436
NM_133646chr264926 3765 3590 1870 821 497 34503 1652 1154 35451 4753 3888 11591
NM_133647chr1593695 3312 2942 2919 2844 2558 1413 725 160 12984 22418 304 21461 732
NM_138391chr14992 891 884 834 3897 295 204 --1846
NM_138444chr13124623 4443 4075 3769 3061 1842 1621 1546 984 664 634 533 34756 4698 3441 13734 --
NM_138468chr286311 5678 4827 4384 4352 4056 2040 530 --32287 1788 1458 24441 150
NM_138713chr1677220 7117 7091 5325 2669 2091 433 27742 730 36919 5430 5214 --
NM_138714chr1677220 7117 7091 5325 2669 2091 433 27742 730 36919 5430 5214 --
NM_138959chr186784 5227 5154 5041 2673 2483 2313 2123 46403 5882 5402 1621 32505 1910 830 14356
NM_144571chr496305 5666 5013 4763 4401 2694 2070 1805 135 15342 --24670 558
NM_144599chr15105343 5002 4882 4806 4413 4043 1798 1792 1047 77 45315 4396 1916 1840 23455 1779 --
NM_145259chr267064 6744 6120 4599 2372 1343 86812 6593 6554 6536 6075 1560 1532 364 14777 --
NM_152529chr264387 4312 3534 2832 185 126 32969 2744 134 23158 1294 --
NM_152624chr5136804 6675 6620 5768 5524 5316 5112 4959 4717 4520 2845 1767 545 57412 4787 1785 1369 150 16481 --
NM_152756chr574003 3969 3567 2896 2835 2677 391 54192 4015 3908 1487 1018 23396 3245 --
NM_152793chr794014 3936 1895 1857 1674 1642 1368 1054 452 14120 64404 1553 1520 930 726 560 --
NM_152838chr20133300 3251 3185 2972 2863 2607 2497 1265 938 348 259 200 28 23290 2302 1446 12554
NM_153188chr5105248 4154 3789 3684 1556 1343 1301 670 582 112 44424 2102 1702 444 11290 --
NM_153207chr1273702 3397 3161 1465 1443 981 280 1884 13643 11186
NM_153607chr573042 2775 2763 2308 957 308 300 22985 579 --12353
NM_171998chrX62547 2256 2048 1946 537 52 32497 2308 577 --12373
NM_172070chr2112277 2239 2177 1939 1566 650 630 527 509 494 478 11881 ----
NM_172071chr1107406 6931 6864 6711 6656 5883 5306 4648 4633 2155 44662 4536 2531 1412 11879 15399
NM_173214chr1677220 7117 7091 5325 2669 2091 433 27742 730 36919 5430 5214 --
NM_173468chr4114990 4982 4702 2362 2309 2095 1747 583 569 215 156 55367 2034 1995 1605 767 11798 --
NM_173536chr484884 3992 3162 2068 1249 371 188 51 23366 3190 23960 728 14739
NM_173582chr1165363 4545 2222 2193 1161 386 11205 36103 1337 364 25861 2497
NM_173808chr1104102 3686 3659 3631 1766 1361 1315 1057 230 135 32846 761 692 14008 13853
NM_173825chr333106 2195 232 2925 693 2769 682 12571
NM_173829chr5184981 4774 4592 2390 2007 1977 1914 1522 1435 1420 1309 1186 594 534 486 407 314 182 34955 4858 1077 --15337
NM_175624chr12117276 6676 5994 5639 5498 3089 1854 1601 1162 960 917 47229 6002 2799 1986 --22701 1567
NM_175625chr12117276 6676 5994 5639 5498 3089 1854 1601 1162 960 917 47229 6002 2799 1986 --22701 1567
NM_177538chr2108178 8080 7962 6565 3270 3002 2957 2572 2413 1782 13458 56612 3102 1950 1604 894 --
NM_178509chr17114091 3710 2789 2618 2612 1552 1515 981 153 120 94 ----23822 1267
NM_178585chr463228 3146 2864 1090 740 195 ----22819 1041
NM_181705chr594431 4177 3682 2109 1777 885 743 705 366 15799 11537 15244
NM_182485chr473573 3228 2480 1286 1213 1096 270 22647 730 11363 12432
NM_182646chr473573 3228 2480 1286 1213 1096 270 22647 730 11363 12432
NM_182898chr796346 6233 5528 5296 4898 4416 2141 1781 389 35975 5362 4425 --11191
NM_182899chr796346 6233 5528 5296 4898 4416 2141 1781 389 35975 5362 4425 --11191
NM_194247chr244518 2999 2766 2746 94010 3562 3037 1799 1787 888 533 479 113 23420 3016 --
NM_194283chr593880 3863 3372 3000 2957 2836 724 245 235 2407 137 11162 1537
NM_194314chr185510 4686 4216 2245 1466 788 617 51 65390 3500 3413 1996 1488 1380 21622 1171 15071
NM_198465chrX92675 2618 2318 2066 1953 1855 1158 1026 786 32651 321 105 --12014
NM_198484chr375983 4748 4727 4518 1125 832 677 54038 2487 1507 845 819 26110 568 1482
NM_198581chr275647 5319 4592 2800 1398 469 236 46749 6254 662 480 36869 6213 4733 --
NM_198859chr3115116 3705 3176 3167 1798 1504 900 825 738 297 49 34382 4283 1292 23929 1191 --
NM_199053chr41292 1931 --2844 116
NM_199188chr1243245 1148 682 416 31527 1309 1155 --13214
NM_199190chr1243245 1148 682 416 31527 1309 1155 --13214
NM_199229chr241773 684 544 220 3671 523 261 21142 1089 11550
NM_199421chr1495119 4841 4723 4604 4244 3357 2011 496 406 11295 33953 1954 1936 --
NM_201613chr121789 5854 643 306 291 198 --160
NM_203394chr1272525 2395 2298 1072 921 342 222 32154 2093 1010 --1940
NM_203463chr223256 1392 34887 3409 1872 24075 1973 33352 3191 3093
NM_206854chr6105251 5183 4843 4606 1719 1402 998 925 815 796 24780 287 1879 --
NM_206855chr6116216 6148 5808 5571 2367 1963 1890 1780 1761 391 209 35745 3984 1252 11844 --
NM_206909chr897921 7849 6612 6178 6127 1632 1387 445 376 35943 1814 498 57543 6773 5403 1855 469 --
NM_207406chr495610 5567 5036 5017 4766 4759 2492 1731 1148 25887 5876 1802 24064 266
NM_213589chr2145216 5158 5146 4883 4735 4626 4498 4312 4288 4073 2167 1684 1665 453 23970 2088 --13671