TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-26b-3p
miRNA Sequence: CCUGUUCUCCAUUACUUGGCUC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000084chrX86614 6103 5081 4978 2403 1186 238 35 25070 2007 16484 15513
NM_000125chr6113928 2995 2968 2677 2636 1154 1060 1025 981 405 191 --1747 --
NM_000208chr19164801 4495 4216 4204 4136 4058 3533 3276 1786 1546 1483 1441 1345 1001 915 406 --24177 3871 --
NM_000216chrX63608 3337 3315 2595 1461 958 --21005 237 --
NM_000217chr1295256 5116 4263 4157 2147 1399 1071 842 373 1516 ----
NM_000245chr772060 1982 1377 900 836 625 170 22124 1391 2400 380 --
NM_000332chr6196294 5973 5851 5837 5783 5576 5440 4901 4834 4807 2674 2270 1473 1289 948 778 706 599 266 --56339 5808 2290 2281 490 --
NM_000337chr5126599 6171 5902 5622 5331 5196 2468 2456 2320 1869 1361 85 25514 2504 15298 1942
NM_000368chr9114390 3986 3551 3519 3264 3203 1941 822 572 465 139 24525 1506 31179 158 49 23435 1434
NM_000461chr374037 3316 2925 809 494 418 339 --11333 14407
NM_000555chrX107243 7153 6952 5956 5917 2464 2057 1737 1146 1081 27614 6379 37426 2242 482 1640
NM_000618chr1295727 5085 4123 4003 3994 2182 829 677 83 12530 14247 14642
NM_000618chr1295727 5085 4123 4003 3994 2182 829 677 83 12530 14247 14642
NM_000719chr12116141 5593 4898 4651 2699 2513 2425 2371 1791 296 104 25493 2467 22278 2042 --
NM_000793chr1475157 4954 4150 3836 2048 854 130 --23413 1301 --
NM_000813chr5115527 4767 4093 3682 2222 2120 1920 1614 1027 542 94 14795 --1746
NM_000831chr154004 1567 1513 1493 732 24978 4267 45273 4996 4888 1331 12000
NM_000875chr15146293 5795 5488 5419 5246 5100 2663 2579 2280 1972 1890 990 921 277 --14488 15676
NM_000899chr1242704 783 751 236 1174 1767 13530
NM_000926chr11159480 8508 7603 7545 6935 6815 6778 6498 5755 3748 3579 3514 2491 2201 1514 23134 2349 17190 23498 1488
NM_000959chr183845 3527 3498 2761 915 868 335 36 11485 11020 --
NM_001001664chr263183 3097 2862 2717 1625 1285 --13407 1116
NM_001001665chr273060 2827 2420 1194 1055 916 460 ----22487 1096
NM_001001971chr1061277 985 379 317 190 141 ----11329
NM_001003407chr1094949 3570 3312 3157 1837 1681 1427 698 552 24603 2032 21769 774 --
NM_001003408chr1094949 3570 3312 3157 1837 1681 1427 698 552 24603 2032 21769 774 --
NM_001003652chr18158686 8216 8166 7749 7039 6979 6824 6801 6059 5846 2700 2683 2489 1936 1910 37848 5345 2385 26758 2042 --
NM_001003674chr1875986 5691 5040 4270 1504 1467 230 14455 46071 1664 1478 271 12544
NM_001003675chr1875986 5691 5040 4270 1504 1467 230 14455 46071 1664 1478 271 12544
NM_001004065chr983737 3588 2779 2761 765 585 353 279 --1380 11201
NM_001004317chr693983 3840 3648 3589 2905 1626 201 170 69 --1945 --
NM_001004419chr12104378 4076 3938 3678 3570 3435 1665 1219 923 528 --2720 477 --
NM_001005404chr1753934 3205 1373 505 440 33820 3385 268 31693 867 355 --
NM_001005473chr5106006 5992 5944 5163 4197 2482 1533 1448 1229 111 --16149 1984
NM_001007023chr1475157 4954 4150 3836 2048 854 130 --23413 1301 --
NM_001007094chr10103918 3731 3664 3459 3036 2888 1175 356 70 27 --13541 22860 696
NM_001007097chr9134580 4173 4159 3954 3854 3796 3616 3576 1022 829 767 449 197 34772 4425 1000 1428 13708
NM_001007559chr1862083 1985 1488 509 475 316 21971 235 21920 1590 --
NM_001008391chr11166 --1651 1224
NM_001008701chr1993051 3023 2364 2269 2234 2111 1975 497 476 21028 797 21112 1032 1490
NM_001009554chr484430 4371 3919 3698 3681 969 744 541 ----11695
NM_001009554chr484430 4371 3919 3698 3681 969 744 541 ----11695
NM_001009899chr356102 5274 2490 1944 1104 1999 46367 2532 2322 451 16320
NM_001010895chr982096 1581 1572 1471 1395 1282 823 144 ------
NM_001010986chrX41792 539 460 207 2610 331 1492 --
NM_001011513chr4103902 3565 3018 2919 1454 1400 1127 867 310 282 ------
NM_001011666chr7106171 6105 5874 5764 5226 4624 4402 4300 4104 4033 --25159 1901 16074
NM_001012755chrX115061 4881 4537 4498 4028 3542 3356 735 723 643 163 ------
NM_001014797chr10227650 7326 7247 6872 6673 6616 6537 6384 6299 6235 5796 5776 5764 5633 3137 3072 2564 2311 2074 1717 869 647 27130 5702 17470 16520
NM_001018111chr7123911 3819 3074 2930 2802 2778 2593 2565 2468 1465 863 382 11345 41117 1034 965 442 23518 3416
NM_001024847chr372353 2132 1898 1754 1748 302 179 ----2843 59
NM_001025076chr1076034 5757 4556 2146 1827 960 47 --11869 15085
NM_001025580chrX63399 3136 2882 1592 883 832 ----1854
NM_001031695chr22135115 4768 4449 3985 3490 1996 1859 1655 1350 1160 1087 146 30 23509 919 ----
NM_001033087chr2032973 2946 927 11996 --23285 623
NM_001033507chr141766 1550 1323 42 21954 760 21219 78 2386 253
NM_001037334chr1872004 1919 1904 1606 1504 733 120 ----21799 132
NM_001039577chr184103 3774 2744 1751 1228 900 391 45 --34402 3162 1602 1797
NM_001039585chr184102 3784 3755 3018 1172 1125 592 293 --21277 270 --
NM_001039618chr1155957 5733 3728 3682 916 --1266 25432 4467
NM_001039840chrX115839 5821 5354 5164 5151 4497 4099 3768 471 456 119 --25726 2100 --
NM_001040108chr1452817 2526 611 119 28 2161 59 23040 65 32944 2877 624
NM_001040284chr1664005 3900 2030 1990 1140 334 13659 44744 4563 4305 55 --
NM_001040441chr174964 4789 4180 3450 1243 448 148 --24988 4947 11312
NM_001042555chr12114487 4373 3713 3618 3102 3009 2912 1706 1687 1507 181 --21907 164 --
NM_001042599chr2177304 7209 6749 6679 5711 4894 3045 2817 2747 2348 2266 2125 2001 1667 1642 484 476 --36086 4830 2420 --
NM_001042603chr1275255 5218 5185 4305 1635 597 384 13685 24612 783 13298
NM_001044385chr233590 3206 703 ----33949 3190 1079
NM_001099678chr3136461 6303 6035 5810 5000 4469 4006 2265 1472 1161 768 739 405 --22431 298 --
NM_001100108chr1147809 7776 7602 7418 7289 6880 2310 1965 1913 972 859 429 261 230 47430 6946 6848 1941 26384 1136 --
NM_001106chr3189544 8802 8787 8775 8170 7709 7612 7379 7157 6707 6340 3613 2602 2405 2311 1023 702 452 36370 3510 671 16200 29260 3533
NM_001126chr131063 380 90 ----1679
NM_001167chrX95459 4950 4284 2373 1639 1421 724 596 240 --11558 --
NM_001198chr662356 1994 1632 686 640 602 ----1820
NM_001204chr2117302 6133 5405 5257 2988 2396 2172 1946 1050 871 701 16522 15268 1856
NM_001259chr785400 4243 2041 2020 1696 498 131 39 ----1885
NM_001269chr151062 939 234 215 198 1825 2736 53 2732 142
NM_001364chr1194243 3649 1798 1752 1377 883 701 48 36 1189 --14320
NM_001412chrX73436 3117 2971 2288 1484 1075 789 ----1804
NM_001650chr1873440 3158 3151 1191 1177 666 520 1172 33753 3601 3238 13961
NM_001695chr8104055 3415 3382 3352 3211 1188 700 516 435 410 14030 13661 1786
NM_001745chr511098 ----2327 205
NM_001759chr1294429 4137 4068 3804 3711 2118 332 309 240 --24324 1558 --
NM_001858chr653914 3467 1424 1368 1312 11529 --24412 3769
NM_001918chr1149315 9079 8209 7643 7553 7544 7467 7408 7280 5881 1887 1472 812 560 38201 7679 1850 28023 7598 37584 6051 2999
NM_001939chrX113860 3787 3776 3498 3491 3413 3161 3019 2987 2543 853 21286 311 22845 655 21246 554
NM_002015chr1383321 3234 2792 2777 2490 2036 776 539 23032 789 12410 --
NM_002025chrX88722 8599 8062 7758 7214 5816 1002 441 18709 25632 806 26044 2797
NM_002092chr444983 4740 3306 923 --43513 805 513 476 --
NM_002214chr7125668 5522 5512 5384 5142 4253 1828 1368 836 775 343 292 2534 477 1486 11130
NM_002223chr12133409 3391 2971 2462 1585 1564 1509 1339 1223 1216 1170 152 86 ------
NM_002247chr1042150 819 609 338 22267 1640 21644 712 --
NM_002264chr363985 3977 3848 1982 1808 1559 13722 21191 219 1721
NM_002270chr575611 5530 4370 1945 1773 1063 389 ----13540
NM_002313chr1094949 3570 3312 3157 1837 1681 1427 698 552 24603 2032 21769 774 --
NM_002481chr1137371 7044 6646 5974 5219 4861 4820 3142 2603 2312 1748 111 36 37253 5907 2103 45792 5659 2373 1202 1753
NM_002547chrX84233 4031 3659 3598 1549 1413 1228 683 22930 474 1107 --
NM_002581chr974547 3603 2209 2133 1137 545 536 1400 22234 1324 --
NM_002613chr16124956 4796 4604 4348 3864 3843 2052 1976 1803 687 182 38 2926 321 11225 1897
NM_002737chr17166411 6346 6253 6218 5769 5484 5407 4610 4580 2586 2528 2303 2219 1103 455 186 --1435 12540
NM_002760chrY135352 5285 4477 4351 4049 3826 3671 3641 1517 1196 338 292 236 15068 ----
NM_002886chr3145211 5105 4495 4449 4404 4373 3738 3447 1775 1749 1720 1363 1169 515 ----14560
NM_002959chr174163 3760 3341 2955 742 530 514 11570 1848 14250
NM_003012chr8112948 2881 2597 2126 2106 1954 1077 1036 963 255 58 --32137 1275 867 --
NM_003034chr12107641 7454 5960 5558 2126 1073 980 739 344 172 25743 1370 16812 16199
NM_003079chr1721011 874 ----2997 745
NM_003099chr15126168 5671 5636 5550 5442 4889 4697 4622 4051 2242 1912 435 --34164 1966 202 --
NM_003108chr297161 6392 2730 2498 2416 2185 2099 1650 994 26834 6062 16748 16726
NM_003161chr1772782 1420 1368 1311 970 409 121 ----13190
NM_003199chr1874987 4794 3501 2098 938 319 296 1604 12267 --
NM_003242chr372353 2132 1898 1754 1748 302 179 ----2843 59
NM_003262chr3104710 4391 4207 3880 2093 1291 867 659 360 164 23187 2048 --1952
NM_003292chr142229 1814 642 237 11994 21733 202 1886
NM_003298chr331880 1199 231 11782 54562 1814 1536 1444 344 23797 718
NM_003340chr4121 --1231 1538
NM_003410chrX63018 2993 2850 2564 1071 1008 --1583 11919
NM_003421chr10103918 3731 3664 3459 3036 2888 1175 356 70 27 --13541 22860 696
NM_003458chr384040 3512 3313 3141 3025 2840 2585 1089 1603 33416 3344 871 11191
NM_003489chr2172942 2352 1256 1123 1019 854 75 --12445 --
NM_003503chr151136 305 157 52 42 --193 --
NM_003574chr1885416 4979 4871 4331 4306 3907 2177 196 --13655 25302 852
NM_003583chr1273930 3405 2747 2648 1330 264 182 11110 2945 494 --
NM_003617chr154219 3074 1648 1558 370 1385 23773 3673 13959
NM_003749chr1332365 1813 1506 --12381 11621
NM_003759chr474124 3951 2997 1680 1178 806 552 22668 129 --24141 81
NM_003831chr183517 211 181 1600 11780 1347
NM_003872chr281943 1130 785 682 410 229 134 118 ----31074 400 140
NM_003966chr5117738 7445 7119 6005 5950 5016 4936 2770 1609 1484 1180 26188 678 26257 2365 13035
NM_003972chr1061369 490 460 452 296 117 ----1244
NM_003983chr16124433 4213 3534 2992 2946 1710 1459 1208 1005 859 521 226 13046 --1808
NM_003994chr1242704 783 751 236 1174 1767 13530
NM_004028chr1873440 3158 3151 1191 1177 666 520 1172 33753 3601 3238 13961
NM_004050chr1462048 1840 1738 1000 180 110 156 31869 722 49 22623 61
NM_004090chr1762756 2695 2666 2382 1285 1190 13366 --23278 955
NM_004094chr1462906 2885 2499 522 148 33 --32449 254 41 --
NM_004171chr11199376 9307 9185 8804 8786 8533 8486 7253 7134 6925 6106 3337 2907 2861 2644 1808 1141 780 673 26126 1196 48364 8050 3274 1579 29046 7543
NM_004290chr561239 889 861 273 239 129 ----11214
NM_004293chr993784 3760 3320 2739 2561 1495 1227 1029 450 11386 1930 --
NM_004338chr1875986 5691 5040 4270 1504 1467 230 14455 46071 1664 1478 271 12544
NM_004412chr1085979 5954 5657 4796 4290 1377 643 537 11252 --24891 4766
NM_004438chr283109 2536 2128 991 891 443 285 214 1771 12653 --
NM_004458chrX21914 809 ----32481 622 243
NM_004464chr484311 4190 4109 3803 2960 925 375 338 11179 ----
NM_004491chr19144114 3875 3544 3096 2939 2751 1747 1108 1001 955 683 574 422 351 33668 3076 91 13672 --
NM_004501chr173526 3203 2495 1537 1179 1154 367 12981 ----
NM_004586chrX85401 4622 4522 1187 795 630 603 378 24552 3486 15430 13563
NM_004612chr994740 3928 3797 3580 1806 1447 1144 608 552 32943 1207 97 --1224
NM_004726chrX105710 5599 5477 5181 4886 4277 3520 1475 318 115 --14637 --
NM_004744chr483692 3407 3356 3334 3113 1565 169 61 13015 12839 23273 1434
NM_004745chr886186 6147 5215 4968 4913 1144 383 255 46426 2436 1713 558 26214 1524 12544
NM_004748chr1562912 1204 1070 218 147 100 11575 11607 13154
NM_004776chr2053096 3031 2659 813 452 --22202 971 42511 2143 412 100
NM_004798chr2053558 1363 1196 875 487 12609 23345 1180 22614 1012
NM_004808chr1093321 2763 2122 2058 549 489 430 239 84 12960 12093 --
NM_004857chr1484808 4497 4408 3788 3608 3218 2926 569 11344 ----
NM_004863chr1445033 1781 1339 774 23218 1478 34740 4057 46 12066
NM_004904chr7106171 6105 5874 5764 5226 4624 4402 4300 4104 4033 --25159 1901 16074
NM_004956chr7133784 3751 3388 3332 3293 3205 2847 2818 1850 1667 1601 1377 1201 ------
NM_004992chrX228118 7666 7385 6742 6602 6325 6088 5606 5143 3351 2925 2681 1878 1465 1031 964 895 839 798 471 387 40 17305 41474 876 620 376 25227 2631
NM_004992chrX228118 7666 7385 6742 6602 6325 6088 5606 5143 3351 2925 2681 1878 1465 1031 964 895 839 798 471 387 40 17305 41474 876 620 376 25227 2631
NM_004999chr6103475 3417 3410 3334 3287 3281 2920 2766 1203 689 21559 117 12747 --
NM_005044chrX113874 3586 3323 3118 1406 1385 1322 1134 155 109 53 --24047 2871 --
NM_005054chr231354 656 280 1538 --11456
NM_005056chr1275499 5462 5429 4549 1879 841 628 13929 24856 1027 13542
NM_005121chr17103721 3714 3101 2344 877 827 636 379 351 34 13138 ----
NM_005151chr1872004 1919 1904 1606 1504 733 120 ----21799 132
NM_005156chr995063 4269 3964 3821 1912 1888 1745 1738 736 34834 4798 2161 14357 24290 2108
NM_005188chr11188137 7773 6510 6355 6230 5844 5828 5366 5212 3047 2485 1056 1024 844 596 303 283 175 25290 2693 28173 2888 25607 5235
NM_005235chr2177304 7209 6749 6679 5711 4894 3045 2817 2747 2348 2266 2125 2001 1667 1642 484 476 --36086 4830 2420 --
NM_005359chr1894739 4624 4465 4432 2014 1997 990 359 332 16326 ----
NM_005397chr7123911 3819 3074 2930 2802 2778 2593 2565 2468 1465 863 382 11345 41117 1034 965 442 23518 3416
NM_005433chr1862824 2368 1821 1732 712 665 22793 992 1275 --
NM_005475chr12113142 3113 2941 2912 2673 2319 2014 950 748 521 415 12511 22428 857 --
NM_005497chr1766023 2260 1541 1534 1026 288 ----1261
NM_005504chr12116144 5283 4966 4239 4211 4182 2585 2425 2346 2266 2227 160 1975 --
NM_005596chr9105925 5680 5369 4571 4423 4316 4100 2260 2029 31 14486 ----
NM_005637chr1862083 1985 1488 509 475 316 21971 235 21920 1590 --
NM_005668chr574473 4149 3316 3107 3079 1339 230 13347 ----
NM_005725chr141640 557 296 201 --11792 11972
NM_005746chr751836 1798 1739 841 614 ----12106
NM_005759chr264736 4676 3904 3067 1186 35 --1980 11486
NM_005819chr183513 3476 2728 2470 2438 2257 709 624 --11380 1519
NM_005901chr18158686 8216 8166 7749 7039 6979 6824 6801 6059 5846 2700 2683 2489 1936 1910 37848 5345 2385 26758 2042 --
NM_005902chr1594535 3806 3099 3075 3000 1771 1449 609 186 24411 270 44102 1746 655 274 --
NM_005907chr631699 1637 1129 1293 --11292
NM_005935chr495125 4742 4425 3810 2035 1971 574 129 89 --14049 1249
NM_005941chr863427 3366 3247 929 640 95 13193 43855 3828 3404 1623 --
NM_005955chr185387 5306 4407 3682 1838 821 526 42 24026 1730 11462 34393 1672 915
NM_005957chr164394 4232 3387 3304 1483 1231 13778 23033 984 21616 1580
NM_006197chr851724 1591 623 584 390 1179 21404 536 12016
NM_006252chr1106517 5978 5844 5477 5296 2452 2328 2169 1691 716 17330 15495 15802
NM_006306chrX44898 4328 1024 233 65495 5439 4224 1078 821 153 24835 3639 --
NM_006315chr493508 3199 2893 2796 1219 1083 1074 782 72 1111 13210 --
NM_006371chr384945 4832 4526 4267 1802 1360 1111 971 21535 1312 45086 4896 1475 1414 --
NM_006420chr2093374 2720 2432 2274 1363 1287 996 808 392 12285 1526 --
NM_006457chr4103902 3565 3018 2919 1454 1400 1127 867 310 282 ------
NM_006482chr1273930 3405 2747 2648 1330 264 182 11110 2945 494 --
NM_006534chr20103248 3235 3190 2659 872 770 434 398 371 154 1959 --11326
NM_006544chr1475917 5422 4727 4709 1537 1527 136 24326 1280 11946 14348
NM_006546chr17116392 5679 5043 4998 4682 4589 2652 2621 2167 1287 33 --11889 --
NM_006557chr981544 1412 1344 574 555 226 220 138 ------
NM_006561chr1076034 5757 4556 2146 1827 960 47 --11869 15085
NM_006599chr16128237 8122 7652 7242 6819 6294 6133 5167 1307 1051 623 149 ----12991
NM_006614chr353180 2991 2368 1325 993 22304 89 23524 763 --
NM_006626chr91559 --22213 905 21900 439
NM_006628chr15124520 4307 4127 3909 3348 2899 2849 1122 888 646 208 198 --23383 2837 13379
NM_006646chr1352784 2390 2073 976 826 ----2817 730
NM_006654chr12114487 4373 3713 3618 3102 3009 2912 1706 1687 1507 181 --21907 164 --
NM_006699chr1102490 1091 1085 1048 843 679 492 412 346 339 --22046 501 22669 217
NM_006720chr1094949 3570 3312 3157 1837 1681 1427 698 552 24603 2032 21769 774 --
NM_006729chrX85243 4939 3792 3586 2104 2059 1482 65 1953 --1391
NM_006731chr9115583 5462 5355 5276 4336 3795 1863 1495 728 571 409 ----13539
NM_006750chr16147770 7503 6935 5295 3209 3127 2548 2370 1886 1292 1250 1230 954 417 11684 36501 3033 1447 --
NM_006814chr2052655 2504 2023 1035 644 12074 11758 2769 336
NM_006902chr132443 2044 1306 22652 681 11333 23333 2065
NM_006930chr551462 1355 479 321 178 ----1352
NM_007007chr1243157 1937 1463 126 24063 133 1647 --
NM_007011chr1586541 5957 5082 4294 2569 2028 1080 325 --56400 2325 2087 845 366 11586
NM_007030chr5224607 3911 3902 3876 3841 3806 3771 3736 3727 3701 3692 3666 3657 3631 3421 3343 3240 2057 1933 1702 1124 1106 21538 1092 33929 1023 44 11543
NM_007038chr2196027 5375 5116 4731 4545 4402 2292 1397 68 --13882 --
NM_007039chr1462142 1979 1898 1840 755 621 --11952 --
NM_007050chr20167364 7244 7168 7091 6787 6496 5848 5456 5003 3173 2548 2508 2194 1354 1116 1046 36430 5986 1582 37372 7293 3166 --
NM_007137chrX135421 4752 4504 4477 4427 4121 2105 2017 1458 966 660 518 471 14984 23369 484 --
NM_007195chr1851001 411 346 266 247 --2661 135 --
NM_007203chr983737 3588 2779 2761 765 585 353 279 --1380 11201
NM_007231chrX32175 836 87 --2332 52 12018
NM_007249chr13159398 8727 7996 7289 6041 3611 3409 2971 2589 2283 1940 1552 777 458 367 48740 6000 2850 705 1131 28408 2230
NM_007350chr1294360 3377 3280 3264 3174 2828 1329 926 434 ----11380
NM_012096chr332513 1079 394 12626 1735 1524
NM_012120chr633011 2262 685 22579 393 12447 12021
NM_012164chr9157302 7254 7151 6745 6614 5684 5625 5470 5169 4937 4737 4606 2030 1779 980 12532 1737 11981
NM_012252chr774868 4767 3589 1593 1501 1428 713 1973 1934 --
NM_012262chr1115248 5059 4854 4058 3935 3581 1967 1917 1843 1608 700 ------
NM_012309chr1184929 4097 1940 1632 993 897 854 469 --2965 861 11278
NM_012347chr682478 2333 2071 2060 998 889 192 61 1343 2938 691 --
NM_012382chr574453 4238 2781 1555 1448 311 94 ------
NM_013231chr14114021 3762 3662 3489 3451 1493 1320 857 361 305 50 --23671 1550 --
NM_013255chr797351 6574 5913 5795 5777 2950 1772 1684 1361 17158 1533 --
NM_013261chr493284 3234 3047 2659 2635 1338 1208 156 52 --13492 --
NM_013269chr12104305 4003 3865 3605 3497 3362 1592 1146 850 455 --2647 404 --
NM_013372chr1583395 3124 3048 2720 2497 739 633 221 1798 ----
NM_013374chr393116 2970 2934 2839 1093 1074 916 643 598 1994 22905 482 --
NM_013381chr1262381 1783 1659 1571 887 342 --1789 --
NM_013943chr163270 3218 2376 2089 1254 46 13185 12003 184
NM_013989chr1475157 4954 4150 3836 2048 854 130 --23413 1301 --
NM_014043chr341541 562 194 126 ----11209
NM_014141chr753389 1946 1802 1745 369 --24960 3249 14540
NM_014155chr1176463 2610 2574 1967 1911 61 25 1948 44859 2512 205 194 16300
NM_014309chr22125105 4758 4439 3975 3480 1986 1849 1645 1340 1150 1077 136 23499 909 ----
NM_014335chr1561440 1419 923 424 341 232 --1146 1132
NM_014381chr1452817 2526 611 119 28 2161 59 23040 65 32944 2877 624
NM_014388chr165414 5406 4928 4815 4448 1850 --14064 25482 3996
NM_014421chr452069 1892 427 268 122 1166 --1857
NM_014423chr5134409 4006 3951 3876 3820 2028 2010 1269 900 820 772 502 107 ------
NM_014586chr21104380 3919 3853 3718 1271 1099 989 933 812 412 33900 1634 50 24768 1893 13775
NM_014615chr1683484 3013 2563 2405 2245 2207 1440 993 --21340 1329 --
NM_014635chr231322 620 244 1500 --11428
NM_014636chr9113368 2969 2699 1721 1522 1322 1208 393 382 343 294 --22824 70 --
NM_014721chr6117054 6194 5260 5173 4554 2913 2506 2165 1142 1107 558 1291 --12529
NM_014739chr684218 4020 3994 2588 1647 1446 897 675 1396 13809 131
NM_014747chr174905 4793 4787 4306 4282 1885 1504 21919 1512 64645 4182 2262 2191 1558 1516 13534
NM_014766chr773432 3067 3006 2674 2552 1441 1084 11407 13094 32926 2820 2466
NM_014873chr1104361 4161 4047 3642 2989 982 549 407 210 87 ------
NM_014877chr1787667 6741 6694 5525 5203 2991 1054 225 ----12898
NM_014921chr1993051 3023 2364 2269 2234 2111 1975 497 476 21028 797 21112 1032 1490
NM_014923chr1332364 1480 708 1397 --1642
NM_014934chr13103722 3521 3382 3199 3152 2842 2633 1245 664 136 --11469 31463 1430 1423
NM_014935chr173204 1526 1488 802 655 387 353 13224 2679 469 23131 2620
NM_014953chr13113227 3127 2986 1730 1280 682 409 390 211 146 63 44069 817 312 194 24027 253 --
NM_014982chr14125320 5265 4908 4813 4255 3607 1430 906 739 602 396 69 24013 503 --1429
NM_014991chr451262 974 855 211 198 --22732 724 --
NM_015000chr1283112 3004 2102 1951 955 817 509 478 21107 254 ----
NM_015020chr1693878 3397 3186 2939 2920 1509 1462 877 799 ----11352
NM_015026chr12114168 3667 3608 3541 3418 3313 3234 1822 1491 195 78 14232 14014 --
NM_015035chr2096652 6236 5951 5785 5191 4903 4101 1683 1131 25614 2515 24828 4763 11945
NM_015039chr193950 3938 3831 3447 3200 1075 862 845 601 1188 44340 3291 3012 2746 --
NM_015051chr992924 2516 2482 2178 913 906 747 729 596 --22773 2106 23356 1098
NM_015071chr585640 5520 2541 1984 634 364 284 228 --15096 26353 4400
NM_015090chr1116251 5333 4148 4100 4020 2042 1227 1171 823 518 449 12212 11430 14926
NM_015111chr5113953 3420 3412 1205 940 714 658 416 385 367 186 1561 --13338
NM_015144chr1673963 2872 2729 2532 1507 293 23 13172 21553 561 --
NM_015187chr41218 ----3870 732 388
NM_015192chr2073034 2870 2187 2156 968 879 420 --22597 304 --
NM_015205chr1375263 3341 3269 1594 1054 810 28 34284 1819 965 34004 1827 1740 --
NM_015245chr652396 2389 620 263 174 1492 32093 845 376 12764
NM_015271chr474071 3218 3159 1502 1099 921 262 ----23789 939
NM_015282chr243068 2373 1209 851 --22733 540 22385 232
NM_015291chr183487 3406 2823 2522 1359 1303 670 58 23169 93 ----
NM_015310chr8138076 8038 7765 7190 6904 6799 6388 6173 6138 5097 2482 1595 1356 26410 893 27650 7199 --
NM_015345chr642788 2191 2045 475 1514 31889 566 333 1611
NM_015365chrX63399 3136 2882 1592 883 832 ----1854
NM_015455chr593873 2953 2495 1202 1112 782 673 313 278 --121 1770
NM_015569chr164256 4166 3886 3717 1359 550 --11227 21515 1101
NM_015713chr891187 1141 1069 966 833 624 601 578 240 --1817 --
NM_015879chr18157638 7463 6830 6720 6639 6321 6311 6002 3387 1759 1411 1194 1004 946 61 --38098 8022 2508 38480 179 74
NM_015995chr15104783 4723 3518 3378 1853 1677 1068 351 284 21 31370 434 364 1368 11538
NM_016009chr194583 4196 4019 3620 1891 823 700 629 396 --13666 --
NM_016173chr393931 3766 3178 3105 3035 1696 1387 1250 147 --44304 3829 3740 461 13558
NM_016206chr3108451 8010 7337 5733 5608 3615 2755 1064 794 92 16578 18029 --
NM_016224chr661625 1594 1547 1459 795 441 1669 ----
NM_016260chr2107554 6693 6360 5336 4691 2616 1177 791 767 492 12571 1259 11674
NM_016297chr253653 2812 1150 475 60 22638 73 --21424 1166
NM_016507chr1772142 2093 1177 1045 710 258 218 12713 2468 339 --
NM_016531chr473859 3835 3821 3774 1392 295 287 44214 3901 2980 740 ----
NM_016617chr1351600 491 326 316 38 2807 476 ----
NM_016621chr1151657 777 567 555 360 11075 34587 639 384 31851 1511 50
NM_016953chr2156049 5395 5387 5186 3943 2445 1385 1134 1045 1005 340 332 302 182 170 15081 12015 2823 818
NM_017540chr573057 2534 2045 1985 521 320 199 2923 229 33261 3198 760 12710
NM_017633chr673253 3075 2493 1361 1345 1109 581 13894 22937 2744 23694 1264
NM_017637chr9139166 8885 8307 6931 6523 6391 5892 3210 3081 2926 2564 1271 355 12493 17240 17613
NM_017650chr7115742 5679 5437 1458 1428 1416 941 888 525 427 336 --14411 14737
NM_017719chr331720 1696 793 --32388 525 44 21673 519
NM_017754chr694378 4328 3481 3055 1631 1516 548 493 181 11225 24807 4195 168
NM_017847chr171742 1642 716 683 670 337 38 ------
NM_017944chr1162640 714 621 613 600 286 --22847 2660 --
NM_018036chr1484461 4386 4314 3517 1099 1052 512 111 13733 1692 --
NM_018085chr1188170 8058 7947 7874 7813 7637 7534 7200 7148 7006 6576 5540 2913 1896 1585 500 198 191 17546 68029 7219 6962 6181 886 511 12582
NM_018105chr861246 1185 1017 813 449 119 --1330 --
NM_018243chr453732 3642 1486 389 181 34035 3434 307 11150 --
NM_018263chr262355 1906 1009 892 471 177 22639 2299 22533 1653 --
NM_018302chr4102493 1750 1543 880 761 491 384 337 280 217 ----1584
NM_018361chr8104041 3999 3820 3734 2738 1598 1350 1304 965 680 ------
NM_018364chr184079 3977 3285 2781 1041 853 713 667 12710 ----
NM_018373chr14125733 4757 4461 4355 1951 1548 1131 895 664 649 475 220 --12091 --
NM_018374chr785101 5018 3724 3527 3392 3191 864 427 --13326 --
NM_018440chr8138425 8137 7612 6926 6619 6405 5640 3245 2541 2086 1846 1414 221 17602 --26848 2618
NM_018452chr6_random52890 1440 1118 943 99 22547 1487 --12552
NM_018490chr1161813 1425 1281 1163 449 270 --2347 168 --
NM_018566chr1134951 4884 4783 4760 4017 3561 1989 1680 1643 987 785 773 89 --24704 242 --
NM_019022chr1882815 2568 2383 927 318 210 186 98 --22956 783 1249
NM_019072chr552923 2770 2662 460 158 1575 13831 14012
NM_019084chr1092409 2336 2206 2174 2111 1912 1763 998 842 1296 ----
NM_020133chr6186329 6291 6271 6208 5987 5945 5615 5184 5088 4989 4758 4731 2447 2022 1517 1365 1200 1093 26305 6149 --1655
NM_020205chr162663 2565 2401 1311 951 69 13067 2783 172 1901
NM_020336chr2063386 2921 2357 1192 963 429 1677 42818 2616 2344 59 1131
NM_020341chr2081862 1740 347 121 77 60 47 39 ------
NM_020390chr364437 4042 4001 3242 2990 1641 --14271 13498
NM_020432chr782181 2128 2091 1832 1680 595 480 40 ----11483
NM_020466chr684824 4600 4516 4354 3297 3036 1491 123 11975 31648 935 145 14466
NM_020673chr20147032 6935 6773 6767 6689 6089 5943 4704 3021 2965 1572 1064 472 258 26645 2793 17008 --
NM_020718chr1696429 5981 5414 5348 5198 4387 1647 1426 414 --1871 --
NM_020727chr2193777 2844 2797 1294 1225 1085 889 220 97 ----11042
NM_020734chr1283059 2999 2583 2577 2309 974 656 295 --22511 211 --
NM_020739chr1562912 1204 1070 218 147 100 11575 11607 13154
NM_020772chr1798044 7729 5876 2885 1256 1193 805 708 262 --18434 --
NM_020774chr1895812 5231 3898 2083 1778 1493 1207 640 148 12186 11668 --
NM_020802chr1183036 2520 2083 520 294 244 203 141 --1159 --
NM_020810chr14113491 3037 2990 2565 2541 2435 1379 1083 961 628 525 --33345 1358 411 --
NM_020844chr8117532 7180 6679 6662 6208 5990 5443 5190 2887 2326 1249 11442 47582 2651 753 424 --
NM_020917chr1983954 2936 2564 1568 896 185 116 39 --33679 813 699 --
NM_021120chrX123008 2978 2898 2889 2694 2165 1286 1243 1195 456 361 90 2882 33 32602 2555 2550 --
NM_021163chr7103138 3126 2770 2481 1386 1119 1045 861 630 100 --22355 481 --
NM_021191chr122984 662 ----2474 248
NM_021252chr1072043 2034 1835 1520 767 760 452 ----1405
NM_021629chr384428 3772 3516 3446 3094 1650 1604 521 1624 --1290
NM_021647chr484430 4371 3919 3698 3681 969 744 541 ----11695
NM_021813chr6105437 4747 4295 4258 3761 1908 1863 1416 171 101 23960 1947 21745 1482 14519
NM_021911chr5115527 4767 4093 3682 2222 2120 1920 1614 1027 542 94 14795 --1746
NM_021914chr1472458 1931 859 784 315 306 67 ------
NM_021949chrX62159 1119 551 410 179 134 22206 2068 1522 12879
NM_021961chr11156764 5892 5740 5603 5496 5145 2941 2361 2334 1953 1646 1628 1497 709 359 15346 22324 1575 12564
NM_021964chr396432 5967 5734 5231 1676 923 839 132 99 --14420 143
NM_022048chr1581525 1084 1037 892 877 704 616 212 --25153 1289 25088 2029
NM_022114chr174611 3750 3337 2965 711 435 222 11268 14725 23682 1235
NM_022497chr363374 2818 2727 1227 861 398 --43159 1393 1375 949 13724
NM_022716chr122287 1150 22496 525 11177 13177
NM_022787chr182778 2123 1826 1713 1695 1113 798 391 ----11795
NM_022893chr232872 691 159 11260 --1576
NM_022977chrX21914 809 ----32481 622 243
NM_023016chr252181 2041 768 550 87 1283 --12252
NM_024512chr393558 3467 2672 2484 1153 1038 749 684 100 ----12424
NM_024524chr352819 2605 1966 1103 591 ----12380
NM_024761chr9105045 3635 3517 3324 1998 1775 1729 1446 1221 108 14652 --11805
NM_024770chr2116523 6312 6274 5667 4950 2631 2535 2239 1010 994 765 14751 ----
NM_024884chr1473596 3192 3170 3115 1452 581 306 1248 44486 4375 1732 411 --
NM_024947chr3159502 9255 7221 6014 3849 3693 2788 2440 2104 1898 1578 1420 1070 623 84 --57815 3804 3165 821 659 --
NM_025054chr874051 3262 2726 2680 2616 1267 732 ----1565
NM_025065chr14692 293 75 36 ----1813
NM_025160chr173147 3059 2811 1219 905 839 204 34150 1609 100 ----
NM_025179chr1134933 4159 3842 3466 3181 1743 1700 1649 1402 1192 286 224 74 14101 13755 14613
NM_030627chr582772 1414 898 607 580 570 379 37 ------
NM_030647chr786151 6013 5888 5763 4349 1512 111 90 22426 1204 1914 1127
NM_030777chr2072465 2327 2311 1883 776 277 80 ------
NM_030806chr1139195 8978 8456 7815 7728 7427 7256 6928 3358 3032 2727 1767 96 29144 5929 15777 --
NM_030918chr1114928 4639 3892 3697 1502 1008 772 459 425 69 33 35126 3708 347 35060 3970 3426 --
NM_031268chr16124956 4796 4604 4348 3864 3843 2052 1976 1803 687 182 38 2926 321 11225 1897
NM_031427chr1475838 5740 4520 4510 396 323 48 14699 13783 15566
NM_031442chrX62477 2279 1225 1059 553 348 --32898 2138 2049 --
NM_031469chr674126 3203 2983 1428 1349 1338 1141 13730 13694 33494 1456 1251
NM_031844chr173526 3203 2495 1537 1179 1154 367 12981 ----
NM_032012chr945171 4333 4087 483 ----34025 4020 376
NM_032105chr1127504 7177 6779 6107 5352 4994 4953 2736 2445 1881 244 169 37386 6040 2236 45925 5792 2506 1335 1886
NM_032208chr273476 2426 1455 1445 833 642 54 --23235 2822 13086
NM_032228chr1183155 2897 2769 406 323 292 272 25 --21415 756 --
NM_032242chr372517 2428 802 398 238 62 50 --2995 42 13104
NM_032373chr1095672 5487 5256 4627 4266 1069 965 585 94 --12162 --
NM_032457chr493763 3371 3126 2438 1527 796 682 354 50 ----1449
NM_032505chr372616 2198 2009 1038 923 319 297 --1915 --
NM_032859chr1353405 3056 2651 2522 316 --23134 2422 11489
NM_032900chr1073761 2961 2953 2863 2837 2795 2505 33708 3237 1538 21341 1294 13076
NM_032968chrX64121 2922 1275 1139 647 127 12750 ----
NM_032969chrX64121 2922 1275 1139 647 127 12750 ----
NM_032973chrY74113 3713 2917 1275 1139 647 127 12745 ----
NM_033143chr494642 4521 4440 4134 3291 1256 706 669 196 11510 ----
NM_033224chr7117890 7872 7048 5339 5045 2653 2220 1918 1455 622 586 22606 324 25889 165 15942
NM_033480chr682478 2333 2071 2060 998 889 192 61 1343 2938 691 --
NM_033481chr682478 2333 2071 2060 998 889 192 61 1343 2938 691 --
NM_033505chr2116409 5898 5277 5004 4929 4468 4199 1644 1316 347 121 35240 601 222 15736 12522
NM_052885chr1263376 3140 1709 1171 186 133 23750 1320 154 --
NM_053016chr9107639 6855 6065 5054 4844 1323 1313 1297 1290 753 --16012 25339 2349
NM_053042chr472975 2879 2476 2439 2130 1187 843 23066 259 ----
NM_080676chr2032973 2946 927 11996 --23285 623
NM_080832chrX31403 268 235 ----1163
NM_080867chr1454683 4207 3359 1507 735 14387 11202 14156
NM_133170chr20167364 7244 7168 7091 6787 6496 5848 5456 5003 3173 2548 2508 2194 1354 1116 1046 36430 5986 1582 37372 7293 3166 --
NM_133445chr9123706 3356 3323 3086 3005 2718 2450 1017 734 636 485 411 12974 13096 33676 3261 496
NM_133493chr684524 4426 3741 1333 941 790 281 77 13921 24167 301 12873
NM_133646chr284882 3751 3727 2058 1486 830 803 663 15311 15197 --
NM_138286chr1994132 3524 3154 3109 2867 2838 1667 954 412 ------
NM_138423chr1521838 316 --1812 2372 367
NM_138444chr1354978 4253 3404 685 659 ----14705
NM_138459chr673370 2789 2545 2469 1396 1049 445 --23331 1217 1550
NM_138638chr1472458 1931 859 784 315 306 67 ------
NM_138713chr16128237 8122 7652 7242 6819 6294 6133 5167 1307 1051 623 149 ----12991
NM_138714chr16128237 8122 7652 7242 6819 6294 6133 5167 1307 1051 623 149 ----12991
NM_138959chr186705 5978 5939 5237 2598 2365 2284 1015 11319 12712 25372 5034
NM_139321chr20104155 3628 1638 1479 1256 1177 1152 1143 1036 956 23214 1135 13302 --
NM_144571chr476773 5277 5048 4999 4771 4605 1063 11281 24592 2073 --
NM_144599chr15195168 5152 4760 4674 4489 4415 4272 3997 3806 1893 1871 1813 1800 1541 1430 1418 1173 725 34 --12022 1165
NM_145176chr673460 2946 2706 1020 466 225 39 1302 22992 290 --
NM_145206chr1062564 2185 2135 927 921 341 12143 --11044
NM_145259chr2146464 6187 5455 2733 2695 2290 2002 1901 1409 1113 787 414 349 336 12621 12625 --
NM_145307chr1063438 1451 1085 567 306 71 13329 11134 21544 1130
NM_145808chr743139 944 401 277 --1865 22242 2237
NM_145912chr22104176 3899 3520 3326 3206 3075 1129 626 534 469 4733 666 609 563 21613 345 13132
NM_147150chr983737 3588 2779 2761 765 585 353 279 --1380 11201
NM_148955chr15126168 5671 5636 5550 5442 4889 4697 4622 4051 2242 1912 435 --34164 1966 202 --
NM_152352chr1842975 2501 2466 553 --1511 1507
NM_152388chr233590 3206 703 ----33949 3190 1079
NM_152622chr583376 3046 3029 2927 2729 1090 1078 603 --12781 --
NM_152624chr5117081 7038 6362 6166 5495 5318 4572 2108 1185 613 560 --16093 17025
NM_152682chr481680 1371 1119 658 651 390 265 29 --21229 1203 --
NM_152754chr783280 3241 2526 2483 1294 1210 908 194 2726 405 ----
NM_152756chr564194 3798 3593 2898 332 145 14121 --12717
NM_152774chr782706 2595 2179 2053 995 750 705 572 ------
NM_152793chr784918 4878 4565 4125 3674 3595 3530 104 23641 3223 11564 --
NM_152826chr15126168 5671 5636 5550 5442 4889 4697 4622 4051 2242 1912 435 --34164 1966 202 --
NM_152902chr152044 1954 1814 1282 291 --11650 21646 1562
NM_152924chr1586541 5957 5082 4294 2569 2028 1080 325 --56400 2325 2087 845 366 11586
NM_153188chr575611 5530 4370 1945 1773 1063 389 ----13540
NM_153365chr492707 2376 1768 1747 872 577 545 512 64 --31811 783 184 --
NM_153456chr13125763 5752 5295 5219 5139 4343 4106 1575 680 422 95 41 --42371 1023 698 318 --
NM_153712chr2133808 3586 3304 3233 3195 2849 2782 2659 1316 1215 987 399 287 2261 146 ----
NM_153810chr10104879 4226 3612 1942 1701 1672 818 780 71 40 ----1340
NM_170706chr193950 3938 3831 3447 3200 1075 862 845 601 1188 44340 3291 3012 2746 --
NM_172069chr262310 1913 1814 1554 718 475 11756 1528 12183
NM_173214chr16128237 8122 7652 7242 6819 6294 6133 5167 1307 1051 623 149 ----12991
NM_173468chr495716 5641 5624 5594 4811 4553 1409 585 433 1990 33919 2028 1651 --
NM_173511chr233736 2562 1392 13722 23726 2990 13769
NM_173536chr4145170 5104 4879 4817 4720 4092 3838 1891 1751 1293 975 904 640 121 ------
NM_173582chr1196066 5781 5664 5407 4839 4510 2134 1819 1067 2730 45 --1554
NM_173642chr1169200 9111 8696 8210 7463 6582 3517 3288 2646 2516 2471 2059 1569 1349 1288 204 27608 2219 38374 7487 2223 --
NM_173654chr352206 2169 1815 1495 815 12275 11689 --
NM_173694chrX41858 605 526 273 2676 397 1558 --
NM_173829chr566001 5935 5539 5272 4253 2106 --14498 1768
NM_173851chr893316 3297 2969 2950 2766 2482 1320 1133 327 --21482 746 13279
NM_173854chr15940 714 513 450 286 32187 444 436 ----
NM_174911chr883562 3061 2421 1286 1050 879 578 192 21425 184 32745 2654 2594 12465
NM_175736chr12137579 7558 7307 7217 7007 6604 5567 4977 3127 1844 1467 1258 341 --56791 6307 5441 2918 1613 22018 604
NM_175861chr1284868 3846 2072 2008 1459 1090 1052 528 ----14933
NM_175907chr1862630 2078 1959 1880 957 134 --11026 12200
NM_176081chr1085979 5954 5657 4796 4290 1377 643 537 11252 --24891 4766
NM_176083chr1085979 5954 5657 4796 4290 1377 643 537 11252 --24891 4766
NM_176823chr1103614 3518 3182 3115 3044 3034 2996 1315 963 39 ----12869
NM_177398chr141766 1550 1323 42 21954 760 21219 78 2386 253
NM_177399chr141766 1550 1323 42 21954 760 21219 78 2386 253
NM_177974chr1521838 316 --1812 2372 367
NM_177990chr2081862 1740 347 121 77 60 47 39 ------
NM_178140chr542516 1869 531 425 22079 802 1746 1891
NM_178151chrX107243 7153 6952 5956 5917 2464 2057 1737 1146 1081 27614 6379 37426 2242 482 1640
NM_178152chrX107243 7153 6952 5956 5917 2464 2057 1737 1146 1081 27614 6379 37426 2242 482 1640
NM_178153chrX107243 7153 6952 5956 5917 2464 2057 1737 1146 1081 27614 6379 37426 2242 482 1640
NM_178505chr1093590 3577 3388 3023 2792 2417 975 449 108 1166 ----
NM_178578chr2052655 2504 2023 1035 644 12074 11758 2769 336
NM_178585chr451262 974 855 211 198 --22732 724 --
NM_178812chr881560 1503 1346 1003 261 244 238 193 ------
NM_181453chr231322 620 244 1500 --11428
NM_181481chr1875986 5691 5040 4270 1504 1467 230 14455 46071 1664 1478 271 12544
NM_181482chr1875986 5691 5040 4270 1504 1467 230 14455 46071 1664 1478 271 12544
NM_181483chr1875986 5691 5040 4270 1504 1467 230 14455 46071 1664 1478 271 12544
NM_181659chr20103248 3235 3190 2659 872 770 434 398 371 154 1959 --11326
NM_181659chr20103248 3235 3190 2659 872 770 434 398 371 154 1959 --11326
NM_181705chr555801 4706 3768 955 176 23708 1697 1125 --
NM_181706chr1162298 2090 2006 1826 1740 749 ----11800
NM_181886chr4121 --1231 1538
NM_181887chr4121 --1231 1538
NM_181888chr4121 --1231 1538
NM_181889chr4121 --1231 1538
NM_181890chr4121 --1231 1538
NM_181891chr4121 --1231 1538
NM_181893chr4121 --1231 1538
NM_182493chr1693871 3564 2156 1415 1380 1101 1036 874 186 --25414 480 --
NM_182503chr6105607 5258 1755 1609 1398 819 788 659 387 152 --15001 --
NM_182515chr1986209 6005 4807 2479 1333 1106 1050 264 ------
NM_182734chr2083281 3117 2434 2403 1215 1126 667 45 --22844 551 --
NM_182762chr794254 3873 2454 2416 2309 1969 1678 1165 604 11295 1696 12350
NM_182898chr7106171 6105 5874 5764 5226 4624 4402 4300 4104 4033 --25159 1901 16074
NM_182899chr7106171 6105 5874 5764 5226 4624 4402 4300 4104 4033 --25159 1901 16074
NM_182907chr662356 1994 1632 686 640 602 ----1820
NM_183398chr561239 889 861 273 239 129 ----11214
NM_183399chr561239 889 861 273 239 129 ----11214
NM_183400chr561239 889 861 273 239 129 ----11214
NM_183401chr561239 889 861 273 239 129 ----11214
NM_194247chr274137 3581 3119 1333 1116 1108 826 ----1623
NM_194282chr442560 2310 2187 405 --32339 873 629 12601
NM_194283chr553885 3865 3600 3524 736 1282 64012 3375 2707 979 570 524 --
NM_194286chr1265039 4756 4202 4183 2348 1845 24450 709 54161 1984 1467 1349 826 --
NM_194314chr165039 5019 4578 4374 3853 2115 --33554 873 121 --
NM_194434chr1885416 4979 4871 4331 4306 3907 2177 196 --13655 25302 852
NM_198215chr1061277 985 379 317 190 141 ----11329
NM_198270chrX63091 3066 2905 2252 1290 547 32476 817 65 --170
NM_198321chr573057 2534 2045 1985 521 320 199 2923 229 33261 3198 760 12710
NM_198900chr12137579 7558 7307 7217 7007 6604 5567 4977 3127 1844 1467 1258 341 --56791 6307 5441 2918 1613 22018 604
NM_198904chr551864 748 420 246 240 ----11711
NM_198935chr2073136 3045 2366 2323 353 336 318 ----1342
NM_198968chr13103722 3521 3382 3199 3152 2842 2633 1245 664 136 --11469 31463 1430 1423
NM_199003chr851530 1469 1301 1097 403 --3614 167 104 --
NM_199050chr21134009 3970 3629 3485 3194 1062 1024 875 823 772 660 525 191 13365 11257 --
NM_199324chr413505 --1712 22577 2484
NM_199421chr1454683 4207 3359 1507 735 14387 11202 14156
NM_199454chr174611 3750 3337 2965 711 435 222 11268 14725 23682 1235
NM_199461chr1083577 3494 3116 2987 2788 1138 676 398 13613 33595 3510 237 --
NM_201266chr281943 1130 785 682 410 229 134 118 ----31074 400 140
NM_201279chr281943 1130 785 682 410 229 134 118 ----31074 400 140
NM_203458chr163492 2395 1308 951 460 411 1535 11489 1999
NM_203463chr2124853 1905 1874 1446 1292 1170 1006 872 418 251 223 135 ------
NM_206854chr695398 4889 4878 4771 4465 3283 248 61 24 --11275 --
NM_206855chr6106363 5854 5843 5736 5430 4248 1213 1026 989 786 --12240 --
NM_206909chr8138076 8038 7765 7190 6904 6799 6388 6173 6138 5097 2482 1595 1356 26410 893 27650 7199 --
NM_207015chr342023 648 348 163 11630 --12073
NM_207361chr13155059 4662 4543 4519 4374 2514 2272 2050 1479 1093 1017 1009 682 182 123 11833 15388 11599
NM_207406chr486004 5962 5505 2138 1675 1306 1289 804 --16323 1551
NM_207411chr893473 3317 3041 2956 2920 2491 2484 563 127 11013 3708 592 384 --
NM_212558chr9114010 3940 3753 3078 2944 2775 1414 647 321 204 35 12721 ----
NM_213589chr2115221 4448 4314 3490 3471 2090 1855 1814 1785 1530 1322 1446 21512 621 11125
NM_213606chr1082543 2180 2117 2036 834 816 534 271 1683 ----