TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-26b-5p
miRNA Sequence: UUCAAGUAAUUCAGGAUAGGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000024chr56484 453 389 196 189 65 --1178 --
NM_000038chr551931 1747 1694 1518 295 --31945 760 150 --
NM_000052chrX23073 367 22508 360 2316 127 32794 2786 2773
NM_000084chrX116135 5933 5589 4952 2137 2131 1377 1295 672 268 93 24886 2676 14574 26267 4501
NM_000089chr74648 594 538 118 2214 38 --1510
NM_000090chr23657 604 140 ------
NM_000092chr284551 3866 3526 3394 2810 1818 1809 1095 11215 23830 3203 14395
NM_000093chr952239 1548 944 883 589 1399 ----
NM_000096chr32927 866 1709 ----
NM_000109chrX3828 661 632 --12517 12346
NM_000110chr111177 --1349 --
NM_000112chr574512 2061 1711 1683 1677 1644 1134 196 --14274
NM_000125chr673456 3154 2835 1031 651 337 149 23988 452 14283 22619 893
NM_000126chr152117 64 ------
NM_000151chr17188 ----31769 278 68
NM_000161chr1451897 1529 1411 1370 1310 ------
NM_000163chr522060 809 ------
NM_000165chr611397 ----21455 1172
NM_000167chrX3589 374 196 --1397 --
NM_000170chr9255 33 ------
NM_000176chr541468 1440 990 168 ----12408
NM_000183chr22348 335 ------
NM_000194chrX1181 ------
NM_000214chr2011195 11118 1632 31791 1255 424
NM_000217chr1235350 5319 3700 1119 23900 1126 --
NM_000232chr443183 2926 2071 42 13012 1884 1582
NM_000240chrX42167 658 366 203 ------
NM_000248chr342933 964 920 327 ------
NM_000252chrX41157 1123 577 91 1110 --11047
NM_000259chr1585727 5620 5467 4412 4396 4338 2206 2128 --1817 25569 5560
NM_000264chr942436 2343 380 292 --13024 176
NM_000267chr1763180 3071 2476 1351 644 555 --1584 --
NM_000278chr10----12027 --
NM_000280chr113895 681 260 1168 1740 --
NM_000286chr172816 159 --2956 626 --
NM_000297chr422073 1279 31750 1445 668 ----
NM_000314chr1042994 2460 1107 646 2854 47 --22626 1268
NM_000317chr11----1340 1279
NM_000319chr1211227 ------
NM_000321chr1331530 599 467 1174 ----
NM_000328chrX1347 ----152
NM_000332chr687064 7006 6931 6743 6588 5435 5076 2334 37128 6448 2267 --12070
NM_000337chr575163 4474 4241 2571 1759 1652 495 14002 35739 5322 139 --
NM_000345chr4--1685 ----
NM_000351chrX103727 3323 3143 2883 2712 1611 1517 1421 979 608 13329 ----
NM_000362chr2253509 2234 1123 661 338 33363 1184 121 ----
NM_000368chr974845 3957 3325 1399 854 737 590 23530 3095 --1750
NM_000389chr62453 102 ----11312
NM_000390chrX83062 2668 1305 983 946 787 613 496 22723 2317 163 2703 402
NM_000397chrX32445 2216 693 12439 --1918
NM_000408chr2113443 3398 3263 3242 2576 2391 1014 189 183 169 156 ------
NM_000434chr62517 424 ------
NM_000439chr542571 844 837 464 31774 1728 360 --11011
NM_000441chr732297 1813 1588 22289 2189 ----
NM_000446chr711049 11064 --1211
NM_000448chr1132849 1242 907 --33169 1293 183 13304
NM_000452chr1341957 1924 767 68 12040 ----
NM_000461chr384553 4305 4291 3175 1182 557 314 106 23613 540 --1175
NM_000489chrX43295 2969 2226 2168 ----11324
NM_000492chr7------11222
NM_000493chr63776 361 127 21070 724 ----
NM_000508chr42959 384 1390 1882 --
NM_000522chr731214 919 407 2899 33 ----
NM_000523chr23940 377 202 2294 73 ----
NM_000533chrX31675 1669 1281 11270 1117 --
NM_000555chrX117900 7222 7213 7041 6476 5645 4891 2752 2276 1201 310 57572 6606 6544 5431 1380 17338 27361 2091
NM_000594chr61515 ------
NM_000596chr72422 138 ------
NM_000599chr221704 1216 --1130 --
NM_000601chr71277 ------
NM_000609chr1052767 2538 2127 253 153 11969 11131 --
NM_000610chr1142759 2386 1217 234 42208 1862 395 255 ----
NM_000617chr1232302 1984 1467 ----1154
NM_000618chr1284910 4466 2251 1601 1589 1404 516 421 11863 11974 26445 2482
NM_000618chr1284910 4466 2251 1601 1589 1404 516 421 11863 11974 26445 2482
NM_000619chr12--1424 --126
NM_000633chr1833627 1874 879 ----11517
NM_000698chr101331 ------
NM_000702chr122158 663 ----22235 1404
NM_000719chr1285290 4352 4113 2224 1726 1067 363 34 15169 --24690 1580
NM_000724chr1021315 451 41778 1561 800 275 22032 794 1142
NM_000726chr231264 510 78 --1410 --
NM_000773chr10------1105
NM_000792chr131023 980 218 ------
NM_000793chr1453454 938 877 588 410 34191 1446 1434 ----
NM_000806chr521495 1366 1108 ----
NM_000807chr4--1522 --1688
NM_000809chr4138832 8121 7642 6534 6400 6048 3532 3136 2211 1940 1121 1097 939 22389 620 23511 1459 48006 7297 1045 313
NM_000813chr565146 4959 3712 1710 1361 538 25089 74 1599 1450
NM_000814chr1533164 1388 1011 23603 777 24154 2841 --
NM_000817chr2--11264 ----
NM_000826chr431669 1626 487 22068 833 2825 815 --
NM_000828chrX22017 1530 ----1235
NM_000829chr1122342 584 11470 ----
NM_000844chr32795 789 ------
NM_000855chr111348 ------
NM_000866chr311781 31188 713 560 --11231
NM_000868chrX1576 --41756 1721 1696 1049 --
NM_000872chr1011592 11555 11266 --
NM_000875chr1596525 6163 6109 5292 4714 4298 782 680 282 ------
NM_000880chr81139 ------
NM_000882chr31338 ----1414
NM_000891chr1732839 2311 510 32691 2321 272 23306 302 13153
NM_000899chr1233880 1580 265 14137 14013 13378
NM_000902chr362794 975 876 707 454 108 --11259 --
NM_000921chr122637 97 ----1533
NM_000925chr3145 ----138
NM_000935chr331117 1108 1006 21194 141 --1912
NM_000938chr41113 ------
NM_000944chr422423 117 ----1665
NM_000945chr241868 1827 1552 497 --2692 392 12101
NM_000950chrX63562 3508 2474 1357 634 497 ------
NM_000958chr531259 331 238 ----11198
NM_000959chr172928 2610 1425 1194 1106 903 325 33114 3105 1331 2608 317 --
NM_000962chr952825 2765 2370 486 43 13100 12049 --
NM_000963chr142373 2331 685 147 1546 --1264
NM_000983chr161427 1409 1294 160 152 48 21539 1115 ----
NM_001001323chr1243179 3166 3158 2912 --12076 11190
NM_001001344chrX32135 722 396 ----12436
NM_001001389chr1142759 2386 1217 234 42208 1862 395 255 ----
NM_001001390chr1142759 2386 1217 234 42208 1862 395 255 ----
NM_001001391chr1142759 2386 1217 234 42208 1862 395 255 ----
NM_001001392chr1132805 2432 280 42254 1908 441 301 ----
NM_001001394chr22628 533 ------
NM_001001395chr1262213 1933 1896 1025 262 239 --11079 22112 313
NM_001001396chr134274 3306 473 12934 ----
NM_001001419chr555071 5065 3364 1242 1157 21494 909 --34616 522 317
NM_001001420chr555071 5065 3364 1242 1157 21494 909 --34616 522 317
NM_001001433chr2052983 2902 2511 1055 811 12270 12490 11219
NM_001001436chr162833 248 --1351 --
NM_001001438chr211382 ------
NM_001001481chr893338 3115 2965 2643 2608 1212 1071 849 513 ------
NM_001001483chr111368 ------
NM_001001484chr1032453 2243 1814 12338 2950 322 --
NM_001001549chr742294 2095 2041 1150 ----1615
NM_001001550chr742294 2095 2041 1150 ----1615
NM_001001555chr742294 2095 2041 1150 ----1615
NM_001001556chr1521491 225 3581 329 269 11481 --
NM_001001664chr262977 2805 2766 1645 1136 138 13493 23448 1508 13470
NM_001001665chr253106 2327 989 323 62 23077 451 43097 2736 2220 638 12763
NM_001001790chr93374 182 124 ------
NM_001001872chr141201 ----1446
NM_001001890chr2153929 3796 3039 1187 527 ------
NM_001001938chr9103526 3377 3133 2773 2755 1547 1363 1262 819 375 23836 530 ----
NM_001001974chr1052264 2032 2024 789 721 11832 ----
NM_001001995chrX41858 1838 1475 774 ------
NM_001002233chr852070 1475 760 751 547 ------
NM_001002257chr283549 2927 2809 2541 2311 933 238 120 12704 ----
NM_001002269chr92421 47 ------
NM_001002838chrX2295 109 --31226 250 153 --
NM_001002843chr1521298 487 ------
NM_001002860chr1474133 4098 3935 1695 1289 1221 1032 14558 42876 1598 1570 1006 23167 1430
NM_001002909chr1731793 1696 867 1159 ----
NM_001002926chr752653 1780 961 676 369 12005 ----
NM_001003652chr18128716 8600 6666 6394 5418 3426 3279 2327 1871 1688 1589 120 26655 2132 27146 2464 1168
NM_001003674chr1897039 6682 6623 6157 5776 4981 4906 721 223 --25414 316 16788
NM_001003675chr1897039 6682 6623 6157 5776 4981 4906 721 223 --25414 316 16788
NM_001003681chr2252154 1985 1934 1728 299 1490 ----
NM_001003688chr421039 472 --1109 2943 53
NM_001003696chr211130 ------
NM_001003697chr211130 ------
NM_001003698chr621606 335 --1795 11387
NM_001003699chr621606 335 --1795 11387
NM_001003701chr211130 ------
NM_001003703chr211130 ------
NM_001003712chr1222645 654 33721 3306 865 23366 187 --
NM_001003792chr31996 1313 11263 --
NM_001003793chr31996 1313 11263 --
NM_001003800chr983469 3438 3142 2913 2433 1237 700 487 12469 1829 --
NM_001003803chr14--138 ----
NM_001004051chrX----1309 --
NM_001004065chr993470 3380 1542 1499 1469 1364 882 525 35 --13014 13449
NM_001004106chr51257 ------
NM_001004196chr331224 309 223 ----145
NM_001004317chr643978 3825 326 166 44333 4077 3432 1750 24518 3349 --
NM_001004330chr121487 2188 132 ----
NM_001004346chr441238 395 251 41 11285 150 --
NM_001004360chr212003 31911 1872 153 21982 1637 --
NM_001004419chr1274634 4410 3995 3814 3276 3095 1631 13441 --12820
NM_001004720chr2--1968 ----
NM_001004722chr2--11137 ----
NM_001005335chr19179 ------
NM_001005375chrY21338 734 1434 ----
NM_001005386chr252293 1867 1547 772 692 11663 ----
NM_001005404chr1784514 4440 4333 4314 3176 3127 2944 88 1481 ----
NM_001005473chr586626 4481 4458 2635 2486 1598 1462 203 21292 1191 21498 306 15116
NM_001005474chr351405 1368 1340 502 240 --1560 1583
NM_001005476chr2179 2526 514 ----
NM_001005502chr1264988 4027 3643 3170 1345 291 31750 1484 602 13756 --
NM_001005526chr21129 ------
NM_001005527chr351321 461 222 119 60 1352 11256 --
NM_001005746chr231264 510 78 --1410 --
NM_001005747chr231264 510 78 --1410 --
NM_001005781chr22556 239 ------
NM_001005782chr231005 761 688 1130 ----
NM_001006118chrY2266 202 ----1217
NM_001006120chrY2266 202 ----1217
NM_001006600chr521523 873 22469 467 ----
NM_001006605chr12940 920 ------
NM_001006605chr12940 920 ------
NM_001006610chr161950 ------
NM_001006617chr941353 343 233 207 ----11375
NM_001006618chr9------1212
NM_001006619chr941353 343 233 207 ----11375
NM_001006620chr941353 343 233 207 ----11375
NM_001006621chr941353 343 233 207 ----11375
NM_001006623chr21152 31825 1579 293 1818 12449
NM_001006684chrX1398 ------
NM_001006945chr12624 283 ------
NM_001007023chr1453454 938 877 588 410 34191 1446 1434 ----
NM_001007024chr1754342 4154 3797 3679 2946 ----11635
NM_001007025chr1754342 4154 3797 3679 2946 ----11635
NM_001007097chr995078 4292 3859 1754 1635 1303 885 588 42 11845 11709 --
NM_001007102chr631648 1564 556 11106 1176 --
NM_001007189chr5------1116
NM_001007237chr122839 197 42334 1020 486 123 ----
NM_001007245chr71214 ------
NM_001007257chr121311 999 1345 ----
NM_001007466chr695021 4899 4544 4172 2023 1697 1161 579 267 25177 1167 ----
NM_001007471chr91180 ------
NM_001007526chrY2266 202 ----1217
NM_001007553chr12942 262 ------
NM_001008239chr1853608 3564 2803 994 395 12655 1268 --
NM_001008272chr31275 ------
NM_001008273chr31275 ------
NM_001008388chr411035 1731 1128 --
NM_001008392chr353294 3286 2192 2183 285 23472 3084 12354 --
NM_001008393chr472923 2858 2078 836 708 323 194 32500 1988 629 32560 995 830 --
NM_001008408chr754876 4813 4098 4077 1850 26007 5321 45969 1560 1230 396 --
NM_001008495chr862033 1910 1805 1463 691 366 11966 12239 --
NM_001008539chr884249 3956 3739 3604 3416 1612 1601 278 --24391 823 1929
NM_001008541chr1042158 2135 1764 283 ----1132
NM_001008541chr1042158 2135 1764 283 ----1132
NM_001008564chr132905 215 2705 137 11515 --
NM_001008660chr1141471 541 339 317 ------
NM_001008738chr552971 2945 1128 975 440 22142 250 ----
NM_001008895chr1311194 ------
NM_001008925chr452977 2600 2387 393 209 13380 11079 11426
NM_001008938chr111155 ------
NM_001009552chr84581 570 555 184 ------
NM_001009880chr2254845 4633 4277 1722 1540 24119 3005 11184 --
NM_001009881chr12565 213 1588 --1616
NM_001009882chr12565 213 1588 --1616
NM_001009899chr3136499 6207 5905 5693 5593 4252 1619 1306 888 760 398 339 51 11690 1970 --
NM_001009909chr1143670 2904 625 70 13390 23289 741 --
NM_001009960chr74737 672 588 506 12843 --22185 1874
NM_001009993chr294011 3893 3634 3487 2824 1419 1334 921 634 ----13949
NM_001009994chr6191 ------
NM_001010853chr642303 2160 923 78 12592 1194 1495
NM_001010861chr131790 702 356 22536 438 12504 --
NM_001010888chrX44667 1659 1100 991 ----11166
NM_001010895chr922038 1670 11915 ----
NM_001010923chr631544 1298 113 ------
NM_001010927chr6----1551 --
NM_001010932chr71277 ------
NM_001010934chr72874 479 11075 ----
NM_001010980chr153511 3305 3069 2934 844 22855 466 13043 --
NM_001010984chr132318 2065 476 11703 1266 --
NM_001010986chrX32095 943 379 32146 2049 679 21559 53 2897 449
NM_001010989chr161379 ------
NM_001010990chr161379 ------
NM_001011513chr463918 3300 3231 821 518 162 33500 724 35 43063 2607 2562 1309 --
NM_001011515chr421057 244 ------
NM_001011516chr421057 244 ------
NM_001011537chr311750 --11686 155
NM_001011551chrX158 ------
NM_001011663chr103928 785 710 1162 ----
NM_001011666chr786402 6341 6305 6290 5431 4828 4124 257 66084 4601 4101 4030 2154 1832 11839 --
NM_001011705chr133278 247 233 ------
NM_001011708chr292868 2840 2447 2347 2193 2125 411 319 136 12471 1958 --
NM_001011713chr1451649 1448 1010 597 148 11421 ----
NM_001012393chr1195068 4679 4223 1652 1624 1590 1413 398 144 31319 646 171 --14200
NM_001012398chr161980 2986 442 ----
NM_001012420chr1552808 2231 2049 312 120 42601 2457 1136 95 ----
NM_001012421chr92857 803 ------
NM_001012423chr1562808 2231 2049 312 150 120 32601 2457 1136 ----
NM_001012425chr1--1100 ----
NM_001012478chr191603 ------
NM_001012512chr18----1108 --
NM_001012513chr18----1119 --
NM_001012751chr1011800 21777 1208 ----
NM_001012755chrX44773 3623 1892 705 34739 3658 3293 24004 414 --
NM_001012761chr542577 2392 513 306 1519 1665 --
NM_001012968chrX62743 2543 2276 871 607 467 --12317 1836
NM_001013406chr731734 1657 1255 1696 ----
NM_001013415chr421226 1081 ------
NM_001013620chr12118380 7112 6681 6248 5140 2433 2225 1830 1666 1652 785 37634 5646 1409 47079 5638 3245 1383 38268 7230 6710
NM_001013659chr1964817 3929 3841 1889 1222 938 55419 5007 4435 3721 389 34960 3694 1334 --
NM_001013717chr52931 433 1484 ----
NM_001014283chr1322155 1658 --1728 --
NM_001014380chr13105881 5404 5041 4980 4672 4445 4116 3994 2058 1506 14005 21388 1023 25760 630
NM_001014434chr14686 223 162 116 1702 1679 --
NM_001014797chr1078257 7030 5902 5373 5233 2786 95 ------
NM_001014812chr151169 ------
NM_001015045chr421659 503 12127 --12301
NM_001015048chr14----12898 --
NM_001015049chr14----12898 --
NM_001015877chrX22747 2600 --12359 12829
NM_001015882chr92288 209 --21008 121 --
NM_001017369chr411086 ----1970
NM_001017395chr322843 2392 22771 321 --1780
NM_001017405chr41225 1377 --1182
NM_001017415chr11784 2279 148 --1773
NM_001017416chr11784 2279 148 --1773
NM_001017440chr7117779 7005 6992 5356 5309 5176 5143 3311 2785 820 674 11650 ----
NM_001017523chr12--11339 ----
NM_001017922chr131751 1383 134 11580 ----
NM_001017923chr1431705 1575 1250 1486 2469 80 --
NM_001017926chr81684 11638 11797 --
NM_001017979chr4--1176 1617 1527
NM_001017992chr551557 1435 1285 1243 1226 ------
NM_001017995chr544806 3694 3577 1010 1772 24847 900 11798
NM_001017999chr13805 463 430 2413 405 ----
NM_001017999chr13805 463 430 2413 405 ----
NM_001018000chr13805 463 430 2413 405 ----
NM_001018000chr13805 463 430 2413 405 ----
NM_001018001chr13805 463 430 2413 405 ----
NM_001018064chr931938 1899 1827 ----11742
NM_001018067chr145301 3470 1203 288 24165 312 1747 23369 638
NM_001018068chr145301 3470 1203 288 24165 312 1747 23369 638
NM_001018069chr145301 3470 1203 288 24165 312 1747 23369 638
NM_001018072chr12--11339 ----
NM_001018074chr541468 1440 990 168 ----12408
NM_001018075chr541468 1440 990 168 ----12408
NM_001018076chr541468 1440 990 168 ----12408
NM_001018077chr541468 1440 990 168 ----12408
NM_001018090chr1572566 2381 2354 2106 2018 1918 843 ----32182 191 175
NM_001018091chr1572676 2491 2464 2216 2128 2028 953 ----32292 301 285
NM_001018102chr1572566 2381 2354 2106 2018 1918 843 ----32182 191 175
NM_001020658chr131455 1216 256 ------
NM_001020658chr131455 1216 256 ------
NM_001023567chr1562440 1770 1621 1612 150 120 195 ----
NM_001024024chr142951 364 ------
NM_001024070chr143947 420 360 ------
NM_001024071chr143919 392 332 ------
NM_001024094chr541468 1440 990 168 ----12408
NM_001024218chr14------1621
NM_001024226chr121128 1066 1446 ----
NM_001024227chr121128 1066 1446 ----
NM_001024228chr121128 1066 1446 ----
NM_001024380chr842229 2178 578 370 42043 1934 603 528 ----
NM_001024381chr842229 2178 578 370 42043 1934 603 528 ----
NM_001024647chr12187718 7291 6770 6663 6309 6144 5937 5559 5222 4833 4742 3072 2810 2785 2309 2258 1883 799 --86612 5306 3062 2897 2284 2160 2151 72 1494
NM_001024649chr562633 1138 758 739 647 177 --12946 --
NM_001024666chrX1629 ------
NM_001024680chr22289 275 --11728 11435
NM_001024847chr321013 475 11695 ----
NM_001024934chr63589 525 57 ----2536 489
NM_001024935chr63589 525 57 ----2536 489
NM_001024936chr63589 525 57 ----2536 489
NM_001024947chr52827 113 11099 ----
NM_001024948chr173352 2725 2589 2559 2176 290 142 2841 371 --12867
NM_001024956chr11105841 5827 5745 4967 4856 4778 4766 1958 1305 803 34834 1185 496 35021 4309 3571 --
NM_001025068chr321579 1145 11737 11635 --
NM_001025069chr321579 1145 11737 11635 --
NM_001025076chr1075935 4478 3951 1492 1147 666 160 24151 365 ----
NM_001025077chr10137293 5836 5309 4979 4748 4696 2850 2505 2024 1518 843 494 192 35509 1723 264 1754 --
NM_001025079chr373768 3310 3277 3058 2809 1539 746 33798 987 915 21426 1413 --
NM_001025108chr264043 2657 1396 1167 1058 452 34162 3818 3495 11496 13236
NM_001025252chr863238 2761 1254 1157 1054 640 1974 1402 --
NM_001025253chr863238 2761 1254 1157 1054 640 1974 1402 --
NM_001025366chr661726 1577 1563 1371 586 497 --1482 --
NM_001025366chr661726 1577 1563 1371 586 497 --1482 --
NM_001025367chr661726 1577 1563 1371 586 497 --1482 --
NM_001025367chr661726 1577 1563 1371 586 497 --1482 --
NM_001025368chr661726 1577 1563 1371 586 497 --1482 --
NM_001025368chr661726 1577 1563 1371 586 497 --1482 --
NM_001025369chr661742 1593 1579 1387 602 513 --1498 --
NM_001025369chr661742 1593 1579 1387 602 513 --1498 --
NM_001025370chr661726 1577 1563 1371 586 497 --1482 --
NM_001025370chr661726 1577 1563 1371 586 497 --1482 --
NM_001025580chrX53891 2939 2840 1181 527 23382 1250 13585 12929
NM_001025595chr441614 1569 1062 1047 ------
NM_001025777chr221075 138 135 ----
NM_001029839chr351241 1228 595 395 362 21334 557 ----
NM_001029840chr351241 1228 595 395 362 21334 557 ----
NM_001029851chr5--1825 2229 127 --
NM_001029852chr5--1825 2229 127 --
NM_001029853chr5--1825 2229 127 --
NM_001029854chr5--1825 2229 127 --
NM_001029858chr633339 2881 1144 1198 12244 --
NM_001029859chr1172322 2234 2042 1934 955 791 130 12070 12165 --
NM_001029884chr62998 464 ----31745 259 24
NM_001029998chr451360 1225 1016 217 78 --2979 157 --
NM_001029999chr1851221 880 204 70 29 1491 ----
NM_001030006chr1762676 2558 1844 819 666 251 ------
NM_001030007chr1673435 3173 2522 2477 1347 735 663 ------
NM_001030055chr14134669 4594 4011 3551 3386 3018 2874 1589 1345 652 601 542 507 --23911 405 14508
NM_001031623chr641703 1305 1274 353 ----1111
NM_001031684chr261461 1373 1311 392 279 210 --1288 --
NM_001031689chr9158 ------
NM_001031695chr22125128 5051 4841 4761 4659 4647 4393 4373 3942 3845 3600 1191 ------
NM_001031700chr452136 1965 927 556 212 21911 1604 1202 --
NM_001031712chr62381 40 ------
NM_001031732chr433413 2761 1062 ----11319
NM_001031748chr122542 251 ------
NM_001031812chr542097 1922 1824 748 --11896 --
NM_001032280chr611128 31554 628 551 11363 --
NM_001032283chr123963 316 29 ------
NM_001032284chr123963 316 29 ------
NM_001032293chr172443 168 ------
NM_001032380chr1031891 1848 622 11550 ----
NM_001032394chr632647 2609 1725 12296 12205 --
NM_001032395chr622514 2476 12163 12072 --
NM_001032999chr20124259 4172 3794 3507 1995 887 880 726 717 550 497 50 ------
NM_001033045chr264254 3816 3668 1683 1255 677 21698 548 ----
NM_001033047chr432657 455 131 ------
NM_001033057chr351802 1335 490 403 239 1144 11970 --
NM_001033059chr631816 1432 600 --11607 11650
NM_001033087chr2083275 3107 2875 2439 2320 1003 950 302 42881 2483 976 516 22866 737 --
NM_001033112chr55806 710 596 361 216 ------
NM_001033503chr5154 2148 77 ----
NM_001033561chr172633 209 ------
NM_001033578chr862216 2207 1812 912 493 65 1794 1767 --
NM_001033602chr1332727 2699 618 --12219 --
NM_001033756chr661660 1511 1497 1305 520 431 --1416 --
NM_001033756chr661660 1511 1497 1305 520 431 --1416 --
NM_001033925chr101756 32027 1676 466 1617 21537 861
NM_001034841chr1674194 3722 3433 1490 796 486 432 --13602 23618 1266
NM_001034845chr441145 1060 893 178 ------
NM_001034850chr531093 633 519 ------
NM_001034915chr831550 194 144 --11449 11247
NM_001034954chr1023214 1207 12790 ----
NM_001034955chr1023214 1207 12790 ----
NM_001034956chr1023214 1207 12790 ----
NM_001034957chr1023214 1207 12790 ----
NM_001035260chr101412 21670 43 ----
NM_001035267chr121243 ------
NM_001035521chr21582 ----1632
NM_001037131chr2--1427 2997 833 11111
NM_001037164chr721521 626 1794 21639 1616 --
NM_001037172chr341043 921 903 190 11393 ----
NM_001037174chr252186 2178 1802 1712 654 11917 11483 1147
NM_001037317chr131790 702 356 22536 438 12504 --
NM_001037332chr542489 2383 2148 2110 12039 22051 751 --
NM_001037333chr542489 2383 2148 2110 12039 22051 751 --
NM_001037334chr1892084 1857 1846 1758 1726 889 538 379 47 --22335 2097 --
NM_001037553chr2174212 4165 4064 3834 1386 1341 135 23997 3149 14135 --
NM_001037738chr51244 ----1314
NM_001039091chrX31346 1027 206 ------
NM_001039366chr221329 ----165
NM_001039459chr7----1432 --
NM_001039538chr243707 3668 1429 611 ----1829
NM_001039547chr3178033 7745 7356 7312 6919 6509 6211 6139 5651 5400 4937 2478 2120 1567 1236 963 853 35261 1479 906 35831 5180 5028 55678 4927 2957 2251 433
NM_001039569chr273231 3044 2753 1195 346 275 224 33088 2135 907 ----
NM_001039580chr464677 4198 3589 3140 1458 24 --2977 939 14650
NM_001039585chr183185 2867 1682 1451 1363 1160 582 175 33371 3362 1588 2865 574 --
NM_001039590chrX82652 2564 2534 1457 1265 980 971 542 11323 13810 21139 1080
NM_001039591chrX82652 2564 2534 1457 1265 980 971 542 11323 13810 21139 1080
NM_001039618chr1164436 1702 1632 1565 1126 724 35893 4992 4803 45650 3913 2371 1307 44194 2256 1969 1880
NM_001039619chr14--1236 ----
NM_001039709chr20124259 4172 3794 3507 1995 887 880 726 717 550 497 50 ------
NM_001039715chr131023 980 218 ------
NM_001039716chr131087 1044 282 ------
NM_001039762chr1022363 567 ------
NM_001039840chrX74798 4247 3718 2083 2033 1402 1263 21577 1329 55228 5146 1103 906 374 --
NM_001039916chr12----1989 --
NM_001039917chr12----1989 --
NM_001039918chr12----1989 --
NM_001039919chr12----1989 --
NM_001039920chr12----1989 --
NM_001039937chr1354057 3387 3286 971 260 32581 1488 638 13108 1111
NM_001040001chr652020 1984 1786 1600 644 1434 1672 11528
NM_001040031chr19175 ------
NM_001040057chr731385 1029 265 --1215 1186
NM_001040092chr81356 176 1167 --
NM_001040142chr221798 335 ----11876
NM_001040143chr221798 335 ----11876
NM_001040152chr775102 4744 4206 3922 1367 319 216 33438 3250 1044 ----
NM_001040153chr132953 178 1644 ----
NM_001040158chr51549 1497 ----
NM_001040159chr41327 ----1131
NM_001040181chr32254 94 ------
NM_001040182chr32254 94 ------
NM_001040183chr32254 94 ------
NM_001040199chr32254 94 ------
NM_001040200chr32254 94 ------
NM_001040214chr62557 199 11667 --11738
NM_001040260chr411079 ------
NM_001040261chr411079 ------
NM_001040272chr922365 1592 ------
NM_001040284chr1685864 5558 5054 5038 4911 4103 2091 534 35010 4096 283 45728 4299 4278 237 --
NM_001040402chr463238 3168 3094 1156 393 160 2931 680 12674 1589
NM_001040429chr1383213 2916 2486 2472 1128 884 822 538 13008 ----
NM_001040432chr32408 118 ------
NM_001040441chr164895 3669 2079 505 229 219 24653 1830 --35207 1521 595
NM_001040446chr572718 2677 2404 1088 880 448 337 --1231 12379
NM_001040450chr1512293 12845 12818 12161
NM_001040453chr1512293 12845 12818 12161
NM_001040653chr362354 2086 863 842 656 325 ----22335 2028
NM_001040665chr764839 3438 3350 1326 1289 955 1529 1624 13204
NM_001040708chr811048 ------
NM_001040709chr172579 2541 2383 1734 940 848 271 --21673 260 22557 1968
NM_001040712chr9181 1705 12193 23067 327
NM_001040876chr421629 452 2112 76 --11224
NM_001042355chr1664811 3624 3303 1477 985 612 14351 14042 13902
NM_001042357chr1031471 338 278 2496 28 11381 11321
NM_001042358chr1031471 338 278 2496 28 11381 11321
NM_001042360chr1031471 338 278 2496 28 11381 11321
NM_001042361chr1031502 369 309 2527 59 11412 11352
NM_001042363chr1031471 338 278 2496 28 11381 11321
NM_001042364chr1031502 369 309 2527 59 11412 11352
NM_001042365chr1031502 369 309 2527 59 11412 11352
NM_001042387chr1031502 369 309 2527 59 11412 11352
NM_001042389chr1031471 338 278 2496 28 11381 11321
NM_001042390chr1031471 338 278 2496 28 11381 11321
NM_001042392chr1031471 338 278 2496 28 11381 11321
NM_001042393chr1031502 369 309 2527 59 11412 11352
NM_001042395chr1031471 338 278 2496 28 11381 11321
NM_001042396chr1031502 369 309 2527 59 11412 11352
NM_001042397chr1031502 369 309 2527 59 11412 11352
NM_001042404chr151770 1409 725 437 197 11718 ----
NM_001042412chr1664811 3624 3303 1477 985 612 14351 14042 13902
NM_001042413chr973771 3244 2791 2495 1540 1283 47 --33257 1028 83 --
NM_001042425chr611128 31554 628 551 11363 --
NM_001042453chrX1582 --11396 11646
NM_001042473chr1022134 1759 1268 --1207
NM_001042481chr1462389 824 809 694 129 81 ------
NM_001042492chr1763180 3071 2476 1351 644 555 --1584 --
NM_001042493chr641787 1495 388 374 ------
NM_001042494chr1563201 2335 1421 1295 1214 460 1558 23399 24 --
NM_001042495chr1563201 2335 1421 1295 1214 460 1558 23399 24 --
NM_001042496chr1563201 2335 1421 1295 1214 460 1558 23399 24 --
NM_001042497chr1563201 2335 1421 1295 1214 460 1558 23399 24 --
NM_001042510chr832068 2013 367 21950 851 ----
NM_001042511chr832068 2013 367 21950 851 ----
NM_001042533chr333125 1208 833 ----22481 1045
NM_001042537chrX31946 754 535 12208 12420 12339
NM_001042555chr1241867 1301 1107 492 43450 3397 746 670 ----
NM_001042599chr2117392 7299 6213 5931 5913 5834 5779 4884 3105 1105 685 37808 1372 163 27641 913 --
NM_001042601chr333311 2854 547 43115 2717 2378 2189 --2538 489
NM_001042603chr1285388 4929 4917 4573 3612 1470 580 410 35063 3767 87 ----
NM_001042604chr374890 4171 3361 1427 1344 861 690 14244 21940 1929 --
NM_001042646chr321452 1268 1194 --11763
NM_001042681chr132652 2624 1014 11965 --12210
NM_001042682chr132652 2624 1014 11965 --12210
NM_001042682chr132652 2624 1014 11965 --12210
NM_001042683chr631760 1144 574 ------
NM_001043318chr1433736 1106 802 ----12584
NM_001043351chr122023 1991 ------
NM_001044305chr621512 163 11629 1250 --
NM_001044385chr231388 91 39 1507 11516 --
NM_001044722chr542097 1922 1824 748 --11896 --
NM_001044723chr542097 1922 1824 748 --11896 --
NM_001046chr542776 2682 818 457 22067 130 --1265
NM_001048183chr143484 3468 3397 3335 33457 2440 901 1238 11368
NM_001049chr1432204 1640 574 ------
NM_001071775chr1331920 1620 720 2729 681 ----
NM_001079874chr161599 776 665 647 503 472 --1402 --
NM_001083620chr431668 1625 486 22066 832 2824 814 --
NM_001096chr171234 ------
NM_001099678chr345834 5200 2086 1627 24934 72 26238 2103 16285
NM_001100108chr1108282 8185 7614 6939 6702 6115 5793 1852 1253 968 56676 6488 5824 2249 1167 22963 104 36245 2763 2663
NM_001106chr3118895 8838 7264 6829 5954 3898 3093 2693 1931 1888 866 59372 8301 6025 5899 1300 11974 29660 7087
NM_001116chr1632753 62 56 12917 1327 12024
NM_001117chr1832195 2161 1860 ------
NM_001121chr1021819 370 --11171 --
NM_001128chr1673435 3173 2522 2477 1347 735 663 ------
NM_001146chr852368 1878 1764 1732 1724 --22341 192 11543
NM_001148chr411992 32077 153 60 --11399
NM_001149chr1041290 1060 937 457 ------
NM_001153chr22876 195 ----1921
NM_001160chr1212253 ------
NM_001167chrX86637 5374 4431 4417 2133 1884 1317 537 34217 2285 1589 14190 16210
NM_001173chr14134669 4594 4011 3551 3386 3018 2874 1589 1345 652 601 542 507 --23911 405 14508
NM_001177chr1292330 1973 1726 901 787 469 254 177 133 12179 21763 961 --
NM_001186chr2142886 2147 2070 401 31185 1112 345 ----
NM_001198chr65657 442 284 261 44 1637 21951 1662 --
NM_001201chr453650 3335 1287 750 184 122 12980 --
NM_001204chr2116684 6207 2822 2298 2292 2238 2165 1830 1819 822 239 66089 5941 2828 2213 1437 756 27056 6449 26195 5502
NM_001206chr952881 2397 2365 464 102 1650 --11121
NM_001231chr12466 162 ------
NM_001241chr24636 498 452 219 32385 891 427 11570 11792
NM_001241chr24636 498 452 219 32385 891 427 11570 11792
NM_001253chr61236 ------
NM_001256chr1742961 950 505 393 12656 --12143
NM_001259chr786211 5205 4354 2014 1209 835 752 293 36223 5874 4930 12129 --
NM_001261chr92851 79 ------
NM_001280chr191656 ------
NM_001282chr1762676 2558 1844 819 666 251 ------
NM_001284chr51411 ------
NM_001286chr152858 1814 1773 515 405 --11018 12844
NM_001289chrX2550 32 11216 11586 1275
NM_001304chr17113388 3353 2757 2688 2651 2564 1133 1071 973 786 266 33411 3275 726 --22802 996
NM_001310chr1262843 2797 2516 2208 2090 745 --32978 2183 499 22046 264
NM_001315chr652240 2225 1756 702 421 ----1588
NM_001316chr203443 434 356 ------
NM_001331chr1132463 1007 251 ------
NM_001332chr51987 21444 188 1505 21337 1236
NM_001338chr2121144 331 --2491 376 1352
NM_001351chr311312 --1638 --
NM_001356chrX62291 1867 1746 1709 526 407 32060 1900 842 ----
NM_001358chr4------1109
NM_001364chr1122922 2887 ----173
NM_001378chr2167 ------
NM_001380chr101985 ------
NM_001386chr862215 2006 1905 1848 1700 946 11940 ----
NM_001389chr211376 ------
NM_001390chr1833421 1395 1382 33432 2405 694 ----
NM_001396chr2122185 506 22080 150 12788 185
NM_001401chr93651 165 142 ------
NM_001402chr641998 1936 691 243 ----11587
NM_001406chr17--11751 ----
NM_001408chr151592 1555 1254 1159 1146 ------
NM_001412chrX83453 3338 3201 3088 2698 1158 940 437 --13160 23543 3480
NM_001418chr113733 571 62 1653 1762 --
NM_001418chr113733 571 62 1653 1762 --
NM_001419chr1921194 907 13435 ----
NM_001426chr2--1481 ----
NM_001427chr71429 ------
NM_001431chr61900 1387 --1893
NM_001432chr443595 3451 925 168 43735 2383 831 541 13748 1128
NM_001438chr12861 825 22540 400 22783 1333 --
NM_001446chr6--2287 202 ----
NM_001448chrX21148 293 --11678 --
NM_001451chr1621261 1047 21227 1087 --11220
NM_001452chr63665 641 160 ------
NM_001453chr641739 1725 1610 1119 ------
NM_001463chr22722 51 ------
NM_001483chr72710 49 ------
NM_001490chr941100 582 479 462 23314 1091 --1615
NM_001499chr9------1143
NM_001521chr21582 ----1632
NM_001527chr674817 3830 1725 1573 1463 1293 467 1454 14561 23729 341
NM_001533chr19179 ------
NM_001542chr122839 197 42334 1020 486 123 ----
NM_001550chr71214 ------
NM_001560chrX72649 2093 1859 1798 405 362 323 ------
NM_001564chr4132 ------
NM_001567chr111750 ------
NM_001604chr113895 681 260 1168 1740 --
NM_001609chr1054031 3791 1293 704 213 --34076 3834 3196 --
NM_001614chr172524 218 ------
NM_001614chr172524 218 ------
NM_001616chr223407 1169 1644 11196 22709 927
NM_001621chr722011 649 --11181 21925 339
NM_001621chr722011 649 --11181 21925 339
NM_001634chr631816 1432 600 --11607 11650
NM_001655chr1131858 1407 830 ----11816
NM_001656chr552033 1811 1587 503 257 11599 11541 --
NM_001658chr121128 1066 1446 ----
NM_001663chr141249 22188 110 --32720 2402 2360
NM_001664chr31688 ------
NM_001668chr11230 12237 1418 --
NM_001682chr1242893 2880 2872 2626 --11790 1904
NM_001684chr133991 3023 190 12651 ----
NM_001685chr211130 ------
NM_001690chr322007 135 12207 ----
NM_001695chr873809 3509 3393 3188 1560 1491 101 32697 748 710 14276 --
NM_001696chr221329 ----165
NM_001707chr73731 193 149 ----1937
NM_001709chr1122315 52 32044 1787 384 12506 --
NM_001714chr121434 ------
NM_001729chr41131 159 ----
NM_001730chr1331357 536 205 --2407 140 --
NM_001730chr1331357 536 205 --2407 140 --
NM_001731chr123822 238 46 ------
NM_001742chr731829 1775 417 ------
NM_001743chr23581 502 49 ------
NM_001746chr562633 1138 758 739 647 177 --12946 --
NM_001753chr73632 303 241 --11496 --
NM_001754chr2153929 3796 3039 1187 527 ------
NM_001755chr1622156 1645 1268 11566 11658
NM_001759chr1255319 4609 2077 1526 1514 25285 3386 --31569 1404 204
NM_001769chr122406 298 ------
NM_001774chr19175 ------
NM_001777chr373768 3310 3277 3058 2809 1539 746 33798 987 915 21426 1413 --
NM_001792chr183850 775 110 1208 ----
NM_001796chr16187 --1248 --
NM_001806chr1932745 2267 428 31945 1082 38 11006 --
NM_001812chr43240 90 74 ------
NM_001830chrX33872 3820 3044 1521 12754 11224
NM_001842chr9------1571
NM_001854chr141187 1133 1082 1038 21324 1254 1608 1267
NM_001858chr674703 4105 3888 3290 3284 844 21 11592 14177 24448 1985
NM_001859chr943875 2579 1031 334 43762 1382 710 58 12962 --
NM_001866chrX--1117 ----
NM_001874chr1264988 4027 3643 3170 1345 291 31750 1484 602 13756 --
NM_001881chr10------1472
NM_001884chr5--1429 ----
NM_001894chr22--11254 ----
NM_001901chr621016 211 144 --1344
NM_001903chr51801 1891 ----
NM_001904chr34974 932 114 83 ------
NM_001918chr189191 8960 8447 5867 3705 1544 1069 139 37764 494 268 52271 1820 1794 1430 467 23490 2555
NM_001920chr121670 ------
NM_001924chr1------1409
NM_001939chrX83872 3682 3607 2883 2616 684 291 123 13293 13265 --
NM_001941chr1863879 3110 3029 1529 1195 501 1652 12825 --
NM_001942chr1821377 228 --12050 --
NM_001945chr51489 ------
NM_001946chr1241075 1057 832 450 ------
NM_001949chr622444 648 23236 491 ----
NM_001961chr193487 346 162 ------
NM_001963chr4------1593
NM_001967chr3--1446 --192
NM_001969chr1483435 2852 2548 1579 1564 1177 1073 829 2653 646 12796 --
NM_001977chr451307 1268 1173 1115 678 11642 2541 413 --
NM_001980chr1212147 12112 12044 --
NM_001981chr131694 1485 286 11770 12182 12096
NM_001995chr421236 376 --31359 1034 277 --
NM_001999chr52484 190 162 ----
NM_002006chr454532 3884 2111 1980 1609 11275 12081 23984 1066
NM_002009chr1562659 2285 1101 841 745 324 1193 ----
NM_002015chr1372153 2139 1013 876 699 361 162 --13364 12719
NM_002017chr1131391 524 127 ------
NM_002024chrX22147 584 1208 --11567
NM_002025chrX127037 6937 6829 6329 3632 3150 2861 2452 2151 1751 1493 226 28421 1062 12636 1751
NM_002026chr2--2778 699 1713 --
NM_002031chr62536 155 ----1547
NM_002035chr1873662 2961 2451 1416 1006 904 218 23333 43 13879 12685
NM_002039chr42789 74 ------
NM_002040chr2153176 2620 2321 978 561 22181 83 ----
NM_002044chr1521491 225 3581 329 269 11481 --
NM_002045chr3----1311 --
NM_002048chr941336 413 207 145 1387 ----
NM_002056chr22671 340 1741 ----
NM_002069chr741536 540 519 122 11783 11205 --
NM_002082chr51220 ------
NM_002089chr42235 170 ------
NM_002091chr18----1108 --
NM_002092chr464692 4509 3268 2018 1716 70 23725 841 23580 535 11866
NM_002106chr4----1124 --
NM_002126chr1783659 3099 2983 2863 1599 844 393 168 --12564 --
NM_002129chr4--1439 ----
NM_002130chr521298 183 --1161 --
NM_002131chr611312 ----11324
NM_002136chr123457 435 177 ------
NM_002137chr722290 602 --22242 1592 --
NM_002139chrX----1189 --
NM_002158chr221284 1112 22908 246 --11234
NM_002161chr93414 171 131 --1351 --
NM_002166chr2----1474 1195
NM_002182chr332759 2646 1089 21965 650 --11752
NM_002193chr2--11502 --11411
NM_002196chr20----1822 --
NM_002196chr20----1822 --
NM_002202chr51937 ------
NM_002203chr544007 3202 1372 390 23644 2667 1426 1656
NM_002207chr3168 ------
NM_002210chr273521 3256 2390 2287 1099 350 148 53397 2967 2272 2175 503 13558 --
NM_002211chr1041053 870 772 199 ------
NM_002214chr744211 3679 2071 1860 12231 --35407 4743 4136
NM_002223chr1283968 3667 2834 2530 2514 2507 1283 928 23887 1561 12567 --
NM_002232chr11532 ------
NM_002234chr121265 ----190
NM_002235chr1261724 1583 1235 1219 1192 497 2572 535 21513 387 --
NM_002239chr22854 56 --1124 --
NM_002240chr213466 205 101 ------
NM_002242chr23648 512 229 21904 609 11463 --
NM_002247chr1031770 596 124 1553 --21608 478
NM_002253chr421048 101 ------
NM_002264chr364422 3377 2002 1631 1376 130 --25073 4170 14965
NM_002270chr544875 1720 932 801 --25688 3506 --
NM_002271chr1311495 --1515 --
NM_002285chr264043 2657 1396 1167 1058 452 34162 3818 3495 11496 13236
NM_002293chr162792 2736 2402 2094 1766 1072 ------
NM_002296chr121745 178 21420 478 ----
NM_002298chr1341249 445 230 97 1577 ----
NM_002303chr1--1105 ----
NM_002310chr5106522 6065 5690 4700 1917 1510 1225 741 437 297 14337 24331 373 11417
NM_002317chr5----1266 --
NM_002336chr12155071 4768 4217 4024 3995 3941 3824 3467 1972 887 834 757 470 209 155 ------
NM_002345chr122568 223 ------
NM_002350chr81459 1212 1248 1937
NM_002356chr642865 2847 2631 1113 ------
NM_002374chr243707 3668 1429 611 ----1829
NM_002387chr523421 80 34874 1293 128 25099 3935 24893 4855
NM_002395chr611386 ----11209
NM_002397chr552169 2075 1421 430 208 --11518 --
NM_002399chr1521389 177 ------
NM_002401chr1711524 12022 22450 1551 --
NM_002408chr14144 --1602 --
NM_002439chr53948 911 332 --1320 --
NM_002448chr41764 ----1731
NM_002465chr12--1314 ----
NM_002480chr1221345 1053 11445 ----
NM_002481chr167189 5666 3137 1850 1580 1214 16715 36598 6487 6395 --
NM_002499chr1572034 1805 1772 482 475 387 100 ----1725
NM_002508chr12346 64 --31520 775 686 155
NM_002515chr1441892 1300 233 223 11719 ----
NM_002522chr1763772 3493 2914 2641 431 45 13394 ----
NM_002524chr11201 --2783 169 --
NM_002543chr1231510 269 75 1287 11193 --
NM_002545chr1195068 4679 4223 1652 1624 1590 1413 398 144 31319 646 171 --14200
NM_002547chrX61649 1559 1388 1119 727 436 23004 2867 13343 --
NM_002577chr351317 1278 1222 1089 593 --11477 1358
NM_002578chrX1175 ------
NM_002581chr974570 4471 4395 3817 3707 1957 773 --1766 --
NM_002586chr621274 1051 150 --11208
NM_002590chr131156 ------
NM_002594chr2022265 1695 ------
NM_002595chr1241930 1397 756 168 193 11914 --
NM_002597chr12326 113 ------
NM_002603chr8--1161 ----
NM_002607chr71907 ------
NM_002610chr252259 2227 771 470 400 13158 1117 --
NM_002613chr1655343 5094 4413 2091 225 ----15158
NM_002623chr202293 26 141 ----
NM_002641chrX21593 1399 --11701 --
NM_002645chr112672 147 12653 --1120
NM_002655chr875062 4456 3373 3366 1834 1137 587 11261 ----
NM_002670chr32429 96 11429 --11153
NM_002698chr1912924 ------
NM_002703chr441949 1298 1226 585 11491 ----
NM_002706chr2------192
NM_002709chr232301 364 91 43457 2811 2577 2320 ----
NM_002711chr72892 570 --1583 --
NM_002715chr54990 859 448 259 ------
NM_002718chr362118 2092 1987 1838 715 406 1429 12378 2836 727
NM_002719chr1421693 793 ------
NM_002731chr162978 2074 1121 1007 780 477 22389 430 --32762 2440 368
NM_002734chr1741800 1461 839 80 11582 ----
NM_002737chr1775649 5429 5390 5009 4647 1360 313 16371 11559 --
NM_002738chr161789 ------
NM_002745chr2274501 3742 3733 3227 3109 1252 475 11795 --13845
NM_002753chr4--1855 ----
NM_002765chrX31346 1027 206 ------
NM_002806chr141239 ------
NM_002814chrX3590 158 70 ------
NM_002816chr17--1269 ----
NM_002822chr1211311 --1549 --
NM_002825chr7------1447
NM_002835chr71244 --1755 1702
NM_002837chr1294430 4190 4118 3809 2908 2854 1399 1209 581 11306 1949 22928 1617
NM_002838chr12881 119 1402 1762 --
NM_002839chr9181 1705 12193 23067 327
NM_002840chr111592 11644 ----
NM_002843chr1133371 929 666 --13145 22613 513
NM_002844chr621125 126 ------
NM_002845chr183430 158 65 ------
NM_002852chr32139 101 122 ----
NM_002858chr131122 1044 851 ------
NM_002865chr82213 206 ----194
NM_002868chr121551 ----1573
NM_002869chr1132153 2084 2027 21819 89 --1636
NM_002874chr942401 1632 664 78 --42302 1741 562 99 11768
NM_002886chr395120 4661 4097 3865 3509 3273 1586 754 308 24626 1969 ----
NM_002890chr54920 847 836 202 ------
NM_002892chr142419 219 1292 --1412
NM_002895chr201697 ------
NM_002901chr111400 2701 308 1738 --
NM_002902chr151628 ------
NM_002906chr1152303 2135 1920 655 183 --1649 --
NM_002911chr191643 ------
NM_002912chr65859 820 739 285 159 ------
NM_002940chr421629 452 2112 76 --11224
NM_002941chr321265 1093 11502 --21364 1104
NM_002942chr31450 --11198 --
NM_002948chr321072 74 ------
NM_002955chr621606 335 --1795 11387
NM_002956chr122547 358 11171 ----
NM_002959chr184432 4423 3821 3088 2730 1365 1257 723 11359 1412 23440 1536
NM_002970chrX------1253
NM_002977chr292398 2368 1042 868 841 502 417 397 49 22429 760 33437 1026 443 --
NM_002990chr1611743 ----22286 1775
NM_002994chr42241 117 ------
NM_002998chr832185 802 715 21901 822 ----
NM_003011chr931579 675 162 --1613 --
NM_003016chr1731668 1532 798 1678 11256 --
NM_003017chr621269 47 ------
NM_003022chrX11279 1166 ----
NM_003026chr921178 845 ------
NM_003030chr331814 741 460 --11846 11388
NM_003031chr161950 ------
NM_003034chr1237019 3220 831 36223 5811 5060 --18118
NM_003043chr341606 1503 615 89 31628 993 372 13880 14128
NM_003046chr884249 3956 3739 3604 3416 1612 1601 278 --24391 823 1929
NM_003048chr242413 2344 2167 235 32419 297 283 ----
NM_003051chr131666 639 178 11691 --11757
NM_003054chr10------1299
NM_003060chr53905 886 853 ----1354
NM_003068chr821074 234 ------
NM_003071chr341292 748 487 228 2754 589 ----
NM_003081chr201798 ------
NM_003095chr12284 69 ------
NM_003106chr3------21024 991
NM_003107chr632497 2225 2162 1436 12204 1353
NM_003108chr287178 6338 6224 5135 4886 4604 1214 826 34797 2116 713 15479 --
NM_003112chr753056 2912 878 868 474 --12675 --
NM_003128chr242796 2236 2216 837 12579 22605 889 --
NM_003133chr11928 1304 3916 675 250 --
NM_003135chr5--1365 --1284
NM_003137chr632163 1485 838 --1160 --
NM_003144chr642201 2122 1923 111 ------
NM_003155chr832749 2574 1752 2493 340 21724 579 --
NM_003161chr1783302 2753 2658 2533 2206 929 795 397 23628 2905 33583 1238 1208 --
NM_003173chrX1337 ------
NM_003178chr331719 464 189 21948 578 ----
NM_003182chr72414 367 ------
NM_003182chr72414 367 ------
NM_003184chr821009 148 ----11085
NM_003185chr2031264 331 35 ------
NM_003188chr63867 657 129 1222 ----
NM_003189chr133124 3004 2310 1115 11043 --
NM_003199chr1875646 5420 4010 3832 3527 1684 216 34888 3722 3460 11531 --
NM_003211chr1221133 711 11736 --21551 212
NM_003220chr611128 31554 628 551 11363 --
NM_003221chr643690 1338 1041 869 --12727 --
NM_003234chr321768 400 32093 1649 1511 ----
NM_003242chr321013 475 11695 ----
NM_003243chr131241 998 829 1957 ----
NM_003244chr18198 ------
NM_003257chr152946 336 1921 ----
NM_003262chr331898 1433 217 --33218 1488 124 --
NM_003272chr12114 104 ------
NM_003286chr201923 1864 ----
NM_003292chr111981 1424 22268 580 --
NM_003295chr133214 139 56 ------
NM_003300chr14--2340 54 ----
NM_003304chr331639 1070 253 1390 --1553
NM_003305chr41181 ----174
NM_003319chr21920 ------
NM_003320chr1134359 2841 674 ------
NM_003338chr1051594 1471 1436 725 112 31818 1279 743 1661 1248
NM_003339chr541237 1123 340 79 11431 --1163
NM_003340chr441209 1044 460 308 --11013 --
NM_003341chr3130 ------
NM_003342chr1773142 2838 2612 2300 2227 1271 1063 --23013 640 11240
NM_003352chr231005 761 688 1130 ----
NM_003368chr11784 2279 148 --1773
NM_003369chr1122434 284 12231 12557 --
NM_003376chr661726 1577 1563 1371 586 497 --1482 --
NM_003376chr661726 1577 1563 1371 586 497 --1482 --
NM_003387chr282682 2674 2205 2017 851 393 329 210 ------
NM_003390chr1121010 898 --1843 --
NM_003392chr352641 1660 1235 1146 186 33820 838 748 2994 879 22941 1357
NM_003400chr23876 309 68 1299 ----
NM_003406chr851601 1459 724 656 604 --11523 21539 125
NM_003409chr183539 276 135 ------
NM_003410chrX72694 2137 1890 697 547 527 499 --23050 2988 --
NM_003411chrY51731 1695 1530 1331 500 --11369 --
NM_003412chr322347 2321 23094 2609 12140 --
NM_003413chrX--1210 ----
NM_003439chr753510 3414 3146 786 394 12442 12415 12842
NM_003453chr13----1237 --
NM_003457chr172443 168 ------
NM_003463chr6103297 2986 2784 1081 487 372 234 188 168 37 --32444 1090 197 --
NM_003468chr2114261 4237 4112 4012 1740 1712 1342 1056 773 688 355 34029 815 124 --11182
NM_003471chr382177 1821 1809 1448 921 675 642 534 --1953 --
NM_003472chr621500 160 141 ----
NM_003473chr1031029 1010 264 ------
NM_003474chr1051862 894 687 188 176 1312 2753 325 --
NM_003477chr114314 226 138 84 ------
NM_003478chr1162923 1285 366 273 90 48 11303 ----
NM_003489chr2133312 1334 55 33458 2422 84 ----
NM_003503chr1--11281 ----
NM_003505chr741931 621 374 299 11253 ----
NM_003506chr8------2427 405
NM_003559chr1763889 2436 1246 342 254 78 --13106 --
NM_003565chr1211439 ----21421 1300
NM_003566chr1293283 3265 2950 2898 1386 1019 980 183 85 --1557 --
NM_003567chr1----1301 --
NM_003569chr6----1583 --
NM_003581chr2--1968 ----
NM_003583chr1243538 3129 832 92 ------
NM_003589chr1311194 ------
NM_003590chr243883 3500 647 535 ------
NM_003597chr272319 1871 1863 1553 773 249 170 --22176 1592 --
NM_003613chr153636 115 79 ----1481
NM_003615chr363580 2937 2878 1408 671 481 ------
NM_003624chr1911444 ------
NM_003626chr1131251 340 110 154 ----
NM_003628chr2179 2526 514 ----
NM_003629chr1113225 3119 2504 2352 2244 1000 896 483 333 306 93 1740 12400 --
NM_003630chr62500 155 ------
NM_003632chr171875 ------
NM_003633chr532516 2394 354 2426 391 12205 --
NM_003645chr153216 80 59 ------
NM_003659chr2--1950 ----
NM_003663chr343309 3121 2856 536 21353 1249 --1362
NM_003668chr122268 226 136 ----
NM_003670chr341276 1210 1085 268 --21289 253 --
NM_003671chr962723 549 504 497 477 468 23551 73 ----
NM_003672chr121635 710 21384 159 ----
NM_003686chr1--1178 ----
NM_003690chr21547 ----1483
NM_003713chr121748 292 ------
NM_003714chr542337 992 943 529 12404 12644 --
NM_003718chr71424 185 ----
NM_003719chr5--1825 2229 127 --
NM_003722chr332658 1011 453 11833 1846 --
NM_003725chr12----1433 1396
NM_003728chr4--1437 ----
NM_003750chr102924 69 ----1401
NM_003758chr1531436 1205 1137 1175 11040 --
NM_003758chr1531436 1205 1137 1175 11040 --
NM_003759chr453460 1686 1283 959 640 188 --23412 3096
NM_003763chr2052983 2902 2511 1055 811 12270 12490 11219
NM_003772chr113889 181 95 1962 1352 --
NM_003774chr1263350 3216 2906 2276 2072 671 12081 13206 --
NM_003791chr162617 425 1536 ----
NM_003794chr341047 880 764 198 --1393 --
NM_003796chr192631 420 ----1152
NM_003818chr201142 ------
NM_003819chr1----1271 --
NM_003822chr173080 3012 2956 2404 2391 407 199 13044 ----
NM_003825chr1521474 526 --11553 11346
NM_003829chr931166 255 230 ------
NM_003831chr1841504 1284 381 314 21152 80 ----
NM_003850chr13------1552
NM_003878chr8--133 ----
NM_003884chr311310 --1741 --
NM_003885chr1712553 --12067 12448
NM_003887chr222321 1936 1522 ----
NM_003895chr2131768 365 30 --21914 132 --
NM_003901chr1052661 1785 989 982 135 1189 --12649
NM_003902chr14737 257 81 25 --1747 --
NM_003909chr842739 2061 684 577 22971 2643 12913 --
NM_003913chr683734 3308 2650 1014 944 732 335 107 14290 --23067 127
NM_003916chrX--11370 1347 --
NM_003922chr15158 1410 ----
NM_003930chr772501 2417 2249 1802 1620 268 31 12148 22494 877 1904
NM_003931chr63589 525 57 ----2536 489
NM_003932chr2231764 1355 417 --31867 1828 568 11548
NM_003934chr92341 58 --11268 11189
NM_003936chr211011 ------
NM_003939chr1053210 2867 1408 878 26 32880 1136 776 13073 12804
NM_003941chr762565 1742 857 680 646 239 ------
NM_003947chr31844 ----11275
NM_003958chr673819 3327 3182 2680 2613 823 130 2760 25 1275 --
NM_003972chr1031157 266 175 ------
NM_003980chr61491 ----1400
NM_003983chr1654013 1659 1541 1281 787 11180 33827 877 289 1357
NM_003987chr10----12027 --
NM_003988chr10----12104 --
NM_003989chr10----11963 --
NM_003990chr10----11963 --
NM_003994chr1233880 1580 265 14137 14013 13378
NM_004006chrX3828 661 632 --12517 12346
NM_004007chrX3828 661 632 --12517 12346
NM_004009chrX3828 661 632 --12517 12346
NM_004010chrX3828 661 632 --12517 12346
NM_004011chrX3828 661 632 --12517 12346
NM_004012chrX3828 661 632 --12517 12346
NM_004013chrX3828 661 632 --12517 12346
NM_004014chrX3828 661 632 --12517 12346
NM_004015chrX3828 661 632 --12517 12346
NM_004016chrX3742 575 546 --12431 12260
NM_004017chrX3828 661 632 --12517 12346
NM_004018chrX3742 575 546 --12431 12260
NM_004020chrX3828 661 632 --12517 12346
NM_004021chrX3742 575 546 --12431 12260
NM_004022chrX3742 575 546 --12431 12260
NM_004023chrX3742 575 546 --12431 12260
NM_004052chr103257 111 23 ------
NM_004056chr81713 ------
NM_004061chr52628 239 ------
NM_004081chrY21338 734 1434 ----
NM_004086chr141669 ------
NM_004087chr321769 1537 --2666 602 --
NM_004094chr1431936 1068 743 23050 71 33003 1100 677 11014
NM_004100chr62912 118 12085 ----
NM_004103chr8----1846 --
NM_004113chr352039 1914 1897 462 188 --1446 --
NM_004114chrX51224 1008 941 483 463 ------
NM_004124chr14113570 3241 3050 2982 1295 1257 1217 1208 1014 966 445 23417 149 --13336
NM_004156chr84581 570 555 184 ------
NM_004170chr931351 144 107 ----1761
NM_004171chr11118511 8032 7196 6755 6722 6707 2972 1538 875 719 373 11513 12993 27913 236
NM_004172chr511368 1427 --21313 1249
NM_004180chr2----170 1126
NM_004215chr82550 200 1510 1103 --
NM_004227chr732956 1125 802 12547 23073 2688 --
NM_004229chrX42031 1718 712 653 32085 2068 2014 --12040
NM_004232chr1843691 2410 1098 944 11021 12929 12883
NM_004235chr92802 574 1245 ----
NM_004238chr2----1251 --
NM_004239chr141104 ------
NM_004242chr62434 409 ----1303
NM_004244chr121382 ------
NM_004253chr92723 58 --1688 1829
NM_004272chr51801 1217 21842 1415 --
NM_004273chr1054279 1463 1429 494 396 34629 3580 1671 25049 3963 11028
NM_004274chr1442656 2615 2197 253 22059 509 1420 --
NM_004279chr71317 195 11822 1856
NM_004280chr63329 158 105 ------
NM_004293chr943801 3616 2373 145 13257 --1323
NM_004327chr2231681 996 926 11721 --1990
NM_004329chr1041333 1014 915 94 1568 ----
NM_004330chr151118 ----11001
NM_004331chr831780 1708 1057 11044 --21823 70
NM_004337chr872029 1760 1468 918 530 222 93 179 1309 --
NM_004338chr1897039 6682 6623 6157 5776 4981 4906 721 223 --25414 316 16788
NM_004342chr732213 2039 841 1491 ----
NM_004346chr4161 ------
NM_004349chr81280 ------
NM_004354chr41128 --1528 --
NM_004376chr1011286 ------
NM_004379chr231344 1208 287 ----21710 1185
NM_004380chr1642593 1674 993 363 22616 750 11966 12658
NM_004384chr542097 1922 1824 748 --11896 --
NM_004385chr51256 ------
NM_004389chr2--1742 1659 --
NM_004392chr1331811 1037 960 22125 448 12596 12092
NM_004396chr17--1247 --1296
NM_004397chr1163260 3194 1661 983 905 448 --23246 2664 --
NM_004407chr411008 2983 53 ----
NM_004411chr7------1526
NM_004415chr66819 776 625 568 547 89 1209 ----
NM_004420chr1142427 2283 1669 1546 ------
NM_004432chr911647 1724 --22307 169
NM_004438chr232885 313 145 23311 200 ----
NM_004440chr621673 337 1150 21830 1295 --
NM_004451chr111707 ------
NM_004457chr271608 1282 1248 1228 533 397 236 --11130 161
NM_004458chrX52564 2290 1876 875 279 ----1725
NM_004459chr171108 ----1756
NM_004464chr433058 2808 1628 --1251 13779
NM_004491chr1974307 4288 3906 1705 1132 328 224 ------
NM_004501chr1114119 3535 3409 3343 2748 2564 1603 1476 876 679 667 23865 610 24044 3184 --
NM_004504chr242359 1097 329 313 11978 --12038
NM_004505chr171285 1149 21255 66 11296
NM_004520chr5--179 2580 282 --
NM_004525chr241455 560 506 258 ------
NM_004537chr124616 120 105 82 11533 ----
NM_004538chrX2785 577 ----1537
NM_004540chr212261 44 2646 23 ----
NM_004566chr1072476 2193 1869 1763 1745 768 149 1524 --12316
NM_004576chr52397 83 ------
NM_004583chr171674 ------
NM_004586chrX45411 5273 5244 22 33482 1682 529 11344 --
NM_004592chr121181 ------
NM_004598chr532835 2684 147 ----11007
NM_004600chr141434 1156 619 509 --21566 348 --
NM_004606chrX181 ------
NM_004612chr984662 4232 4061 4013 3920 3208 1051 1002 34778 1814 1203 21825 1425 --
NM_004643chr141749 ------
NM_004654chrY3939 930 142 ----11093
NM_004660chrY82016 1907 1797 1679 1425 640 538 405 31985 1831 876 ----
NM_004663chr1541552 1511 305 69 2482 314 ----
NM_004666chr62511 28 11529 11348 1203
NM_004673chr121206 268 --185 --
NM_004687chr1721595 1544 --1446 --
NM_004705chr112310 39 --133 --
NM_004713chr145770 642 621 501 209 --126 --
NM_004715chr181117 ------
NM_004717chr721300 247 11028 11571 --
NM_004718chr22517 488 ----191
NM_004726chrX65638 3852 3535 697 382 79 34554 1649 207 25508 3735 --
NM_004730chr541890 1753 1691 1478 11570 ----
NM_004731chr1251878 1771 759 690 178 31463 1393 1251 21636 403 --
NM_004733chr32408 251 --1164 --
NM_004735chr23310 210 157 11044 1810 --
NM_004736chr12605 547 --12118 --
NM_004742chr351550 1289 675 133 89 11473 21823 374 --
NM_004744chr453945 3628 2669 783 661 43210 3070 653 349 13536 --
NM_004745chr8126757 6659 5963 5465 5335 2706 2298 2056 1853 992 799 242 ------
NM_004747chr1021134 341 ----1361
NM_004748chr1543949 3659 177 34 --11652 24193 1453
NM_004755chr143987 296 288 ------
NM_004760chr752076 1956 790 556 298 --22374 1859 --
NM_004768chr12358 77 --2969 951 --
NM_004772chr511590 ------
NM_004775chr1841992 1709 686 448 153 ----
NM_004779chr521295 282 11248 ----
NM_004781chr111090 1559 ----
NM_004781chr111090 1559 ----
NM_004788chr1142663 1682 1007 184 22318 2140 22487 2451 --
NM_004796chr1442408 2269 420 378 --11919 --
NM_004798chr2023606 3222 22235 484 13575 23033 2605
NM_004800chr132221 206 ------
NM_004808chr1053388 2968 1269 884 211 43105 2672 1323 912 ----
NM_004817chr92301 262 1682 2751 651 --
NM_004820chr81100 --1126 --
NM_004830chr61815 2896 613 ----
NM_004841chr11831 ------
NM_004842chr61366 11325 --11350
NM_004849chr621211 1149 --11567 --
NM_004856chr15----1475 --
NM_004857chr1464316 4075 3362 3132 1828 630 --44360 3711 3681 806 1833
NM_004863chr1484526 4344 4158 3968 3331 1578 356 279 11715 34720 4304 1688 14857
NM_004865chr61348 ------
NM_004866chr554528 3077 3054 1609 1601 --14272 33975 1638 1072
NM_004871chr1754342 4154 3797 3679 2946 ----11635
NM_004872chr11146 1402 --1471
NM_004873chr14----12898 --
NM_004874chr83499 54 39 ----1137
NM_004887chr52926 323 ----11163
NM_004893chr51549 1497 ----
NM_004896chr101327 11585 ----
NM_004897chr104881 770 369 57 1322 1105 1619
NM_004904chr786402 6341 6305 6290 5431 4828 4124 257 66084 4601 4101 4030 2154 1832 11839 --
NM_004912chr731734 1657 1255 1696 ----
NM_004921chr152491 2368 2239 2233 263 1972 52144 2126 2022 217 149 --
NM_004937chr1721087 957 1358 31836 964 911 11863
NM_004939chr22187 27 ------
NM_004947chr362570 2274 2261 2232 2007 1911 ----12248
NM_004948chr183487 264 22 11392 ----
NM_004949chr1862080 1700 625 466 325 301 22163 148 11727 1549
NM_004956chr744525 4329 3168 425 23420 416 1182 13969
NM_004965chr21--1542 1622 --
NM_004968chr72614 168 --1731 --
NM_004972chr921119 756 --11029 --
NM_004985chr1273479 2868 2848 1674 952 932 903 ----11772
NM_004992chrX68204 7115 7000 5783 5522 978 26771 1043 --13309
NM_004992chrX68204 7115 7000 5783 5522 978 26771 1043 --13309
NM_004999chr621631 1029 24028 3495 24001 605 12909
NM_005034chr81474 ----140
NM_005040chr111109 ------
NM_005056chr1295632 5173 5161 4817 3856 1714 824 654 254 35307 4011 331 ----
NM_005058chrY2266 202 ----1217
NM_005063chr1073790 3688 3585 3145 1307 513 419 13167 23176 2643 --
NM_005065chr14104854 4670 3729 3583 3358 1810 1493 775 569 68 24173 1479 ----
NM_005066chr11129 1836 --1724
NM_005077chr91483 ------
NM_005079chr863238 2761 1254 1157 1054 640 1974 1402 --
NM_005093chr20124259 4172 3794 3507 1995 887 880 726 717 550 497 50 ------
NM_005095chr142266 2260 1390 104 1476 11568 --
NM_005104chr61615 ------
NM_005105chr1144 11923 1127 --
NM_005114chr43663 175 101 ----1497
NM_005116chr2054523 4402 4260 3314 415 1254 11117 --
NM_005119chr131087 382 307 ----11250
NM_005121chr1742492 2329 277 145 11479 12459 --
NM_005124chr61260 2724 717 ----
NM_005126chr331723 1458 517 --1425 22270 2197
NM_005128chr211197 ----1491
NM_005135chr1563201 2335 1421 1295 1214 460 1558 23399 24 --
NM_005151chr1892084 1857 1846 1758 1726 889 538 379 47 --22335 2097 --
NM_005153chr162588 293 --1223 --
NM_005154chr152588 426 ------
NM_005156chr985319 5010 4366 1840 1484 1237 793 658 33891 1989 299 45334 4109 1409 405 13274
NM_005160chr22126251 6147 5882 5649 5352 4294 2153 1980 1393 1327 1262 540 45370 4887 4803 251 12397 26359 2697
NM_005164chr1232640 2583 2320 32681 2385 2362 ----
NM_005171chr1241338 1167 505 312 ------
NM_005174chr101105 ----181
NM_005181chr82212 155 1836 1576 1645
NM_005188chr1157100 6470 6113 6005 896 37696 1183 217 --15678
NM_005197chr1466063 6054 5315 4754 4048 1774 --21835 1006 --
NM_005215chr181641 ------
NM_005224chr191691 1239 ----
NM_005233chr312391 ------
NM_005235chr2117392 7299 6213 5931 5913 5834 5779 4884 3105 1105 685 37808 1372 163 27641 913 --
NM_005238chr1162402 1365 1279 1032 875 671 21072 262 ----
NM_005245chr42715 305 --1803 --
NM_005249chr141797 ------
NM_005254chr151530 ------
NM_005257chr182890 434 --11412 11326
NM_005259chr221399 1294 21235 443 1469 --
NM_005269chr121162 ------
NM_005296chrX4760 327 270 222 174 ----
NM_005302chr72157 32 --1367 1420
NM_005308chr101376 ------
NM_005311chr742294 2095 2041 1150 ----1615
NM_005313chr151224 ------
NM_005316chr112722 155 --1967 --
NM_005333chrX21234 883 ------
NM_005338chr731323 1003 376 23642 1435 42719 2580 1258 336 11016
NM_005339chr4144219 4057 3849 3733 3573 3113 2888 1512 1187 1023 893 506 453 445 13493 32731 835 460 --
NM_005342chrX82799 2591 2453 2152 1805 923 336 115 --173 11013
NM_005349chr4135 1161 ----
NM_005358chr131556 --1561 1382
NM_005359chr1896130 5744 5416 5202 4522 4172 2548 2447 2043 24657 218 11040 --
NM_005375chr651105 986 734 355 51 1821 ----
NM_005378chr22772 627 ------
NM_005381chr2--134 ----
NM_005385chr33886 756 31 12721 ----
NM_005387chr113563 520 458 ------
NM_005392chr911469 1188 ----
NM_005393chrX1249 ------
NM_005398chr1031207 151 113 11386 11057 --
NM_005399chr133711 1189 155 13860 ----
NM_005400chr232956 2116 1913 1700 ----
NM_005402chr731840 1832 1558 11440 11320 --
NM_005410chr52627 264 ------
NM_005413chr21410 ------
NM_005415chr22139 112 ------
NM_005433chr1832778 585 372 31818 957 617 ----
NM_005436chr10113991 3843 3256 3238 3198 1600 1004 304 272 103 88 --1812 2950 222
NM_005445chr10188 ------
NM_005461chr2031788 1763 122 11670 ----
NM_005466chr145569 508 470 205 104 ------
NM_005479chr1051553 1330 405 266 185 11617 ----
NM_005487chr2252154 1985 1934 1728 299 1490 ----
NM_005491chrX41930 1583 300 113 22150 43 ----
NM_005493chr6--2523 76 ----
NM_005494chr72151 51 ------
NM_005502chr921051 710 1233 11233 --
NM_005504chr12126581 6519 6075 5087 4893 4041 2640 2457 2152 1494 393 200 45550 4974 4598 74 24005 1207 14142
NM_005506chr472836 2657 2397 2315 1973 927 776 --12299 --
NM_005509chr511242 --21253 452 1631
NM_005520chr51633 ------
NM_005522chr731159 179 153 ------
NM_005524chr3--176 1344 --
NM_005542chr751823 1772 1683 1321 629 11877 ----
NM_005544chr22834 707 ------
NM_005546chr532358 1882 710 11575 1414 11688
NM_005561chr131834 ------
NM_005570chr182798 31 11011 ----
NM_005578chr394748 4646 4553 4505 4166 3563 1320 846 344 21105 402 14457 24862 1766
NM_005584chr131643 3767 733 708 --2754 676
NM_005595chr1--1216 ----
NM_005596chr996331 5999 4125 2392 2379 2315 2296 1812 437 --11049 14211
NM_005604chr632501 1949 768 ------
NM_005613chr11438 1672 22164 791 11473
NM_005627chr61879 ------
NM_005638chrX3704 672 475 11470 11447 --
NM_005639chr122544 317 --31350 734 575 1129
NM_005657chr151121 ------
NM_005665chr164918 4553 4314 1854 1566 451 14641 --13758
NM_005667chr21153 ------
NM_005668chr533904 3732 1786 21277 60 23911 3268 13184
NM_005711chr52949 189 11075 ----
NM_005715chr682754 2476 1949 1056 539 502 168 93 ------
NM_005717chr11378 ------
NM_005719chr12--1186 ----
NM_005721chr23988 935 808 1106 1431 2338 215
NM_005722chr252293 1867 1547 772 692 11663 ----
NM_005725chr132369 1599 355 22270 626 11654 11551
NM_005730chr1253624 2616 2451 2230 612 13579 ----
NM_005734chr112113 41 --1565 --
NM_005738chr721521 626 1794 21639 1616 --
NM_005739chr1522106 1550 ------
NM_005746chr742474 2247 2241 101 32204 729 558 11916 2474 401
NM_005748chr1222837 115 32790 2384 1368 2496 386 --
NM_005749chr171544 ----1658
NM_005754chr52937 427 ----11221
NM_005759chr284792 4764 4668 4019 1586 1476 570 21 1839 ----
NM_005776chr144711 669 614 161 1547 ----
NM_005778chr31418 ------
NM_005779chr593533 3490 3472 2631 1452 930 647 377 69 ------
NM_005802chr94780 538 249 167 ------
NM_005806chr2121300 950 ------
NM_005807chr12156 130 ------
NM_005808chr353294 3286 2192 2183 285 23472 3084 12354 --
NM_005813chr242585 2442 2350 2199 --11819 --
NM_005819chr193048 2977 2747 2613 2333 1305 1106 1076 788 43262 2396 1372 886 ----
NM_005822chr641866 1605 833 406 --1507 11940
NM_005828chr1752002 1841 870 486 284 15088 34011 3127 1620 --
NM_005839chr13840 395 34 ------
NM_005840chrX87690 6698 6405 5390 2716 1612 654 644 17492 37517 6218 2360 11887
NM_005842chr133293 220 174 ----1630
NM_005845chr1321627 1329 1128 --21143 398
NM_005857chr12289 263 1419 ----
NM_005859chr541328 1088 979 465 --2575 308 11066
NM_005862chr31798 ------
NM_005871chr103359 159 83 1336 ----
NM_005880chr1621403 1024 1226 21288 290 --
NM_005882chr41225 1377 --1182
NM_005885chr521156 22 --1116 --
NM_005895chr1274147 4018 3871 3502 3469 472 266 --164 --
NM_005898chr1163010 2414 1991 1955 1251 86 2963 326 --1316
NM_005899chr1731565 1299 475 11056 --1984
NM_005900chr421039 472 --1109 2943 53
NM_005901chr18128716 8600 6666 6394 5418 3426 3279 2327 1871 1688 1589 120 26655 2132 27146 2464 1168
NM_005903chr555071 5065 3364 1242 1157 21494 909 --34616 522 317
NM_005906chr631638 530 244 --2478 264 1129
NM_005909chr514238 33705 957 61 44273 3096 1626 974 --
NM_005911chr241394 1340 504 389 ----11081
NM_005920chr143870 3545 3336 475 12576 ----
NM_005930chr141215 ------
NM_005935chr4105076 3692 3618 3591 3289 1249 969 785 582 495 14149 ----
NM_005937chr1754126 3879 3872 3324 911 22534 369 ----
NM_005941chr842785 1527 1218 51 ----23091 1287
NM_005944chr331224 309 223 ----145
NM_005955chr175272 5117 4500 4071 3743 456 266 2284 87 15011 --
NM_005957chr174949 4715 4649 4007 3544 677 500 24851 378 ----
NM_005962chr1042158 2135 1764 283 ----1132
NM_005962chr1042158 2135 1764 283 ----1132
NM_005966chr231739 774 315 1789 2660 572 22191 393
NM_005968chr191160 ------
NM_005996chr1231340 1334 962 ------
NM_006002chr13297 38 ------
NM_006007chr963606 3212 3170 1724 1142 536 11741 11042 13589
NM_006011chr1554198 4148 3110 804 294 33735 1509 996 --11565
NM_006015chr121233 1206 ------
NM_006016chr652217 1621 1476 749 615 11951 1501 --
NM_006031chr21----140 --
NM_006047chr2022383 1094 1880 1874 --
NM_006048chr13446 371 248 11143 --11100
NM_006054chr114551 427 99 66 31627 1089 286 11190 --
NM_006055chr262744 2241 903 584 545 112 21073 287 13200 --
NM_006080chr722110 960 22207 2159 21163 481 21949 1145
NM_006085chr141237 494 364 83 --1189 --
NM_006094chr892440 2414 2316 2238 2176 1704 1534 359 143 12255 ----
NM_006095chr474003 1666 1482 1459 973 748 217 23888 1408 ----
NM_006106chr1112908 1503 --12244
NM_006109chr14--1236 ----
NM_006113chr161599 776 665 647 503 472 --1402 --
NM_006135chr121405 1396 ------
NM_006139chr282841 2610 2542 1799 1165 889 846 262 11017 32367 1145 812 12466
NM_006141chr1622287 718 11967 ----
NM_006154chr153715 648 395 1141 12835 --
NM_006158chr871446 1357 1282 1263 1216 615 196 --11790 --
NM_006162chr1811138 ------
NM_006166chr1292526 2328 2027 1992 1941 1900 627 448 165 --1138 --
NM_006178chr1751297 1276 1144 494 293 11363 --11639
NM_006180chr931938 1899 1827 ----11742
NM_006183chr122583 69 ------
NM_006190chr23983 690 282 11080 11072 --
NM_006196chr2------1365
NM_006197chr822084 425 1678 21926 1383 --
NM_006203chr5155615 5253 5088 4745 4410 4345 4207 3865 3732 3725 1534 965 748 352 330 23871 3509 14891 --
NM_006206chr442862 2524 1852 99 22665 2181 12045 --
NM_006209chr81356 176 1167 --
NM_006210chr192397 42 ------
NM_006212chr154071 3731 3399 3338 1203 25442 3466 23312 475 25384 4763
NM_006226chr221288 433 --11182 --
NM_006241chr342324 2267 481 387 1354 --11558
NM_006246chr1421177 482 1865 ----
NM_006251chr543295 3077 2048 378 12139 21089 259 12551
NM_006252chr1106449 5464 5332 5016 2180 1921 1801 1728 544 178 27617 6531 13021 --
NM_006254chr31421 ------
NM_006257chr104978 362 303 69 2286 89 --1265
NM_006258chr1011388 21509 305 11315 11155
NM_006267chr271906 1669 1470 423 341 219 70 2393 373 --11386
NM_006275chr2052237 1580 454 356 126 --32390 812 76 --
NM_006281chr8169 ------
NM_006281chr8169 ------
NM_006282chr2042945 1778 1673 1587 24568 4459 12912 --
NM_006283chr894916 3790 1987 1788 1777 1765 1000 748 720 24533 1378 ----
NM_006290chr621634 1538 2763 295 --11870
NM_006306chrX84965 3979 1582 887 710 604 588 429 25491 3800 168 --
NM_006310chr1711226 ------
NM_006313chr1251682 1672 1501 1211 1141 31695 1380 1198 --1158
NM_006320chr41367 2746 153 ----
NM_006330chr8--1316 11337 21244 1134
NM_006335chr1--1205 --2769 266
NM_006343chr22372 86 --2421 394 --
NM_006345chr41890 1220 ----
NM_006346chr13------1120
NM_006352chr141685 1590 742 625 ----11786
NM_006359chrX31946 754 535 12208 12420 12339
NM_006364chr1421168 1042 1240 --11272
NM_006379chr732125 1948 669 1866 ----
NM_006380chr17104376 4317 3887 3304 3042 2969 1656 1470 1438 1249 11167 --1753
NM_006386chr2242295 1973 1964 580 12362 1315 --
NM_006393chr1044346 3245 3020 88 14085 24166 915 14071
NM_006400chr121110 ------
NM_006403chr641738 1436 1404 477 11672 --11388
NM_006416chr62803 617 ------
NM_006420chr2053206 2999 2549 2127 776 32293 2202 477 ----
NM_006427chr141167 ------
NM_006434chr1023214 1207 12790 ----
NM_006449chr222093 87 1499 ----
NM_006457chr463918 3300 3231 821 518 162 33500 724 35 43063 2607 2562 1309 --
NM_006460chr1741467 618 372 259 ------
NM_006467chr562315 2213 2159 743 96 61 31840 435 259 --2659 313
NM_006476chr111498 1275 243 31 --
NM_006482chr1243538 3129 832 92 ------
NM_006489chr1441892 1300 233 223 11719 ----
NM_006504chr1012842 --11923 --
NM_006526chr2042140 1527 436 390 1485 1325 11837
NM_006527chr41564 ----1233
NM_006532chr1921766 369 ------
NM_006534chr2063088 2990 2483 1246 546 150 ------
NM_006538chr264134 4088 3898 3885 1158 44 ------
NM_006544chr1484692 3952 3840 2100 1869 1622 1119 703 25428 932 45401 4705 4446 2162 11091
NM_006547chr7--11366 21880 1860 --
NM_006549chr1272525 2229 1915 558 426 182 133 1621 ----
NM_006561chr1075935 4478 3951 1492 1147 666 160 24151 365 ----
NM_006572chr1753190 1027 826 547 360 13385 43314 2532 1083 878 --
NM_006577chr241044 828 364 125 ------
NM_006595chr1121823 788 41963 1778 1679 1316 --1696
NM_006597chr11--150 ----
NM_006599chr16108016 7801 7771 7530 6847 5928 3247 2001 1330 164 1805 38021 7472 242 --
NM_006601chr1231097 714 111 --1957 --
NM_006609chr21612 32924 2776 214 22319 905 12102
NM_006612chr171482 ------
NM_006614chr372481 2268 1080 872 583 568 304 12824 1349 --
NM_006620chr673835 3535 3450 3261 1766 1262 346 14590 1430 --
NM_006625chr11206 --1867 --
NM_006625chr11206 --1867 --
NM_006625chr11206 --1867 --
NM_006628chr1584662 4176 3034 2829 1789 1672 565 98 1511 23076 555 2505 228
NM_006629chr1832668 2406 132 1445 ----
NM_006633chr51170 ----1702
NM_006654chr1241867 1301 1107 492 43450 3397 746 670 ----
NM_006698chr2021441 1404 1517 ----
NM_006699chr152265 2184 2025 1946 391 ----11876
NM_006706chr53531 284 42 1342 --1839
NM_006713chr52666 565 ------
NM_006717chr962754 2732 2410 716 68 51 23249 2860 ----
NM_006722chr342933 964 920 327 ------
NM_006726chr44958 888 401 344 --21019 157 --
NM_006727chr5----172 --
NM_006731chr995623 5072 2193 1920 1127 694 627 608 77 35210 4102 1337 11903 15771
NM_006735chr7173 ------
NM_006738chr15104412 3479 3380 3217 1622 1506 1322 681 411 372 ----11570
NM_006745chr411086 ----1970
NM_006750chr16107935 5582 5563 5435 4922 2502 1642 1054 745 658 25181 1463 21515 1041 1898
NM_006751chr22165 143 3684 314 196 ----
NM_006754chr72369 77 1203 ----
NM_006756chr831008 529 113 --1481 --
NM_006761chr17--2783 334 ----
NM_006769chr11717 ------
NM_006775chr672459 2280 1904 861 853 522 91 22089 598 12314 --
NM_006777chrX42242 2109 2021 96 1286 1496 22513 1023
NM_006788chr182856 456 --11334 1245
NM_006791chr151546 ------
NM_006800chrX----1577 --
NM_006802chr1----1948 --
NM_006805chr571650 1436 1417 1220 589 413 166 --11676 2451 270
NM_006811chr2041004 794 777 696 --2341 160 --
NM_006813chr61334 --2822 208 --
NM_006819chr111297 ------
NM_006827chr1423135 625 ----1641
NM_006828chr6--124 179 --
NM_006838chr1221449 717 ----1335
NM_006846chr52339 106 ------
NM_006852chr1731090 1046 861 3854 375 315 --1887
NM_006856chr124823 716 704 446 ------
NM_006873chr263019 1288 859 770 717 585 --11004 --
NM_006884chr331814 741 460 --11846 11388
NM_006885chr1653726 3332 2791 976 337 --11609 --
NM_006888chr1442928 2458 327 235 23097 752 32687 2227 1261 23407 3390
NM_006898chr22514 236 ------
NM_006910chr16--1292 2140 132 --
NM_006913chr61301 ------
NM_006914chr941252 1180 959 188 ------
NM_006915chrX5909 900 582 62 25 --22123 159 1665
NM_006916chr22513 244 ------
NM_006918chr11105841 5827 5745 4967 4856 4778 4766 1958 1305 803 34834 1185 496 35021 4309 3571 --
NM_006920chr21725 ------
NM_006924chr1744100 3010 2892 1283 23548 3241 ----
NM_006939chr1451040 814 344 258 40 ------
NM_006940chr1241819 1773 1651 1348 ------
NM_006947chr42374 282 ------
NM_006948chr2162439 1992 880 726 397 25 2778 425 --22252 436
NM_006981chr922412 48 22360 2017 21924 976 --
NM_006988chr211189 ------
NM_006997chr102390 143 ------
NM_007007chr1283453 1358 1307 1109 946 931 758 324 11337 33846 840 461 1213
NM_007011chr1576312 5099 4840 4797 4280 2738 1359 11005 26892 1169 25580 1457
NM_007013chr81757 1954 ----
NM_007015chr133278 247 233 ------
NM_007023chr21944 --1182 --
NM_007034chr11979 ----2812 647
NM_007035chr12--1714 1749 --
NM_007036chr51870 ------
NM_007038chr21125640 5616 5525 5286 5233 5139 5029 4067 1298 1131 1051 214 45982 5044 3713 280 ----
NM_007039chr1462209 2187 799 265 218 94 ------
NM_007043chr1242119 861 287 78 ------
NM_007073chr6104242 4067 3553 3475 3459 2788 1543 990 909 394 ------
NM_007106chr1332644 1008 494 ----1849
NM_007107chr351911 938 903 706 146 --21887 1666 --
NM_007111chr132857 229 ------
NM_007114chr311172 42471 2214 970 390 --23033 189
NM_007124chr641817 1535 549 259 1694 1660 --
NM_007125chrY41462 1450 1322 1193 1267 ----
NM_007129chr13------11002
NM_007153chr1974042 3691 3490 3200 1316 961 630 --24475 3174 --
NM_007157chrX62868 2821 2813 2581 934 705 12224 ----
NM_007158chr12942 262 ------
NM_007159chr351729 548 499 376 219 21319 653 21439 1156 --
NM_007166chr1141471 541 339 317 ------
NM_007172chr2233016 1231 1028 1224 12257 13256
NM_007173chr1152195 1778 1563 1473 364 --1281 1178
NM_007175chr883523 2546 2334 1418 671 499 350 245 22625 1262 1364 --
NM_007176chr1451619 1171 1142 620 349 11632 ----
NM_007187chr1331081 1031 819 --1124 --
NM_007192chr1431130 978 325 199 ----
NM_007197chr121984 --1333 --
NM_007200chr15104412 3479 3380 3217 1622 1506 1322 681 411 372 ----11570
NM_007203chr993470 3380 1542 1499 1469 1364 882 525 35 --13014 13449
NM_007204chr12559 122 1113 1527 --
NM_007207chr12833 298 ------
NM_007212chr142232 1795 1437 691 21577 279 11922 --
NM_007217chr31365 1327 ----
NM_007218chr82660 34 1264 ----
NM_007220chrX53712 1594 913 646 94 11048 ----
NM_007222chr81684 11638 11797 --
NM_007231chrX22297 71 22424 440 12011 --
NM_007240chr1----1192 --
NM_007249chr1377950 5693 2463 2395 1773 1225 1167 78715 8258 7650 7571 7021 3487 3018 47420 3763 3302 865 38542 6791 3159
NM_007279chr191603 ------
NM_007282chr32625 60 1840 ----
NM_007287chr362794 975 876 707 454 108 --11259 --
NM_007288chr362794 975 876 707 454 108 --11259 --
NM_007289chr362794 975 876 707 454 108 --11259 --
NM_007308chr4--1685 ----
NM_007325chrX22017 1530 ----1235
NM_007331chr41804 12589 2524 184 --
NM_007345chr1811639 168 11629 12208
NM_007346chr201345 ------
NM_007347chr1523041 425 23196 656 ----
NM_007349chr7--1364 ----
NM_007350chr1274017 1451 1164 980 930 342 41 33827 986 80 11390 --
NM_007351chr421064 67 ----1165
NM_007358chr141648 1259 755 376 --11458 11885
NM_007373chr1051483 1382 608 456 210 --11320 --
NM_007375chr172768 2739 2219 1799 1073 892 863 21896 391 ----
NM_012069chrX42139 1824 1011 516 ------
NM_012072chr2053691 3100 3009 826 667 34260 2782 682 --2787 705
NM_012081chr5103558 3416 3372 3313 3266 3201 3049 700 584 126 22838 2551 ----
NM_012089chr111401 ----1106
NM_012092chr221961 774 31696 1662 56 1646 --
NM_012095chr1043060 2563 1398 651 --22229 603 13196
NM_012096chr373508 2801 621 155 120 112 38 33614 3388 2847 12739 12510
NM_012097chr252186 2178 1802 1712 654 11917 11483 1147
NM_012102chr132652 2624 1014 11965 --12210
NM_012104chr1153661 3624 3513 3125 476 13323 11252 1277
NM_012104chr1153661 3624 3513 3125 476 13323 11252 1277
NM_012113chr11396 ------
NM_012115chr62386 129 ------
NM_012120chr642672 2552 1999 699 12566 1383 1254
NM_012129chr742467 2436 1683 1669 12356 ----
NM_012137chr122295 129 --12487 11139
NM_012141chr1354057 3387 3286 971 260 32581 1488 638 13108 1111
NM_012158chr1361737 1698 744 377 108 62 ------
NM_012161chr4--1905 ----
NM_012164chr967497 7445 6108 5780 5064 2878 36593 2657 1494 24971 2724 35333 5109 1449
NM_012180chr42624 298 --1465 --
NM_012193chr1154953 4583 2144 928 350 15057 64356 3828 3513 3435 3426 1249 1620
NM_012199chr184504 4004 3351 2979 2855 1834 1276 425 33591 3427 924 1336 --
NM_012202chr11--1372 ----
NM_012207chr1051093 946 398 178 130 ------
NM_012214chr286268 5968 4377 3885 1586 308 203 169 1140 24513 1430 36395 5856 86
NM_012219chr342284 1206 996 112 ----23099 3083
NM_012223chr231139 858 69 --1136 --
NM_012224chr41433 21094 45 11177 --
NM_012234chr373747 3372 3196 1405 668 138 73 1939 32964 2822 543 1515
NM_012238chr1051779 1743 1505 179 76 --1637 --
NM_012249chr243530 3015 1258 324 1109 22789 562 11200
NM_012252chr734651 1512 311 24524 4435 ----
NM_012255chr202430 55 ------
NM_012259chr621366 1087 --1128 --
NM_012262chr1125067 5039 3723 3438 1477 1208 1158 983 787 768 511 40 34793 4357 1692 24953 1616 --
NM_012287chr354120 4075 3726 3654 1053 33866 3745 2799 13533 2900 820
NM_012290chr22303 71 ------
NM_012297chr432397 1716 596 1214 --11991
NM_012309chr1144364 3095 1872 506 ----14315
NM_012316chr185509 4989 4226 3581 2241 1479 1323 952 25596 4810 24783 446 1894
NM_012318chr411254 --11342 11221
NM_012322chr72342 317 1390 ----
NM_012325chr2021360 612 ----1548
NM_012326chr2----1336 --
NM_012328chr721285 116 21394 1254 ----
NM_012330chr101562 ------
NM_012334chr554480 4138 1277 1097 588 14521 12989 11001
NM_012342chr102194 161 139 ----
NM_012343chr531016 801 783 1456 ----
NM_012345chr1331652 695 229 ------
NM_012347chr672711 2314 2288 2120 710 669 551 --1373 --
NM_012395chr753347 2571 2340 540 532 1422 --1612
NM_012398chr192259 248 --12146 --
NM_012399chr2262020 1956 1918 709 666 142 11385 ----
NM_012405chr183877 3089 2520 1210 1022 895 887 629 ------
NM_012416chr92461 283 --1322 --
NM_012417chr171629 ----1461
NM_012431chr743253 1085 161 42 33088 2696 842 23568 271 --
NM_012446chr5----1558 --
NM_012449chr7170 ------
NM_012454chr6----1551 --
NM_012464chr422939 2294 1282 1207 1195
NM_013229chr1212253 ------
NM_013230chrY61453 1271 1115 606 296 161 1171 ----
NM_013231chr14114079 3914 3532 3082 2921 2780 1420 929 733 535 90 31106 635 123 ----
NM_013233chr2--21010 516 11155 11037
NM_013238chr1321909 380 1596 ----
NM_013254chr121225 --1110 --
NM_013257chr862216 2207 1812 912 493 65 1794 1767 --
NM_013259chr31275 ------
NM_013261chr433569 2412 343 1665 32811 2417 1288 --
NM_013269chr1274561 4337 3922 3741 3203 3022 1558 13368 --12747
NM_013309chr1562250 1699 650 334 291 53 12425 ----
NM_013316chr721082 214 ------
NM_013320chr121144 ------
NM_013341chr292868 2840 2447 2347 2193 2125 411 319 136 12471 1958 --
NM_013354chr851445 1424 300 228 46 --2530 405 --
NM_013374chr31169 32635 290 228 --12928
NM_013380chr192820 548 1696 ----
NM_013381chr1232235 2080 173 1583 ----
NM_013386chr141821 1510 1200 630 1294 --21354 700
NM_013390chr951741 589 428 211 152 ----1390
NM_013417chr93414 171 131 --1351 --
NM_013436chr22603 302 --2280 175 1246
NM_013437chr841341 1033 936 307 11005 ----
NM_013438chr941775 1543 472 301 ------
NM_013444chrX1435 ------
NM_013448chr14------128
NM_013449chr1252682 2651 2317 1063 281 --11837 11880
NM_013943chr121323 873 13029 ----
NM_013958chr81433 1394 ----
NM_013959chr81433 1394 ----
NM_013961chr81433 1394 ----
NM_013962chr81433 1394 ----
NM_013989chr1453454 938 877 588 410 34191 1446 1434 ----
NM_013995chrX42590 2430 789 405 1540 1511 --
NM_013996chr72414 367 ------
NM_013996chr72414 367 ------
NM_013997chr72414 367 ------
NM_013997chr72414 367 ------
NM_013998chr72414 367 ------
NM_013998chr72414 367 ------
NM_014011chr232587 2275 2259 12240 1272 --
NM_014021chr133399 2621 1247 12767 13509 1381
NM_014028chr693127 2447 2104 773 414 291 237 88 59 11325 22246 629 --
NM_014034chr621013 215 1486 --1149
NM_014035chr511429 ------
NM_014038chr73393 83 69 ------
NM_014048chr16115113 5007 4891 4696 4664 4138 3609 3564 1834 1516 450 12042 34600 1932 888 --
NM_014057chr91292 11607 ----
NM_014059chr131304 1381 ----
NM_014071chr202436 21 ----129
NM_014079chr3177 1982 ----
NM_014089chr132905 215 2705 137 11515 --
NM_014106chr1572533 2188 2166 1104 387 213 122 --1422 32544 2302 2102
NM_014112chr834883 1308 879 35500 5327 353 15166 --
NM_014141chr71547 33590 3412 1202 ----
NM_014153chr163534 508 99 ------
NM_014154chr321294 598 21248 1066 ----
NM_014155chr11126995 6699 6537 6279 5936 4763 1977 1896 1840 660 320 211 26473 6181 26966 4735 --
NM_014178chr141106 1499 ----
NM_014181chr222261 1944 ----11047
NM_014246chr2242211 1810 1468 481 ----1605
NM_014250chr2252154 1985 1934 1728 299 1490 ----
NM_014253chrX52523 2390 1950 669 561 12074 --22331 392
NM_014264chr42444 171 ------
NM_014267chr111792 --1354 --
NM_014268chr1831252 365 249 --31394 504 257 --
NM_014283chr1----1424 21106 71
NM_014293chr2273670 3419 2616 2564 2515 1483 51 44127 3781 3180 791 ----
NM_014294chr851122 1110 1077 907 153 ------
NM_014296chr331118 546 142 21541 1325 1453 11520
NM_014309chr22125118 5041 4831 4751 4649 4637 4383 4363 3932 3835 3590 1181 ------
NM_014319chr1221954 1260 --11921 --
NM_014325chr1241896 1516 472 51 31706 659 501 ----
NM_014326chr1511229 ------
NM_014331chr4107847 7593 6638 6627 5464 3026 2984 2947 2811 2126 37084 2417 1873 --47813 5746 5250 1543
NM_014332chrX2349 80 --1419 --
NM_014333chr11--1255 --21860 263
NM_014335chr1541021 444 312 102 1469 134 --
NM_014350chr521056 978 ----3168 151 41
NM_014363chr13--1235 ----
NM_014372chr131667 1590 302 ----1583
NM_014376chr542489 2383 2148 2110 12039 22051 751 --
NM_014382chr361732 1618 1222 436 88 23 21672 623 ----
NM_014393chr862326 1570 922 901 579 274 ----1530
NM_014395chr431995 1530 559 12004 --31666 1227 421
NM_014399chr7--2929 756 1825 2908 192
NM_014415chr331453 435 89 --1247 11056
NM_014423chr585530 5286 5085 5063 3939 1710 1246 880 22124 1732 13749 25049 540
NM_014431chr1031624 1210 1164 --11357 11304
NM_014445chr361766 1714 1576 1542 692 231 32128 396 49 21948 1912 --
NM_014447chr441613 1568 1061 1046 ------
NM_014462chr82308 84 ------
NM_014481chrX2331 306 ------
NM_014489chr11------1866
NM_014494chr1621975 1683 ----21773 160
NM_014504chr731617 1418 555 --2192 29 --
NM_014515chr122276 157 ------
NM_014521chr241822 1233 614 224 ------
NM_014522chrX1650 ------
NM_014547chr15--1305 ----
NM_014547chr15--1305 ----
NM_014554chr12--21875 1530 --11462
NM_014569chr741408 1201 365 223 1308 ----
NM_014574chr1441191 1174 223 36 ------
NM_014583chr3--1461 ----
NM_014584chr1431674 560 532 21242 486 21657 1154 11430
NM_014586chr2174789 4541 4474 3884 1873 1645 1305 1748 ----
NM_014587chr1611565 ------
NM_014612chr921204 239 --1407 --
NM_014613chr532703 2623 408 22229 781 1594 22911 2723
NM_014615chr1663581 3551 3324 2352 510 321 ------
NM_014616chr342940 2858 372 213 33264 2136 192 13370 --
NM_014630chr1563239 3108 2993 1385 812 791 22841 321 ----
NM_014633chr111387 1486 1182 --
NM_014637chr821282 1133 --1512 --
NM_014648chr321343 503 1147 --137
NM_014660chr72978 168 --1297 1210
NM_014666chr52970 374 ------
NM_014667chr33703 166 123 --1977 1458
NM_014670chr221008 541 21453 218 ----
NM_014671chr751569 1528 1366 598 557 11337 ----
NM_014676chr131455 1216 256 ------
NM_014677chr811235 --11267 11284
NM_014679chr1141277 1209 385 295 ----1391
NM_014682chr872244 2111 2059 1873 1591 876 729 11721 12127 1766
NM_014683chr1771774 1676 549 439 262 171 66 21425 139 1675 --
NM_014685chr161379 ------
NM_014686chr1932081 1786 612 21638 316 ----
NM_014689chr23544 482 217 ----191
NM_014701chr1593365 2926 2857 1266 916 903 719 387 141 ------
NM_014702chr623427 739 1107 43007 2671 2534 771 12318
NM_014705chr731977 1951 1585 --1369 2752 377
NM_014707chr762082 2035 1940 1719 673 70 ------
NM_014709chr24548 455 428 76 ----1114
NM_014711chr1631891 1582 393 1455 1836 --
NM_014713chr22467 349 --1454 --
NM_014720chr1021319 1149 21563 1497 --11599
NM_014721chr6107172 6966 6900 6275 5429 2957 2449 2149 755 548 45628 1645 971 89 17404 26012 5757
NM_014729chr841894 1851 387 130 11494 11626 1596
NM_014730chr1264805 1829 1123 1046 750 621 1802 --21702 884
NM_014730chr1264805 1829 1123 1046 750 621 1802 --21702 884
NM_014733chr542213 2011 1813 506 11834 ----
NM_014735chrX52009 1727 793 615 252 ------
NM_014736chr152388 162 --2666 304 --
NM_014739chr674175 3619 2631 771 698 541 222 24162 453 2943 736 --
NM_014743chr452948 2100 889 460 268 1874 --1220
NM_014746chr254185 1517 1459 1171 422 --14150 --
NM_014755chr272922 2595 1642 1577 461 344 91 33735 3031 251 --13268
NM_014756chr111155 ------
NM_014758chr1122271 635 ----22437 2331
NM_014765chr1102681 2224 1899 1079 1028 1016 883 428 419 95 ----11933
NM_014779chr31431 ------
NM_014781chr821292 412 2887 347 1938 --
NM_014783chr1531527 1205 169 11717 11552 11119
NM_014787chr172686 2282 2274 2255 2224 1746 435 22306 569 ----
NM_014790chr5--1518 1146 --
NM_014797chr643152 2869 2432 820 22768 73 42464 2371 2199 25 --
NM_014800chr7----1432 --
NM_014802chr125896 727 411 124 94 1923 ----
NM_014803chr1022717 775 1758 --3998 576 171
NM_014810chr122459 979 ----23069 916
NM_014812chr151770 1409 725 437 197 11718 ----
NM_014819chr532368 2347 1530 --12115 1796
NM_014820chr331857 568 128 ------
NM_014824chr111799 11419 11591 11801
NM_014827chr121691 204 ----11660
NM_014829chr522368 2086 22326 1662 1142 1298
NM_014830chr1253170 3032 2787 2441 1329 13942 11267 12692
NM_014832chr1331767 1742 1416 11972 --1425
NM_014836chr1031891 1848 622 11550 ----
NM_014839chr122297 1013 --12174 --
NM_014840chr1283308 3095 3019 483 477 374 130 59 ----13186
NM_014841chr64334 228 219 22 ------
NM_014846chr81313 168 ----
NM_014848chr1541770 788 720 420 1458 1560 --
NM_014859chr1741200 1190 1165 1056 ------
NM_014864chr124230 3309 12969 14322 --
NM_014872chr932375 706 153 ------
NM_014873chr153860 2997 1358 838 437 --1332 13842
NM_014874chr131878 1452 296 --21883 304 --
NM_014877chr1777681 5190 4801 2995 2844 819 744 --33024 2721 984 12216
NM_014883chr421659 503 12127 --12301
NM_014891chr731570 1434 671 1250 11408 --
NM_014892chr61657 --1460 --
NM_014893chrY1675 11977 11554 --
NM_014897chr1763108 2816 2203 935 316 233 11026 1864 --
NM_014899chr542947 2105 2075 694 --11256 --
NM_014900chr241185 860 800 362 ------
NM_014903chr1221832 770 --12343 --
NM_014904chr1043449 1624 1600 855 1599 11585 23866 840
NM_014905chr231943 290 236 11886 11661 --
NM_014906chr1723518 693 --11216 --
NM_014909chr1473790 3371 2616 903 731 250 213 --11305 --
NM_014912chr1073509 2941 2838 2323 1331 1267 251 12898 ----
NM_014913chr1821372 1308 --21401 379 --
NM_014914chr2--1427 2997 833 11111
NM_014918chr1531521 1253 1054 1230 ----
NM_014920chr653643 3043 2682 1132 1085 1184 ----
NM_014923chr1362234 1945 1937 1617 783 492 --1654 --
NM_014932chr33637 447 410 --11668 1203
NM_014936chr692779 2437 2416 2122 1050 909 622 394 307 --22029 1954 1600
NM_014939chr182513 248 --170 11181
NM_014946chr243028 1089 786 124 1139 --12186
NM_014947chr173055 2349 2286 760 669 594 266 --12067 12200
NM_014949chr14363 304 261 62 1977 ----
NM_014950chr141228 21241 678 ----
NM_014951chr1032437 1819 454 1489 ----
NM_014962chr2032414 910 25 22325 1057 1356 12768
NM_014967chr1531536 1185 940 11052 ----
NM_014978chr1031705 1269 207 11795 ----
NM_014982chr1474984 4950 4613 4395 3774 3396 1888 ----24489 1158
NM_014988chr41427 --12267 --
NM_014991chr463207 3040 2942 938 757 347 12207 ----
NM_014996chr31118 ------
NM_014999chr1241552 1426 1415 293 11039 --11077
NM_015000chr1252338 1052 879 836 62 ------
NM_015002chr1242222 2071 1543 253 21734 572 ----
NM_015008chr322843 2392 22771 321 --1780
NM_015009chr3--1781 ----
NM_015017chr131156 1099 92 --11161 --
NM_015020chr1633220 1289 1069 ----33331 3034 3026
NM_015024chr811231 ------
NM_015025chr252114 1712 1071 730 568 1106 ----
NM_015026chr1244351 3285 1759 496 24028 3981 ----
NM_015027chr1631618 1326 1245 21633 482 1578 11379
NM_015032chr1352124 492 418 301 72 2851 366 ----
NM_015035chr20116667 5780 5630 5263 4543 4411 4169 2288 2085 2041 1802 66678 5465 5131 5048 1953 1259 11830 --
NM_015042chr1564340 1705 1612 1238 1088 925 --34177 3195 1461 --
NM_015044chr1652372 1277 1185 638 586 11251 1496 22885 823
NM_015045chr1011588 11841 12030 --
NM_015049chr263253 2885 2045 1097 1039 84 13330 13028 --
NM_015051chr952477 2244 2167 2155 2093 12233 21167 445 12197
NM_015055chr1172712 2554 1918 1806 1121 939 791 21107 292 1265 --
NM_015071chr576470 6155 4899 1445 1287 936 233 31706 1635 834 31734 868 480 --
NM_015073chr1921950 701 --1684 --
NM_015074chr1124880 4847 4579 4322 3648 3310 1977 1484 1242 1110 1036 852 14040 24363 4013 11270
NM_015076chr654264 3716 3628 1321 1088 13862 ----
NM_015087chr1332434 2147 365 ----11650
NM_015091chr142537 128 ------
NM_015092chr16104643 4413 4145 3886 3577 3462 1171 927 487 453 --11219 --
NM_015093chr641772 1231 381 226 11319 ----
NM_015097chr31854 1505 --11632
NM_015100chr12333 97 ------
NM_015101chr172881 2549 2535 2496 617 599 499 --32111 717 697 --
NM_015110chr972476 2247 1778 1580 573 217 24 ----1888
NM_015115chr463238 3168 3094 1156 393 160 2931 680 12674 1589
NM_015132chr721482 630 1418 ----
NM_015137chr812378 21806 980 1684 11022
NM_015138chr1531960 1798 579 12129 1708 12004
NM_015141chr372774 2735 2016 1745 929 259 78 --1362 --
NM_015143chr441417 1258 274 136 --11207 11339
NM_015144chr1613891 11547 13348 11138
NM_015149chr162212 2148 1791 280 227 182 ------
NM_015156chr1454013 3973 925 833 25 ----12818
NM_015157chr1111164 ------
NM_015170chr852172 1814 841 311 146 3414 379 345 --1126
NM_015176chr1--2386 130 11386 --
NM_015180chr142727 604 1850 ----
NM_015191chr1152388 2056 1995 1762 960 ------
NM_015192chr2072765 2685 2480 2280 757 640 568 ----32881 2419 624
NM_015199chr332344 1195 755 ----22674 2633
NM_015200chr452400 1928 989 818 294 22523 69 12353 --
NM_015203chr1182 ------
NM_015206chr1552530 1505 1288 1235 1110 1627 33759 2917 1200 1774
NM_015208chr1842598 1309 1162 434 13199 12684 13047
NM_015209chr13805 463 430 2413 405 ----
NM_015215chr152320 2173 2109 1124 226 ----11056
NM_015230chr431907 1773 1704 ------
NM_015233chr1332727 2699 618 --12219 --
NM_015234chr641320 1280 962 67 --1937 --
NM_015236chr421479 1096 --11361 --
NM_015245chr66989 906 878 437 317 141 ----22565 1891
NM_015246chr161200 ------
NM_015247chr1664811 3624 3303 1477 985 612 14351 14042 13902
NM_015250chr961771 1740 1444 735 371 22 1771 ----
NM_015251chr1652225 1849 793 417 148 ----1908
NM_015263chr1541239 1188 937 273 2296 119 ----
NM_015264chr2254845 4633 4277 1722 1540 24119 3005 11184 --
NM_015265chr222448 1034 ----11817
NM_015269chr12565 213 1588 --1616
NM_015271chr433665 2979 1454 13124 ----
NM_015272chr1631318 678 286 ----1496
NM_015275chr1252122 1538 1437 335 228 ----21833 252
NM_015277chr1841605 1388 177 47 1755 --1434
NM_015278chr642233 2109 1213 592 1957 ----
NM_015285chr1852353 1892 1733 607 302 ----1403
NM_015291chr133419 3352 3049 124 ----
NM_015296chr1311161 ------
NM_015310chr8106660 6317 6048 5924 5743 5295 5238 2016 1551 206 35992 5301 2124 --1650
NM_015313chr1164853 4535 4527 3976 1431 388 21775 772 23010 348 1366
NM_015314chr752598 2572 2268 894 102 1540 1410 --
NM_015315chr532791 1191 25 33500 3208 2533 --13344
NM_015317chr22950 171 ------
NM_015323chr621275 1257 ----11173
NM_015328chr792713 2248 2163 1228 1104 1016 986 788 688 ------
NM_015335chr1232364 2181 1813 12495 ----
NM_015336chr122808 380 --22494 1715 --
NM_015347chr1232150 1013 252 22680 755 22720 184 1269
NM_015349chr672861 2680 2600 1925 1231 294 182 42899 1050 769 380 2343 120 --
NM_015352chr2033805 3632 3517 13660 --13789
NM_015355chr1741367 772 501 142 21924 761 --11993
NM_015358chr2131223 249 29 ------
NM_015359chr842945 2317 887 382 ------
NM_015361chr23786 742 70 ------
NM_015365chrX53891 2939 2840 1181 527 23382 1250 13585 12929
NM_015375chr1105000 4015 3133 1675 1382 1233 1007 433 117 73 43355 1933 890 131 43799 3094 1906 1604 14315
NM_015379chr71236 --178 --
NM_015385chr1023214 1207 12790 ----
NM_015396chr33477 86 73 ------
NM_015407chr31165 ------
NM_015409chr1212048 --1812 12719
NM_015415chr12245 66 ------
NM_015423chr11172 11614 1389 --
NM_015435chr831418 1410 362 1228 11392 1272
NM_015439chr61474 133 ----
NM_015458chr895250 4858 4620 3510 3281 1781 1133 798 381 ----14883
NM_015460chr321684 345 ------
NM_015461chr182532 257 1625 ----
NM_015462chr171266 ------
NM_015464chr73660 61 54 199 ----
NM_015469chr93759 565 232 --1712 2578 96
NM_015475chr21120 --1194 2767 319
NM_015483chr71143 ------
NM_015485chr11295 ------
NM_015497chr15--11070 ----
NM_015507chrX1164 --122 --
NM_015508chr311527 11065 128 --
NM_015509chr122180 33 ----11590
NM_015520chr342500 2033 1101 937 1842 12668 --
NM_015532chr1572566 2381 2354 2106 2018 1918 843 ----32182 191 175
NM_015535chr233367 838 499 24152 3355 1190 1474
NM_015542chr1041094 397 384 288 ------
NM_015548chr63730 139 131 11009 1674 --
NM_015549chr141609 ------
NM_015550chr753499 3054 2932 2419 46 1632 ----
NM_015554chr1562851 2116 1785 711 537 452 ------
NM_015555chr641703 1305 1274 353 ----1111
NM_015560chr332879 2516 310 1708 2670 501 12771
NM_015565chr2152260 772 755 660 482 1696 32145 2106 230 --
NM_015567chr1331338 1087 75 ----11047
NM_015569chr144577 4202 3171 851 14873 24531 59 23855 293
NM_015570chr741351 738 521 62 1260 ----
NM_015571chr6102279 2058 2027 1747 1048 577 496 423 327 116 1738 21913 943 12485
NM_015575chr222407 1460 ------
NM_015576chr322500 727 22584 397 2352 202 12026
NM_015578chr1951738 1572 837 344 222 --11531 --
NM_015601chr103385 110 49 ------
NM_015605chr1031502 369 309 2527 59 11412 11352
NM_015626chr171114 2997 820 ----
NM_015630chr221141 198 1262 --1227
NM_015635chr9----1534 --
NM_015640chr145301 3470 1203 288 24165 312 1747 23369 638
NM_015641chr73946 199 186 175 ----
NM_015652chr102653 130 1240 ----
NM_015678chr1331414 1222 555 ------
NM_015691chrX52524 995 749 450 89 11964 1285 --
NM_015702chr2245 32 ------
NM_015711chr19----1128 --
NM_015834chr212973 785 ------
NM_015866chr121311 999 1345 ----
NM_015874chr4135 1161 ----
NM_015878chr841854 1593 512 137 12023 --11994
NM_015879chr18168559 8212 7815 7402 7224 6493 6344 5493 3402 2420 1892 1567 1522 1510 577 208 --33089 2077 599 16964
NM_015886chr8115402 5295 4826 4094 3843 2197 2038 1807 1688 963 445 13550 55435 4379 2297 621 326 23798 183
NM_015888chr122604 2165 53282 2952 2825 1333 213 33301 2647 1345 12275
NM_015891chr62147 88 --1225 11291
NM_015902chr81619 ------
NM_015906chr184120 3441 1600 1395 976 850 374 249 24410 1328 33992 358 339 --
NM_015912chr841825 1696 896 453 12318 1284 1211
NM_015915chr141250 ----1286
NM_015932chr13166 ------
NM_015949chr71735 ------
NM_015957chr112262 165 ------
NM_015975chrX31857 509 206 ----11604
NM_015976chr1--1133 1307 --
NM_015981chr533037 624 156 13106 --1784
NM_015984chr1----1481 --
NM_016002chr11568 --2222 58 166
NM_016006chr31259 ------
NM_016009chr154376 4168 3915 1526 1263 24236 3554 ----
NM_016018chr892742 2682 2599 2253 1822 1770 893 393 348 ------
NM_016019chr74947 866 295 138 ------
NM_016021chr632100 1919 518 22818 797 22427 226 22478 611
NM_016037chr11758 ------
NM_016038chr7187 --1101 --
NM_016042chr91240 ------
NM_016061chr261456 1269 1174 596 424 379 11518 --11314
NM_016072chr1272417 2307 1588 1581 1531 931 271 31972 1715 58 ----
NM_016073chr1541111 982 221 78 ------
NM_016076chr142048 1102 170 145 ------
NM_016078chr1731121 1061 1029 --1803 --
NM_016081chr452057 1912 1648 1597 763 --22230 352 --
NM_016083chr663271 3028 2811 2514 1380 478 1690 --1947
NM_016087chr711342 ----11391
NM_016090chr111307 ------
NM_016094chr3--2750 30 ----
NM_016096chr832068 2013 367 21950 851 ----
NM_016100chr201347 ------
NM_016103chr5154 2148 77 ----
NM_016106chr141126 ----134
NM_016107chr511152 ----1170
NM_016125chr17----1234 --
NM_016131chr282231 1966 1830 787 619 240 161 139 --1406 --
NM_016132chr1552500 2390 1198 1124 481 --22345 2124 --
NM_016133chr2----1220 --
NM_016192chr21260 ------
NM_016206chr3148788 8494 8185 6010 6002 3586 3368 2138 1989 1383 1370 982 894 200 57760 3289 1058 801 728 38166 2543 1240 12192
NM_016224chr652060 1931 1924 1519 48 ------
NM_016227chr1----1424 21106 71
NM_016231chr1751475 1401 1141 132 86 61742 1707 1587 1422 1213 1206 1413 --
NM_016247chr32426 55 ------
NM_016248chr1393946 3778 3692 2989 2530 2466 1381 648 33 181 12885 1258
NM_016252chr2166 1756 --2737 723
NM_016255chr653352 2920 2614 2174 2123 --33149 3002 2839 2636 154
NM_016258chr11642 ------
NM_016260chr296687 6178 6140 6011 4759 2544 1888 917 302 11210 26965 2840 26484 1638
NM_016262chr61564 ------
NM_016271chr1852068 1505 677 321 86 1449 22332 1680 --
NM_016272chr223837 611 225 ------
NM_016281chr1221175 925 ------
NM_016287chr181961 1814 1730 1724 1591 1459 360 255 11976 ----
NM_016289chr241813 680 637 177 12121 ----
NM_016300chr3----1496 --
NM_016308chr141798 1461 1347 712 ----137
NM_016312chr121444 --1517 --
NM_016315chr241714 1411 1244 1162 ------
NM_016322chr952534 2162 2072 2041 29 23083 666 ----
NM_016338chr521044 257 --11207 1329
NM_016340chr511004 --1476 2451 432
NM_016357chr1221078 889 11276 --1115
NM_016377chr61366 11325 --11350
NM_016395chr1571787 1688 1292 1284 469 380 176 ------
NM_016396chr1552796 2373 1876 929 634 1592 12424 --
NM_016422chr1121008 46 1888 --33177 1140 548
NM_016436chr2062715 2684 2104 1788 1085 1064 1286 12320 --
NM_016441chr262398 2127 1726 275 248 112 12328 --11821
NM_016448chr111541 11793 --21344 477
NM_016472chr1411496 ----11050
NM_016480chr55806 710 596 361 216 ------
NM_016485chr652081 759 738 687 100 ------
NM_016507chr1722537 484 1537 12799 32853 2612 2099
NM_016512chr81255 ------
NM_016513chr653643 3043 2682 1132 1085 1184 ----
NM_016518chr172885 743 2599 190 1572 1724
NM_016530chr1571636 1587 1114 809 734 445 344 ----1787
NM_016531chr4104078 3754 3565 3469 2897 2567 1233 1069 963 104 23064 1539 1440 --
NM_016542chrX1582 --11396 11646
NM_016547chr11703 ------
NM_016569chr1231340 1334 962 ------
NM_016577chr363664 2776 1655 1259 360 41 --11377 1332
NM_016588chr61183 ------
NM_016603chr5--22257 442 2124 70 11739
NM_016604chr51306 ----11104
NM_016605chr51439 ----12375
NM_016613chr462723 2136 1965 927 556 212 11911 22706 202 --
NM_016620chr11981 149 ----
NM_016621chr1174511 4266 3638 1358 728 402 140 ----1872
NM_016626chr1851723 1646 1579 1372 277 21801 1265 1392 --
NM_016630chr15--1218 ----
NM_016631chr21126 1773 131 --
NM_016651chr1431157 1024 377 ------
NM_016654chr151530 ------
NM_016824chr1021819 370 --11171 --
NM_016831chr142041 1933 1901 1846 21922 1675 11657 1397
NM_016950chr41327 ----1131
NM_016953chr245708 5687 4796 1232 23742 1194 ----
NM_016954chrX2471 55 --1258 --
NM_017412chr841374 1124 564 251 1169 11308 11133
NM_017415chr574379 3542 1436 1341 1321 136 93 --14490 --
NM_017420chr1433802 665 312 ----12810
NM_017423chr452210 2176 2099 1786 410 2697 372 ----
NM_017425chr11194 ------
NM_017426chr42563 458 --1429 --
NM_017437chr1432328 977 676 --2704 30 1295
NM_017440chr121578 1604 --1142
NM_017447chr2194397 4378 4364 4321 3679 3293 3244 3129 2743 23661 3309 23521 471 11334
NM_017489chr811151 1844 ----
NM_017519chr621264 187 1166 ----
NM_017540chr522716 2679 22965 2061 1594 1725
NM_017548chr371850 1768 1732 1500 1387 869 780 1840 ----
NM_017554chr332103 1517 706 21511 200 --22235 1877
NM_017563chr376307 5588 5113 4264 671 139 115 55891 5348 1756 395 89 15038 --
NM_017577chr311652 11487 1156 135
NM_017588chr91121 11912 ----
NM_017590chr2222170 2013 1367 ----
NM_017594chr933195 2966 478 ------
NM_017599chr1251850 1805 1777 1549 238 --11843 11957
NM_017610chr1562146 1660 1630 1359 826 210 ------
NM_017626chr10----196 --
NM_017628chr475245 4952 4543 3645 3391 3216 77 21478 179 14171 --
NM_017629chr141237 766 667 634 --11281 11725
NM_017632chr4------2404 41
NM_017633chr653926 1523 1349 966 796 22891 845 --23527 2636
NM_017635chr1121039 463 ------
NM_017637chr9138610 8604 8096 6101 5942 5775 3363 3196 3111 3023 2941 2339 1096 11491 28958 87 11463
NM_017640chr61250 ----1315
NM_017641chr1221143 444 11104 --1298
NM_017643chr1732669 2497 612 11012 12886 1223
NM_017644chr384624 4557 4271 2055 1897 805 399 258 --35199 927 227 --
NM_017646chr12458 428 1574 ----
NM_017650chr7105880 5081 4871 4518 4384 3718 2034 1436 648 608 24394 309 25049 4670 24569 2172
NM_017658chr1484619 4436 3125 1846 1527 1503 1032 634 34063 1778 111 31429 1318 819 --
NM_017661chr1521298 487 ------
NM_017662chr952070 2025 399 238 31 22091 297 21848 1469 --
NM_017666chrX11866 --2545 268 --
NM_017672chr1541208 1182 496 280 1949 ----
NM_017686chr11979 ------
NM_017693chr1321370 532 1324 21254 1066 11566
NM_017709chr1144279 4158 3902 3763 3376 2833 2777 2758 2693 1331 1282 411 380 367 1718 14235 --
NM_017712chr1966331 5962 5664 5350 4640 3903 46360 5946 4150 952 24444 4330 14777
NM_017719chr332212 2195 1702 11658 --11708
NM_017734chr11157 --1213 --
NM_017736chr1693124 3101 2902 2777 2771 2423 1149 816 99 22147 2001 ----
NM_017737chr152061 1434 885 594 436 ----11576
NM_017742chr1831873 636 295 11495 21685 337 11902
NM_017747chr51120 ------
NM_017752chrX32147 840 420 --11843 --
NM_017753chr91298 ------
NM_017754chr694639 4466 4459 4093 3091 1688 1682 1484 856 33478 2010 1206 44935 4189 1361 1254 2742 172
NM_017761chr1182 --2972 182 --
NM_017762chr1532429 2383 2350 ----1736
NM_017768chr13755 742 693 ------
NM_017769chr1442646 2054 977 641 --12013 23053 943
NM_017779chr132709 2142 30 ----2438 282
NM_017780chr81223 ------
NM_017786chr82506 441 --2490 118 --
NM_017789chr25835 688 659 303 174 --1849 --
NM_017791chr1461655 1371 1087 632 214 122 1388 ----
NM_017798chr2041117 319 161 66 ------
NM_017799chr1431385 697 607 31941 1817 1550 ----
NM_017813chr821673 262 25831 1692 24711 919 --
NM_017822chr121235 ------
NM_017824chr1052187 1858 978 737 430 ------
NM_017831chr1833737 1567 1288 24045 738 33205 3071 711 24312 60
NM_017848chrX53696 3661 3334 885 809 22981 1444 11590 --
NM_017902chr1064779 4377 3578 2073 1936 183 44077 1953 1470 1086 ----
NM_017905chr133599 528 198 ------
NM_017910chr2--129 1332 --
NM_017919chr975715 5477 5014 4890 4412 2198 306 --25660 5566 25825 2186
NM_017922chr141455 --197 --
NM_017925chr951862 1348 723 486 274 2611 183 --1334
NM_017934chr61116 ------
NM_017935chr41532 167 --2562 231
NM_017938chrX51963 1901 1730 1400 508 ------
NM_017955chr141791 ------
NM_017958chr232384 2366 1157 22156 737 22539 263 1668
NM_017964chr22311 168 1963 ----
NM_017966chr1131435 1208 319 1343 2618 421 --
NM_017987chr1052242 628 580 472 109 --1335 11577
NM_017993chr131288 ------
NM_017994chr752782 1900 1843 533 247 32763 1094 410 ----
NM_017998chr951253 1172 967 360 36 1459 1583 196
NM_018004chr34373 345 303 294 ----1149
NM_018018chr12------21594 67
NM_018030chr181220 1701 --1391
NM_018043chr1131324 310 301 11517 ----
NM_018046chr541914 1822 1715 623 ------
NM_018061chr111404 11488 21359 1089 11453
NM_018078chr41110 ------
NM_018079chr2--1380 ----
NM_018084chr252945 2021 1044 866 537 --13188 --
NM_018085chr1107921 6681 6666 5361 5350 2506 2102 1343 1232 686 48090 5693 1791 1370 --16299
NM_018086chr2--1193 ----
NM_018094chrX--1416 ----
NM_018098chr34392 353 92 78 --1137 --
NM_018105chr82914 92 ------
NM_018112chr92789 174 1368 2410 377 1243
NM_018119chr161271 1243 ----
NM_018120chr821366 1238 1578 ----
NM_018121chr1072770 2453 2324 2125 1287 1207 397 2354 127 ----
NM_018126chr411474 --11430 --
NM_018128chr1721021 936 11335 ----
NM_018133chr311725 ------
NM_018155chr383105 2267 2153 1245 995 876 599 498 32895 897 796 1168 13448
NM_018164chr12------1308
NM_018167chr14136 ------
NM_018169chr122491 161 ----2545 223
NM_018181chr1831356 550 271 21781 1700 1182 --
NM_018200chr1562603 2069 1705 989 119 46 22081 79 ----
NM_018227chr453211 2499 2132 751 36 ------
NM_018243chr483995 3439 2635 1122 1008 907 576 289 --12744 12771
NM_018247chr652648 2450 2403 800 558 1717 ----
NM_018254chr122216 2044 ----11650
NM_018263chr262459 1611 919 691 631 337 22564 519 ----
NM_018268chr53697 345 221 1622 1780 --
NM_018287chr1041188 932 377 174 ------
NM_018293chr332748 2302 2054 --22158 913 --
NM_018298chr12882 681 --1907 --
NM_018299chr893338 3115 2965 2643 2608 1212 1071 849 513 ------
NM_018303chr63578 193 79 1175 11368 --
NM_018312chr1131708 755 545 11730 --2719 360
NM_018313chr362567 2182 2148 1752 494 293 32541 1641 275 ----
NM_018315chr421226 1081 ------
NM_018323chr441709 1273 1204 677 1496 1583 --
NM_018330chr101568 21712 1462 11535 11270
NM_018340chr1633936 1850 1445 21868 949 24751 4275 24064 3763
NM_018348chr1631077 1027 55 ------
NM_018351chr12134304 4259 3990 3846 3731 3496 3108 3066 876 697 501 490 421 21809 1472 ----
NM_018361chr853479 2506 598 382 275 13369 24004 3603 1794
NM_018362chr1153134 2864 1591 1165 904 --33010 2851 702 --
NM_018364chr193912 3896 3386 3368 2671 2532 924 404 364 11329 ----
NM_018367chr112468 200 11669 31695 628 382 22304 859
NM_018372chr12624 283 ------
NM_018374chr794945 4936 4927 4919 4374 3415 1818 354 187 43594 3316 1135 905 34429 3941 3308 24958 208
NM_018375chr1431871 1463 1227 ------
NM_018383chr232032 789 427 1832 --1599
NM_018387chr92438 113 1176 1100 --
NM_018394chr31142 31254 437 389 ----
NM_018403chr321486 1471 22947 660 33727 3636 2686 --
NM_018413chr12153 ------
NM_018427chr1651448 1188 510 399 265 ------
NM_018429chr521878 137 22719 143 --42826 2793 2248 1777
NM_018431chr201545 1667 1479 --
NM_018439chr1842511 935 602 208 31826 1791 224 ----
NM_018440chr8138520 7553 7516 7333 7298 6625 6200 5796 2688 2523 1927 1528 908 36339 5449 2803 13274 31390 1289 718
NM_018444chr851942 1697 1644 1455 729 2657 221 1564 11811
NM_018448chr12--1248 ----
NM_018456chr31125 ------
NM_018460chr2--1163 ----
NM_018464chr102361 348 ------
NM_018471chr21401 ------
NM_018472chrX1123 ------
NM_018475chr41165 --1609 --
NM_018482chr832148 919 878 ------
NM_018489chr11928 ------
NM_018490chr1121731 321 1246 11205 --
NM_018509chr1711701 ------
NM_018557chr231234 1060 79 ----11584
NM_018566chr164985 4495 3935 3174 3121 1614 54893 4729 3941 1649 1547 --1107
NM_018569chr4------11293
NM_018571chr2--1542 134 197
NM_018590chr1061590 1212 647 462 240 146 1471 ----
NM_018638chr1244865 4805 4258 41 24597 1820 35008 4117 1066 34141 4133 1551
NM_018640chr1262213 1933 1896 1025 262 239 --11079 22112 313
NM_018650chr112058 1345 12256 11728
NM_018652chr153301 226 196 1171 ----
NM_018657chr33743 706 92 --1799 --
NM_018682chr73584 477 255 ------
NM_018695chr521523 873 22469 467 ----
NM_018696chr1821028 97 ------
NM_018703chr16--1292 2140 132 --
NM_018704chr111579 --1301 1809
NM_018710chr83531 415 321 21299 205 --2937 448
NM_018834chr53929 763 713 1722 ----
NM_018841chr163946 3815 3722 3643 220 85 13879 ----
NM_018844chr721434 703 21720 1712 1159 --
NM_018847chr931854 1756 534 21767 646 --1463
NM_018934chr51287 ------
NM_018939chr53631 217 177 --1187 --
NM_018963chr2111104 2944 347 21352 491 --
NM_018970chr743056 2495 2391 467 ------
NM_018976chr1252602 2402 1022 368 302 1325 11101 1346
NM_018979chr1232246 2111 890 ----1865
NM_018983chr4--1265 --1276
NM_018999chr10104628 3872 3699 3494 3407 3367 3349 1492 1465 914 34493 1698 1577 --24571 4011
NM_019000chr531093 633 519 ------
NM_019001chr374890 4171 3361 1427 1344 861 690 14244 21940 1929 --
NM_019004chr752300 911 711 621 321 --22322 66 --
NM_019022chr1853046 2101 1287 262 24 ------
NM_019027chr432151 414 55 12424 --12546
NM_019028chr111368 ------
NM_019030chr51207 ------
NM_019040chr11191 ------
NM_019045chrX--1833 ----
NM_019050chr431846 1427 641 ----21879 1644
NM_019053chr10--2343 296 ----
NM_019060chr11281 ------
NM_019072chr5104190 3684 1092 1024 608 561 449 346 293 59 --23328 988 14090
NM_019084chr1021886 322 22025 1879 --1737
NM_019094chr1283850 3596 2868 2831 1044 764 344 307 ------
NM_019114chr972357 1684 1601 610 351 228 149 1833 --12521
NM_019116chr1623603 570 --13594 --
NM_019556chrX--1161 --1228
NM_019590chr1011088 1558 ----
NM_019591chr121133 1344 ----
NM_019610chr152148 1631 1510 771 713 --21858 193 --
NM_019859chr1011623 11586 11297 --
NM_019860chr1011671 11634 11345 --
NM_019885chr252716 2457 952 593 114 1572 ----
NM_019895chr32254 94 ------
NM_019903chr1021819 370 --11171 --
NM_020066chr121028 211 ------
NM_020120chr221075 138 135 ----
NM_020122chr264633 4392 4366 945 348 42 56045 4685 3689 1846 1487 --14894
NM_020130chr82981 578 1251 ----
NM_020132chr2174212 4165 4064 3834 1386 1341 135 23997 3149 14135 --
NM_020141chr13902 746 654 ------
NM_020148chr1832591 1112 544 1105 --12623
NM_020156chr71457 ------
NM_020159chr441749 617 426 45 1437 21130 400 1506
NM_020168chr151242 ------
NM_020177chr572962 2120 1232 1068 913 549 98 22893 2246 ----
NM_020180chr181851 ------
NM_020182chr2053573 3540 2585 647 362 --1652 13314
NM_020184chr212300 ------
NM_020185chr6--1120 ----
NM_020199chr53925 450 38 21066 824 143 --
NM_020200chr1031071 853 438 --3311 208 58 --
NM_020204chr14686 223 162 116 1702 1679 --
NM_020205chr142848 2614 755 224 22387 487 ----
NM_020226chr41565 ------
NM_020245chr694927 4805 4450 4078 1929 1603 1067 485 173 25083 1073 ----
NM_020307chr32351 103 ------
NM_020309chr19------1287
NM_020336chr2063602 3492 3134 879 815 155 11349 --13608
NM_020337chr443023 2820 2368 300 12204 ----
NM_020341chr2041316 750 672 522 1211 ----
NM_020342chr272280 2233 2086 1770 604 475 129 --1716 11654
NM_020344chr91134 ------
NM_020346chr1151370 1268 1061 601 380 --21520 354 --
NM_020354chr103938 111 27 ------
NM_020357chr321337 1298 ----1615
NM_020382chr1211606 21597 192 ----
NM_020390chr364893 4522 4228 3289 851 584 24051 3266 13986 --
NM_020403chr131528 --1427 --
NM_020409chr3--1325 ----
NM_020420chrY21338 734 1434 ----
NM_020423chr12473 239 ------
NM_020425chr641787 1495 388 374 ------
NM_020429chr731965 588 447 ------
NM_020432chr731979 1599 656 --31424 369 262 22307 668
NM_020440chr141114 1082 658 128 2575 562 12852 --
NM_020443chr186175 5355 2649 2390 1836 1524 1429 938 --36722 5471 2545 --
NM_020452chr122122 519 ------
NM_020455chr632647 2609 1725 12296 12205 --
NM_020456chr1342059 745 317 108 11444 32324 2197 387 --
NM_020463chr241452 400 188 181 ------
NM_020466chr6114975 4732 4349 4261 4058 3572 3496 811 360 317 110 44635 3779 1486 497 1470 --
NM_020473chrX21593 1399 --11701 --
NM_020474chr1831608 1494 343 11732 --11812
NM_020529chr14138 ------
NM_020548chr21215 ------
NM_020630chr101100 ------
NM_020651chr231801 1752 263 ------
NM_020661chr1241586 1566 1484 398 21701 1357 21330 389 --
NM_020666chr51874 ------
NM_020673chr2067309 5279 2556 2431 962 25 27701 1527 35692 5440 2018 26751 5757
NM_020693chr111217 ------
NM_020699chr144526 4019 3468 1149 ------
NM_020715chr1422086 1754 --22238 1694 1657
NM_020717chrX44314 1711 1129 271 14332 --34881 3141 1746
NM_020718chr1636468 4844 2586 35238 5141 2162 12648 --
NM_020726chr51234 ------
NM_020727chr2163980 2673 1374 538 522 385 2820 125 12471 23229 2784
NM_020732chr621264 187 1166 ----
NM_020734chr1263322 3245 3025 2197 1062 743 1906 12150 --
NM_020739chr1543949 3659 177 34 --11652 24193 1453
NM_020742chrX52531 2309 2044 844 382 12376 --11787
NM_020747chr52868 338 186 --1781
NM_020748chr172639 168 ----1689
NM_020752chr1072880 2700 2202 2169 2109 847 777 12677 ----
NM_020755chr621511 140 --2590 381 148
NM_020766chrX23437 214 23249 1294 1593 24195 753
NM_020768chr542529 1166 532 231 ----11064
NM_020772chr17178635 8475 7635 7539 7382 7284 7097 6413 5356 2840 2480 2321 2001 1763 1537 735 367 16268 37479 6226 1631 12411
NM_020773chr452619 993 730 390 380 ------
NM_020774chr18115945 5823 4937 4781 4363 4142 3961 2156 2139 905 874 41696 1508 654 206 14052 26126 4018
NM_020782chr1254609 3560 1585 1107 1024 24779 3942 24405 896 2163 150
NM_020783chr1812051 --1549 --
NM_020792chr342178 756 177 109 12164 22387 889 1638
NM_020794chr121523 625 11352 ----
NM_020796chr522871 2123 --12551 --
NM_020800chr32992 118 --1372 --
NM_020801chr552555 2195 2074 921 877 1317 11798 1199
NM_020805chr1841947 1520 459 420 11289 ----
NM_020806chr14------1621
NM_020809chr1132214 1446 663 22068 1935 1164 --
NM_020818chr14169 ------
NM_020824chr102636 235 1559 ----
NM_020841chr1222645 654 33721 3306 865 23366 187 --
NM_020843chr15----125 1166
NM_020844chr8147364 7227 6272 6185 4942 4779 2928 2549 2406 449 205 192 137 93 34948 1298 734 13010 37600 5626 2502
NM_020854chr1871300 1199 1133 984 169 140 74 2582 378 --167
NM_020856chr19------11086
NM_020859chr443930 3837 2904 2477 --1532 --
NM_020866chr132326 34 ------
NM_020868chr212003 31911 1872 153 21982 1637 --
NM_020870chr442248 2214 628 317 1333 --11797
NM_020871chrX21762 1699 --42248 1626 407 213 2871 44
NM_020872chr341586 393 195 38 1419 ----
NM_020895chr191294 ------
NM_020918chr1073622 3506 2340 926 917 725 207 13435 --13598
NM_020922chrX2295 109 --31226 250 153 --
NM_020932chrX3490 103 96 1346 ----
NM_020935chr284480 4098 3066 3058 2830 739 616 40 21764 1571 21086 97 --
NM_020937chr14184 ------
NM_020940chr1062963 2231 1970 1141 869 392 --22422 1148 --
NM_020943chr2------1189
NM_020948chr163718 2770 2348 1293 966 335 43173 258 223 112 --12626
NM_020951chr1922211 360 --21932 980 --
NM_020952chr91180 ------
NM_020958chr142342 88 ------
NM_020973chr43536 185 179 ------
NM_020977chr411992 32077 153 60 --11399
NM_020980chr151632 ----11753
NM_020987chr1041290 1060 937 457 ------
NM_020988chr16--1219 129 --
NM_021005chr151906 1848 11184 --
NM_021007chr221798 335 ----11876
NM_021032chr352039 1914 1897 462 188 --1446 --
NM_021033chr1343510 3341 2995 1046 1270 ----
NM_021038chr363278 3240 2574 743 228 50 ------
NM_021072chr552142 1770 942 662 557 1874 ----
NM_021079chr1762840 2620 2312 2078 1157 151 12028 --12745
NM_021090chr2274629 3765 3757 1833 1291 1180 726 13852 11395 24467 4278
NM_021103chr21214 ------
NM_021104chr121243 ------
NM_021111chr921321 914 --11150 --
NM_021116chr797773 7605 6949 5519 3614 3414 3279 2791 2177 28341 5762 29116 7402 16442
NM_021136chr141714 --2729 177 --
NM_021145chr721179 896 ------
NM_021148chr742317 2103 1590 46 --1127 --
NM_021156chr2011088 ------
NM_021183chrX52159 1739 1022 990 476 12165 --21853 680
NM_021190chr11444 11178 158 --
NM_021194chr11293 --125 --
NM_021201chr1142050 1766 1740 134 11881 1835 --
NM_021205chr111055 22157 2081 22734 2432 12880
NM_021215chr2052216 1893 1508 705 216 11600 ----
NM_021238chr12--21475 318 --11842
NM_021239chr1411114 11431 ----
NM_021252chr1041565 1536 557 132 11676 31416 370 32 11695
NM_021260chr1411197 ------
NM_021572chr66986 875 439 397 267 260 2995 362 ----
NM_021574chr2231681 996 926 11721 --1990
NM_021619chr9----11242 11307
NM_021620chr62687 505 1139 ----
NM_021622chr1052264 2032 2024 789 721 11832 ----
NM_021629chr3105063 4014 3594 2043 1778 987 812 600 219 89 --24698 1385 13380
NM_021637chrX183 11000 ----
NM_021643chr251882 1467 1436 1250 270 --21359 1336 11546
NM_021644chr1051093 946 398 178 130 ------
NM_021648chr632159 457 63 12520 22643 2616 12736
NM_021813chr675287 5215 4756 4628 4097 1971 752 25009 1437 14024 11062
NM_021814chr631243 1148 1110 ------
NM_021815chr231981 1225 301 ----13100
NM_021911chr565146 4959 3712 1710 1361 538 25089 74 1599 1450
NM_021912chr1533164 1388 1011 23603 777 24154 2841 --
NM_021914chr1441564 953 428 407 12266 22247 1969 --
NM_021935chr331037 321 59 1854 ----
NM_021940chr621512 163 11629 1250 --
NM_021942chr43831 681 259 ------
NM_021946chrX1510 ------
NM_021949chrX32430 1017 691 ----12731
NM_021951chr92811 116 133 ----
NM_021954chr1353202 2707 547 496 172 13529 --23575 2327
NM_021956chr641150 987 397 172 21062 563 ----
NM_021960chr131701 1115 685 12014 1616 --
NM_021961chr11107118 7083 7059 6260 6092 5953 4973 4818 1382 626 --16353 1951
NM_021964chr375911 4750 4717 4178 2156 938 226 36672 6209 4684 35657 5199 5173 24429 1870
NM_021973chr41730 ----1220
NM_021977chr693223 2492 1376 1342 1058 867 738 695 382 ------
NM_021978chr111507 ------
NM_021998chrX2301 95 --152 1147
NM_021999chr13------1202
NM_022048chr1566208 5979 4910 1752 1227 242 ----25954 991
NM_022051chr1152 1622 ----
NM_022058chr22718 228 1649 --11810
NM_022068chr182227 195 140 ----
NM_022079chr103385 110 49 ------
NM_022080chr2092701 1969 1936 1046 923 662 628 337 282 12551 ----
NM_022093chr12992 715 ------
NM_022114chr164659 4638 3975 1228 672 570 ------
NM_022118chr13180 ------
NM_022121chr611078 ------
NM_022133chr8------2587 532
NM_022138chr621350 95 ----1258
NM_022165chr19----181 --
NM_022307chr72614 168 --1731 --
NM_022346chr42348 47 ------
NM_022351chr831478 1276 817 12405 13152 1847
NM_022366chr1141 170 ----
NM_022373chr7--1682 1389 1839
NM_022374chr22397 113 ------
NM_022444chr72287 171 ----1426
NM_022456chr12187718 7291 6770 6663 6309 6144 5937 5559 5222 4833 4742 3072 2810 2785 2309 2258 1883 799 --86612 5306 3062 2897 2284 2160 2151 72 1494
NM_022459chr13136128 5796 5542 4786 4463 2135 1874 1688 825 700 429 169 69 24145 1849 --16202
NM_022461chr311043 --11113 1131
NM_022465chr1223023 2189 ------
NM_022474chr143922 470 34 22675 571 --12490
NM_022476chr161980 2986 442 ----
NM_022482chr2052555 1981 1691 921 850 ----1828
NM_022484chr7187 21324 467 ----
NM_022495chr144441 223 212 83 ------
NM_022550chr51181 ------
NM_022576chr12326 113 ------
NM_022650chr54920 847 836 202 ------
NM_022652chr1241075 1057 832 450 ------
NM_022658chr1231041 191 146 ------
NM_022716chr142776 2300 821 786 42571 2478 2455 706 23038 1223 --
NM_022719chr2282720 2696 2492 2387 1521 1499 1126 950 21051 349 12426 --
NM_022750chr72761 54 ------
NM_022753chr132504 1002 49 1167 11956 1490
NM_022755chr922493 2431 2382 31 11755 --
NM_022763chr312512 12861 12413 --
NM_022770chr1621272 432 1491 11387 --
NM_022771chr123824 690 353 176 --2931 61
NM_022777chr71613 21497 358 31400 1374 1180 --
NM_022781chr943204 2588 1119 463 23197 924 11033 --
NM_022784chr152355 342 2824 88 ----
NM_022824chr541918 1455 615 128 31732 1555 339 ----
NM_022826chr21751 --1936 --
NM_022841chr153821 660 55 1483 ----
NM_022843chr1311122 --1398 11418
NM_022845chr1622110 1599 1222 11520 11612
NM_022893chr273084 3003 2429 2321 1106 768 171 12927 11166 12253
NM_022898chr1474856 4606 4599 4279 3038 1591 1041 11363 11625 14554
NM_022900chr721079 838 ------
NM_022901chr921488 250 --31885 1363 332 --
NM_022918chr1121551 670 2781 492 ----
NM_022977chrX52564 2290 1876 875 279 ----1725
NM_023000chr142419 219 1292 --1412
NM_023001chr142419 219 1292 --1412
NM_023016chr262591 2165 2052 2011 901 36 22785 2718 1112 --
NM_023037chr131249 ------
NM_023039chr51286 ------
NM_023074chr193893 543 236 ------
NM_023076chr1652911 2168 2153 2043 676 11150 --12865
NM_023079chr1721498 455 ------
NM_023923chr143484 3468 3397 3335 33457 2440 901 1238 11368
NM_023927chr511056 ------
NM_023929chr862536 2243 2086 840 285 172 175 --1922
NM_024117chr941353 343 233 207 ----11375
NM_024295chr821968 1649 --11956 --
NM_024332chrX51750 1493 1370 1341 665 21445 84 1708 --
NM_024345chr956147 6119 5349 4473 708 22041 1739 41972 745 508 155 35889 1098 916
NM_024416chr91292 11607 ----
NM_024423chr1854093 3324 3243 1409 715 1866 13039 --
NM_024491chr32636 100 ------
NM_024496chr141285 1213 ----
NM_024511chr483151 2979 2812 1038 789 190 114 91 21082 939 23465 2430 12392
NM_024520chr2178 ------
NM_024522chr111695 4177 171 165 153 1660 --
NM_024524chr321060 492 22116 1026 32275 1144 130 22577 2158
NM_024525chr11560 1213 1207 1135
NM_024529chr1----1109 --
NM_024539chrX11081 21208 25 ----
NM_024548chr341550 1201 1078 421 11636 ----
NM_024551chr1262564 2343 2267 1571 858 319 11793 ----
NM_024551chr1262564 2343 2267 1571 858 319 11793 ----
NM_024558chr144967 710 329 182 ------
NM_024561chr132345 100 11114 ----
NM_024563chr551843 1709 1262 518 85 ------
NM_024565chr521072 290 ----1681
NM_024570chr13133 1235 ----
NM_024582chr431125 1100 1059 189 ----
NM_024613chr821650 1338 ----11184
NM_024636chr722692 147 11040 12284 --
NM_024638chr382370 2018 1805 638 622 409 358 105 2815 573 ----
NM_024639chr692747 2566 2501 2018 1864 1133 637 529 247 --22303 571 --
NM_024645chr831578 1103 215 ------
NM_024646chr174016 3520 3421 3062 1567 1230 262 32931 2429 1483 1269 --
NM_024665chr354018 3680 3047 2873 1342 34701 2933 92 ----
NM_024670chr102463 74 11714 1470 --
NM_024674chr141975 1023 885 613 12629 13131 --
NM_024676chr111301 1496 11323 --
NM_024713chr1531555 1204 283 21602 1338 ----
NM_024721chr81872 ----22643 1063
NM_024744chr262334 2237 1893 1685 924 144 ----1701
NM_024763chr111231 1338 2165 110 --
NM_024770chr2105933 5648 5328 4527 4110 841 354 321 251 205 12113 36591 6447 4132 --
NM_024792chr173431 171 119 --1955 --
NM_024813chr111008 1295 ----
NM_024837chr1541646 662 587 83 21924 1184 ----
NM_024841chr1172369 2206 2200 1978 1931 881 635 21649 887 ----
NM_024913chr711434 1590 --1256
NM_024920chr4192 --11278 --
NM_024927chr172168 65 ------
NM_024941chr521199 144 1501 --1185
NM_024945chr91814 ----11120
NM_024947chr3149646 9462 9358 9262 8770 8096 7964 7178 6981 3223 2333 1592 597 75 26963 5944 22075 1507 27843 6817
NM_024949chr434744 4231 350 11136 11988 13226
NM_024953chr1212046 2919 590 22729 506 12278
NM_024971chr91180 ------
NM_024979chr1321464 521 --1533 --
NM_024989chr2108120 6499 5550 5061 2805 1834 1739 968 764 342 27086 5436 --35804 5730 5179
NM_024991chr1023214 1207 12790 ----
NM_024997chr1641209 1028 73 42 ------
NM_025027chr1921194 34 --1269 --
NM_025040chr1952466 1998 1784 1645 180 31852 1549 1515 32429 2410 684 --
NM_025054chr893949 3819 2880 1565 1024 975 961 75 53 21220 440 14094 --
NM_025073chr164460 1485 569 435 404 98 23662 605 34476 4371 4276 1893
NM_025074chr462959 2774 2630 2175 525 508 1987 ----
NM_025076chr22555 42 ----1596
NM_025077chr1----1276 --
NM_025106chr121489 1447 11383 ----
NM_025107chr642003 1968 845 336 12276 ----
NM_025126chr122488 40 ------
NM_025133chr2181 1228 --1879
NM_025134chr164969 637 307 119 1352 ----
NM_025141chr151183 1530 ----
NM_025147chr21406 --1450 --
NM_025151chr852070 1475 760 751 547 ------
NM_025152chr141689 2769 702 1139 --
NM_025160chr184304 3068 2876 831 607 496 403 367 --13884 --
NM_025164chr1151832 1439 1371 755 191 --1263 --
NM_025179chr164551 4342 4117 3247 3146 328 23859 1071 13717 11187
NM_025181chr2127 1297 1571 --
NM_025191chr132795 945 587 11175 23513 2372 --
NM_025222chr352096 582 475 414 94 1315 32785 2424 2194 12451
NM_025235chr1042222 1413 556 154 1274 ----
NM_025248chr1763117 2096 2041 1090 1017 859 21064 428 12840 --
NM_030594chr1531163 1092 1033 11085 ----
NM_030621chr1453914 3307 3247 2907 1623 33637 3001 1665 14084 21565 1428
NM_030625chr1021780 695 32308 2178 649 --12380
NM_030627chr544134 3562 3298 2833 13360 13876 --
NM_030629chr1621474 1377 ------
NM_030634chr121674 965 2148 37 154 --
NM_030637chr14------2529 128
NM_030647chr753999 937 562 530 396 46008 2422 1656 266 14588 --
NM_030648chr475550 5540 4950 4489 3814 3415 234 35359 1005 44 25070 3861 11783
NM_030650chr293483 3335 3029 2759 1164 904 738 397 105 23819 118 22689 2586 34206 749 141
NM_030664chr1032453 2243 1814 12338 2950 322 --
NM_030674chr1233671 1907 191 35613 5493 5144 1574 --
NM_030755chr1443077 2686 370 260 22341 870 11093 --
NM_030758chr221971 ------
NM_030774chr1161544 1448 1409 1323 1194 39 ------
NM_030777chr2042509 2355 2177 1849 ------
NM_030780chr841690 1419 350 197 ------
NM_030786chr151845 1461 1408 608 112 31717 616 594 ----
NM_030791chr1431381 738 686 --11524 21801 420
NM_030806chr189313 8439 8420 7128 6418 2180 2057 1148 19296 26266 2406 17206
NM_030816chr143387 1043 771 702 21391 524 ----
NM_030820chr631031 751 349 1989 ----
NM_030881chr2242295 1973 1964 580 12362 1315 --
NM_030911chr131167 1311 1657 --
NM_030918chr165314 5163 4284 3827 3636 1434 55181 4635 3734 3525 1416 ----
NM_030920chr151641 1610 1488 1332 833 1529 ----
NM_030939chr61231 ------
NM_030945chr541793 1782 1008 403 22598 2507 21877 597 --
NM_030962chr1121449 464 --21523 317 --
NM_031157chr123457 435 177 ------
NM_031203chr191160 ------
NM_031216chr1851845 1416 1396 615 40 1441 --1208
NM_031243chr722290 602 --22242 1592 --
NM_031267chr71424 185 ----
NM_031268chr1655343 5094 4413 2091 225 ----15158
NM_031271chr841467 1344 461 326 11300 --11365
NM_031283chr2----194 --
NM_031296chr452612 2327 2021 1964 405 --1763 --
NM_031309chr81934 ------
NM_031365chr22784 392 12753 ----
NM_031366chr22784 392 12753 ----
NM_031418chr1151888 1117 410 272 191 2897 155 22838 96 1125
NM_031419chr351405 1368 1340 502 240 --1560 1583
NM_031431chr1341833 1750 1606 1535 --11362 --
NM_031435chr1273289 2995 2913 2751 805 134 22 32907 1341 457 22492 1081 3601 176 105
NM_031438chr541702 591 435 386 1797 11823 --
NM_031439chr84572 548 413 336 ------
NM_031442chrX42395 2306 2069 458 1619 1463 --
NM_031453chr1042623 2528 2086 1937 11009 1331 11652
NM_031461chr821770 920 ------
NM_031468chr7117779 7005 6992 5356 5309 5176 5143 3311 2785 820 674 11650 ----
NM_031469chr683811 3576 2589 1179 1101 1045 220 120 13851 --2742 680
NM_031475chr12273 251 ------
NM_031483chr2073108 2332 1420 1120 503 313 41 1599 --12247
NM_031844chr1114119 3535 3409 3343 2748 2564 1603 1476 876 679 667 23865 610 24044 3184 --
NM_031845chr243707 3668 1429 611 ----1829
NM_031847chr243707 3668 1429 611 ----1829
NM_031858chr1731565 1299 475 11056 --1984
NM_031862chr1731565 1299 475 11056 --1984
NM_031890chr2263085 2498 1985 826 94 80 11906 ----
NM_031940chr842229 2178 578 370 42043 1934 603 528 ----
NM_031946chr71172 --1448 --
NM_031966chr5--1135 ----
NM_032012chr995080 5062 4492 1497 945 843 683 200 44 2286 251 21483 576 --
NM_032018chr12563 310 ------
NM_032021chr112931 377 ------
NM_032027chr1126 ------
NM_032038chr161219 ------
NM_032042chr542277 2243 1125 64 ----12744
NM_032047chr342364 1968 1610 432 12258 21778 288 32375 1871 861
NM_032102chr1131200 1087 40 22800 2214 1259 --
NM_032105chr157322 5799 1983 1713 1347 16848 36731 6620 6528 --
NM_032116chr13105881 5404 5041 4980 4672 4445 4116 3994 2058 1506 14005 21388 1023 25760 630
NM_032121chrX32558 2404 339 11941 21117 1008 1198
NM_032153chr342678 2539 2388 1000 22614 389 ----
NM_032154chr103928 785 710 1162 ----
NM_032160chr1874130 3767 3492 3220 1453 1257 168 11334 --11678
NM_032186chr11981 149 ----
NM_032189chr1365053 4383 1853 1616 1478 341 --34360 1252 753 11514
NM_032199chr1073652 3082 2626 2391 1414 1102 540 --13495 --
NM_032228chr11123562 3429 2832 2598 2321 2205 2194 1316 982 880 845 401 23230 2539 22426 435 --
NM_032231chr15145 ------
NM_032233chr141762 ------
NM_032246chr1511241 11258 11140 --
NM_032256chr122417 168 --1712 --
NM_032271chr1611477 ------
NM_032288chr311750 --11686 155
NM_032289chr531880 1500 1274 183 ----
NM_032291chr151793 1642 278 237 106 ------
NM_032312chr22670 344 ------
NM_032320chr112776 219 ------
NM_032352chr141122 --11394 --
NM_032373chr1085008 4897 3954 3779 3653 301 221 44 14568 11415 11343
NM_032379chr111901 ----1229
NM_032410chr831118 988 941 ------
NM_032434chr21439 ------
NM_032435chr132430 1549 758 21800 212 1850 --
NM_032436chr132410 153 ------
NM_032438chr631648 1564 556 11106 1176 --
NM_032439chr101565 ----11601
NM_032440chr1082760 2743 2624 2608 2277 744 349 74 ------
NM_032446chr553677 3582 2925 2706 792 21295 352 43758 3002 1237 1023 1337
NM_032457chr463906 3072 2762 1273 1226 206 21402 822 --23740 1014
NM_032458chrX23077 2930 --12689 13159
NM_032471chr6----11106 --
NM_032482chr1922669 900 ------
NM_032505chr322480 2228 12450 --11993
NM_032507chr61256 ------
NM_032509chr852381 2224 1608 875 122 1946 2714 322 --
NM_032510chr1822400 2015 1686 11677 11712
NM_032532chr62657 562 ----1509
NM_032558chr911257 1228 ----
NM_032560chr1431109 719 130 ------
NM_032582chr1731445 1167 297 ----11315
NM_032594chr1411063 ------
NM_032632chr145625 595 421 270 152 11859 ----
NM_032635chr19172 ------
NM_032664chr831168 432 379 --11682 174
NM_032727chr10151 11575 ----
NM_032765chr52269 127 ------
NM_032778chr333125 1208 833 ----22481 1045
NM_032784chr611017 ------
NM_032813chr13----1958 --
NM_032815chr1662069 2011 1977 800 177 38 22113 261 32531 2486 460 --
NM_032828chr19104937 4349 3505 3447 3317 1627 1457 999 489 214 --11943 21137 644
NM_032833chr132694 2650 2194 32515 584 119 --12111
NM_032837chr175776 622 461 159 52 11376 22068 1632 1129
NM_032838chr1921072 109 ------
NM_032857chr15--194 ----
NM_032859chr1334011 3833 2925 23878 2763 --23849 775
NM_032867chr111646 ------
NM_032873chr1194393 3695 3298 1535 1515 1124 938 853 174 1799 --14384
NM_032875chr171583 ------
NM_032900chr1053623 1147 942 447 99 --33850 3287 658 --
NM_032918chr1211269 1231 --1205
NM_032932chr1796243 5965 5615 4135 2414 2319 2260 1460 468 --21477 1073 --
NM_032936chr71192 ------
NM_032943chr111901 ----1229
NM_032949chr131156 ------
NM_032960chr12370 262 ------
NM_032961chr421003 388 ------
NM_032968chrX53535 1608 988 749 560 12886 1847 --
NM_032969chrX53535 1608 988 749 560 12886 1847 --
NM_032973chrY63531 1607 1454 988 749 560 12881 1847 --
NM_032975chr1833421 1395 1382 33432 2405 694 ----
NM_032980chr1833421 1395 1382 33432 2405 694 ----
NM_032983chr753292 3142 3018 2936 1139 --13359 --
NM_032991chr4161 ------
NM_032993chr4--1265 --1276
NM_033014chr91292 11607 ----
NM_033020chr184120 3441 1600 1395 976 850 374 249 24410 1328 33992 358 339 --
NM_033027chr331146 461 162 ------
NM_033030chr21167 --1386 --
NM_033055chr12394 245 21079 752 ----
NM_033058chr82931 336 ------
NM_033067chr1----1673 --
NM_033083chr323385 3172 33007 802 759 23036 2467 12363
NM_033121chr121623 1727 ----
NM_033132chr1331571 624 187 21963 1875 11998 11751
NM_033138chr732213 2039 841 1491 ----
NM_033139chr732213 2039 841 1491 ----
NM_033140chr732213 2039 841 1491 ----
NM_033143chr423389 3139 --1582 14110
NM_033157chr732213 2039 841 1491 ----
NM_033161chr93686 396 146 ------
NM_033181chr663271 3028 2811 2514 1380 478 1690 --1947
NM_033211chr52346 330 2454 152 1179 --
NM_033219chr91110 135 ----
NM_033222chr93339 175 32 158 --1946
NM_033224chr786653 5071 2124 1844 1249 745 571 180 47315 5817 2756 1053 25246 1723 27045 5607
NM_033227chr52563 117 1129 171 --
NM_033228chr52603 157 1169 1111 --
NM_033260chr61754 ------
NM_033276chr121291 ------
NM_033285chr884004 3915 3679 3095 1686 857 742 546 34209 3673 1232 1430 --
NM_033309chr16--11104 ----
NM_033331chr962723 549 504 497 477 468 23551 73 ----
NM_033360chr1273600 2989 2969 1795 1073 1053 1024 ------
NM_033389chr1764516 4344 4058 3642 3261 3042 14721 --21057 942
NM_033394chr231567 1363 1281 ------
NM_033426chr1421840 1069 1585 2969 28 12964
NM_033429chr1553090 2659 2437 443 81 143 ----
NM_033430chr493868 3078 1226 1023 747 505 320 194 95 1894 21434 1393 13897
NM_033437chr493868 3078 1226 1023 747 505 320 194 95 1894 21434 1393 13897
NM_033480chr672711 2314 2288 2120 710 669 551 --1373 --
NM_033481chr672711 2314 2288 2120 710 669 551 --1373 --
NM_033495chrX3893 309 149 ------
NM_033505chr275866 1585 1237 656 387 150 44 65211 4506 1917 1328 1095 1032 66113 5073 4947 2659 2210 88 32059 1280 118
NM_033506chr71192 ------
NM_033512chr873004 2006 1122 1085 604 304 59 --42996 2813 1090 582 --
NM_033535chr4--1905 ----
NM_033540chr31853 ------
NM_033551chr532791 1191 25 33500 3208 2533 --13344
NM_033624chr1242222 2071 1543 253 21734 572 ----
NM_033632chr421226 1081 ------
NM_033637chr1053210 2867 1408 878 26 32880 1136 776 13073 12804
NM_033642chrX51224 1008 941 483 463 ------
NM_033656chr2195766 5623 4220 3872 2099 1625 1301 694 161 1657 45717 1237 534 246 --
NM_048368chr181236 ------
NM_052821chr91121 11912 ----
NM_052832chr832558 2049 993 12600 22723 2623 --
NM_052834chr1852353 1892 1733 607 302 ----1403
NM_052867chr1321451 1186 31468 1192 958 ----
NM_052879chr1264071 4065 3878 2702 2644 1090 43121 587 458 50 1606 --
NM_052880chr2231464 468 384 ------
NM_052885chr1264570 4549 3932 1600 1495 1150 --34253 1480 138 --
NM_052886chr812182 ------
NM_052896chr1--12566 ----
NM_052898chr81138 --11598 11304
NM_052900chr841474 1239 280 237 1591 ----
NM_052904chr611128 21265 1060 ----
NM_052905chr241681 656 443 228 ------
NM_052910chr1331658 1560 683 ------
NM_052911chr182918 764 --11026 1823
NM_052913chr65944 735 722 261 168 ------
NM_052923chr62276 220 ------
NM_052927chr542034 1876 681 653 32171 1496 275 ----
NM_052934chr152234 2075 1868 477 46 22298 1648 ----
NM_052937chr832585 1913 812 12723 12270 11999
NM_052953chr3--196 ----
NM_052958chr8----1287 --
NM_052965chr131333 48 22 ------
NM_053002chr341005 978 913 892 1430 ----
NM_053016chr9167988 6788 6489 6457 6322 6219 6104 5485 4987 2877 2650 2604 1662 1649 1484 320 33189 2232 1706 16762 15910
NM_053024chr341388 1246 1212 1204 ------
NM_053025chr31255 1331 11569 --
NM_053026chr31255 1331 11569 --
NM_053027chr31255 1331 11569 --
NM_053028chr31255 1331 11569 --
NM_053031chr31255 1331 11569 --
NM_053032chr31255 1331 11569 --
NM_053043chr754876 4813 4098 4077 1850 26007 5321 45969 1560 1230 396 --
NM_053064chr1432892 2353 747 22666 95 --12745
NM_053067chr91301 ------
NM_054016chr152016 1527 1468 340 269 1685 11698 1262
NM_054016chr152016 1527 1468 340 269 1685 11698 1262
NM_054016chr152016 1527 1468 340 269 1685 11698 1262
NM_054034chr2195 ------
NM_057159chr93651 165 142 ------
NM_057168chr711342 ----11391
NM_057175chr422348 2050 2870 713 22226 539 11029
NM_057749chr821269 978 1553 ----
NM_058191chr215854 720 347 319 135 ------
NM_058237chr145962 803 719 412 324 1424 ----
NM_058241chr24536 398 352 119 42285 910 791 327 11470 11692
NM_058241chr24536 398 352 119 42285 910 791 327 11470 11692
NM_078467chr62453 102 ----11312
NM_078473chr842229 2178 578 370 42043 1934 603 528 ----
NM_078474chr151183 1530 ----
NM_078629chrX----1577 --
NM_078630chrX----1577 --
NM_080546chr962289 2206 1702 920 640 67 42144 2122 1882 790 ----
NM_080591chr952825 2765 2370 486 43 13100 12049 --
NM_080597chr181220 1701 --1391
NM_080599chr1041094 397 384 288 ------
NM_080617chr203320 196 172 ----1944
NM_080629chr141187 1133 1082 1038 21324 1254 1608 1267
NM_080630chr141187 1133 1082 1038 21324 1254 1608 1267
NM_080654chr112907 138 ----11257
NM_080672chr20--1433 ----
NM_080676chr2083275 3107 2875 2439 2320 1003 950 302 42881 2483 976 516 22866 737 --
NM_080743chr642134 926 459 305 1761 31848 992 793 --
NM_080752chr202431 299 ------
NM_080759chr1331811 1037 960 22125 448 12596 12092
NM_080760chr1331811 1037 960 22125 448 12596 12092
NM_080764chr2253038 2287 2237 2221 1181 21302 631 1160 --
NM_080867chr1464825 4441 1988 1483 639 590 44651 1032 347 318 ----
NM_080872chr811138 12754 22922 1587 13963
NM_080921chr12881 119 1402 1762 --
NM_080927chr373355 3265 2575 2448 859 735 666 33000 818 405 12586 --
NM_130391chr9181 1705 12193 23067 327
NM_130392chr9181 1705 12193 23067 327
NM_130393chr9181 1705 12193 23067 327
NM_130398chr1--151 ----
NM_130434chr153787 480 438 ------
NM_130435chr1012842 --11923 --
NM_130436chr2122185 506 22080 150 12788 185
NM_130438chr2152762 2194 1083 593 392 32657 2204 727 13365 1662
NM_130439chr1042158 2135 1764 283 ----1132
NM_130439chr1042158 2135 1764 283 ----1132
NM_130440chr111592 11644 ----
NM_130442chr7----1432 --
NM_130798chr1521474 526 --11553 11346
NM_130809chr562382 2310 933 891 507 48 --1328 --
NM_130811chr201798 ------
NM_130831chr332879 2516 310 1708 2670 501 12771
NM_130832chr332879 2516 310 1708 2670 501 12771
NM_130833chr332879 2516 310 1708 2670 501 12771
NM_130834chr332879 2516 310 1708 2670 501 12771
NM_130835chr332879 2516 310 1708 2670 501 12771
NM_130836chr332879 2516 310 1708 2670 501 12771
NM_130837chr332879 2516 310 1708 2670 501 12771
NM_133264chr1742886 2705 2593 515 43517 3414 2562 737 ----
NM_133326chr1--1312 ----
NM_133329chr231836 634 159 ----3747 550 295
NM_133334chr485703 4943 4923 4348 2161 2127 2087 796 35210 2027 1461 ----
NM_133367chr653394 3081 1255 686 57 --32615 918 852 13257
NM_133370chr433413 2761 1062 ----11319
NM_133372chr552971 2945 1128 975 440 22142 250 ----
NM_133378chr21920 ------
NM_133432chr21920 ------
NM_133437chr21920 ------
NM_133446chr10------1289
NM_133468chr741881 972 630 82 12576 12343 1803
NM_133476chr12----1989 --
NM_133478chr241639 631 474 27 21613 926 22372 1958 --
NM_133493chr643888 3348 2891 1059 --13582 1582
NM_133496chr123803 624 --23469 1646 11614
NM_133503chr121670 ------
NM_133504chr121670 ------
NM_133505chr121670 ------
NM_133506chr121670 ------
NM_133507chr121848 1626 ----
NM_133631chr321265 1093 11502 --21364 1104
NM_133645chr63652 452 45 ------
NM_133646chr255486 4633 4321 3595 958 33985 1554 873 73426 1750 1528 1430 592 566 333 21830 852
NM_133647chr1563201 2335 1421 1295 1214 460 1558 23399 24 --
NM_134265chr171114 2997 820 ----
NM_134442chr231344 1208 287 ----21710 1185
NM_134447chr192631 420 ----1152
NM_138270chrX43295 2969 2226 2168 ----11324
NM_138285chr21155 1401 1181 --
NM_138286chr1953662 2660 711 360 45 13760 14252 13574
NM_138300chr111168 ------
NM_138316chr102999 499 1904 ----
NM_138328chr1713296 --13393 --
NM_138333chr962508 2283 2093 751 446 86 --1103 22116 1775
NM_138357chr102575 371 11234 ----
NM_138426chr722043 195 1542 22431 255 --
NM_138437chrX----1309 --
NM_138444chr1354230 4203 3240 3115 989 11069 ----
NM_138448chr22409 306 ------
NM_138459chr673125 2978 2255 992 687 616 23 33208 3059 2377 33656 1322 149 1747
NM_138468chr284906 2248 1740 1312 965 580 574 535 36243 3918 161 23891 1113 12384
NM_138473chr1223595 1136 14268 --33601 1890 859
NM_138494chr74737 672 588 506 12843 --22185 1874
NM_138555chr15----1475 --
NM_138569chr61290 ------
NM_138576chr1474856 4606 4599 4279 3038 1591 1041 11363 11625 14554
NM_138609chr51549 1497 ----
NM_138610chr51549 1497 ----
NM_138621chr264134 4088 3898 3885 1158 44 ------
NM_138633chr61366 11325 --11350
NM_138638chr1441564 953 428 407 12266 22247 1969 --
NM_138694chr633012 2629 290 1467 13673 --
NM_138713chr16108016 7801 7771 7530 6847 5928 3247 2001 1330 164 1805 38021 7472 242 --
NM_138714chr16108016 7801 7771 7530 6847 5928 3247 2001 1330 164 1805 38021 7472 242 --
NM_138730chr62459 434 ----1328
NM_138731chr1443910 3374 861 183 --14038 21613 779
NM_138771chr72980 180 ----1447
NM_138779chr13294 42 ------
NM_138782chr541774 1557 892 551 --1116 --
NM_138799chr221892 1354 1501 12001 22028 559
NM_138923chrX181 ------
NM_138927chr213712 361 230 ------
NM_138959chr196093 5788 5589 4830 4653 2344 591 437 158 46822 1704 969 659 36283 6268 4639 15605
NM_138970chr1442408 2269 420 378 --11919 --
NM_138971chr1153661 3624 3513 3125 476 13323 11252 1277
NM_138971chr1153661 3624 3513 3125 476 13323 11252 1277
NM_138972chr1153661 3624 3513 3125 476 13323 11252 1277
NM_138972chr1153661 3624 3513 3125 476 13323 11252 1277
NM_138973chr1153661 3624 3513 3125 476 13323 11252 1277
NM_138973chr1153661 3624 3513 3125 476 13323 11252 1277
NM_138980chr4--1724 ----
NM_138981chr4--1855 ----
NM_138982chr4--1724 ----
NM_139012chr652240 2225 1756 702 421 ----1588
NM_139014chr652320 2305 1836 782 501 ----1668
NM_139048chr34455 253 164 152 ------
NM_139056chr521129 752 ------
NM_139072chr21729 1667 1843 --
NM_139076chr451034 965 605 87 34 --11447 --
NM_139078chr122268 226 136 ----
NM_139126chr62626 612 --1684 --
NM_139131chr113563 520 458 ------
NM_139135chr121233 1206 ------
NM_139160chr11--197 ----
NM_139168chr531876 1687 1595 --21584 1297 1443
NM_139169chr1042165 1932 589 287 142 ----
NM_139182chr431907 1773 1704 ------
NM_139207chr123794 779 756 12207 ----
NM_139242chr1521529 37 ----1510
NM_139244chr61855 ----1920
NM_139279chr263482 3453 3034 2965 2707 2511 ----23283 313
NM_139283chr1242574 1945 1799 1648 --11568 1225
NM_139321chr2073710 3477 3081 1511 1157 961 668 1693 1220 --
NM_144571chr4106964 6228 5553 4923 4661 2603 1531 515 314 293 24431 566 26346 1318 15887
NM_144574chr141167 125 ----
NM_144576chr122607 65 189 ----
NM_144578chr1474771 4692 4559 2043 1200 751 229 35315 2129 1880 24839 744 1157
NM_144582chr242442 2074 1917 1611 ------
NM_144590chr1041904 1027 970 609 22635 327 1300 --
NM_144595chr132953 178 1644 ----
NM_144599chr1565238 5160 1350 1250 1016 692 1675 --24250 1616
NM_144628chr2043064 1031 905 404 --22119 871 --
NM_144633chr31539 ------
NM_144642chr321015 479 1565 11417 --
NM_144643chr41383 ------
NM_144658chrX3337 84 51 ------
NM_144664chr1112535 --1217 --
NM_144665chr11170 ------
NM_144710chr251175 1039 268 110 90 ----21391 1271
NM_144721chr462688 2594 2169 1992 347 189 --11733 22789 1760
NM_144724chr51748 ------
NM_144726chr52912 77 11256 ----
NM_144728chr12833 298 ------
NM_144729chr12833 298 ------
NM_144767chr15104412 3479 3380 3217 1622 1506 1322 681 411 372 ----11570
NM_144775chr1764912 3744 3016 1877 501 392 --14829 --
NM_144778chr1362395 2357 1865 1775 1020 834 1584 ----
NM_144949chr232587 2275 2259 12240 1272 --
NM_144963chr832687 2518 2180 12398 ----
NM_144969chrX2568 158 2659 138 ----
NM_144973chr1254983 4959 4001 3321 851 35247 5108 172 33506 1588 783 1560
NM_144974chr132257 193 ------
NM_144979chr42568 100 ----1710
NM_144981chr11292 24 ------
NM_144982chr12--2620 552 --2751 54
NM_145005chr93958 663 179 1890 1250 1126
NM_145010chr1062240 1975 1937 1892 1836 215 31759 1672 773 ----
NM_145011chr1042180 1526 553 167 ----1534
NM_145025chr631176 1080 99 11194 ----
NM_145037chr321059 561 --21605 1118 31269 545 283
NM_145049chr52936 189 1220 1120 11016
NM_145052chrX41041 161 79 61 --1137 1310
NM_145055chr1853608 3564 2803 994 395 12655 1268 --
NM_145102chr741408 1201 365 223 1308 ----
NM_145174chr22--129 21397 315 --
NM_145176chr643449 3442 2844 434 11267 13034 --
NM_145203chr131680 ------
NM_145204chr15----1603 2654 250
NM_145206chr1033271 3238 848 12361 --13160
NM_145251chr1451559 1106 641 326 38 ----1317
NM_145259chr2116322 5209 5144 5090 4787 2241 2145 1916 1456 827 566 15238 22449 1572 1327
NM_145268chr71988 21110 28 --2246 131
NM_145274chr171284 1228 167 --
NM_145276chr193934 856 374 11013 1360 --
NM_145284chrX32008 681 377 --22447 397 22393 2320
NM_145291chr41414 ------
NM_145296chr191648 ------
NM_145305chrX21263 1131 1909 ----
NM_145307chr1043849 3742 1358 1318 23706 3277 11585 --
NM_145309chr1121351 69 ------
NM_145313chr1051682 1599 1582 1471 1458 --11614 11546
NM_145320chr753499 3054 2932 2419 46 1632 ----
NM_145321chr753499 3054 2932 2419 46 1632 ----
NM_145322chr753499 3054 2932 2419 46 1632 ----
NM_145330chr2--154 ----
NM_145331chr63867 657 129 1222 ----
NM_145332chr631015 805 277 1370 ----
NM_145333chr631015 805 277 1370 ----
NM_145690chr851601 1459 724 656 604 --11523 21539 125
NM_145693chr272508 2498 2491 2282 884 596 567 ------
NM_145698chr1022134 1759 1268 --1207
NM_145725chr14--2340 54 ----
NM_145726chr14--2340 54 ----
NM_145753chr31150 11698 --21429 345
NM_145799chrX63121 2343 2179 2118 2008 407 ------
NM_145808chr752310 2129 897 379 304 33156 2612 1966 23021 2210 --
NM_145858chr211437 1159 --150
NM_145859chr31365 1327 ----
NM_145860chr31365 1327 ----
NM_145891chr161368 ------
NM_145892chr161368 ------
NM_145893chr161490 ------
NM_145899chr611312 ----11324
NM_145901chr611312 ----11324
NM_145902chr611312 ----11324
NM_145903chr611312 ----11324
NM_145904chr611312 ----11324
NM_145905chr611312 ----11324
NM_145911chr161423 1344 ----
NM_145913chr122934 742 --2913 306 --
NM_147147chr6104242 4067 3553 3475 3459 2788 1543 990 909 394 ------
NM_147150chr993470 3380 1542 1499 1469 1364 882 525 35 --13014 13449
NM_147156chr1031374 1253 1178 11094 ----
NM_147164chr9------1571
NM_147166chr73826 607 541 147 ----
NM_147189chr852032 1801 935 136 107 11529 1900 12077
NM_147202chr91520 ------
NM_148170chr1155596 5542 3808 981 146 1417 --11429
NM_148174chr841854 1593 512 137 12023 --11994
NM_148923chr181276 198 ----
NM_148957chr1342685 2236 1785 896 1140 1500 --
NM_148977chr102999 499 1904 ----
NM_148978chr102999 499 1904 ----
NM_152221chr22--11254 ----
NM_152238chr1--1133 1307 --
NM_152261chr1232417 2034 1921 22452 1560 32285 2075 1603 --
NM_152264chr1111096 ------
NM_152275chr232353 2278 89 1942 11880 --
NM_152277chr511974 2308 231 22119 513 --
NM_152278chrX2451 85 ------
NM_152282chr341043 921 903 190 11393 ----
NM_152285chr91218 ------
NM_152316chr112249 79 --2588 159 --
NM_152330chr1462389 824 809 694 129 81 ------
NM_152347chr17----2587 63 --
NM_152352chr1842564 2222 820 291 --22352 1072 22926 2289
NM_152387chr22787 339 2866 717 ----
NM_152388chr231388 91 39 1507 11516 --
NM_152390chr22484 473 ------
NM_152400chr452020 1562 1362 478 467 1688 ----
NM_152407chr563162 3134 2994 2039 793 647 53032 2567 624 273 202 --13061
NM_152409chr572397 2368 2197 1245 959 495 200 --1437 --
NM_152415chr81201 1351 ----
NM_152422chr941757 1741 652 475 --1241 21887 152
NM_152423chrX21193 26 11392 1122 11249
NM_152424chrX64045 3922 3598 1610 1056 562 1102 ----
NM_152437chr1232029 671 478 1743 12450 11792
NM_152446chr142675 220 ------
NM_152457chr16--1223 ----
NM_152519chr251541 1381 844 792 266 ------
NM_152520chr21484 1387 1276 --
NM_152523chr21272 ------
NM_152529chr264254 3816 3668 1683 1255 677 21698 548 ----
NM_152594chr1562049 1963 672 421 243 216 31715 1494 59 --21913 1536
NM_152603chr191613 ------
NM_152622chr543472 3432 684 47 32773 1075 794 23024 2405 12915
NM_152624chr5127464 6876 6524 6486 2941 2850 2264 1713 1491 1459 638 52 37374 5218 4945 ----
NM_152629chr973771 3244 2791 2495 1540 1283 47 --33257 1028 83 --
NM_152636chr1172454 2371 2202 1975 927 252 123 ----11937
NM_152638chr1251278 1195 359 152 42 1251 ----
NM_152641chr1232040 1063 623 11842 1555 22230 976
NM_152666chr13573 197 59 ------
NM_152671chr22360 102 ----1415
NM_152678chr322484 1886 22069 974 1947 --
NM_152685chr51400 ------
NM_152688chr62848 743 ------
NM_152692chrX158 ------
NM_152695chrX2793 204 1590 22315 923 22103 2047
NM_152699chr363635 3150 2446 2429 1452 978 ----159
NM_152705chr1311354 11367 ----
NM_152707chr102662 261 11041 1134 186
NM_152737chr661824 1485 1310 788 513 140 ------
NM_152740chr72699 544 ------
NM_152754chr743247 1507 1279 322 1177 11202 13473
NM_152756chr584089 3426 3026 1277 1204 928 788 49 21271 845 13858 --
NM_152758chr821227 196 22949 2460 1435 12585
NM_152772chr122482 318 ------
NM_152774chr752099 1997 1817 518 328 11717 32342 1024 307 12407
NM_152787chrX63600 3534 2468 1082 535 503 ----1229
NM_152789chr731385 1029 265 --1215 1186
NM_152829chr73946 199 186 175 ----
NM_152835chr142358 2340 1989 859 11101 2938 493 12064
NM_152836chr8------2587 532
NM_152837chr8------2587 532
NM_152838chr2022383 1094 1880 1874 --
NM_152857chr63999 691 294 --1696 --
NM_152858chr63999 691 294 --1696 --
NM_152896chr9--1792 ----
NM_152902chr182014 1973 1627 1438 1432 1356 1258 55 --11287 --
NM_152903chr1342553 2420 1892 997 --1239 --
NM_152910chr132195 165 1506 ----
NM_152924chr1576312 5099 4840 4797 4280 2738 1359 11005 26892 1169 25580 1457
NM_152989chr1241819 1773 1651 1348 ------
NM_152991chr114508 257 220 80 ------
NM_152994chr21169 ------
NM_152995chr4--160 ----
NM_152999chr764839 3438 3350 1326 1289 955 1529 1624 13204
NM_153013chr552408 2159 618 398 106 1321 --12310
NM_153035chr132825 937 804 23192 2591 --23166 649
NM_153050chr2274629 3765 3757 1833 1291 1180 726 13852 11395 24467 4278
NM_153051chr2274629 3765 3757 1833 1291 1180 726 13852 11395 24467 4278
NM_153182chr333125 1208 833 ----22481 1045
NM_153184chr331674 799 783 --1624 1254
NM_153188chr544875 1720 932 801 --25688 3506 --
NM_153201chr11--150 ----
NM_153207chr1241086 976 429 307 1454 13758 1792
NM_153223chr52477 193 21400 400 1150 --
NM_153235chr681928 1704 654 647 514 377 318 167 1191 11829 --
NM_153262chr163214 2575 2260 2210 1241 1048 42029 1984 1230 277 --12777
NM_153267chr91853 1934 ----
NM_153332chr842415 2075 1121 1023 --1524 --
NM_153333chrX1398 ------
NM_153354chr52949 644 1936 ----
NM_153361chr51113 ------
NM_153365chr452238 2094 2055 964 220 22128 1847 ----
NM_153367chr1032499 1125 1053 23607 3556 33391 2688 2530 --
NM_153456chr1365989 2213 2206 1695 763 497 --21057 114 1528
NM_153607chr522463 880 --32738 859 168 --
NM_153620chr731550 570 544 ------
NM_153634chr1221531 1269 --11344 1218
NM_153645chr2233016 1231 1028 1224 12257 13256
NM_153646chr1452463 2166 1801 1705 1637 ----1719
NM_153647chr1452463 2166 1801 1705 1637 ----1719
NM_153648chr1452463 2166 1801 1705 1637 ----1719
NM_153649chr122023 1991 ------
NM_153687chr1231639 1615 662 11391 --21280 196
NM_153689chr231851 556 170 1221 1676 --
NM_153695chr9188 ------
NM_153713chr1------1200
NM_153757chr421042 185 --11125 2979 820
NM_153809chr91617 ------
NM_153810chr1074917 4734 4443 1791 1345 385 201 23503 1064 21076 146 11274
NM_153819chr111184 ------
NM_170606chr721750 1453 11303 1600 --
NM_170665chr1221811 433 14136 1957 11182
NM_170674chr1521389 177 ------
NM_170677chr1521389 177 ------
NM_170692chr11831 ------
NM_170695chr18198 ------
NM_170709chr862216 2207 1812 912 493 65 1794 1767 --
NM_170710chr463095 2994 2423 2334 1166 848 1661 21024 24 22550 401
NM_170721chr1741219 983 974 841 21007 436 11066 --
NM_170731chr1122315 52 32044 1787 384 12506 --
NM_170732chr1122315 52 32044 1787 384 12506 --
NM_170733chr1122315 52 32044 1787 384 12506 --
NM_170734chr1122315 52 32044 1787 384 12506 --
NM_170735chr1122315 52 32044 1787 384 12506 --
NM_170750chrX3736 304 216 ------
NM_170776chr161908 ------
NM_171825chr533037 624 156 13106 --1784
NM_171998chrX32535 1016 807 --3942 929 352 139
NM_172069chr272337 2161 2024 1613 1558 741 392 --1147 --
NM_172070chr221972 150 11762 1350 11990
NM_172071chr1147259 6638 6519 5945 5920 5030 4643 2717 1701 1666 1316 1031 975 578 35207 981 886 1507 27056 7004
NM_172103chr62912 118 12085 ----
NM_172105chr62912 118 12085 ----
NM_172159chr382177 1821 1809 1448 921 675 642 534 --1953 --
NM_172160chr382177 1821 1809 1448 921 675 642 534 --1953 --
NM_172178chr1241418 1203 159 52 ------
NM_172193chr143839 300 187 ------
NM_172196chr2171 ------
NM_172216chr1272525 2229 1915 558 426 182 133 1621 ----
NM_172315chr1521389 177 ------
NM_172316chr1521389 177 ------
NM_172344chr231836 634 159 ----3747 550 295
NM_172387chr1811091 ------
NM_172388chr1811138 ------
NM_172389chr1811138 ------
NM_173083chr141313 1003 815 440 11177 ----
NM_173163chr16--1483 ----
NM_173165chr16--1364 ----
NM_173174chr8----1846 --
NM_173175chr8----1846 --
NM_173176chr8----1846 --
NM_173198chr922412 48 22360 2017 21924 976 --
NM_173200chr922412 48 22360 2017 21924 976 --
NM_173207chr18198 ------
NM_173208chr18198 ------
NM_173209chr18198 ------
NM_173210chr18198 ------
NM_173211chr18198 ------
NM_173214chr16108016 7801 7771 7530 6847 5928 3247 2001 1330 164 1805 38021 7472 242 --
NM_173359chr351600 1526 1420 489 203 ------
NM_173362chr51129 1662 1523 141
NM_173468chr484249 2080 1568 901 703 295 240 205 34737 3961 441 35532 1973 254 15545
NM_173469chr1521525 1318 ------
NM_173470chrX62784 2314 960 695 536 517 --12592 --
NM_173473chr102848 199 11697 1128 12651
NM_173475chr16--1535 --1230
NM_173491chr541299 1206 1160 1068 ----11111
NM_173494chrX5815 787 651 630 257 --1753 --
NM_173496chr1031025 781 617 22926 2747 --12907
NM_173500chr1551359 1226 999 881 493 ------
NM_173508chr12475 146 ----11262
NM_173511chr273208 3095 2699 2489 1260 845 735 12707 13402 --
NM_173517chr71492 ------
NM_173519chr851714 1299 569 308 186 11492 1104 --
NM_173526chr14--177 ----
NM_173531chr1963583 2570 1515 930 584 283 --1389 --
NM_173552chr331837 543 222 12435 42120 1973 337 261 --
NM_173570chr332109 1407 75 1640 1286 --
NM_173576chr1021558 908 1439 1560 11913
NM_173582chr1156270 5960 5951 4017 2328 25293 4048 44456 2453 1651 987 34028 1434 519
NM_173602chr1223569 3469 1595 --23712 1361
NM_173642chr198530 7312 7280 6470 6200 5570 3305 2439 438 35927 3262 2513 28229 2856 22883 887
NM_173644chr2021879 1368 ------
NM_173654chr342236 1623 892 864 ----22393 2197
NM_173665chr52279 74 1704 ----
NM_173667chr532439 2201 105 ----1302
NM_173694chrX32161 1009 445 32212 2115 745 21625 119 2963 515
NM_173698chrX31847 1757 152 1751 ----
NM_173797chr511114 --1540 1463
NM_173808chr134386 4215 3134 43777 3313 3025 684 23722 1701 --
NM_173825chr352443 2141 1116 1072 822 11930 22790 1903 --
NM_173826chr32240 74 ------
NM_173827chr463153 2913 2836 2359 2308 2293 1348 3461 321 84 --
NM_173829chr564226 3995 2021 264 233 132 --35331 1883 206 --
NM_173848chr81317 ------
NM_173854chr112413 ----147
NM_174886chr18198 ------
NM_174890chr101793 ------
NM_174900chr44968 496 220 195 11265 11246 --
NM_174902chr111483 11269 1516 --
NM_174909chr5139 ------
NM_174911chr8103696 3621 3530 3464 2906 1444 1279 1224 913 467 13849 11435 --
NM_174916chr153654 356 286 --2738 473 21602 1471
NM_174921chr44983 425 377 343 --1208 11120
NM_175056chr331928 1832 105 ------
NM_175061chr731764 1475 483 ------
NM_175075chr84552 485 202 123 --1117 --
NM_175085chr213611 495 238 ----1545
NM_175607chr341257 643 552 496 1391 ----
NM_175610chr152946 336 1921 ----
NM_175612chr341257 643 552 496 1391 ----
NM_175623chr12187718 7291 6770 6663 6309 6144 5937 5559 5222 4833 4742 3072 2810 2785 2309 2258 1883 799 --86612 5306 3062 2897 2284 2160 2151 72 1494
NM_175624chr12177813 7386 6865 6758 6404 6239 6032 5654 5317 4928 4837 2905 2880 2404 2353 1978 894 --76707 5401 2992 2379 2255 2246 167 1589
NM_175625chr12177813 7386 6865 6758 6404 6239 6032 5654 5317 4928 4837 2905 2880 2404 2353 1978 894 --76707 5401 2992 2379 2255 2246 167 1589
NM_175634chr81280 ------
NM_175635chr81280 ------
NM_175636chr81280 ------
NM_175736chr1297419 6262 5939 5292 2273 1773 875 747 147 16212 --16530
NM_175767chr5--11594 2407 294 --
NM_175852chr163044 2634 923 449 360 339 ------
NM_175854chr1332213 1904 126 22092 1785 11830 1155
NM_175856chr5----1253 --
NM_175863chr621264 187 1166 ----
NM_175873chr531525 432 198 21118 264 ----
NM_175876chr142672 2522 2265 712 32106 877 108 22502 924 1944
NM_176812chr201263 1611 ----
NM_176814chr731135 532 419 --1976 --
NM_176824chr41522 --2397 124 11274
NM_177414chr121748 292 ------
NM_177438chr1453914 3307 3247 2907 1623 33637 3001 1665 14084 21565 1428
NM_177951chr141706 1347 ----
NM_177968chr272067 2047 1735 1408 611 477 161 ----22241 2095
NM_177969chr2------192
NM_177972chr1134359 2841 674 ------
NM_177985chr252186 2178 1802 1712 654 11917 11483 1147
NM_177988chr3--1325 ----
NM_177990chr2041316 750 672 522 1211 ----
NM_177995chr941757 1741 652 475 --1241 21887 152
NM_178009chr132158 128 1469 ----
NM_178010chr1241819 1773 1651 1348 ------
NM_178011chr1032748 2272 577 --13184 --
NM_178123chr21684 1852 ----
NM_178140chr532796 2580 2322 --11901 2864 305
NM_178151chrX117900 7222 7213 7041 6476 5645 4891 2752 2276 1201 310 57572 6606 6544 5431 1380 17338 27361 2091
NM_178152chrX117900 7222 7213 7041 6476 5645 4891 2752 2276 1201 310 57572 6606 6544 5431 1380 17338 27361 2091
NM_178153chrX117900 7222 7213 7041 6476 5645 4891 2752 2276 1201 310 57572 6606 6544 5431 1380 17338 27361 2091
NM_178313chr232122 1706 125 11923 ----
NM_178423chr711192 1174 11028 --
NM_178425chr711192 1174 11028 --
NM_178426chr11330 12337 1518 --
NM_178427chr11230 12237 1418 --
NM_178441chr1411197 ------
NM_178450chr51218 ----1573
NM_178470chrX51551 1294 565 258 97 ------
NM_178496chr321251 1015 --3477 449 324 --
NM_178509chr1734121 3540 107 23885 1438 21658 399 11611
NM_178539chr12--41937 252 216 104 ----
NM_178548chr11214 2643 570 ----
NM_178558chr73416 94 62 11225 1198 1851
NM_178566chr91745 ------
NM_178584chr251175 1039 268 110 90 ----21391 1271
NM_178585chr463207 3040 2942 938 757 347 12207 ----
NM_178586chr1421693 793 ------
NM_178812chr82480 217 1414 11410 11096
NM_178815chr1062189 1968 1886 612 552 451 42703 1082 981 128 11059 1715
NM_180989chr1341825 619 557 376 22490 102 1478 --
NM_181077chr1562193 1768 1619 1610 150 120 195 ----
NM_181265chr463095 2994 2423 2334 1166 848 1661 21024 24 22550 401
NM_181302chr141167 125 ----
NM_181308chr141167 125 ----
NM_181332chrX52531 2309 2044 844 382 12376 --11787
NM_181349chr731965 588 447 ------
NM_181354chr811376 ------
NM_181356chr61278 --1357 11037
NM_181358chr173577 3412 3328 2595 1445 1324 344 23817 1353 13932 1254
NM_181443chr2032414 910 25 22325 1057 1356 12768
NM_181481chr1897039 6682 6623 6157 5776 4981 4906 721 223 --25414 316 16788
NM_181482chr1897039 6682 6623 6157 5776 4981 4906 721 223 --25414 316 16788
NM_181483chr1897039 6682 6623 6157 5776 4981 4906 721 223 --25414 316 16788
NM_181527chr201347 ------
NM_181528chr201402 ------
NM_181571chr103310 258 230 ------
NM_181598chr141250 ----1286
NM_181643chr131591 1333 273 ------
NM_181645chr11121 ------
NM_181659chr2063088 2990 2483 1246 546 150 ------
NM_181659chr2063088 2990 2483 1246 546 150 ------
NM_181670chr1231191 565 303 --11125 11518
NM_181671chr172940 592 126 --1772
NM_181672chrX41279 591 553 85 11539 ----
NM_181673chrX41279 591 553 85 11539 ----
NM_181674chr52397 83 ------
NM_181675chr52397 83 ------
NM_181676chr52397 83 ------
NM_181677chr52397 83 ------
NM_181678chr52397 83 ------
NM_181701chr952008 1818 1508 394 208 12391 ----
NM_181705chr575618 5481 5218 4610 4211 2179 994 34013 1634 1097 2320 301 12039
NM_181706chr1172326 1947 231 222 178 107 91 ------
NM_181714chr631977 1619 1409 ------
NM_181723chr82651 495 --1457 --
NM_181782chr641671 809 507 401 ----11507
NM_181783chr123600 573 386 11790 1535 --
NM_181784chr232415 2318 932 ------
NM_181787chr823593 707 2323 99 ----
NM_181794chr6----11106 --
NM_181795chr6----11106 --
NM_181836chr532300 1076 175 11723 --12247
NM_181838chr541237 1123 340 79 11431 --1163
NM_181861chr1212253 ------
NM_181868chr1212253 ------
NM_181869chr1212338 ------
NM_181886chr441209 1044 460 308 --11013 --
NM_181887chr441209 1044 460 308 --11013 --
NM_181888chr441209 1044 460 308 --11013 --
NM_181889chr441209 1044 460 308 --11013 --
NM_181890chr441209 1044 460 308 --11013 --
NM_181891chr441209 1044 460 308 --11013 --
NM_181892chr441256 1091 507 355 --11060 --
NM_181893chr441209 1044 460 308 --11013 --
NM_181897chr362118 2092 1987 1838 715 406 1429 12378 2836 727
NM_182485chr453730 2826 2808 2385 1019 22889 1374 --13236
NM_182488chr132912 188 1742 ----
NM_182515chr1966182 4608 2042 1495 1161 547 34743 991 41 66695 6403 6382 6135 5931 655 24960 4198
NM_182522chr351321 461 222 119 60 1352 11256 --
NM_182551chr283549 2927 2809 2541 2311 933 238 120 12704 ----
NM_182641chr171108 ----1756
NM_182643chr892440 2414 2316 2238 2176 1704 1534 359 143 12255 ----
NM_182646chr453730 2826 2808 2385 1019 22889 1374 --13236
NM_182648chr14------128
NM_182666chr3130 ------
NM_182687chr16------1224
NM_182688chr2132072 2026 1536 1863 ----
NM_182700chr741970 1651 1434 514 ----11413
NM_182715chr72369 77 1203 ----
NM_182718chr103310 258 230 ------
NM_182719chr103310 258 230 ------
NM_182724chr103310 258 230 ------
NM_182725chr103310 258 230 ------
NM_182734chr2083012 2932 2727 2527 1004 887 815 234 ----33128 2666 871
NM_182756chr21630 ------
NM_182757chr643303 3284 409 334 23432 3316 ----
NM_182763chr141690 1119 1104 674 12003 1605 --
NM_182765chr1062029 1867 1807 788 770 198 ----11699
NM_182769chr103310 258 230 ------
NM_182770chr103310 258 230 ------
NM_182771chr103310 258 230 ------
NM_182772chr103310 258 230 ------
NM_182830chr142732 391 21530 744 --12195
NM_182835chr141126 ----134
NM_182848chr1311566 1120 ----
NM_182850chr103310 258 230 ------
NM_182896chr351412 1377 490 442 189 1563 ----
NM_182898chr786402 6341 6305 6290 5431 4828 4124 257 66084 4601 4101 4030 2154 1832 11839 --
NM_182899chr786402 6341 6305 6290 5431 4828 4124 257 66084 4601 4101 4030 2154 1832 11839 --
NM_182907chr65657 442 284 261 44 1637 21951 1662 --
NM_182910chr142727 604 1850 ----
NM_182913chr142727 604 1850 ----
NM_182914chr142727 604 1850 ----
NM_182931chr73584 477 255 ------
NM_182943chr331117 1108 1006 21194 141 --1912
NM_182944chr14--1362 ----
NM_182948chr162978 2074 1121 1007 780 477 22389 430 --32762 2440 368
NM_182972chr141996 1974 335 306 1949 --153
NM_182977chr531016 801 783 1456 ----
NM_183004chr1483435 2852 2548 1579 1564 1177 1073 829 2653 646 12796 --
NM_183060chr103310 258 230 ------
NM_183078chr673725 3233 3088 2586 2519 729 36 1666 1181 --
NM_183244chr20--1433 ----
NM_183246chr20--1433 ----
NM_183376chr1552601 2328 2047 1631 398 196 ----
NM_183380chr63730 139 131 11009 1674 --
NM_183381chr32625 60 1840 ----
NM_183383chr32625 60 1840 ----
NM_183384chr32625 60 1840 ----
NM_183416chr14762 397 176 64 123 11682 --
NM_183419chr831418 1410 362 1228 11392 1272
NM_184085chr82819 224 ------
NM_184086chr82819 224 ------
NM_184087chr82819 224 ------
NM_194247chr264158 3305 3213 1669 745 392 1860 ----
NM_194250chr21348 ------
NM_194271chr122488 40 ------
NM_194278chr1433736 1106 802 ----12584
NM_194282chr472674 2477 2221 2030 396 248 62 ----1730
NM_194283chr533640 2952 603 41590 1390 658 217 21233 593 --
NM_194285chr1122766 150 42362 954 819 501 22305 101 --
NM_194286chr1286146 5776 4275 4043 3765 2291 610 122 --12111 --
NM_194292chr12654 594 11346 31332 180 108 --
NM_194314chr1105182 5169 5088 4545 4446 4103 3794 1166 631 171 1499 1927 21319 198
NM_194318chr1331678 733 404 1994 ----
NM_194328chr943204 2588 1119 463 23197 924 11033 --
NM_194329chr943204 2588 1119 463 23197 924 11033 --
NM_194330chr943204 2588 1119 463 23197 924 11033 --
NM_194332chr943204 2588 1119 463 23197 924 11033 --
NM_194439chr421400 1245 1124 1303 1594
NM_194442chr121745 178 21420 478 ----
NM_194454chr731734 1657 1255 1696 ----
NM_194455chr731734 1657 1255 1696 ----
NM_194456chr731734 1657 1255 1696 ----
NM_194463chrX11081 21208 25 ----
NM_197968chr13----1237 --
NM_197970chr21167 --1386 --
NM_198066chr1443106 2930 2724 2385 1248 1581 --
NM_198120chr82550 200 1510 1103 --
NM_198123chr841474 1239 280 237 1591 ----
NM_198124chr841474 1239 280 237 1591 ----
NM_198128chr1852068 1505 677 321 86 1449 22332 1680 --
NM_198158chr342933 964 920 327 ------
NM_198159chr342933 964 920 327 ------
NM_198177chr342933 964 920 327 ------
NM_198178chr342933 964 920 327 ------
NM_198181chr1592805 2577 2102 320 249 219 189 161 131 22220 80 11149 --
NM_198196chr322527 731 ----1368
NM_198225chr1031891 1848 622 11550 ----
NM_198240chr122547 358 11171 ----
NM_198268chr173577 3412 3328 2595 1445 1324 344 23817 1353 13932 1254
NM_198269chr173577 3412 3328 2595 1445 1324 344 23817 1353 13932 1254
NM_198270chrX53289 2814 901 95 78 22571 2278 11354 --
NM_198273chr562708 2424 2141 2013 738 428 1258 --32122 1229 753
NM_198279chrX41206 1061 1014 261 1249 --1787
NM_198320chr1264988 4027 3643 3170 1345 291 31750 1484 602 13756 --
NM_198321chr522716 2679 22965 2061 1594 1725
NM_198336chr751735 1684 1595 1233 541 11789 ----
NM_198390chr1621474 1377 ------
NM_198392chr641901 721 328 261 1666 ----
NM_198395chr52937 427 ----11221
NM_198399chr321579 1145 11737 11635 --
NM_198400chr153715 648 395 1141 12835 --
NM_198401chr851198 668 625 610 523 31585 473 165 ----
NM_198404chr133754 314 273 --1652 --
NM_198443chr161107 ------
NM_198465chrX1907 12439 --22562 1943
NM_198467chr71548 ------
NM_198468chr674597 4358 4079 3915 1167 978 491 --23878 1120 --
NM_198489chr111118 ------
NM_198503chr142304 1923 598 344 1219 22181 1822 2195 46
NM_198511chrX41495 730 545 338 11607 ----
NM_198513chr831988 1493 596 1224 ----
NM_198549chr152563 1166 527 283 25 33251 2972 267 22670 1140 32642 990 549
NM_198562chr332181 725 425 --21725 696 22317 561
NM_198569chr622514 2476 12163 12072 --
NM_198581chr286920 5878 2459 2380 2152 980 558 417 21294 577 17436 --
NM_198584chr832103 1069 507 11878 --12133
NM_198715chr185828 5444 4734 1705 1280 1075 1067 782 24034 2184 15104 1582
NM_198793chr373764 3306 3273 3054 2805 1535 742 33794 983 911 21422 1409 --
NM_198830chr171234 ------
NM_198844chr173957 348 25 1209 ----
NM_198859chr375031 4660 4617 3656 2020 1546 196 15175 15098 11166
NM_198896chr1132153 2084 2027 21819 89 --1636
NM_198900chr1297419 6262 5939 5292 2273 1773 875 747 147 16212 --16530
NM_198904chr522089 407 11964 ----
NM_198947chr111185 --1932 --
NM_198956chr741970 1651 1434 514 ----11413
NM_198992chr122138 120 2901 92 --1187
NM_199000chr711779 ----11873
NM_199040chr1283850 3596 2868 2831 1044 764 344 307 ------
NM_199053chr43853 703 281 ------
NM_199131chr1022791 2241 --33530 3003 2305 1900
NM_199135chr9----1862 --
NM_199168chr1011184 ----11301
NM_199169chr2053573 3540 2585 647 362 --1652 13314
NM_199170chr2053573 3540 2585 647 362 --1652 13314
NM_199171chr2053573 3540 2585 647 362 --1652 13314
NM_199188chr1264071 4065 3878 2702 2644 1090 43121 587 458 50 1606 --
NM_199189chr53929 763 713 1722 ----
NM_199190chr1264071 4065 3878 2702 2644 1090 43121 587 458 50 1606 --
NM_199229chr261722 1708 1699 1522 513 244 ------
NM_199320chr44779 471 185 119 ----1672
NM_199320chr44779 471 185 119 ----1672
NM_199321chr173957 348 25 1209 ----
NM_199324chr493537 3134 2950 2627 1298 1016 927 690 411 21491 579 --13409
NM_199328chr2121195 1126 11149 1878 1816
NM_199358chr9----1862 --
NM_199418chr111109 ------
NM_199421chr1464825 4441 1988 1483 639 590 44651 1032 347 318 ----
NM_199436chr243028 1089 786 124 1139 --12186
NM_199454chr164659 4638 3975 1228 672 570 ------
NM_199461chr1053587 3559 3426 3006 2801 1785 1866 12437
NM_199462chr1105000 4015 3133 1675 1382 1233 1007 433 117 73 43355 1933 890 131 43799 3094 1906 1604 14315
NM_199478chrX31675 1669 1281 11270 1117 --
NM_199483chr202124 98 ----1311
NM_199511chr32523 290 ------
NM_199512chr32523 290 ------
NM_201269chr11981 149