TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-26a-1-3p
miRNA Sequence: CCUAUUCUUGGUUACUUGCACG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000092chr273804 3683 3373 1792 1730 1354 607 --13847 1724
NM_000112chr5114883 4530 4300 2153 1894 1180 1102 696 646 422 23 ----14861
NM_000332chr697013 6294 5783 5576 5440 4834 2508 2270 1473 --45808 2290 2281 1878 --
NM_000555chrX117243 6952 6896 5917 5039 2363 1602 1146 1081 421 30 16379 47426 2917 2117 461 1640
NM_000793chr1485157 4999 4954 3117 2048 854 629 603 23128 1761 34032 3413 1301 11616
NM_000809chr4198869 8535 7606 7579 7358 7222 6566 6279 3640 2770 2668 2345 1936 1315 1002 527 503 233 47 21983 1559 28710 2731 22988 1115
NM_000813chr5125527 4798 4182 4093 3917 3497 1971 1877 1782 1614 1118 295 ----22096 751
NM_001001481chr883302 3105 2599 2576 2539 2173 765 456 --13135 12328
NM_001003652chr18158068 7508 7039 6979 6824 6801 6722 6447 5846 3223 2967 2388 1910 1099 897 17746 22143 2042 --
NM_001004065chr962779 2710 2664 1027 507 418 --32465 2460 1117 23658 1201
NM_001004330chr1261827 1795 1717 1446 1341 168 ----21375 1248
NM_001004419chr1274202 3938 3678 3642 3338 3291 1577 14227 12957 22953 1178
NM_001005473chr5125944 5248 5163 4669 4173 2482 2187 1917 1672 1566 234 110 26033 1312 --12212
NM_001007023chr1485157 4999 4954 3117 2048 854 629 603 23128 1761 34032 3413 1301 11616
NM_001010984chr1112626 2401 2371 2364 2234 1669 894 676 463 370 180 1660 1453 --
NM_001010986chrX81792 539 460 443 325 234 207 48 3610 331 282 21928 492 --
NM_001013620chr12128316 8308 6700 5472 5167 3263 2950 2704 2639 1751 1224 71 22267 1163 ----
NM_001014797chr10116536 6473 6384 5796 5660 5497 5186 5108 3072 529 234 15702 25051 2474 --
NM_001024647chr12157149 7108 7001 5843 2991 2416 2035 1820 1745 1586 1501 952 762 408 333 --27065 442 --
NM_001039618chr1195957 5896 5733 5140 4351 2336 1712 916 463 35704 3725 647 23765 923 --
NM_001039840chrX135990 5839 5730 5354 5164 5082 4784 4658 4280 4125 3768 1123 119 --12144 --
NM_001039937chr13124156 3892 3785 3766 3670 3646 3442 3282 2897 1169 1117 478 12693 11294 13714
NM_001042599chr2197757 7646 7455 7209 6123 5711 3045 2864 2747 2348 2266 2223 2125 2018 1848 1642 1482 484 246 --1569 1940
NM_001099678chr3156461 6391 6303 6035 5828 5414 2265 2144 2107 1804 1690 942 707 320 168 --25723 281 --
NM_001106chr3139191 8969 8944 7729 7612 7553 7090 6985 2601 2405 1959 1907 945 --36626 3361 617 28517 8268
NM_001204chr295405 2396 2225 2148 1946 1629 1410 1050 701 17299 --1856
NM_001412chrX123445 3029 3008 2755 2633 2466 2288 1123 1104 1075 991 789 ----11501
NM_001695chr8104142 4033 3985 3937 1483 1369 516 435 410 354 ----1786
NM_001918chr1169315 9079 7998 7467 7280 6606 6525 6401 6054 5881 1472 1163 1119 812 788 44 --28340 3198 12999
NM_002006chr4115800 5386 5045 4857 4551 4205 4117 3546 1786 1278 72 --25005 4443 --
NM_002025chrX98237 7683 6693 5816 5602 3708 2807 2247 556 12205 25632 322 37737 6044 2797
NM_002210chr2123029 2912 2858 2842 2303 2168 1384 1216 1163 1104 473 244 --11025 1943
NM_002214chr7135522 5512 5384 5142 4829 4799 3776 1710 1288 836 775 683 274 1477 14405 23502 1130
NM_002270chr595611 5530 5429 4759 1945 1131 725 325 125 --1425 13540
NM_002310chr5166312 6302 5970 5540 5137 4663 4597 4522 4313 2489 2449 2363 2309 2242 1987 1124 15711 16389 --
NM_002336chr12124736 4439 3777 3398 1932 1706 1528 1286 350 325 172 142 ------
NM_002481chr1137931 7869 7473 7371 6914 6646 5219 2894 2670 2531 1748 504 259 15267 22240 1202 --
NM_002581chr9105443 4547 4490 4426 3603 2133 1100 536 414 89 11789 32234 1250 722 --
NM_002737chr1796346 6253 6218 5768 2107 1499 1322 1103 769 36032 4177 2280 12077 12524
NM_002886chr385211 5105 5079 4449 4373 3770 3588 557 23517 1973 1813 14560
NM_003034chr12137787 6482 5960 5558 5331 3120 2126 2026 1971 1413 1073 1002 73 12456 --15896
NM_003079chr1711011 ----2997 745
NM_003759chr493951 3360 3320 2762 1680 1603 1178 943 806 ----181
NM_003913chr663697 2889 2880 2868 1140 298 23418 740 33375 3218 2821 --
NM_004171chr11159243 8803 8480 8266 7851 7502 7447 7325 7287 6106 3612 2907 2644 2067 1342 1240 36167 3274 1579 --
NM_004293chr983760 3397 2488 1165 1155 1139 734 414 11386 ----
NM_004458chrX31780 118 90 1334 11829 22318 622
NM_004586chrX105060 4169 3513 2082 1883 1786 1467 1120 838 795 24637 4552 --13772
NM_004612chr9104831 4740 4253 3796 3542 1852 1806 1714 1144 103 21207 683 --14314
NM_004815chr163029 1149 1009 171 164 74 --14257 13554
NM_004857chr1484808 3934 3608 3507 3440 2926 1117 569 11344 --11244
NM_004999chr6103538 3446 3281 3265 2920 2903 2766 1475 1203 689 --22747 1641 --
NM_005121chr17103843 3714 3101 2343 1218 877 827 740 686 605 23138 677 ----
NM_005156chr994976 4172 1888 1745 1738 1548 1279 1268 736 24798 2161 --34839 4290 2108
NM_005160chr2296391 5512 5136 4627 2541 2435 2323 1868 1279 26363 5328 36242 4141 1647 22041 319
NM_005188chr1198137 7994 7482 7310 6957 5828 3047 1194 1056 --38173 6326 1869 25887 5857
NM_005235chr2197757 7646 7455 7209 6123 5711 3045 2864 2747 2348 2266 2223 2125 2018 1848 1642 1482 484 246 --1569 1940
NM_005504chr12106541 6144 5998 5283 5160 4828 4239 4182 1849 36 26296 1487 --12310
NM_005746chr762684 1930 1798 1739 841 614 ----12106
NM_005759chr2104573 4034 3232 3067 1186 900 334 100 93 34 --23736 980 11486
NM_005840chrX147592 7538 7239 7223 6800 6435 5943 5681 3040 2432 1285 1061 969 450 26655 5880 1974 17469
NM_005901chr18158068 7508 7039 6979 6824 6801 6722 6447 5846 3223 2967 2388 1910 1099 897 17746 22143 2042 --
NM_005955chr185414 5387 5049 4407 3682 3412 1969 1838 --11462 14393
NM_006252chr1107137 6456 6196 5844 5296 4592 2820 2452 1691 1523 11937 27031 7005 15802
NM_006534chr2063289 3235 2779 2687 769 398 1959 12316 33046 1326 736
NM_006599chr16137775 7242 6293 6189 5919 5895 5844 5718 5167 3213 2994 2361 990 --15701 --
NM_006731chr9105582 5462 5355 4720 3634 1538 728 635 409 391 ----23539 1515
NM_006750chr16118008 7770 7125 6729 5266 2828 2073 1886 1541 1309 953 23015 1049 45370 3033 1447 291 15249
NM_006827chr1493249 2951 2619 2610 2101 1078 958 881 855 1868 ----
NM_007195chr1891291 1001 960 601 411 382 266 247 37 --21122 135 --
NM_007203chr962779 2710 2664 1027 507 418 --32465 2460 1117 23658 1201
NM_007231chrX52175 1745 999 836 87 --32236 332 52 12018
NM_007249chr13138848 8561 8371 7996 7350 6718 6258 3715 3610 2447 1373 1317 777 48740 7701 6000 5973 16578 27801 2230
NM_012141chr13124156 3892 3785 3766 3670 3646 3442 3282 2897 1169 1117 478 12693 11294 13714
NM_012164chr9137254 6778 6745 5683 5625 4979 4670 4631 4606 3013 3001 1863 1122 --16534 11619
NM_013255chr7158861 7673 7301 6799 6574 5795 5777 3216 2950 2789 2317 1684 1391 1361 1113 11522 ----
NM_013269chr1274129 3865 3605 3569 3265 3218 1504 14154 12884 22880 1105
NM_013989chr1485157 4999 4954 3117 2048 854 629 603 23128 1761 34032 3413 1301 11616
NM_014048chr1684830 4490 3868 2045 1759 883 307 274 --23751 126 11013
NM_014155chr11147583 6347 6047 5621 5272 4753 4622 2999 2751 2610 1925 1678 953 272 1677 56187 5864 2634 2512 1267 --
NM_014423chr595458 4982 4409 4137 900 591 475 106 99 24363 1758 ----
NM_014586chr2184533 4455 4380 4283 4173 3514 3487 1367 --34768 3430 1398 34764 3775 1639
NM_014721chr6217214 7177 7020 6423 6222 6194 5987 5328 5173 5066 4671 4533 2913 2506 2440 1815 1034 815 800 558 224 ------
NM_014873chr1124703 4414 4232 4070 3873 3815 3474 1929 1643 1327 549 87 13308 13798 13140
NM_014877chr17116987 6741 6701 6694 5782 4782 2991 2725 1670 225 29 ----25145 618
NM_014898chr1962115 1684 762 639 461 140 2756 580 --1994
NM_014912chr10123565 3334 1415 1404 1118 1079 1059 743 582 529 523 460 32585 794 36 22540 213 1823
NM_014923chr1352364 1638 553 391 178 1397 11531 1306
NM_015039chr194237 3949 3831 3338 3096 1692 862 845 229 12871 14340 13901
NM_015049chr263324 3228 1180 845 812 202 32899 141 133 12138 150
NM_015071chr5105608 5391 4361 4065 2257 2013 930 882 817 284 --13950 26353 2538
NM_015310chr8188230 8076 7488 6903 6388 6144 6080 5951 5880 2881 2323 2200 2162 2012 1594 1356 1119 256 1893 22234 1901 13251
NM_015569chr1114643 4238 4166 3886 3879 3321 3175 1375 835 550 85 11781 11057 14764
NM_015852chr7153212 2740 2636 1238 1157 1073 989 905 821 569 485 401 317 233 65 --11404 --
NM_015879chr18168392 8062 7954 7463 7384 6545 6501 5279 3380 2856 2822 1004 946 811 87 61 11373 38098 8022 2508 174
NM_015906chr183468 1823 1788 1523 1331 807 334 97 13330 --21638 1074
NM_016009chr1134366 4339 3943 3620 1891 1767 1193 848 807 608 445 396 203 14404 ----
NM_016206chr3167849 7512 7337 7132 6984 6682 5780 5608 5540 3615 3396 2852 2164 1952 794 369 16578 ----
NM_016260chr2147532 6407 6191 5043 5018 4778 4640 2067 1385 1296 791 766 444 210 11125 ----
NM_016485chr692186 1599 1448 835 816 723 628 424 306 11613 --1799
NM_016531chr4124169 3774 3533 2909 2732 1684 1621 998 959 355 347 213 ----11603
NM_017637chr9158533 8175 7681 6931 6497 5817 3692 3378 2564 1922 1886 1242 1229 355 264 27259 1495 --13728
NM_017650chr7115785 5679 4944 4557 3936 3829 1719 1428 1113 682 166 --24411 4158 12121
NM_018299chr883302 3105 2599 2576 2539 2173 765 456 --13135 12328
NM_018362chr1143628 3294 2839 1027 ----33986 1420 972
NM_018364chr1133977 3405 3267 3090 2864 2781 1240 1168 1041 853 713 667 296 ------
NM_018440chr8128425 7988 7840 7789 6619 5511 3316 2541 2086 1846 1600 1336 16807 26689 5850 12618
NM_018566chr1145155 4884 4760 4749 4479 4350 4017 3520 3380 1989 772 760 697 96 --24704 242 --
NM_020432chr772181 2091 1883 1832 394 46 40 ----11930
NM_020466chr664986 4300 3036 1709 1670 1491 1980 2935 622 14466
NM_020673chr20177728 7300 7268 6773 6767 6688 6089 5661 5162 4704 4695 3021 2357 1742 730 575 296 11629 27008 453 --
NM_020718chr16136318 5981 5596 5413 5297 5198 4634 2395 1647 1426 786 760 248 12312 15581 --
NM_020727chr21134027 3912 3884 3842 3037 2844 2797 2632 1333 1294 441 344 97 12925 13018 --
NM_020772chr17135890 5711 5647 3316 3216 3029 2564 707 674 534 465 262 124 18324 27580 6016 11686
NM_020774chr18145812 5434 5231 4334 4195 3785 2083 598 590 573 503 274 234 121 12186 ----
NM_020935chr281003 969 949 719 487 360 252 159 1328 --24171 3002
NM_021911chr5125527 4798 4182 4093 3917 3497 1971 1877 1782 1614 1118 295 ----22096 751
NM_021964chr3126583 6029 5967 5020 4043 2620 2224 1815 1676 1432 526 132 14400 12096 --
NM_022121chr641115 1092 904 286 ----2780 378
NM_022456chr12157149 7108 7001 5843 2991 2416 2035 1820 1745 1586 1501 952 762 408 333 --27065 442 --
NM_022977chrX31780 118 90 1334 11829 22318 622
NM_024345chr9125694 5419 5388 5298 4662 4481 3956 3866 3744 3709 968 791 12195 16129 11954
NM_024770chr2135918 5903 5261 4311 2631 2571 2535 2410 2353 1541 1389 1010 765 26692 4751 ----
NM_024947chr3209502 8008 7876 6977 6285 6098 5991 5906 3693 3193 3027 2704 2440 1898 1754 1280 928 441 106 84 23180 2238 ----
NM_024949chr4104654 4422 2012 1767 1477 1111 657 651 639 393 21432 299 14671 --
NM_025054chr874008 3607 3262 2680 2616 1223 29 --12701 21520 565
NM_025073chr194755 4444 3537 3415 3061 3037 1773 1537 1428 --23549 3023 --
NM_025160chr1113879 3467 3147 1476 1283 1219 860 800 443 431 325 24150 1609 33453 1510 1056 --
NM_030627chr5123584 3493 3236 3097 1565 1032 898 757 379 330 139 37 ------
NM_030648chr455007 4111 2071 1861 728 22246 36 55513 3733 2089 1888 507 --
NM_030777chr2082481 2327 2311 2304 776 384 277 168 ----12462
NM_031469chr674126 3931 3883 2983 1349 1162 1088 13730 --11621
NM_032012chr945171 4425 727 145 11920 13906 34025 4020 376
NM_032047chr342128 882 327 134 12262 --32023 2018 1704
NM_032105chr1138064 8002 7606 7504 7047 6779 5352 3027 2803 2664 1881 637 392 15400 22373 1335 --
NM_032373chr1085672 5487 5153 4743 4404 2227 1766 1069 --35460 5332 2162 --
NM_033020chr183468 1823 1788 1523 1331 807 334 97 13330 --21638 1074
NM_033224chr7187701 7668 7616 7048 6143 5861 5773 5045 4879 2784 2640 2613 2064 1918 1598 1455 622 306 42606 1346 752 324 25889 5267 --
NM_033505chr2176764 6531 6493 5898 5878 5004 4911 4736 4468 4199 2205 2111 1856 1644 442 410 225 12700 55919 5736 4599 4347 662 12522
NM_033656chr21125684 5341 5008 4965 4087 3983 3887 2015 1584 992 926 99 1539 --12236
NM_053016chr9106064 6034 5992 5425 4844 2498 2297 1984 1297 1100 1277 26640 6012 15339
NM_133493chr674371 2876 1539 394 281 203 77 23921 1493 23998 301 --
NM_133646chr2114748 4692 3726 3645 3515 2069 2034 1927 1811 1315 1304 15311 15197 --
NM_138459chr693419 2789 2505 2469 1157 1048 557 445 397 ----11392
NM_138468chr2116213 4602 4304 4196 2052 1010 868 754 684 527 306 --35419 1782 1550 --
NM_138713chr16137775 7242 6293 6189 5919 5895 5844 5718 5167 3213 2994 2361 990 --15701 --
NM_138714chr16137775 7242 6293 6189 5919 5895 5844 5718 5167 3213 2994 2361 990 --15701 --
NM_144571chr4116161 5890 5161 5103 4999 4624 1937 1284 791 501 346 --12073 --
NM_145259chr2196643 6222 6122 5455 5342 5176 5086 4769 4674 2575 2338 1996 1943 1737 1712 1284 1238 1113 787 12621 35810 4602 2095 --
NM_147150chr962779 2710 2664 1027 507 418 --32465 2460 1117 23658 1201
NM_148170chr1195610 4966 4797 4774 4114 3560 2001 1961 1561 34658 4081 1433 24250 1455 --
NM_152624chr5117231 7117 6739 6567 6362 5846 5318 4858 4634 2756 571 --12481 1148
NM_152754chr793380 2541 2483 2448 1210 929 729 702 449 13433 1527 11069
NM_152787chrX103664 3473 3269 2847 2628 1533 1519 499 260 127 ----12944
NM_153188chr595611 5530 5429 4759 1945 1131 725 325 125 --1425 13540
NM_153456chr13105219 5148 4343 2176 1938 1575 1355 1106 909 422 --44916 2371 1023 318 --
NM_170706chr194237 3949 3831 3338 3096 1692 862 845 229 12871 14340 13901
NM_172071chr1117226 7036 6927 6169 5324 5303 4699 2466 2320 1605 1185 36677 6530 996 11056 --
NM_173214chr16137775 7242 6293 6189 5919 5895 5844 5718 5167 3213 2994 2361 990 --15701 --
NM_173468chr4105716 5689 5624 4811 4553 4293 3882 2164 1409 888 34143 1170 990 44128 3919 2028 994 --
NM_173511chr293672 3397 3004 2912 2629 2445 1116 902 471 12556 12990 13769
NM_173536chr4134879 4817 4720 4240 3921 3895 3816 1891 1862 1293 705 317 121 ------
NM_173582chr11126121 6066 4722 4414 4180 2252 1945 1819 1067 859 527 513 --15543 --
NM_173642chr1159210 9200 8696 8222 7611 7463 7034 6911 5799 3516 3356 3288 3092 1660 527 29254 984 28374 7487 --
NM_173694chrX81858 605 526 509 391 300 273 114 3676 397 348 21994 558 --
NM_174911chr863730 3645 3562 2958 1050 878 13594 22654 2469 22536 2465
NM_175623chr12157149 7108 7001 5843 2991 2416 2035 1820 1745 1586 1501 952 762 408 333 --27065 442 --
NM_175624chr12157244 7203 7096 5938 3086 2511 2130 1915 1840 1681 1596 1047 857 503 428 --27160 537 --
NM_175625chr12157244 7203 7096 5938 3086 2511 2130 1915 1840 1681 1596 1047 857 503 428 --27160 537 --
NM_175861chr12144868 4563 4081 2128 2114 2072 2008 1797 1102 1090 528 421 234 30 ------
NM_178151chrX117243 6952 6896 5917 5039 2363 1602 1146 1081 421 30 16379 47426 2917 2117 461 1640
NM_178152chrX117243 6952 6896 5917 5039 2363 1602 1146 1081 421 30 16379 47426 2917 2117 461 1640
NM_178153chrX117243 6952 6896 5917 5039 2363 1602 1146 1081 421 30 16379 47426 2917 2117 461 1640
NM_181659chr2063289 3235 2779 2687 769 398 1959 12316 33046 1326 736
NM_181659chr2063289 3235 2779 2687 769 398 1959 12316 33046 1326 736
NM_181705chr5125801 5691 5578 4867 4838 4706 4473 1118 955 638 550 325 13708 1125 14603
NM_181706chr1172298 2090 2006 1954 1740 749 160 ----11800
NM_181787chr883846 3381 2468 877 776 549 400 87 --12860 11157
NM_182503chr6165607 5531 5120 4874 4225 3738 3438 1905 1820 1639 1398 877 858 836 659 328 --25346 1279 11856
NM_194247chr284137 3666 1603 1306 1116 891 599 358 --11202 1623
NM_194314chr195446 5039 4578 4228 3560 2230 2115 511 417 --25601 3554 --
NM_198401chr841752 1264 1187 636 11562 --21327 287
NM_198503chr182245 2088 1989 1658 1487 530 368 211 ----11868
NM_198581chr2147450 6871 6534 6208 6189 6019 5591 5262 4562 2986 2896 2478 2471 1812 15937 12854 --
NM_203406chr592869 2560 1994 1923 1171 794 476 364 131 11067 ----
NM_206855chr6126363 6036 5816 5736 5368 5000 4777 4489 3965 3905 989 785 ------
NM_206909chr8188230 8076 7488 6903 6388 6144 6080 5951 5880 2881 2323 2200 2162 2012 1594 1356 1119 256 1893 22234 1901 13251
NM_207361chr13115741 5351 5059 4519 4408 2514 1479 1048 1009 682 123 ----192
NM_213589chr2134448 4314 3490 3471 2090 1855 1814 1697 1530 1495 818 488 455 21984 446 ----