TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-27a-5p
miRNA Sequence: AGGGCUUAGCUGCUUGUGAGCA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr531013 201 176 1135 ----
NM_000024chr51153 ------
NM_000046chr512813 1543 31989 787 250 12202
NM_000051chr1152916 2434 1396 1362 1288 22658 1127 1698 --
NM_000052chrX62640 2478 1287 901 423 265 1335 12126 --
NM_000081chr111845 --1245 11194
NM_000090chr21907 ------
NM_000109chrX22077 231 11677 ----
NM_000110chr1--1844 ----
NM_000115chr1341667 986 390 215 1628 ----
NM_000124chr10129 ------
NM_000125chr663310 830 768 682 409 332 12987 ----
NM_000141chr1011161 ------
NM_000163chr542298 1786 708 70 ------
NM_000168chr733229 2839 2634 23262 1144 1275 --
NM_000176chr553126 2611 1427 1311 927 21216 774 ----
NM_000216chrX63320 1108 675 240 105 43 --12519 --
NM_000217chr1295132 4719 4633 3783 3752 1368 935 751 29 24695 1218 ----
NM_000232chr432567 2207 1080 --1462 13156
NM_000254chr151999 1936 1055 840 384 ----12703
NM_000259chr1556231 5730 4618 4516 2293 14655 --11986
NM_000267chr1732778 544 164 --1725 --
NM_000268chr22103790 3389 3322 3198 3172 3050 2690 2301 526 379 43497 3132 2335 147 1893 --
NM_000280chr111985 ------
NM_000289chr121295 ----163
NM_000314chr1022677 2337 ------
NM_000315chr112325 75 ------
NM_000318chr842439 2059 1902 718 52883 2632 2558 2238 1929 ----
NM_000329chr11370 --1894 --
NM_000330chrX42015 1404 484 407 2593 260 ----
NM_000332chr676353 6203 5502 1666 958 786 346 12831 ----
NM_000337chr576575 6043 5018 1658 1414 964 464 41636 1569 1240 96 15347 --
NM_000346chr173805 413 160 ------
NM_000358chr54431 397 375 140 ------
NM_000362chr2262921 2801 2391 2329 2314 1038 1789 ----
NM_000368chr9104165 3964 3131 3091 3070 879 701 646 616 440 11334 ----
NM_000390chrX73216 2719 2359 1037 810 580 489 --11227 --
NM_000393chr212087 12025 ----
NM_000408chr242927 2583 2334 448 1956 12265 12959
NM_000411chr2151172 1145 881 227 106 --12953 --
NM_000430chr1743568 3031 1139 747 13494 12402 13274
NM_000448chr11--1237 ----
NM_000449chr13595 490 59 2381 108 ----
NM_000458chr172913 667 2187 88 ----
NM_000461chr384638 3328 3204 1690 1505 1114 884 351 --23662 3352 1701
NM_000478chr12291 29 ------
NM_000480chr1131582 1164 442 ------
NM_000484chr21----1363 --
NM_000489chrX33373 2943 260 12858 ----
NM_000493chr64974 397 269 192 ------
NM_000495chrX1439 ------
NM_000516chr20130 ------
NM_000533chrX31702 1436 633 ------
NM_000539chr321377 1329 21432 1244 ----
NM_000555chrX77824 7593 6457 5203 2887 2498 526 37047 2031 44 12010 11997
NM_000599chr233610 3444 1446 13273 12914 22941 1368
NM_000601chr71328 ------
NM_000611chr11176974 6632 6488 6411 6193 4841 4817 4588 4560 4441 2335 2258 2039 1867 1720 1049 192 66697 6518 5192 4553 2365 1579 --12595
NM_000615chr1112056 32235 454 344 ----
NM_000618chr1266305 6202 5573 2414 1048 980 45133 4807 2108 1092 ----
NM_000618chr1266305 6202 5573 2414 1048 980 45133 4807 2108 1092 ----
NM_000627chr22705 132 --1165 2738 26
NM_000633chr1865150 4447 1251 1025 975 725 1552 31954 1177 787 --
NM_000663chr1672651 2490 2321 2049 847 825 31 1870 1245 22937 227
NM_000689chr94422 210 116 27 ------
NM_000700chr9166 ----1176
NM_000719chr12126303 6069 5425 5194 4944 4557 4438 4390 4311 2678 826 265 14289 22653 2082 --
NM_000726chr221432 1364 ------
NM_000767chr1941555 1450 545 424 --11056 --
NM_000780chr8------2413 249
NM_000793chr1474156 1923 1490 756 458 222 87 24637 426 ----
NM_000801chr202788 704 1872 ----
NM_000807chr4--1586 ----
NM_000809chr458049 1763 767 637 132 49046 8544 8011 5901 ----
NM_000813chr543501 1768 1618 1474 ------
NM_000816chr5--1469 --170
NM_000828chrX3444 311 73 21762 436 ----
NM_000829chr1141878 1857 401 123 --22248 1899 --
NM_000831chr1135881 5103 4740 4721 4109 4015 2134 1917 1877 1655 1232 875 426 2845 385 25963 3913 14284
NM_000833chr1611184 ------
NM_000834chr1221134 1008 ------
NM_000838chr63557 233 86 ------
NM_000844chr33863 272 198 ------
NM_000859chr52449 305 180 ----
NM_000875chr15106625 4590 4561 2696 2500 2107 1711 1113 387 94 26076 375 --15595
NM_000877chr252921 2214 628 455 156 32382 2350 1184 1229 --
NM_000891chr1731151 773 287 2482 60 1160 --
NM_000894chr19--128 ----
NM_000908chr51695 2258 150 ----
NM_000917chr103872 654 352 ------
NM_000944chr411746 ------
NM_000949chr51107 ------
NM_000956chr143454 280 134 ------
NM_000961chr2053493 3064 2864 841 196 ----12758
NM_000963chr122481 1996 ----11818
NM_001001132chr2141176 1145 602 39 ------
NM_001001323chr1243146 3079 650 295 22405 259 ----
NM_001001394chr22603 243 1131 1512 --
NM_001001395chr1252655 2536 2512 2456 1721 ------
NM_001001396chr1103898 3810 3646 1738 1627 1410 1181 801 661 470 144 14296 --
NM_001001433chr2052816 2481 2297 1140 520 ------
NM_001001481chr852732 2654 1002 290 277 13373 1916 --
NM_001001521chr21279 ------
NM_001001556chr151154 ------
NM_001001890chr2163906 3534 2692 2641 165 82 1192 ----
NM_001001974chr1052167 1778 1468 948 137 ------
NM_001001995chrX21509 582 21645 560 ----
NM_001002243chr22180 129 ------
NM_001002257chr253377 2841 2776 2344 558 1308 --22595 68
NM_001002759chr101452 ------
NM_001002762chr10122873 2656 2581 2229 2082 2002 1137 511 448 419 122 39 1903 12160 --
NM_001002814chr893379 3113 3009 2459 1357 1001 769 589 288 ------
NM_001002838chrX1340 ----1289
NM_001002843chr152359 334 ----1860
NM_001002860chr1474241 4002 3340 2853 1060 1035 685 1893 24173 597 --
NM_001003406chr2283143 2919 2525 2472 2105 909 739 507 33322 3314 2140 ----
NM_001003407chr1084789 4422 3790 1688 1580 1476 923 607 21001 74 11624 --
NM_001003408chr1084789 4422 3790 1688 1580 1476 923 607 21001 74 11624 --
NM_001003652chr1888314 7584 6284 5463 3209 1949 865 732 13154 26324 2301 --
NM_001003679chr142057 1826 1644 662 ------
NM_001003712chr1253945 3731 3222 834 813 ------
NM_001003792chr31431 ------
NM_001003793chr31431 ------
NM_001003800chr951494 920 813 743 195 2968 582 2603 302 --
NM_001003940chr15103570 2885 2796 2354 1192 807 729 698 423 188 21504 1410 ----
NM_001003942chr15103570 2885 2796 2354 1192 807 729 698 423 188 21504 1410 ----
NM_001003943chr15103574 2889 2800 2358 1196 811 733 702 427 192 21508 1414 ----
NM_001004065chr933520 3302 173 ------
NM_001004317chr653667 3301 1199 952 676 13596 --11574
NM_001004342chr1185682 5591 5549 5441 5428 5263 5149 4978 4771 4695 4347 4092 3998 2237 1923 1691 1377 1089 35782 4042 1713 --175
NM_001004356chr441501 1219 1003 283 11235 ----
NM_001004358chr441501 1219 1003 283 11235 ----
NM_001004360chr231518 1461 784 1165 ----
NM_001004419chr1244594 2872 624 90 14263 1614 --
NM_001005266chr153272 150 82 ------
NM_001005267chr153272 150 82 ------
NM_001005268chr153272 150 82 ------
NM_001005269chr153272 150 82 ------
NM_001005473chr536653 6135 847 24968 43 ----
NM_001005476chr2--2561 65 1192 --
NM_001005505chr33706 448 129 2544 394 ----
NM_001005609chrX103517 3183 3045 2747 2732 2370 2352 1210 1028 213 23721 3244 13575 --
NM_001005739chr21634 --1670 --
NM_001005746chr221432 1364 ------
NM_001005747chr221432 1364 ------
NM_001005782chr21192 ------
NM_001005861chr3159 ------
NM_001005910chr31426 ------
NM_001005911chr31426 ------
NM_001005920chr1621115 750 ------
NM_001006115chr342746 2147 988 370 12164 32651 2602 2233 --
NM_001006617chr9189 ------
NM_001006619chr9189 ------
NM_001006620chr9189 ------
NM_001006621chr9189 ------
NM_001006932chr672821 2376 1212 1022 291 187 71 2649 100 ----
NM_001007023chr1474156 1923 1490 756 458 222 87 24637 426 ----
NM_001007067chr82283 80 ------
NM_001007068chr82283 80 ------
NM_001007069chr82283 80 ------
NM_001007070chr82283 80 ------
NM_001007097chr954264 3812 2038 167 66 1633 --13668
NM_001007098chr13603 314 273 ------
NM_001007102chr6--21488 45 ----
NM_001007156chr1541788 364 122 70 1375 ----
NM_001007277chr112821 705 ------
NM_001007471chr9--1806 ----
NM_001007794chr12537 179 ------
NM_001008220chr583569 3272 959 952 783 500 471 78 2487 267 --12742
NM_001008222chrX51344 1175 958 901 93 11089 11067 --
NM_001008239chr1843814 3500 3216 554 ------
NM_001008392chr3103116 2996 2320 2246 2195 1389 1372 1267 1088 423 11330 ----
NM_001008405chr731630 1331 1223 --1293 --
NM_001008407chr751612 1538 1329 1156 228 --1191 1147
NM_001008408chr795227 5134 4921 4212 4141 4083 2312 2215 1327 --14576 --
NM_001008541chr1062091 877 809 727 603 516 21874 565 ----
NM_001008541chr1062091 877 809 727 603 516 21874 565 ----
NM_001008711chr8147 ------
NM_001008777chr171223 ------
NM_001008938chr11154 ------
NM_001009555chr421117 111 ------
NM_001009894chr1221492 226 11188 1219 1322
NM_001009899chr385586 5398 2272 2085 1645 1609 1408 973 11753 11010 --
NM_001009993chr2104437 4344 4233 3151 3075 3036 2935 1762 859 151 1711 ----
NM_001010861chr122125 855 1227 ----
NM_001010867chr1185937 5753 4955 4591 4298 4142 4088 2359 2271 2212 1875 1832 862 651 570 369 134 112 46423 5854 1036 231 16114 25640 2646
NM_001010888chrX74438 3608 1112 694 277 262 243 11360 --11323
NM_001010891chr5106366 6171 6013 5624 5364 4795 2782 2484 1416 566 36684 4550 874 --14398
NM_001010908chr103747 556 260 1597 ----
NM_001010932chr71328 ------
NM_001010971chr11799 ------
NM_001010983chr3141 ------
NM_001011513chr463759 2568 968 949 751 235 ------
NM_001011551chrX----1457 --
NM_001011657chrX--2478 180 ----
NM_001011666chr7116438 6255 6080 5694 5684 5076 5025 4549 4539 4475 1605 36134 4903 971 24347 955 25846 1158
NM_001011708chr282936 2741 2610 2375 2350 1115 1100 308 --12653 --
NM_001012267chr941588 1251 521 232 --11553 --
NM_001012393chr1184428 3517 1975 1796 1612 1603 1189 367 --13156 14534
NM_001012426chr6102826 2477 2370 1325 1107 792 669 432 126 58 52923 2133 830 622 105 12439 --
NM_001012427chr6102826 2477 2370 1325 1107 792 669 432 126 58 52923 2133 830 622 105 12439 --
NM_001012753chr1961220 897 459 273 191 107 ------
NM_001012754chr1351867 1774 1618 1404 763 1777 ----
NM_001012755chrX34550 3133 1467 44108 3298 1102 170 13140 --
NM_001013031chr1042715 2665 2413 301 --2964 150 --
NM_001013406chr761481 1433 1276 573 500 312 ------
NM_001013438chr32823 69 ------
NM_001013439chr31669 ------
NM_001013620chr1297004 6945 6387 6031 3106 2980 643 538 207 26824 6344 16688 --
NM_001013693chr162435 2292 2135 2119 862 27 22302 2008 --12463
NM_001013693chr162435 2292 2135 2119 862 27 22302 2008 --12463
NM_001013699chr122377 109 ------
NM_001013746chr731781 901 78 1469 ----
NM_001014443chr12209 30 1201 149 --
NM_001014797chr1067678 7656 6703 2319 2113 164 141 16018 --
NM_001015045chr452277 2034 1938 909 497 22257 414 ----
NM_001015877chrX3610 316 292 11077 22324 164 --
NM_001015882chr92916 864 ------
NM_001017371chr211018 ------
NM_001017389chr16--1378 ----
NM_001017390chr16--1378 ----
NM_001017391chr16--1378 ----
NM_001017395chr343583 2444 2300 2246 --11286 --
NM_001017440chr7117926 7437 7013 6714 6602 5591 5189 3258 2814 2244 874 66499 6399 2911 2539 1444 694 11824 --
NM_001017923chr1421200 667 ------
NM_001017926chr851747 1663 1501 1313 417 --11268 --
NM_001017930chrX21471 1016 ------
NM_001017962chr103872 654 352 ------
NM_001017973chr51396 ------
NM_001017974chr51396 ------
NM_001017975chr11197 ------
NM_001018050chr22123107 3085 2975 2784 2508 2189 2163 1363 1288 1279 1169 932 33358 2469 2338 1168 --
NM_001018052chr22123107 3085 2975 2784 2508 2189 2163 1363 1288 1279 1169 932 33358 2469 2338 1168 --
NM_001018054chr111340 ------
NM_001018064chr951846 1512 1388 624 141 --1584 --
NM_001018067chr134192 3744 3479 13298 14508 --
NM_001018068chr134192 3744 3479 13298 14508 --
NM_001018069chr134192 3744 3479 13298 14508 --
NM_001018074chr553126 2611 1427 1311 927 21216 774 ----
NM_001018075chr553126 2611 1427 1311 927 21216 774 ----
NM_001018076chr553126 2611 1427 1311 927 21216 774 ----
NM_001018077chr553126 2611 1427 1311 927 21216 774 ----
NM_001018111chr721412 1387 53372 2724 2604 1224 537 ----
NM_001020825chr5186 ------
NM_001024094chr553126 2611 1427 1311 927 21216 774 ----
NM_001024401chr1672784 2590 1908 1831 677 617 529 32642 1862 939 1369 12684
NM_001024465chr6178 ------
NM_001024647chr1235081 427 95 32735 2303 1436 --56286 2928 2790 2289 2165
NM_001024649chr522268 991 1579 22988 975 --
NM_001024660chr311090 --21644 1114 1339
NM_001024847chr33716 212 130 --1709 --
NM_001024858chr1462671 2526 1963 547 338 322 12847 22379 955 --
NM_001024912chr1941728 1535 766 614 154 ----
NM_001024948chr123157 246 12378 ----
NM_001024956chr1145292 1999 1738 1084 14395 14361 24827 928
NM_001025076chr1076180 4944 4830 4753 4469 2202 499 22060 1999 ----
NM_001025077chr1077538 6302 6188 6111 5827 4751 1857 --152 --
NM_001025079chr334152 3988 3119 13073 13534 --
NM_001025233chr1272508 2211 1057 731 485 308 249 11107 147 --
NM_001025266chr373016 1978 1909 1858 1208 1048 801 ------
NM_001025389chr1131582 1164 442 ------
NM_001025390chr1131582 1164 442 ------
NM_001025580chrX43472 3440 1103 1012 11363 14111 --
NM_001025595chr431320 1054 650 ------
NM_001025603chr13595 490 59 2381 108 ----
NM_001029858chr653236 2275 2084 780 730 22372 158 ----
NM_001029859chr1172399 2173 1821 1699 1589 433 373 2151 44 11757 --
NM_001029863chr662257 2006 765 655 450 437 12121 --21116 866
NM_001029875chr51944 ----12113
NM_001029955chr432833 870 206 ------
NM_001030007chr1683919 3858 3751 3382 1217 1077 523 79 11533 12663 1922
NM_001030055chr1453579 2962 1908 1632 1166 1466 ----
NM_001030272chr111368 --1188 --
NM_001030273chr111368 --1188 --
NM_001031679chr1262801 2515 2388 2250 635 151 1676 21241 1185 --
NM_001031695chr2274801 4339 4028 3900 1366 1261 933 14157 ----
NM_001031700chr442495 2174 1900 84 ------
NM_001031735chr191227 ------
NM_001031746chr105287 161 118 73 59 1390 1234 --
NM_001031812chr532230 2174 542 1900 --11962
NM_001032296chr1352259 2090 1977 1894 1142 32962 2460 2396 ----
NM_001032363chr141960 714 625 82 2686 233 ----
NM_001032363chr141960 714 625 82 2686 233 ----
NM_001032380chr1021840 187 21625 174 ----
NM_001032393chrX--1271 ----
NM_001033044chr111767 --128 11594
NM_001033045chr284406 3536 3464 1416 575 346 324 105 13369 1850 --
NM_001033056chr111767 --128 11594
NM_001033059chr61122 11923 ----
NM_001033087chr2062838 2631 891 501 416 100 ----1447
NM_001033112chr52819 82 ------
NM_001033117chr3124598 4391 4217 3763 3289 1934 1854 1840 1721 1441 1216 147 21650 599 1934 --
NM_001033503chr5--1338 ----
NM_001033521chr20--1519 179 --
NM_001033522chr20--1519 179 --
NM_001033557chr23563 463 106 ----11443
NM_001033578chr872319 2249 1922 1815 821 216 38 ----11467
NM_001033602chr1332309 1093 865 22712 305 ----
NM_001033723chr8102392 2330 2193 2071 2065 761 360 171 118 36 32399 708 326 1848 --
NM_001033925chr10----11370 --
NM_001034837chr52656 300 1754 --1726
NM_001034838chr52656 300 1754 --1726
NM_001034841chr1664811 4685 3645 3499 619 42 1311 11663 --
NM_001034915chr821481 350 ------
NM_001034954chr1052642 1186 739 377 155 1394 13037 --
NM_001034955chr1052642 1186 739 377 155 1394 13037 --
NM_001034956chr1052642 1186 739 377 155 1394 13037 --
NM_001034957chr1052642 1186 739 377 155 1394 13037 --
NM_001035260chr1041584 1351 1153 317 ------
NM_001035511chr131433 867 577 1360 ----
NM_001037126chr7--150 ----
NM_001037163chr7171 ------
NM_001037290chr113807 722 218 1180 ----
NM_001037317chr122125 855 1227 ----
NM_001037331chr184909 795 648 321 --1925 --
NM_001037497chr6129 ------
NM_001037553chr21104915 3603 3515 1395 1234 1090 749 636 575 138 24858 3910 ----
NM_001037582chr42588 487 --21254 1130 11244
NM_001037637chr5------1130
NM_001039091chrX1390 2161 30 ----
NM_001039199chr20124988 4445 4016 3834 3691 3532 3450 1949 1483 773 696 527 --1163 1148
NM_001039348chr2134 ------
NM_001039349chr2134 ------
NM_001039465chr14----1211 --
NM_001039570chr2284381 4178 3395 3361 3278 1190 986 231 13711 12940 --
NM_001039571chr2284381 4178 3395 3361 3278 1190 986 231 13711 12940 --
NM_001039580chr424467 919 --1301 --
NM_001039585chr143575 1314 1152 130 ----12671
NM_001039618chr1155949 5167 4728 1942 1776 --15147 --
NM_001039690chr1652197 1821 1702 736 601 5905 692 413 371 365 ----
NM_001039716chr1155 1919 ----
NM_001039762chr104592 413 374 56 ------
NM_001039770chr331989 602 132 --11895 --
NM_001039840chrX53881 1806 1550 1541 412 25782 2245 ----
NM_001039846chr191227 ------
NM_001039937chr1321573 1050 23276 981 13800 1658
NM_001040092chr8----1393 --
NM_001040110chr751376 1234 1142 750 86 21744 1262 ----
NM_001040142chr21961 ------
NM_001040143chr21961 ------
NM_001040144chr1652197 1821 1702 736 601 5905 692 413 371 365 ----
NM_001040146chr1652197 1821 1702 736 601 5905 692 413 371 365 ----
NM_001040284chr1675831 5331 5072 4144 4118 1524 243 1423 ----
NM_001040402chr433122 2557 945 --12907 --
NM_001040429chr1352839 2303 1371 1054 487 23085 2933 ----
NM_001040450chr1532898 910 323 ------
NM_001040453chr1532898 910 323 ------
NM_001040665chr764609 4498 3536 2011 1337 353 11097 ----
NM_001040712chr95654 492 88 66 37 --13206 --
NM_001040715chr1671142 1084 943 921 483 42 29 1783 153 --
NM_001042355chr1633716 706 329 11629 ----
NM_001042357chr1021173 145 1300 ----
NM_001042358chr1021173 145 1300 ----
NM_001042360chr1021173 145 1300 ----
NM_001042361chr1021204 176 1331 ----
NM_001042363chr1021173 145 1300 ----
NM_001042364chr1021204 176 1331 ----
NM_001042365chr1021204 176 1331 ----
NM_001042387chr1021204 176 1331 ----
NM_001042388chr181255 ------
NM_001042389chr1021173 145 1300 ----
NM_001042390chr1021173 145 1300 ----
NM_001042392chr1021173 145 1300 ----
NM_001042393chr1021204 176 1331 ----
NM_001042395chr1021173 145 1300 ----
NM_001042396chr1021204 176 1331 ----
NM_001042397chr1021204 176 1331 ----
NM_001042404chr12369 316 ----1736
NM_001042412chr1633716 706 329 11629 ----
NM_001042413chr923729 2706 23967 1301 11356 --
NM_001042453chrX2465 44 ----11141
NM_001042471chr17129 ------
NM_001042481chr1441974 680 274 150 12042 12015 --
NM_001042492chr1732778 544 164 --1725 --
NM_001042494chr1573610 3082 2797 2386 285 142 100 22834 2353 ----
NM_001042495chr1573610 3082 2797 2386 285 142 100 22834 2353 ----
NM_001042496chr1573610 3082 2797 2386 285 142 100 22834 2353 ----
NM_001042497chr1573610 3082 2797 2386 285 142 100 22834 2353 ----
NM_001042533chr342554 878 571 68 22739 442 13053 --
NM_001042537chrX31991 103 76 ------
NM_001042543chr421152 1092 ------
NM_001042555chr1274491 4396 4316 1058 495 355 323 ------
NM_001042599chr297114 7056 5719 5570 5249 2381 1735 1092 919 --25333 2596 --
NM_001042601chr312737 23305 2459 1998 --
NM_001042603chr1274561 3924 3804 3307 1588 863 126 35202 5085 4794 ----
NM_001042604chr323716 3183 ------
NM_001042646chr331640 1625 125 ------
NM_001042749chrX21553 207 ------
NM_001042750chrX21553 207 ------
NM_001042751chrX21553 207 ------
NM_001043318chr1493586 2949 1630 1255 1018 929 628 423 263 23657 861 11234 --
NM_001044305chr611179 ------
NM_001044722chr532230 2174 542 1900 --11962
NM_001044723chr532230 2174 542 1900 --11962
NM_001046chr542911 980 651 318 --12883 --
NM_001048183chr1113690 2872 2738 2558 2467 1465 1395 1160 928 586 500 33089 1080 599 11065 --
NM_001071775chr13136 ------
NM_001076chr41199 ------
NM_001076chr41199 ------
NM_001079874chr151940 1616 280 145 60 ------
NM_001084chr71300 ------
NM_001092chr1792541 2198 2041 2026 1832 1714 1704 560 549 ------
NM_001095chr1241605 1387 1196 363 11538 11698 --
NM_001099678chr376111 4961 4452 4025 4015 905 312 1535 ----
NM_001100108chr168300 7566 6860 2885 1804 1412 26726 2032 12449 25639 1119
NM_001106chr3119344 9124 8976 7799 7508 7252 3632 3140 3129 2735 2326 56907 6753 6685 6672 2238 27667 6327 12827
NM_001113490chrX21267 514 13141 ----
NM_001116chr1652759 2331 2286 1992 647 22155 1108 ----
NM_001117chr1822401 1553 ------
NM_001122679chr531013 201 176 1135 ----
NM_001128chr1683919 3858 3751 3382 1217 1077 523 79 11533 12663 1922
NM_001160chr1262368 2045 870 851 563 92 --12471 --
NM_001167chrX65751 4803 2136 1433 1228 687 --11219 14422
NM_001173chr1453579 2962 1908 1632 1166 1466 ----
NM_001177chr1222043 495 --22398 1981 --
NM_001178chr111368 --1188 --
NM_001204chr2177622 7512 7501 7316 7165 6862 6742 6568 5695 5334 5051 1459 1237 1053 966 537 526 16014 35364 1841 550 --
NM_001206chr932808 2442 789 --184 --
NM_001207chr5------1130
NM_001217chr19----139 --
NM_001219chr712145 22017 503 21823 400 --
NM_001237chr41351 ------
NM_001237chr41351 ------
NM_001253chr6--1275 ----
NM_001256chr1752147 1925 1910 908 822 ------
NM_001259chr7106228 6128 5683 5616 1183 891 823 761 74 23 15295 14444 --
NM_001270chr51317 ------
NM_001278chr103881 858 192 ------
NM_001284chr51119 ------
NM_001289chrX21235 300 ------
NM_001298chr231282 946 214 11001 ----
NM_001304chr1721506 1092 11034 12484 --
NM_001315chr632119 2107 668 22299 454 11692 --
NM_001324chr20--1519 179 --
NM_001329chr101416 11382 ----
NM_001351chr351760 1412 1123 725 53 ------
NM_001356chrX31985 1967 664 --11533 11834
NM_001364chr1163913 3798 3770 3486 1108 902 33618 3406 1521 11663 --
NM_001387chr552866 2838 2266 2118 130 1855 1123 --
NM_001389chr21--1232 ----
NM_001396chr2112162 11888 1491 --
NM_001399chrX103517 3183 3045 2747 2732 2370 2352 1210 1028 213 23721 3244 13575 --
NM_001407chr3--11127 ----
NM_001419chr1994726 4380 4343 4025 3952 3159 1712 1418 1393 11908 1726 1657
NM_001422chr11--122 ----
NM_001426chr21271 ------
NM_001427chr72667 500 1371 1300 --
NM_001431chr61132 ------
NM_001444chr8--152 ----
NM_001482chr15----1135 --
NM_001483chr73962 255 106 ----1817
NM_001497chr982336 2055 1900 1753 1080 953 811 632 --1572 --
NM_001530chr14193 ------
NM_001543chr594226 4147 3645 3626 3620 1942 1791 1470 64 44104 1451 1309 823 23029 1103 11832
NM_001546chr621422 298 1356 134 --
NM_001554chr11122 ------
NM_001565chr41201 --1241 --
NM_001584chr111326 ------
NM_001604chr111985 ------
NM_001615chr2176 ------
NM_001616chr24981 847 707 57 ------
NM_001634chr61122 11923 ----
NM_001650chr1874132 3011 2801 1057 1029 867 306 1649 ----
NM_001659chr1231887 1705 377 2947 541 12414 --
NM_001663chr1422046 330 ------
NM_001668chr111860 --12024 --
NM_001684chr1103615 3527 3363 1455 1344 1127 898 518 378 187 11674 14013 --
NM_001695chr884308 3156 2763 2683 1083 847 683 337 --11249 --
NM_001699chr1961779 1698 1127 731 694 238 ------
NM_001704chr62540 67 ------
NM_001709chr1152071 1148 1093 813 780 12826 --11999
NM_001716chr1191385 1320 1308 1206 1110 1102 966 571 563 31561 600 209 ----
NM_001717chr1521203 33 ------
NM_001731chr121254 ------
NM_001746chr522268 991 1579 22988 975 --
NM_001753chr711865 ------
NM_001754chr2163906 3534 2692 2641 165 82 1192 ----
NM_001759chr1294370 4361 4274 4258 3674 1867 1822 1195 570 25036 2085 ----
NM_001760chr62897 209 1126 2873 93 --
NM_001777chr334152 3988 3119 13073 13534 --
NM_001796chr161236 ------
NM_001802chr162702 304 187 1197 --
NM_001826chr11444 ------
NM_001830chrX73899 3768 3671 3561 3552 3363 1287 ------
NM_001831chr831094 122 108 21060 957 ----
NM_001833chr9158 ------
NM_001845chr1341388 1309 1179 200 ------
NM_001851chr61142 ------
NM_001854chr111196 --1545 --
NM_001859chr973789 3115 2634 1328 1257 737 215 --13933 --
NM_001884chr51216 ------
NM_001903chr5--1929 ----
NM_001904chr31690 ------
NM_001931chr1111133 1955 ----
NM_001938chr11337 21875 1403 ----
NM_001941chr1823671 708 --11184 12469
NM_001949chr692970 2876 2559 2290 1275 690 569 256 219 12508 ----
NM_001954chr61229 ----1626
NM_001968chr4172 ------
NM_001969chr1463803 3622 3154 1149 728 335 23554 1267 12575 1159
NM_001977chr41147 ----11201
NM_001982chr121936 ----2880 862
NM_001987chr1243229 2696 1110 220 44314 3092 1023 457 ----
NM_002006chr495202 4073 4012 3866 3679 2139 1916 1484 736 ----11985
NM_002009chr1532244 1084 991 --12767 --
NM_002015chr1353372 2923 2358 2233 1034 12419 23326 3110 --
NM_002017chr1131352 1085 280 123 ----
NM_002024chrX42019 1843 1605 76 ------
NM_002025chrX98387 6754 6011 3524 2905 2818 2059 1983 1340 22142 1212 18616 25904 300
NM_002028chr144940 842 417 97 1884 11129 --
NM_002039chr4----1721 --
NM_002044chr151154 ------
NM_002048chr94529 244 192 36 ------
NM_002049chrX1142 ------
NM_002054chr2----172 --
NM_002065chr111767 --128 11594
NM_002086chr1742148 1451 1383 852 1624 ----
NM_002092chr484959 4671 3824 3608 3598 3583 1701 1421 --23490 645 --
NM_002094chr16--2140 56 ----
NM_002126chr1773968 3852 3257 1179 930 452 298 --11631 14130
NM_002128chr1312192 ------
NM_002130chr511232 11629 --1632
NM_002158chr263279 2868 2593 2476 1391 205 ------
NM_002181chr2151 1716 1633 --
NM_002189chr101126 1107 129 1539
NM_002193chr211818 ------
NM_002199chr41115 ------
NM_002203chr543897 3801 1616 983 21435 786 21546 1199 --
NM_002214chr754860 4332 1494 1444 1150 24218 3674 11886 13597
NM_002221chr152972 1062 704 608 322 32686 2033 445 1307 --
NM_002226chr141790 ------
NM_002247chr1021921 890 ------
NM_002249chr11469 ------
NM_002266chr17--1241 ----
NM_002268chr331440 421 384 ----1438
NM_002270chr595552 4362 3952 3939 1897 1404 1098 834 188 15018 24249 4112 --
NM_002271chr134845 438 213 114 ------
NM_002290chr611483 --11210 1925
NM_002306chr141113 ------
NM_002310chr575841 5469 4864 4180 2333 2322 713 11545 22187 42 --
NM_002312chr13127 ------
NM_002313chr1084789 4422 3790 1688 1580 1476 923 607 21001 74 11624 --
NM_002334chr1181746 1706 1481 1400 1374 832 804 82 --1137 --
NM_002336chr1295048 4827 4236 3746 3383 3184 1538 795 763 ----23957 405
NM_002343chr3136 ------
NM_002345chr122588 543 ------
NM_002349chr211611 1229 ----
NM_002351chrX31290 337 55 ------
NM_002380chr83752 242 67 176 ----
NM_002383chr164584 343 240 59 ----1314
NM_002397chr53861 762 198 ------
NM_002398chr221334 257 21486 1026 ----
NM_002399chr1551434 1363 1033 938 260 ------
NM_002429chr1231384 1345 1190 181 --21530 1255
NM_002448chr41786 ------
NM_002481chr186824 6214 5679 5228 3071 3049 2273 1648 25771 5073 16873 --
NM_002489chr71296 ------
NM_002499chr155879 645 444 197 116 ------
NM_002501chr19113622 3332 3134 2591 1455 1100 861 766 688 396 239 ------
NM_002515chr141431 --1265 --
NM_002522chr1793383 2882 2769 2612 2606 2439 1473 216 197 13633 22925 23 --
NM_002524chr121029 120 ------
NM_002538chr51485 ------
NM_002543chr1221037 59 3615 242 95 ----
NM_002545chr1184428 3517 1975 1796 1612 1603 1189 367 --13156 14534
NM_002546chr81639 ------
NM_002570chr1511025 1973 ----
NM_002572chr11--1311 ----
NM_002576chr1121046 35 ------
NM_002578chrX----2182 141 --
NM_002581chr954359 4103 1533 1108 440 34436 4406 1095 ----
NM_002583chr121543 ------
NM_002592chr20----135 --
NM_002613chr16134820 4750 4421 4265 3870 3513 2158 1746 1689 1111 853 566 478 24095 3976 --1805
NM_002629chr104661 335 246 234 ------
NM_002645chr1122038 574 1996 --1808
NM_002655chr894828 4366 4118 3735 3566 3496 3473 605 131 --15108 --
NM_002656chr621051 309 ------
NM_002657chr2022688 443 33386 1496 394 31229 1130 193 --
NM_002667chr611269 ------
NM_002687chr141324 1919 ----
NM_002706chr2------1726
NM_002709chr253560 3163 2924 2581 1002 ------
NM_002711chr7135 ------
NM_002715chr521000 158 ------
NM_002716chr1183381 3104 2990 1309 1112 1044 336 215 21083 557 ----
NM_002717chr81161 ------
NM_002719chr1431659 919 187 11973 1679 --
NM_002731chr142694 2503 2056 1127 --12942 --
NM_002734chr1712015 ------
NM_002742chr14------1615
NM_002748chr15175 ------
NM_002753chr42741 102 1266 --1326
NM_002760chrY35438 1256 62 --11158 --
NM_002765chrX1390 2161 30 ----
NM_002822chr121415 144 ----
NM_002834chr1243687 2608 1502 547 11264 13591 11120
NM_002837chr1263937 3763 3325 1649 1495 236 33946 3447 676 11707 13721
NM_002839chr95654 492 88 66 37 --13206 --
NM_002840chr161483 1244 321 261 250 67 ------
NM_002843chr1113123 11125 33210 2275 1230 --
NM_002852chr31580 ------
NM_002855chr11113428 3372 3257 3175 1336 1274 1234 1165 907 429 295 31151 873 154 ----
NM_002857chr142600 1825 1773 1035 11668 1616 12246
NM_002869chr1131630 1562 1362 2496 36 ----
NM_002874chr9--22389 540 ----
NM_002886chr355138 4394 1682 492 127 14571 ----
NM_002892chr142602 182 ------
NM_002893chrX----1272 --
NM_002902chr151101 ------
NM_002906chr1121601 35 12419 ----
NM_002922chr12525 263 ------
NM_002942chr32955 527 1311 1939 --
NM_002945chr172846 309 ------
NM_002956chr122981 410 ------
NM_002958chr3159 ------
NM_002971chr32939 893 162 ----
NM_002976chr22368 121 158 ----
NM_002990chr16101754 974 853 707 680 460 305 285 93 54 1727 ----
NM_002994chr451563 1487 1354 297 195 ------
NM_003017chr621293 95 ------
NM_003021chr194442 378 271 55 21175 1007 ----
NM_003026chr931196 1156 305 --1461 --
NM_003027chr151411 ------
NM_003028chr9103897 3732 3494 3200 2847 1269 797 469 417 59 12524 --1567
NM_003030chr331770 1676 1380 11706 ----
NM_003034chr12148091 7477 7237 7168 7114 6878 6637 4936 3200 2327 1829 1644 1610 570 66647 5391 4968 2252 1168 648 36938 3151 773 --
NM_003036chr13371 299 202 ------
NM_003068chr8--171 ----
NM_003069chrX--1153 ----
NM_003070chr9----1806 --
NM_003075chr121122 ------
NM_003079chr173978 237 148 2914 757 ----
NM_003107chr622340 1984 ------
NM_003108chr245353 2687 2550 2026 15928 15331 --
NM_003111chr211018 ------
NM_003112chr723066 2921 1638 ----
NM_003113chr22583 46 ------
NM_003115chr11422 ------
NM_003128chr212360 164 ----
NM_003133chr11189 ------
NM_003137chr642185 1933 538 91 ----1343
NM_003150chr1742265 2171 1952 815 --22135 499 --
NM_003155chr852792 2178 1839 607 582 --12687 --
NM_003161chr1733069 830 817 ------
NM_003165chr91110 1340 ----
NM_003173chrX31236 1079 956 ------
NM_003180chr19294 28 ------
NM_003185chr202986 952 ------
NM_003189chr192739 2549 2466 2213 1333 1134 739 541 146 --2700 479 --
NM_003198chr11217 ------
NM_003199chr1875367 4938 3653 1435 685 520 375 --11444 --
NM_003202chr581924 1733 1621 1308 717 556 506 156 21246 683 ----
NM_003221chr653030 3006 2906 1297 1104 23749 1146 --12834
NM_003234chr322411 1956 --2702 454 --
NM_003242chr33716 212 130 --1709 --
NM_003246chr1521268 534 ------
NM_003253chr2151867 771 610 543 208 ------
NM_003269chr631107 1032 69 ------
NM_003270chrX1931 --21118 1072 1250
NM_003320chr1174276 3776 1571 556 527 501 94 ----11644
NM_003325chr222534 223 1206 ----
NM_003336chrX1300 ------
NM_003339chr551526 1249 1168 1076 62 ----197
NM_003340chr411039 --1441 --
NM_003341chr32660 589 ------
NM_003348chr1221462 1289 1112 ----
NM_003352chr21192 ------
NM_003355chr11--1329 ----
NM_003360chr41241 ------
NM_003373chr1051914 1610 1280 573 206 ----1291
NM_003382chr732426 538 340 31701 1518 36 1798 --
NM_003385chr22408 282 ------
NM_003387chr241821 1167 1057 354 22069 30 1544 --
NM_003392chr333885 3006 700 --11035 --
NM_003404chr2021827 1313 ------
NM_003406chr8--11792 11885 --
NM_003410chrX32380 1249 1019 ------
NM_003418chr31820 1548 1299 --
NM_003430chr195646 492 397 137 111 ------
NM_003432chr51110 ----184
NM_003453chr131538 ------
NM_003462chr1----21220 86 --
NM_003463chr62700 89 ------
NM_003466chr252181 1924 1713 1602 59 22419 115 --11729
NM_003468chr233865 1411 873 43901 3520 3366 3066 ----
NM_003473chr101893 ------
NM_003483chr1211900 --12535 --
NM_003485chr1451212 194 122 104 40 21163 858 2171 141 --
NM_003488chr172625 109 ------
NM_003489chr2133099 2829 2109 ------
NM_003498chr1642617 1842 821 281 22299 477 2367 345 --
NM_003506chr81413 ------
NM_003576chr1352259 2090 1977 1894 1142 32962 2460 2396 ----
NM_003583chr1263276 1520 715 392 239 50 ------
NM_003590chr253921 2703 1591 665 139 12473 ----
NM_003593chr172124 48 1436 ----
NM_003603chr441864 712 235 169 ------
NM_003607chr133668 2834 1110 53874 3833 3680 3348 695 33915 1200 440 11349
NM_003615chr313229 --23921 1371 --
NM_003618chr211118 ------
NM_003628chr2--2561 65 1192 --
NM_003629chr1103063 2900 2874 2844 2409 1404 1060 543 340 220 ----12717
NM_003636chr171810 1739 1460 1329 644 254 66 31359 328 196 ----
NM_003644chr17125968 5896 5478 5357 4990 4410 2360 2269 1217 761 419 341 34018 1451 185 25484 2051 --
NM_003648chr2102623 2146 2057 1911 1702 1681 647 612 164 99 ------
NM_003670chr331196 963 218 ------
NM_003671chr941311 1238 269 97 ------
NM_003692chr9--1671 ----
NM_003701chr131745 1997 ----
NM_003711chr52212 98 ------
NM_003716chr3--1998 ----
NM_003722chr342647 1668 274 79 1807 1194 --
NM_003732chr51281 ------
NM_003759chr464054 3505 2972 2924 1051 39 13617 ----
NM_003763chr2052816 2481 2297 1140 520 ------
NM_003772chr1111036 ------
NM_003787chr18--11209 ----
NM_003816chr82238 83 ------
NM_003829chr91310 ------
NM_003842chr842279 2244 840 196 161 1682 --
NM_003861chr1442864 2817 2535 2233 --12380 11930
NM_003862chr52330 100 ------
NM_003872chr263035 2941 2477 2442 2351 216 22150 1095 22267 946 --
NM_003873chr1032444 818 116 --21712 1685 --
NM_003878chr81208 ------
NM_003885chr1742004 1760 1042 388 12626 ----
NM_003893chr102448 351 ------
NM_003895chr212589 90 1323 ----
NM_003909chr841903 673 409 238 1181 ----
NM_003913chr641336 899 538 472 ------
NM_003916chrX21168 123 ------
NM_003919chr7--1274 ----
NM_003934chr9----1227 --
NM_003948chr4----12516 11799
NM_003966chr5107504 6977 5115 2794 2589 2571 2070 1530 772 219 56433 1901 800 564 268 14900 --
NM_003983chr1654138 3905 3854 1425 155 12867 13194 --
NM_004006chrX22077 231 11677 ----
NM_004007chrX22077 231 11677 ----
NM_004009chrX22077 231 11677 ----
NM_004010chrX22077 231 11677 ----
NM_004011chrX22077 231 11677 ----
NM_004012chrX22077 231 11677 ----
NM_004013chrX22077 231 11677 ----
NM_004014chrX22077 231 11677 ----
NM_004015chrX22077 231 11677 ----
NM_004016chrX21991 145 11591 ----
NM_004017chrX22077 231 11677 ----
NM_004018chrX21991 145 11591 ----
NM_004020chrX22077 231 11677 ----
NM_004021chrX21991 145 11591 ----
NM_004022chrX21991 145 11591 ----
NM_004023chrX21991 145 11591 ----
NM_004028chr1874132 3011 2801 1057 1029 867 306 1649 ----
NM_004050chr1472652 2506 2138 1776 1747 822 154 22771 2477 ----
NM_004052chr101622 ------
NM_004055chr1152249 1840 600 360 292 ----1388
NM_004056chr821121 116 ------
NM_004060chr54249 99 90 38 1224 ----
NM_004076chr221125 ------
NM_004077chr1241140 461 393 383 146 11042 --
NM_004080chr72985 139 11006 --11341
NM_004087chr341962 1377 590 456 ------
NM_004090chr1733227 2985 704 2905 834 1416 --
NM_004100chr632296 2255 782 12480 ----
NM_004105chr2134 ------
NM_004117chr651809 1740 621 450 249 12102 --1264
NM_004136chr1552463 1993 1249 749 47 ------
NM_004161chr211468 ------
NM_004171chr1189536 8008 3764 2683 2221 1502 986 460 19114 12792 --
NM_004180chr2------1200
NM_004187chrX21102 76 21377 1016 ----
NM_004193chr10185 ----1341
NM_004199chr51396 ------
NM_004200chr1173216 3024 2815 2232 2142 941 319 42788 2735 675 456 186 --
NM_004241chr10186 ------
NM_004249chr4179 ------
NM_004261chr1--1698 1832 --
NM_004272chr541990 1500 1305 442 ------
NM_004274chr1432388 1152 187 --1943 --
NM_004286chr2272276 1916 1814 1036 1003 687 170 22729 2324 --1662
NM_004290chr53434 266 210 1535 ----
NM_004293chr923688 309 --12792 1252
NM_004294chr132731 689 ------
NM_004302chr12122925 2775 2609 2215 1971 1010 790 466 372 279 141 117 12746 12113 --
NM_004311chr1052242 2211 2187 965 809 1932 12145 --
NM_004329chr102354 306 ------
NM_004330chr1521097 834 ------
NM_004331chr842704 2594 1874 989 --1609 --
NM_004370chr631900 477 462 11522 11679 --
NM_004380chr1662585 2538 2274 2242 1810 721 ----12296
NM_004384chr532230 2174 542 1900 --11962
NM_004385chr5146 ------
NM_004386chr193434 151 101 1281 12043 1794
NM_004392chr1352599 2408 2237 664 88 11994 ----
NM_004393chr331709 716 148 --1573 --
NM_004397chr1183647 3525 3288 2982 2719 1387 1337 840 34329 3438 623 1427 --
NM_004412chr1065651 5442 4061 1726 1461 948 25526 1021 15049 14660
NM_004417chr5--1224 ----
NM_004420chr11122378 2328 2206 2096 2049 1656 1603 966 778 407 140 41 12295 ----
NM_004432chr921667 94 ------
NM_004437chr143441 2720 852 604 12379 11146 --
NM_004438chr282709 2605 2287 2253 1112 873 638 506 --12593 --
NM_004447chr123796 448 68 ----1166
NM_004449chr2111353 ------
NM_004458chrX32420 2234 1050 --171 12116
NM_004459chr171643 11653 ----
NM_004482chr22925 653 ------
NM_004485chr183830 3568 3305 3185 1576 834 264 45 13126 174 --
NM_004499chr51544 ------
NM_004500chr1431980 645 213 11649 ----
NM_004501chr132794 906 521 ------
NM_004504chr21124 --12839 12364
NM_004529chr92570 434 1520 ----
NM_004535chr2031286 550 521 21792 296 ----
NM_004571chr2152570 2124 1318 534 122 23291 511 1516 --
NM_004586chrX84492 4317 3950 1825 1709 1006 946 39 25177 3908 25370 4337 13545
NM_004598chr562699 2393 1011 897 814 328 33158 3064 2590 ----
NM_004612chr984191 4165 3374 3090 1609 1167 1079 849 --14291 --
NM_004613chr2091675 1376 1270 1243 1117 1111 235 172 31 ----21126 505
NM_004631chr111340 ------
NM_004655chr173214 43 36 ------
NM_004657chr22462 359 ------
NM_004660chrY21895 660 ----11764
NM_004663chr153369 274 133 1319 ----
NM_004685chr1362899 2871 2520 898 487 166 12177 ----
NM_004686chr81338 1231 ----
NM_004694chr171184 ------
NM_004703chr1722456 1562 12099 11692 --
NM_004704chr3165 --126 --
NM_004719chr1221830 996 ----12096
NM_004734chr1342596 2349 130 70 ------
NM_004736chr11805 22229 161 11446 --
NM_004744chr463932 3836 2647 1030 686 527 ----3922 496 163
NM_004745chr8126192 5785 5496 5243 4950 4635 4303 2655 2187 1808 1378 714 35420 4615 481 --15268
NM_004748chr1533743 2638 694 13598 ----
NM_004755chr141302 ------
NM_004768chr11131 --1878 --
NM_004774chr1742740 2360 761 359 21227 742 12208 --
NM_004776chr2072829 2578 2231 2178 996 698 626 ------
NM_004779chr521278 211 11069 ----
NM_004788chr1132525 1670 750 --11889 --
NM_004798chr2063128 2748 2670 765 757 537 22697 1339 ----
NM_004799chr1190 ------
NM_004809chr156688 652 514 104 50 38 3134 122 27 ----
NM_004815chr134145 3033 1564 11551 21024 523 --
NM_004820chr8--1165 --158
NM_004822chr1763525 3352 1187 1042 746 453 23537 844 ----
NM_004836chr23360 173 144 ----1747
NM_004840chrX31705 713 484 12398 --11581
NM_004842chr62624 38 --11506 --
NM_004857chr1474612 1760 1559 1325 612 327 152 ------
NM_004863chr14124966 4884 4468 4186 4161 3946 3819 3502 1158 1086 722 65 --12023 --
NM_004865chr6----1136 --
NM_004866chr544326 3926 1319 433 11885 13590 --
NM_004867chrX1162 ------
NM_004874chr8126 ------
NM_004879chr111699 ------
NM_004896chr1041499 1266 1068 232 ------
NM_004898chr432487 1932 1008 1292 ----
NM_004902chr20--1338 1735 --
NM_004904chr7116438 6255 6080 5694 5684 5076 5025 4549 4539 4475 1605 36134 4903 971 24347 955 25846 1158
NM_004912chr761481 1433 1276 573 500 312 ------
NM_004926chr1431502 273 97 --1316 1119
NM_004956chr784017 3884 3592 3546 3251 2975 1298 706 24626 783 ----
NM_004965chr211660 ------
NM_004969chr101366 ------
NM_004976chr1185058 4712 4509 4310 3946 3283 3215 1664 31837 1449 1089 14368 --
NM_004992chrX118255 6913 6775 5839 5366 3236 3230 2869 2475 2008 1162 27353 1706 36440 6412 1413 15948
NM_004992chrX118255 6913 6775 5839 5366 3236 3230 2869 2475 2008 1162 27353 1706 36440 6412 1413 15948
NM_004993chr1421404 1377 11223 ----
NM_004999chr643052 1654 1355 992 --13591 11108
NM_005011chr751376 1234 1142 750 86 21744 1262 ----
NM_005017chr32218 55 ------
NM_005023chr531562 1117 151 1408 ----
NM_005056chr1274805 4168 4048 3551 1832 1107 370 35446 5329 5038 ----
NM_005057chr131402 1295 582 ----1208
NM_005063chr1032974 651 185 22837 328 12423 1226
NM_005065chr1434101 3857 3570 34613 4220 3658 ----
NM_005077chr9--1165 ----
NM_005082chr17113088 2888 2846 1437 1284 1113 1066 1051 1040 910 40 13616 --11299
NM_005087chr31669 ------
NM_005095chr161750 1548 1424 660 400 86 --193 --
NM_005116chr2054603 3837 3653 390 349 23879 1185 23740 199 --
NM_005121chr1753860 3563 3340 726 293 12445 22912 2471 --
NM_005126chr312069 --32036 1651 686 --
NM_005134chr181255 ------
NM_005135chr1573610 3082 2797 2386 285 142 100 22834 2353 ----
NM_005137chr2292325 2220 1894 1718 851 792 773 625 82 32404 982 558 ----
NM_005144chr861083 1011 946 927 254 167 21064 192 --1390
NM_005160chr2286397 6009 5010 4607 2672 2101 1166 1104 11803 --15431
NM_005161chr113560 299 22 11877 ----
NM_005188chr11127925 7788 7019 6933 6608 6429 6360 5784 5130 2722 1660 1637 46517 2145 1944 519 16744 18207
NM_005197chr141639 32371 935 419 44566 3811 1426 792 --
NM_005201chr31187 ------
NM_005207chr2243673 2316 1462 855 31364 1344 110 ----
NM_005233chr3--1108 ----
NM_005235chr297114 7056 5719 5570 5249 2381 1735 1092 919 --25333 2596 --
NM_005238chr1163242 2903 2343 998 930 138 --21123 624 12587
NM_005241chr3--135 ----
NM_005249chr14----195 176
NM_005254chr153370 280 133 11097 ----
NM_005264chr101764 1783 1746 --
NM_005281chr12891 285 ------
NM_005284chr6----162 --
NM_005295chr71261 ------
NM_005316chr111345 11020 ----
NM_005324chr1731369 377 112 11409 1693 --
NM_005329chr1651690 1642 720 611 526 1519 31535 821 323 --
NM_005349chr42535 401 ------
NM_005357chr19189 ------
NM_005359chr1836448 4822 2360 26292 808 11164 13969
NM_005370chr1941329 1174 364 23 11318 163 --
NM_005397chr721412 1387 53372 2724 2604 1224 537 ----
NM_005399chr163969 3807 2930 1463 1230 238 44063 3463 3081 724 --12820
NM_005400chr243106 2292 278 108 1941 --11889
NM_005406chr181557 ------
NM_005410chr51579 ------
NM_005415chr21647 1786 ----
NM_005424chr12299 95 --1384 --
NM_005436chr1033829 3129 2868 13571 12578 --
NM_005440chr1742887 1265 1172 470 22749 535 ----
NM_005455chr131830 1776 288 ------
NM_005465chr141709 1509 779 540 1657 --1304
NM_005475chr1272812 2624 2485 1084 713 528 157 1410 23042 980 --
NM_005494chr71565 ------
NM_005497chr1795352 5212 4977 4523 4447 1901 1449 780 400 24037 132 1924 24734 2188
NM_005502chr93893 651 428 --12631 --
NM_005503chr1511063 ------
NM_005504chr1245019 880 520 247 --12277 --
NM_005509chr5------11852
NM_005517chr11313 ----1395
NM_005524chr3--1245 ----
NM_005537chr132928 251 ------
NM_005542chr721703 329 ------
NM_005573chr52744 118 ------
NM_005578chr365165 3859 3300 1818 1495 561 24103 589 ----
NM_005584chr13146 ------
NM_005585chr151369 ------
NM_005596chr965405 4986 2366 563 448 368 14866 35334 4701 923 --
NM_005607chr81273 ------
NM_005613chr132170 1709 893 --184 --
NM_005625chr82283 80 ------
NM_005626chr12409 163 ------
NM_005634chrX1181 ------
NM_005664chr15--1732 1182 --
NM_005665chr153156 1669 889 874 778 --11804 --
NM_005668chr573700 1736 1680 1104 1056 938 737 23936 3000 --14139
NM_005721chr2--1770 ----
NM_005725chr132061 632 456 11851 ----
NM_005730chr1292769 2642 2313 2299 1423 1031 961 674 639 12255 21265 942 23196 2880
NM_005734chr11--2247 24 ----
NM_005739chr152955 124 12181 --11694
NM_005746chr742715 2369 1863 210 ------
NM_005748chr1243460 3407 2673 2094 12770 --12739
NM_005749chr17189 ------
NM_005752chr1621245 903 ------
NM_005754chr51407 ------
NM_005759chr233251 1208 64 23103 2956 ----
NM_005778chr31406 ------
NM_005785chr1231357 249 112 11830 ----
NM_005808chr3103116 2996 2320 2246 2195 1389 1372 1267 1088 423 11330 ----
NM_005822chr631882 1537 132 ------
NM_005828chr1774322 4081 3950 3181 1674 1660 776 1702 44676 1538 1453 954 --
NM_005832chr321147 953 137 1441 --
NM_005840chrX177029 6886 6828 6627 6168 6038 5534 4930 4858 4704 2577 2560 2393 2131 1556 1291 62 26926 1526 --15218
NM_005842chr132510 242 ------
NM_005843chr221242 29 11676 ----
NM_005845chr1331394 671 22 1291 ----
NM_005853chr161583 ------
NM_005857chr111006 1117 ----
NM_005859chr541350 1216 441 376 ------
NM_005870chr1331493 468 186 --191 1336
NM_005877chr2252241 1889 206 77 25 21932 287 ----
NM_005880chr1641542 1474 1388 404 ------
NM_005885chr511508 ------
NM_005898chr1122360 228 12520 12989 --
NM_005901chr1888314 7584 6284 5463 3209 1949 865 732 13154 26324 2301 --
NM_005902chr1574637 4337 4277 1761 1577 833 422 23059 746 13703 --
NM_005909chr523719 99 1880 23269 688 14064
NM_005910chr1783997 3694 3514 2576 1502 1444 1113 1059 52692 2518 1617 1323 1184 --23651 1543
NM_005911chr251232 915 479 60 52 ------
NM_005920chr153824 2559 2412 383 369 --2825 581 --
NM_005924chr7155 ------
NM_005926chr15------1408
NM_005933chr1192683 2559 1967 1936 930 850 616 459 413 32322 2147 1163 12701 --
NM_005935chr454394 3941 1923 1796 55 11316 ----
NM_005937chr1794075 3096 1400 1254 1188 1130 394 253 180 43485 3063 1436 556 ----
NM_005941chr831308 875 249 13531 12765 1369
NM_005955chr1135199 5189 4226 3948 3868 2124 1697 1635 1539 1483 1465 1212 677 ------
NM_005957chr1114915 4030 3116 1963 1848 1651 1558 1272 923 623 382 11573 44151 3592 835 321 24012 3196
NM_005962chr1062091 877 809 727 603 516 21874 565 ----
NM_005962chr1062091 877 809 727 603 516 21874 565 ----
NM_005966chr241948 1485 543 246 --173 --
NM_005986chr1332755 1834 727 41736 798 415 344 12749 --
NM_005999chr131218 510 463 ------
NM_006007chr943927 3487 2745 1523 --1553 --
NM_006011chr15114234 4087 3917 3435 2761 2751 1243 1069 549 407 220 24059 442 ----
NM_006015chr121044 263 ------
NM_006016chr632096 860 832 --1680 --
NM_006030chr33706 448 129 2544 394 ----
NM_006033chr1852220 672 424 410 371 2255 57 11496 --
NM_006036chr232591 939 527 --1518 --
NM_006037chr231472 1360 147 41861 965 165 53 ----
NM_006038chr2041761 1570 1359 1351 12006 1464 --
NM_006041chr171128 ------
NM_006047chr2033189 884 461 1649 ----
NM_006051chr5198 ------
NM_006064chrX1302 ------
NM_006067chr161261 2702 379 ----
NM_006080chr73698 554 407 11846 ----
NM_006090chr12537 179 ------
NM_006100chr31237 --1478 --
NM_006106chr1152108 1315 1264 284 74 ------
NM_006107chr17--1147 ----
NM_006108chr1171850 1810 1770 1541 959 713 253 ------
NM_006110chr161127 ------
NM_006113chr151940 1616 280 145 60 ------
NM_006134chr211274 --11596 11449
NM_006141chr1622087 1021 22404 425 ----
NM_006154chr152976 740 --1290 --
NM_006158chr811714 ------
NM_006159chr12----1614 --
NM_006180chr951846 1512 1388 624 141 --1584 --
NM_006187chr1252990 2657 2348 989 699 32867 1083 1045 ----
NM_006191chr121282 1750 ----
NM_006194chr141479 ------
NM_006197chr841956 1444 733 448 21811 437 1188 --
NM_006203chr574272 3642 2151 1650 1010 872 468 11990 13829 --
NM_006206chr452289 2122 2076 623 267 --1989 --
NM_006209chr8----1393 --
NM_006218chr31214 127 --1253
NM_006224chr1721627 201 11824 21758 854 --
NM_006226chr21177 ------
NM_006246chr141398 ------
NM_006251chr542539 827 773 51 2877 163 ----
NM_006252chr157576 6655 6395 5594 5087 --11439 11663
NM_006256chr132147 2079 1102 ------
NM_006258chr1031373 1175 241 11259 ----
NM_006264chr41398 ------
NM_006265chr821563 407 ------
NM_006275chr201594 11688 --1264
NM_006281chr821115 1013 ----1873
NM_006281chr821115 1013 ----1873
NM_006283chr854793 3553 3487 1712 1291 23452 3077 ----
NM_006288chr1131221 847 32 --1995 --
NM_006306chrX85829 4002 3716 2288 1086 968 756 40 11001 11218 11429
NM_006307chrX167 ------
NM_006310chr171278 --21109 1066 --
NM_006317chr51286 ------
NM_006322chr132291 206 ------
NM_006343chr21147 ------
NM_006348chr72314 287 --1795 --
NM_006356chr17122 ------
NM_006359chrX31991 103 76 ------
NM_006361chr1741654 1569 1453 103 172 --11709
NM_006371chr395169 4422 3779 3334 2024 988 492 162 127 15241 14735 --
NM_006375chrX2262 178 11615 1439 --
NM_006380chr1773203 2670 1677 1557 1262 1109 300 ------
NM_006393chr1032881 2760 860 11318 ----
NM_006403chr651580 1430 630 587 442 ------
NM_006416chr6164 ------
NM_006420chr2032317 1279 1138 --11029 --
NM_006434chr1052642 1186 739 377 155 1394 13037 --
NM_006439chr41105 ------
NM_006457chr463759 2568 968 949 751 235 ------
NM_006459chr104738 731 450 326 21514 1405 ----
NM_006475chr13142 ------
NM_006482chr1263276 1520 715 392 239 50 ------
NM_006486chr222138 123 ----2193 158
NM_006489chr141431 --1265 --
NM_006494chr192811 756 --2229 63 --
NM_006496chr11704 ------
NM_006500chr115845 248 180 99 76 21127 231 ----
NM_006504chr1072660 2281 1998 1976 1846 1811 1096 22408 353 ----
NM_006516chr111261 11526 1341 --
NM_006517chrX61907 1745 1507 912 764 149 --21752 285 1393
NM_006524chr72322 70 2175 44 ----
NM_006527chr42287 237 ----1219
NM_006540chr861470 1202 605 500 493 206 ------
NM_006544chr1455241 4871 1646 1494 721 --11724 11413
NM_006546chr17125548 5293 4861 4726 4303 4284 2024 1856 1412 1321 283 274 51986 1971 1955 1534 1152 16014 --
NM_006547chr71446 21431 646 ----
NM_006549chr1242965 2500 2201 659 --22937 2510 11906
NM_006558chr8----1315 --
NM_006559chr121174 1111 ------
NM_006561chr1076180 4944 4830 4753 4469 2202 499 22060 1999 ----
NM_006565chr161934 ------
NM_006572chr1713378 43501 1409 1161 246 23162 889 --
NM_006591chr1141591 680 639 508 ------
NM_006593chr21524 ------
NM_006599chr1666958 6322 5433 3315 2365 1239 13233 17864 --
NM_006601chr123353 311 200 ------
NM_006603chrX21553 207 ------
NM_006614chr343249 2509 2394 281 ------
NM_006618chr121106 426 ------
NM_006620chr674604 4204 3251 1794 1082 438 76 14542 1906 33124 1771 1630
NM_006624chr1032096 1431 1371 ------
NM_006625chr11147 ------
NM_006625chr11147 ------
NM_006625chr11147 ------
NM_006626chr91222 ------
NM_006628chr1554363 4179 3027 3017 929 ----14044
NM_006629chr1822747 666 21759 826 12011 1137
NM_006644chr133429 232 152 ------
NM_006650chr583569 3272 959 952 783 500 471 78 2487 267 --12742
NM_006654chr1274491 4396 4316 1058 495 355 323 ------
NM_006660chr151125 ------
NM_006662chr161100 ------
NM_006667chrX21029 741 ------
NM_006699chr121012 745 22592 1991 ----
NM_006717chr963037 2356 1065 794 685 259 1852 --1701
NM_006718chr621051 309 ------
NM_006720chr1084789 4422 3790 1688 1580 1476 923 607 21001 74 11624 --
NM_006729chrX74595 4304 4228 1635 1361 354 126 14754 --13559
NM_006738chr1574048 3546 2852 1656 1401 1380 534 31753 473 189 1936 --
NM_006750chr16107879 7861 7849 6706 5004 2492 2463 1736 829 532 15778 26064 2230 --
NM_006751chr21704 1132 ----
NM_006754chr72268 150 --1301 --
NM_006759chr21279 ------
NM_006761chr171668 ------
NM_006766chr862718 2550 2115 1000 786 533 ------
NM_006783chr131711 --1730 --
NM_006809chr205862 663 601 248 113 1677 ----
NM_006822chr172194 46 ------
NM_006823chr821110 1047 ------
NM_006825chr121852 136 ----
NM_006826chr21954 1817 ----
NM_006827chr1433171 3001 2766 --13268 --
NM_006832chr142288 88 ------
NM_006838chr1211705 1249 ----
NM_006852chr1742651 1151 1104 218 --12451 --
NM_006854chr731822 543 358 ------
NM_006873chr233140 875 68 12349 ----
NM_006874chr41774 ------
NM_006884chr331770 1676 1380 11706 ----
NM_006885chr1641034 381 290 233 ------
NM_006887chr23746 538 131 ------
NM_006893chr1146 ------
NM_006901chr152416 179 1496 ----
NM_006902chr163043 2960 2771 858 845 630 12347 ----
NM_006908chr72264 253 ------
NM_006910chr16279 37 ------
NM_006918chr1145292 1999 1738 1084 14395 14361 24827 928
NM_006924chr1743980 3834 1643 979 --12801 --
NM_006925chr14----1211 --
NM_006939chr142170 136 ------
NM_006940chr122232 44 11627 ----
NM_006947chr41389 ------
NM_006982chr12182 ------
NM_006990chr1142530 2521 2488 2456 2397 1821 1715 1704 1636 858 818 591 475 200 --11922 --
NM_006999chr541785 1382 411 199 11455 ----
NM_007005chr911230 ------
NM_007007chr1244415 3466 3113 982 14667 --11240
NM_007008chr24894 661 364 206 ------
NM_007011chr1586653 5792 5607 5219 4717 2477 1238 285 ------
NM_007013chr8180 ------
NM_007014chr1671185 625 466 209 166 151 93 ------
NM_007027chr3154 ------
NM_007038chr2135989 5003 1023 23901 1653 15200 --
NM_007050chr20207134 6940 6709 6451 5965 5473 5229 3183 2727 2207 1987 1841 1533 1310 1230 1078 1032 559 546 52 88021 5402 5210 2609 2535 1924 1206 208 15110 25439 1801
NM_007052chrX1114 1219 ----
NM_007053chr11154 --1227 --
NM_007064chr311090 --21644 1114 1339
NM_007096chr9158 ------
NM_007111chr132820 115 ------
NM_007124chr62627 90 ----1722
NM_007146chr1732245 812 770 12016 ----
NM_007153chr19113617 3321 3228 3203 1767 1747 609 475 441 271 75 ------
NM_007157chrX42982 2498 1815 212 ------
NM_007187chr131245 1186 ----
NM_007189chr721334 325 ----31465 1296 1163
NM_007195chr1863229 2937 2444 2434 2374 1446 1762 22653 70 --
NM_007200chr1574048 3546 2852 1656 1401 1380 534 31753 473 189 1936 --
NM_007203chr933520 3302 173 ------
NM_007207chr12293 243 ------
NM_007210chr1272152 2078 1780 1638 560 37 27 --11830 1389
NM_007214chr611210 --1460 --
NM_007222chr851747 1663 1501 1313 417 --11268 --
NM_007236chr1541756 993 337 56 --1493 --
NM_007249chr1358854 8719 3296 1334 452 27062 5922 --15863
NM_007278chr17--187 ----
NM_007286chr551816 1380 628 586 532 ----1825
NM_007324chr1190 ------
NM_007325chrX3444 311 73 21762 436 ----
NM_007345chr1832282 1622 1544 ------
NM_007347chr1553058 2715 2510 1173 232 ----11026
NM_007353chr762970 2810 1178 1160 623 610 21993 1071 1518 --
NM_012069chrX42449 2103 452 250 ----1521
NM_012081chr563139 2615 2477 2325 827 39 ----1424
NM_012082chr8176 ------
NM_012089chr151395 1191 434 380 366 --11026 --
NM_012090chr111130 1293 ----
NM_012096chr353198 1446 672 440 103 13755 12474 --
NM_012104chr1123204 257 22825 508 22445 944 --
NM_012104chr1123204 257 22825 508 22445 944 --
NM_012137chr162475 1077 867 417 364 193 ------
NM_012141chr1321573 1050 23276 981 13800 1658
NM_012160chr6----1397 --
NM_012166chr921236 29 1266 ----
NM_012180chr4----1667 --
NM_012193chr1174978 4770 4494 4205 3367 1840 1366 24645 314 ----
NM_012197chr91110 ----11504
NM_012199chr153924 3608 1342 1044 48 24459 3137 13527 --
NM_012214chr255915 4789 4428 4354 183 --14372 14263
NM_012219chr373225 2991 2468 2368 2357 2043 860 ----11177
NM_012224chr41800 ------
NM_012234chr323137 1348 ------
NM_012247chr101387 ------
NM_012250chr1131195 310 40 ------
NM_012257chr72187 25 ------
NM_012259chr621457 1061 ------
NM_012262chr143253 1483 1121 117 13700 14074 --
NM_012286chrX--1457 1169 --
NM_012287chr364559 1573 1515 885 693 263 1216 13591 --
NM_012288chr695330 5200 3776 2164 1648 1290 1040 858 462 34709 4610 61 23873 477 12220
NM_012296chr1193490 3053 2987 2940 2794 2780 2442 866 351 43960 3711 2909 23 13098 1830
NM_012297chr422028 831 ------
NM_012300chr541905 1694 628 236 11985 ----
NM_012301chr741645 764 205 141 --11454 --
NM_012304chr562570 2032 1718 470 342 310 ------
NM_012307chr181941 ------
NM_012308chr1161849 1689 1607 993 943 711 22258 1581 1133 11003
NM_012309chr1154166 3953 3350 839 426 14875 11383 --
NM_012316chr195160 5068 4837 4080 3659 3617 1907 995 949 35217 1791 289 14544 14363
NM_012330chr1051669 1240 520 329 165 ------
NM_012333chr111388 ------
NM_012338chr71175 ------
NM_012343chr521131 104 ------
NM_012382chr544323 4207 2744 449 11137 ----
NM_012384chr2072118 2089 2038 1960 1699 869 409 12016 1816 1473
NM_012416chr91850 ----11046
NM_012420chr1021961 1681 --1406 --
NM_012425chr1032424 2099 244 ------
NM_012428chr152709 346 ------
NM_012430chr31102 1497 ----
NM_012464chr492948 2636 2528 2286 1969 1142 991 787 707 ------
NM_012465chr1032433 2303 2269 12345 22692 1336 --
NM_012471chrX21720 325 11296 --1223
NM_012475chr12209 30 1201 149 --
NM_012479chr752584 2324 1786 1761 531 21803 1096 ----
NM_012482chr11702 ------
NM_013229chr1262368 2045 870 851 563 92 --12471 --
NM_013230chrY11605 174 11119 11440
NM_013233chr2--1389 ----
NM_013247chr2----1552 --
NM_013254chr121668 ------
NM_013255chr797658 7027 6285 6206 6110 5540 3014 1891 1403 26780 5764 38129 8030 6023 --
NM_013257chr872319 2249 1922 1815 821 216 38 ----11467
NM_013262chr62944 352 --11376 --
NM_013269chr1234521 2799 551 14190 1541 --
NM_013279chr11102168 1829 1665 1596 1442 697 639 582 329 88 21775 354 31921 823 773 --
NM_013283chr51741 ------
NM_013313chr2263406 2648 2377 2213 1144 748 12932 13313 --
NM_013314chr10171 ------
NM_013316chr71780 1371 ----
NM_013322chr71180 194 ----
NM_013325chr21350 ------
NM_013326chr18164 ------
NM_013341chr282936 2741 2610 2375 2350 1115 1100 308 --12653 --
NM_013346chrX----165 --
NM_013354chr81959 ------
NM_013363chr32392 24 ------
NM_013374chr342306 1948 1002 708 ------
NM_013402chr1162410 2398 2138 946 202 128 12703 ----
NM_013436chr2--1614 ----
NM_013446chr721181 406 ------
NM_013448chr14------1515
NM_013951chr252181 1924 1713 1602 59 22419 115 --11729
NM_013952chr252258 2001 1790 1679 136 22496 192 --11806
NM_013953chr252258 2001 1790 1679 136 22496 192 --11806
NM_013989chr1474156 1923 1490 756 458 222 87 24637 426 ----
NM_013992chr252258 2001 1790 1679 136 22496 192 --11806
NM_013993chr61229 ----1626
NM_013994chr61229 ----1626
NM_014000chr1051914 1610 1280 573 206 ----1291
NM_014011chr242533 2010 1614 112 1457 ----
NM_014016chr341348 1101 500 476 ------
NM_014021chr133241 2772 1266 --22325 1107 11307
NM_014023chr1042666 2393 1163 1090 2833 243 --11906
NM_014034chr62544 32 --11125 --
NM_014046chr61581 ------
NM_014048chr1665001 3683 1842 1653 1266 891 43620 1198 702 481 ----
NM_014059chr131340 ------
NM_014079chr31126 ------
NM_014109chr821053 48 ------
NM_014112chr854616 4134 3686 1220 245 --21856 854 --
NM_014117chr1642520 2505 978 713 22297 1755 ----
NM_014141chr7105064 4656 4569 4245 4114 3675 3286 1454 513 361 ------
NM_014154chr321357 269 1522 1590 --
NM_014155chr11127258 5713 5645 5500 5415 4771 4593 2459 1309 809 752 723 --24931 421 11904
NM_014181chr292765 2670 2636 2433 2150 2009 1934 1898 1070 ----12229
NM_014182chr122511 108 ------
NM_014186chr1142060 1959 245 228 32213 480 336 2774 515 --
NM_014190chr4111693 1618 1479 678 614 460 358 280 158 147 54 1132 ----
NM_014191chr121831 ------
NM_014231chr1231776 275 202 1519 --11416
NM_014232chr1721542 309 ----11361
NM_014232chr1721542 309 ----11361
NM_014233chr1741789 1412 357 248 3851 172 37 1620 --
NM_014234chr61165 ------
NM_014243chr422081 1914 --11908 --
NM_014251chr7--1120 ----
NM_014264chr41101 ------
NM_014268chr18--183 ----
NM_014283chr131421 975 600 3500 313 282 ----
NM_014299chr1931874 635 129 11861 11477 174
NM_014300chr152434 294 ------
NM_014309chr2274791 4329 4018 3890 1356 1251 923 14147 ----
NM_014319chr1241864 1481 651 223 11369 ----
NM_014325chr1222177 146 22110 723 ----
NM_014330chr19174 ------
NM_014335chr1521012 345 1378 ----
NM_014363chr132419 73 ------
NM_014372chr12484 210 --11637 170
NM_014382chr3--1609 ----
NM_014388chr175570 5182 5174 5027 4679 4399 2197 --15043 --
NM_014393chr811551 12037 11646 12336
NM_014415chr331261 565 175 ------
NM_014423chr565345 5132 4582 4427 4301 1180 11773 13753 --
NM_014445chr3--12179 ----
NM_014447chr431319 1053 650 ------
NM_014454chr61371 --173 --
NM_014455chr12428 412 ------
NM_014456chr102394 248 21847 1266 ----
NM_014469chr111220 ------
NM_014480chr195323 267 183 155 105 1854 ----
NM_014491chr72696 145 11058 ----
NM_014494chr1622289 1935 ------
NM_014498chr3--1291 ----
NM_014515chr1211072 ------
NM_014548chr1521535 1077 11194 ----
NM_014554chr1252123 1486 374 235 128 --2660 545 --
NM_014570chr221970 21019 83 ----
NM_014574chr142595 278 1164 ----
NM_014577chr22145 ------
NM_014584chr1441408 297 174 93 --11084 --
NM_014585chr21152 1878 1847 --
NM_014592chr52656 300 1754 --1726
NM_014602chr31323 ------
NM_014608chr151429 ------
NM_014612chr921015 295 ------
NM_014614chr22516 462 ------
NM_014615chr1673168 3132 2710 855 600 555 21 23027 405 ----
NM_014630chr1573898 3429 3177 2587 1595 1078 939 ----13261
NM_014633chr112611 21 --1146 --
NM_014634chr2293598 3324 3296 2935 2864 2548 2454 934 63 22803 411 2649 270 33228 3064 994
NM_014636chr993131 3022 1674 1194 1095 995 867 585 92 11151 --13205
NM_014644chr13822 201 47 3840 830 135 ----
NM_014655chr141486 829 813 22 --12361 11807
NM_014660chr741009 819 429 139 ----1735
NM_014665chr883508 2791 2574 2559 2411 2282 1230 149 1721 ----
NM_014666chr52840 263 ----11145
NM_014670chr241397 1151 1104 465 21647 611 ----
NM_014671chr73570 465 341 --1111 --
NM_014682chr8----1789 --
NM_014686chr1942561 581 203 167 ----11812
NM_014701chr1512945 ----1471
NM_014702chr642169 1348 974 925 ------
NM_014705chr721828 393 11304 ----
NM_014707chr732282 1705 261 ------
NM_014709chr2----131 --
NM_014710chrX4887 336 267 144 ------
NM_014713chr21188 ------
NM_014720chr1051777 1169 1162 401 198 ------
NM_014721chr696134 5460 5122 4731 4725 2491 1290 640 52 ------
NM_014725chrX4956 319 157 37 21101 116 ----
NM_014729chr822119 319 --1770 --
NM_014730chr1264119 3661 2053 1630 941 564 14955 11127 24899 1269
NM_014730chr1264119 3661 2053 1630 941 564 14955 11127 24899 1269
NM_014733chr53902 292 121 ------
NM_014735chrX------12102
NM_014737chr20103841 3575 3544 3233 3153 2634 1458 1191 1183 1148 ----1664
NM_014742chr20--11417 ----
NM_014743chr422871 488 22702 2127 11125 --
NM_014746chr2103394 3192 2822 2730 2666 1696 1091 673 613 178 --13822 --
NM_014751chr841678 1656 1380 709 ------
NM_014752chr1131517 1325 112 ------
NM_014756chr11154 ------
NM_014758chr1162546 2313 2036 960 383 73 --11735 --
NM_014761chr161808 1875 ----
NM_014764chr121407 ------
NM_014767chr10103344 3187 3181 2498 1419 1406 698 661 512 287 ------
NM_014772chr18103480 3270 2954 2924 2899 2433 1333 1313 602 194 42627 2525 1187 217 11422 --
NM_014774chr162449 2180 883 429 345 263 1602 12420 12364
NM_014776chr1251239 1214 1152 783 629 148 12722 --
NM_014791chr9----1285 --
NM_014798chr1771727 1624 1555 1304 724 276 171 21609 163 --21387 701
NM_014803chr1062878 2869 2532 2411 2175 1836 ------
NM_014810chr113409 1477 ----
NM_014812chr12369 316 ----1736
NM_014819chr552079 2068 1737 350 189 32418 802 513 ----
NM_014826chr133668 2834 1110 53874 3833 3680 3348 695 33915 1200 440 11349
NM_014827chr12555 525 ------
NM_014830chr1273614 3151 2926 1480 1202 999 163 23439 3252 12861 --
NM_014832chr1331964 1509 177 ------
NM_014836chr1021840 187 21625 174 ----
NM_014840chr1242482 2390 2360 151 --22607 645 23322 397
NM_014847chr11370 ------
NM_014850chr3124598 4391 4217 3763 3289 1934 1854 1840 1721 1441 1216 147 21650 599 1934 --
NM_014862chr15124160 3764 3701 3550 2802 1600 1149 907 866 847 267 105 32725 709 75 11633 22586 1337
NM_014864chr174035 3766 2729 2658 1500 1465 589 14222 21492 1159 --
NM_014873chr164236 4023 3595 3523 1687 1483 21881 350 ----
NM_014877chr1786962 6473 6184 5560 3086 1973 1839 1663 ------
NM_014883chr452277 2034 1938 909 497 22257 414 ----
NM_014897chr1743238 2742 2380 356 1224 --12020
NM_014898chr1952078 1877 1664 1558 163 --1715 --
NM_014900chr22746 449 ------
NM_014903chr1262326 2008 1773 778 238 150 ------
NM_014904chr1073670 3533 2953 2711 1593 886 775 11228 --23121 294
NM_014912chr1042849 1244 961 593 11069 1550 --
NM_014918chr15182 ------
NM_014935chr163269 3155 2997 2446 603 43 23229 2686 13769 --
NM_014947chr142482 2235 1194 576 22532 2085 ----
NM_014948chr2082361 2345 2174 1998 1929 1692 197 93 12135 --1249
NM_014961chr451733 1591 401 314 30 31958 1849 300 186 11494
NM_014962chr2042062 918 797 641 ----12723
NM_014974chr1041473 1399 471 334 1250 11782 --
NM_014977chr141226 ------
NM_014988chr422156 496 21864 83 --11024
NM_014991chr4--1613 13020 --
NM_014992chr14--132 ----
NM_014994chr1582280 1812 1601 1524 1487 869 751 695 1822 2728 608 --
NM_015000chr1212782 ------
NM_015008chr343583 2444 2300 2246 --11286 --
NM_015018chr61241 ------
NM_015025chr241806 977 298 216 ------
NM_015026chr1223794 583 ----1658
NM_015027chr1621569 527 ----1320
NM_015032chr1332780 2395 87 ------
NM_015033chr962353 2053 907 853 526 30 22543 787 12926 --
NM_015035chr2076181 5797 4241 4222 4183 2235 968 12501 26428 5062 1822
NM_015037chr10--1179 ----
NM_015039chr113562 23842 3149 --11237
NM_015040chr262997 2722 2396 1069 241 69 --1676 1887
NM_015042chr1593924 3354 3266 3255 2681 2665 2654 1180 347 11011 2937 814 --
NM_015049chr21899 1643 2632 161 1454
NM_015051chr943238 1209 1147 654 23229 1083 2854 26 12085
NM_015052chr71315 ------
NM_015056chr2142139 1621 797 752 42668 2328 707 686 ----
NM_015059chr1583649 3073 1154 925 345 124 116 25 --1594 13786
NM_015062chr101263 ------
NM_015068chr733311 2491 1360 12960 ----
NM_015075chrX42038 284 277 76 11675 11607 11888
NM_015076chr663044 3018 1379 1037 783 357 ------
NM_015082chr552014 1989 1960 1943 689 52490 2237 1748 1735 453 1531 --
NM_015090chr1104552 4214 2287 1984 1933 1827 1737 1402 1394 170 34696 4385 1885 12382 12124
NM_015091chr142267 110 ------
NM_015092chr1664018 3827 3302 1740 1414 849 23216 239 ----
NM_015097chr311992 ------
NM_015107chrX61973 1738 1619 695 428 367 22265 384 ----
NM_015115chr433122 2557 945 --12907 --
NM_015124chr2282343 2192 2178 2104 1730 1645 402 267 1845 ----
NM_015130chr41537 1124 ----
NM_015144chr1673799 3655 3490 1278 1235 777 33 --1845 --
NM_015147chr242967 2908 1066 77 1316 --12423
NM_015149chr121667 743 2757 494 ----
NM_015155chr1042963 2324 537 243 --1307 --
NM_015157chr1131192 949 307 2200 161 11125 11093
NM_015158chr9142 1126 1867 --
NM_015170chr8------1364
NM_015172chr1159 ------
NM_015176chr13704 440 98 ------
NM_015178chr892540 2396 1726 1008 975 520 308 288 259 52005 1997 1860 531 480 1175 --
NM_015185chrX43018 2022 2011 950 22522 1160 22310 2093 --
NM_015192chr2042885 2727 349 330 ------
NM_015193chr861487 1392 1351 316 189 97 1374 21066 939 --
NM_015199chr362785 2742 2190 1145 614 117 ------
NM_015200chr421860 174 1103 ----
NM_015202chr1641403 1263 1129 125 41595 1520 1096 238 ----
NM_015208chr1844031 4006 3797 1107 23193 935 13553 --
NM_015215chr112014 22637 1994 ----
NM_015226chr1653358 2762 2728 672 158 32637 1311 504 1292 --
NM_015230chr411165 31377 642 363 ----
NM_015231chr111935 ------
NM_015233chr1332309 1093 865 22712 305 ----
NM_015247chr1633716 706 329 11629 ----
NM_015251chr1611974 1316 12040 1798
NM_015254chr892920 2805 2324 2054 1952 916 466 426 84 11200 32145 622 52 --
NM_015265chr232300 2209 1002 12104 11063 --
NM_015267chr12--1626 ----
NM_015268chr3--2516 47 ----
NM_015270chr1251740 1596 751 563 95 --1384 --
NM_015271chr464078 3689 3084 3007 1546 1303 13969 ----
NM_015278chr672955 2264 799 606 528 427 179 ------
NM_015284chr182022 1731 1610 1400 818 562 507 395 ------
NM_015288chr593857 3334 3277 2949 2493 2391 1088 1060 26 11342 ----
NM_015289chr1542052 1916 1748 778 ------
NM_015291chr182626 2483 2320 1100 891 786 503 378 ------
NM_015299chr14143643 3589 3540 3488 3130 2783 2761 2734 2476 2463 1577 1316 647 363 23261 3150 1453 --
NM_015308chr111833 ------
NM_015310chr877923 7106 7010 6616 2694 2424 2044 --16894 --
NM_015313chr1174335 3945 3537 3373 1823 577 139 13042 13629 --
NM_015315chr573066 2989 2976 2359 2268 1212 434 13213 12875 --
NM_015317chr221088 775 --12745 --
NM_015321chr19134720 4601 4053 3597 3433 3153 1032 972 759 699 603 304 243 44633 3291 721 169 23258 499 --
NM_015326chr122523 162 ----11123
NM_015328chr752875 2236 2019 811 48 ------
NM_015329chr1952338 1018 449 121 72 1889 11808 12226
NM_015335chr1212219 1903 ----
NM_015336chr1252532 1984 1724 729 701 ------
NM_015339chr203793 231 154 ------
NM_015344chr821701 102 11351 ----
NM_015346chr1431802 1306 622 ------
NM_015347chr1252609 1995 1049 759 65 --12931 --
NM_015349chr642509 2227 2157 373 --22321 245 --
NM_015355chr1711320 --11529 --
NM_015358chr212378 332 --1260 --
NM_015361chr22942 312 ------
NM_015365chrX43472 3440 1103 1012 11363 14111 --
NM_015375chr1104342 4043 3978 3163 1960 1685 1172 917 660 540 13935 ----
NM_015379chr7185 ------
NM_015382chr14153 ------
NM_015385chr1052642 1186 739 377 155 1394 13037 --
NM_015387chr21172 ------
NM_015393chr411149 1950 33611 3241 106 --
NM_015394chr122860 68 ----12456
NM_015397chr92601 154 11605 ----
NM_015455chr553289 3118 2892 1394 776 ----23550 184
NM_015460chr31501 11418 11792 --
NM_015464chr7175 ------
NM_015477chr151100 1263 ----
NM_015483chr72738 406 ------
NM_015508chr311239 ------
NM_015525chr6----11045 --
NM_015526chr1991262 1254 1230 1198 1091 1001 518 145 64 11378 1398 --
NM_015550chr763580 2700 2645 2207 429 139 33031 1362 1334 11346 --
NM_015557chr1123557 3097 2827 2754 2683 2556 2518 1349 1339 764 507 48 63406 3314 2883 2476 193 172 ----
NM_015564chr553607 3600 3164 2182 632 1591 13337 1100
NM_015565chr2121439 516 --1441 --
NM_015569chr164790 4694 3947 1254 1136 383 34079 3893 3466 12948 --
NM_015570chr731758 636 108 1334 11335 --
NM_015571chr632525 2098 437 ------
NM_015575chr262496 1240 1177 963 745 576 ------
NM_015576chr321003 908 --12650 --
NM_015577chr51213 1733 ----
NM_015604chr141211 ------
NM_015605chr1021204 176 1331 ----
NM_015626chr171260 ------
NM_015635chr952216 1659 797 764 636 ------
NM_015640chr134192 3744 3479 13298 14508 --
NM_015652chr10293 83 ------
NM_015678chr1321651 353 ------
NM_015686chrX5820 596 396 320 251 ------
NM_015695chr651504 840 150 114 61 2670 451 ----
NM_015719chr195782 709 330 265 35 ------
NM_015723chr71225 ------
NM_015726chr181524 1449 1339 1144 546 537 257 76 1282 1195 --
NM_015853chr11160 ------
NM_015874chr42535 401 ------
NM_015878chr8144 1293 ----
NM_015888chr143033 2190 1148 1039 --12064 --
NM_015904chr22663 317 ------
NM_015906chr164415 3078 1906 1314 1037 1024 ----14385
NM_015980chr531145 66 60 --1515 1575
NM_015994chr142583 553 ------
NM_015995chr15125196 5058 5019 4860 4823 4468 3618 3458 2167 1400 695 577 25264 99 ----
NM_015999chr11650 ------
NM_016009chr174165 3581 3170 3070 1958 1435 265 14117 14076 11792
NM_016016chr173356 312 129 ------
NM_016018chr822415 776 1316 --1674
NM_016019chr7132 ------
NM_016032chrX51344 1175 958 901 93 11089 11067 --
NM_016048chr52107 74 ----165
NM_016072chr1212369 ------
NM_016083chr643544 3066 3044 211 --13152 33866 3129 51
NM_016089chr391851 822 654 486 402 360 318 234 66 1781 ----
NM_016103chr5--1338 ----
NM_016131chr222266 1918 ----12320
NM_016132chr1543198 2206 631 251 ------
NM_016138chr1631504 1468 580 2737 595 ----
NM_016147chr111292 21034 778 1314 --
NM_016156chr1142397 2022 1544 1493 ------
NM_016169chr10113078 2500 2201 2038 884 795 750 694 450 435 168 137 1217 --
NM_016188chr7146 135 ----
NM_016206chr3118907 8887 8148 7709 7666 6451 2901 2684 1136 1099 220 ----12548
NM_016220chr731781 901 78 1469 ----
NM_016224chr62359 341 ------
NM_016227chr131421 975 600 3500 313 282 ----
NM_016235chr1621480 1256 21171 563 11410 --
NM_016247chr3134 ------
NM_016248chr131105 1986 13984 --
NM_016257chr143378 2469 2354 136 22688 584 1980 --
NM_016258chr11629 --1326 --
NM_016260chr276449 6132 5841 5226 5215 4886 1410 --11452 --
NM_016269chr4--2975 23 ----
NM_016272chr2232608 2596 912 1401 --1723
NM_016279chr51156 ------
NM_016281chr12----1995 --
NM_016284chr161835 1703 ----
NM_016287chr12555 444 11701 ----
NM_016289chr21573 11917 ----
NM_016297chr263416 2340 998 653 406 299 21200 1009 ----
NM_016322chr933053 2781 1103 13010 1375 --
NM_016338chr531177 1028 406 ------
NM_016339chr1751350 686 251 175 155 ------
NM_016376chr1753303 3274 2916 1671 535 14239 14229 --
NM_016377chr62624 38 --11506 --
NM_016383chrX1171 ------
NM_016396chr1522311 1187 ------
NM_016399chr12--135 ----
NM_016418chr22113850 3449 3382 3258 3232 3110 2750 2361 586 439 33 43557 3192 2395 207 1953 --
NM_016424chr172148 124 11652 --1392
NM_016441chr231598 909 748 1445 ----
NM_016480chr52819 82 ------
NM_016484chrX1551 ------
NM_016488chr1221922 1331 ----1634
NM_016506chr117685 679 595 471 270 207 62 ------
NM_016516chr21634 --1670 --
NM_016530chr1544036 3992 3564 2962 ------
NM_016542chrX2465 44 ----11141
NM_016563chr1531256 589 397 3956 525 22 ----
NM_016570chr121325 ------
NM_016577chr374318 3658 3500 3073 1416 967 719 --1525 --
NM_016578chr111534 ------
NM_016591chr521085 221 --1858 1853
NM_016598chr31165 138 11140 --
NM_016603chr522268 1953 1453 1171 --
NM_016604chr53899 93 21 1472 ----
NM_016605chr592685 2601 2146 2067 2018 1803 976 955 155 --22012 1724 11833
NM_016607chrX----1292 --
NM_016621chr1174645 4286 3493 3001 881 787 702 33649 1597 437 13507 --
NM_016628chr101104 ------
NM_016644chr51338 193 ----
NM_016654chr153370 280 133 11097 ----
NM_016656chrX1302 ------
NM_016830chr121138 ------
NM_016834chr1783997 3694 3514 2576 1502 1444 1113 1059 52692 2518 1617 1323 1184 --23651 1543
NM_016835chr1783997 3694 3514 2576 1502 1444 1113 1059 52692 2518 1617 1323 1184 --23651 1543
NM_016841chr1783997 3694 3514 2576 1502 1444 1113 1059 52692 2518 1617 1323 1184 --23651 1543
NM_016929chr6124496 4350 3387 3362 3029 1565 1495 1337 993 942 687 116 31742 1212 288 11784 --
NM_016952chr1143663 3178 2655 709 23745 2984 14036 --
NM_017413chrX72020 1677 1635 881 716 633 274 11870 ----
NM_017415chr573432 3406 3189 2945 1742 828 746 --13952 --
NM_017420chr1421433 57 --12437 12919
NM_017443chr951289 1244 1204 1017 491 ------
NM_017455chr152709 346 ------
NM_017522chr111340 ------
NM_017544chrX----1888 --
NM_017545chr20------1415
NM_017553chr1531218 1042 287 ------
NM_017563chr376166 4186 4073 3871 2487 699 537 22144 635 --12462
NM_017590chr2262381 2282 460 205 135 28 42203 2090 913 337 --1821
NM_017592chr1982508 1783 1058 843 734 722 287 258 42175 2008 983 604 1893 12470
NM_017596chr1164348 3658 3400 3359 3243 2964 2861 2850 1851 1628 1468 920 805 385 308 215 33255 3065 471 24629 1039 22869 1026
NM_017610chr1531481 1470 368 ------
NM_017612chr12--1143 ----
NM_017615chr10--136 ----
NM_017617chr92430 41 ------
NM_017633chr643683 3444 1320 921 --12398 --
NM_017635chr112236 163 11585 ----
NM_017637chr958845 8746 2235 1608 1315 46350 3192 2984 1252 29111 3074 16967
NM_017643chr1742306 2170 2033 442 11939 ----
NM_017644chr364274 3932 1658 1268 790 170 11645 --1932
NM_017650chr785800 5769 2406 1266 1230 674 119 44 13943 --14416
NM_017657chr22180 129 ------
NM_017658chr14----14254 --
NM_017661chr152359 334 ----1860
NM_017666chrX41589 1381 716 355 2746 665 ----
NM_017672chr1521258 179 ------
NM_017680chr92979 754 ----1128
NM_017693chr131151 ----188
NM_017694chr241899 1803 684 67 ------
NM_017697chr81350 ------
NM_017709chr143888 1609 362 180 --1384 --
NM_017714chr201689 ------
NM_017715chr71493 ------
NM_017719chr321623 589 1205 ----
NM_017724chr31551 1650 ----
NM_017730chr31117 ------
NM_017734chr11130 197 ----
NM_017737chr121866 519 ------
NM_017742chr1831764 1728 181 11464 ----
NM_017744chr162452 2026 1787 775 518 394 21549 674 ----
NM_017745chrX1185 ------
NM_017761chr131432 1041 339 ----11108
NM_017769chr1452954 2801 2684 844 626 ------
NM_017780chr8197 ------
NM_017784chr3----1316 --
NM_017787chr1062438 2022 926 920 856 322 22910 477 ----
NM_017799chr1431524 1303 107 ------
NM_017801chr32173 71 --22071 59 --
NM_017811chr962373 2231 2122 2033 1258 725 --22135 613 --
NM_017813chr855640 4459 1742 1627 1522 ------
NM_017824chr102987 99 ------
NM_017848chrX54507 3270 1332 1204 348 13300 --167
NM_017873chr9132960 2835 2802 2184 2074 2066 1932 1026 841 428 396 332 230 22010 1983 12670 --
NM_017893chr1041200 991 952 166 31087 210 156 1465 --
NM_017902chr10105632 5325 5011 3767 1158 1074 902 845 550 249 31683 1237 678 23789 1043 --
NM_017907chr112201 157 ------
NM_017915chr121163 ------
NM_017919chr954168 2226 672 430 197 25747 2191 35364 4676 2262 --
NM_017922chr14185 ------
NM_017925chr921427 1403 ------
NM_017933chr221588 1384 ------
NM_017944chr1133053 2881 2323 1149 12352 11023
NM_017952chr253879 3709 3601 3575 171 24269 3422 1289 --
NM_017953chr13893 823 130 --1245 --
NM_017998chr921417 1394 ------
NM_018011chr131184 ------
NM_018013chr672999 2713 2272 2087 1198 991 193 52792 2558 2149 529 222 ----
NM_018027chr1072875 2787 2768 528 388 108 90 11036 ----
NM_018030chr18143 ------
NM_018036chr14180 ------
NM_018045chr192707 2487 2406 2034 1186 883 811 694 494 1959 1440 22623 607
NM_018050chr121525 146 ----
NM_018056chr11173 ------
NM_018072chr1----1178 --
NM_018084chr222881 72 22905 2636 ----
NM_018085chr1137249 6949 6723 6653 6326 6099 4986 3061 2048 1818 831 668 281 17345 1526 27271 7030
NM_018086chr241936 540 198 76 ------
NM_018092chr16--11138 11319 1442
NM_018095chr117685 679 595 471 270 207 62 ------
NM_018121chr1043171 2842 672 318 1840 12065 --
NM_018126chr411485 ------
NM_018169chr121375 ------
NM_018182chr1761954 1945 1901 1583 1547 383 ----1220
NM_018191chr1352120 1866 1519 1469 421 21561 1512 --1181
NM_018193chr154574 259 225 198 ------
NM_018195chr111163 ------
NM_018205chr1082348 2014 1848 1659 727 642 274 88 173 22341 403 --
NM_018222chr1151720 1258 1210 723 367 21666 119 11381 11652
NM_018227chr412029 12464 1114 --
NM_018239chr1082348 2014 1848 1659 727 642 274 88 173 22341 403 --
NM_018241chr42718 377 ------
NM_018243chr473896 3623 2798 2755 1221 1067 481 ------
NM_018263chr241670 623 199 193 --12343 --
NM_018270chr20--2666 256 --1119
NM_018299chr852732 2654 1002 290 277 13373 1916 --
NM_018302chr462084 2013 1967 710 589 29 ----1562
NM_018313chr352455 2105 2080 526 161 ------
NM_018320chr1141258 1107 494 431 2875 796 ----
NM_018327chr2021213 203 11187 1285 --
NM_018330chr104619 380 246 229 ------
NM_018339chr9------1172
NM_018351chr1233836 1499 964 14504 13824 2858 739
NM_018357chr152374 26 ----1436
NM_018361chr862958 2699 751 538 395 108 --11132 --
NM_018364chr144058 3114 2620 1217 1627 ----
NM_018371chr82402 132 ----1257
NM_018374chr774609 4491 4484 3444 1488 639 595 ------
NM_018375chr1441637 578 372 237 11823 21711 1351 --
NM_018383chr242020 1504 272 85 ------
NM_018387chr9168 ------
NM_018403chr3103948 3281 2974 2828 2632 1404 637 507 108 31 ----11430
NM_018416chr1242204 1775 765 705 32406 2237 1709 ----
NM_018420chr122889 396 ------
NM_018425chr1082468 2061 1889 618 578 485 111 51 --12172 --
NM_018431chr202631 114 ------
NM_018440chr8107182 7075 6783 6136 5952 5502 2592 2545 1197 130 22826 2409 --1846
NM_018446chr3141 ------
NM_018452chr6_random32705 2650 593 23221 773 1487 --
NM_018471chr2130 ------
NM_018482chr822254 2227 ------
NM_018509chr1731601 1524 1315 ----11659
NM_018534chr21394 ------
NM_018555chr191124 ------
NM_018566chr163947 3336 3190 1812 1762 70 128 --13920
NM_018569chr411534 1344 ----
NM_018640chr1252655 2536 2512 2456 1721 ------
NM_018667chr1692355 2257 2052 1935 1907 1807 696 336 195 22450 1107 --12480
NM_018685chr72940 243 ------
NM_018691chr541247 1069 1029 377 1242 ----
NM_018703chr16279 37 ------
NM_018710chr82216 55 ------
NM_018712chr1131259 1055 375 ------
NM_018837chr20--2293 194 ----
NM_018841chr143540 3465 1452 387 --33153 1159 1002 1935
NM_018844chr731872 1573 1465 --1535 --
NM_018890chr72264 253 ------
NM_018898chr521515 189 12178 1101 --
NM_018899chr521515 189 12178 1101 --
NM_018900chr521515 189 12178 1101 --
NM_018901chr521515 189 12178 1101 --
NM_018902chr521515 189 12178 1101 --
NM_018903chr521515 189 12178 1101 --
NM_018904chr521515 189 12178 1101 --
NM_018905chr521515 189 12178 1101 --
NM_018906chr521515 189 12178 1101 --
NM_018907chr521515 189 12178 1101 --
NM_018908chr521515 189 12178 1101 --
NM_018909chr521515 189 12178 1101 --
NM_018910chr521515 189 12178 1101 --
NM_018911chr521515 189 12178 1101 --
NM_018958chr1573492 2894 2790 1617 944 359 260 21235 495 --11319
NM_018963chr2131434 1411 1297 ------
NM_018970chr722446 1073 ----12479
NM_018999chr1064854 4794 4725 3432 832 337 2978 115 23617 523 --
NM_019001chr323716 3183 ------
NM_019002chr21114 ------
NM_019004chr711570 12234 ----
NM_019008chr2253225 2571 1039 683 39 53706 3569 3091 3064 598 ----
NM_019027chr432347 693 644 1823 ----
NM_019045chrX3838 806 715 ------
NM_019050chr442173 763 664 188 ------
NM_019071chr71505 ------
NM_019072chr542935 2712 2673 890 33213 3116 22 21443 357 --
NM_019084chr1031004 361 240 12474 ----
NM_019087chr511578 ------
NM_019091chr21846 ------
NM_019094chr1263776 3461 3107 2436 1514 193 --13534 --
NM_019106chr2273268 3110 2361 2276 1010 567 372 13287 12658 12515
NM_019556chrX31431 1314 985 ------
NM_019590chr1021295 159 --1603 --
NM_019597chrX--1271 ----
NM_019600chr151619 ------
NM_019610chr1----31540 241 134 --
NM_019891chr121070 51 ------
NM_020039chr1241605 1387 1196 363 11538 11698 --
NM_020116chr421755 508 ------
NM_020122chr295498 4921 4608 4558 4537 2288 2041 1803 1092 55798 3882 1710 1524 465 11395 12081
NM_020132chr21104915 3603 3515 1395 1234 1090 749 636 575 138 24858 3910 ----
NM_020135chr61291 ------
NM_020140chr121221 134 ----
NM_020148chr184953 458 400 63 --12838 --
NM_020150chr1041766 667 545 94 ------
NM_020177chr522500 2055 ------
NM_020182chr2073484 3459 3036 2838 2483 1312 1211 23094 2629 22748 734 --
NM_020193chr11----21022 967 --
NM_020200chr104753 740 393 27 ------
NM_020205chr163416 2807 2497 1153 741 494 13080 --147
NM_020228chr1132141 63 54 1674 11643 --
NM_020336chr2033519 651 569 33834 3178 1304 1282 --
NM_020337chr421990 730 ------
NM_020338chr10112920 2573 2502 2429 2415 2342 1493 741 620 457 131 31151 773 213 ----
NM_020340chr642262 1422 415 145 ------
NM_020357chr3------11430
NM_020362chr12830 603 --1765 --
NM_020378chr191602 ------
NM_020384chrX51693 1646 1220 741 290 --1255 --
NM_020390chr364818 4339 3840 1723 1202 749 ------
NM_020403chr131508 ------
NM_020408chr65917 752 709 680 354 1727 ----
NM_020423chr11183 --1382 --
NM_020424chr162597 35 1637 ----
NM_020432chr7157 ------
NM_020433chr2071730 1714 1469 1288 1259 1249 106 1248 ----
NM_020440chr163024 3012 2916 2689 2671 2124 ----1599
NM_020443chr1116016 5565 5029 4455 4303 4276 2751 2401 2337 1878 430 1509 44978 4504 2425 2150 12096
NM_020463chr21504 ------
NM_020466chr664610 4108 4030 3429 3240 653 21818 82 ----
NM_020532chr24894 661 364 206 ------
NM_020640chr31286 ------
NM_020644chr113822 279 218 ------
NM_020645chr113666 128 109 1507 ----
NM_020647chr832060 1806 23 12078 ----
NM_020651chr221739 42 ------
NM_020654chr33369 118 51 --11320 --
NM_020655chr161117 ------
NM_020673chr20107234 7204 5608 5378 5318 4737 4698 3107 2630 1841 27164 2246 32858 1212 689 --
NM_020686chr1672651 2490 2321 2049 847 825 31 1870 1245 22937 227
NM_020698chr121340 13114 1992 --
NM_020699chr1115360 5068 5038 4768 4743 4735 4202 3587 3511 1511 804 13871 1311 --
NM_020708chr2072337 1763 987 967 435 138 55 --1249 21680 695
NM_020713chr2092843 2777 2499 2488 2415 1033 1021 673 350 22565 2250 --11009
NM_020718chr16106203 6108 5481 5402 4299 2569 1846 984 699 74 15267 26189 4896 14741
NM_020724chr462628 2517 1947 833 704 272 --21895 668 22143 1024
NM_020727chr2153916 3888 2575 1321 712 ----1420
NM_020728chr773016 2836 2462 1113 1064 1001 857 12151 ----
NM_020739chr1533743 2638 694 13598 ----
NM_020740chr172111 56 ------
NM_020752chr1042549 694 319 208 ------
NM_020754chr341080 919 497 211 ----11272
NM_020755chr62331 24 ------
NM_020760chr211793 --21385 458 11279
NM_020766chrX54255 1732 951 510 385 --32896 487 405 --
NM_020772chr1767146 6622 6080 5226 2941 1855 22027 1051 1524 --
NM_020774chr1875452 4211 3833 1574 1406 1049 264 ------
NM_020782chr1294728 3729 2941 1721 1630 1375 942 565 142 11581 11750 --
NM_020783chr182942 758 ------
NM_020787chr172967 573 ------
NM_020791chr1741416 1222 454 423 --1974 --
NM_020792chr342272 1769 30 23 12280 --1615
NM_020794chr11328 ------
NM_020801chr51209 31918 1825 164 ----
NM_020805chr1841894 1426 1276 423 11318 ----
NM_020809chr1121848 517 12284 ----
NM_020815chr41400 ------
NM_020819chr6------1277
NM_020825chr1663594 2532 768 705 414 28 13537 --159
NM_020839chr351576 1364 1191 231 194 174 --1389
NM_020841chr1253945 3731 3222 834 813 ------
NM_020850chr1653039 2669 1197 1040 325 22075 389 22503 734 12551
NM_020854chr1831108 344 229 ------
NM_020856chr1941154 1078 459 67 --11236 --
NM_020859chr431122 428 151 1907 13323 --
NM_020860chr431036 850 347 ------
NM_020865chr31119 1471 ----
NM_020868chr231518 1461 784 1165 ----
NM_020872chr3----1435 --
NM_020886chr11--122 1296 1538
NM_020888chr142020 1908 1682 155 ------
NM_020920chr14--1106 ----
NM_020921chr1422742 2731 23276 1457 --185
NM_020922chrX1340 ----1289
NM_020927chr1682285 1872 1502 1452 573 480 373 302 1310 --1499
NM_020933chr1941710 1211 228 69 21872 126 11272 --
NM_020940chr1042407 2134 787 95 22750 1946 ----
NM_020948chr122354 868 1408 ----
NM_020952chr9--1806 ----
NM_020956chr19144596 4554 4469 4408 4373 4352 4191 3890 2986 1537 1414 1244 1061 1037 24118 3798 14461 --
NM_020962chr1542468 1881 868 108 ------
NM_020963chr1137 ------
NM_020983chr1251740 1596 751 563 95 --1384 --
NM_020988chr162531 121 11243 11260 --
NM_021003chr141718 ------
NM_021005chr151365 ------
NM_021007chr21961 ------
NM_021013chr17170 ------
NM_021020chr8133359 3186 3125 2824 2797 2460 2175 1146 790 774 510 442 212 1991 ----
NM_021033chr1333191 1276 1156 ------
NM_021047chr194734 517 183 48 ------
NM_021069chr441864 712 235 169 ------
NM_021072chr512469 --1309 --
NM_021090chr2254209 1031 853 550 80 44979 1623 289 54 34721 4155 1473 1865
NM_021096chr2283143 2919 2525 2472 2105 909 739 507 33322 3314 2140 ----
NM_021111chr911144 ------
NM_021135chr672821 2376 1212 1022 291 187 71 2649 100 ----
NM_021140chrX1422 ------
NM_021145chr72377 126 ------
NM_021151chr7----2265 201 1757
NM_021155chr1952892 2064 1836 853 24 --12866 --
NM_021158chr205752 206 125 84 62 --1583 --
NM_021165chr11741 --170 --
NM_021194chr1199 ------
NM_021198chr271479 1267 1152 931 597 413 199 ----11022
NM_021202chr2072594 2459 2402 945 868 819 622 1975 --1494
NM_021216chr1961315 1260 1088 245 194 179 1976 1886 --
NM_021224chr92422 337 ------
NM_021229chr1211197 ------
NM_021237chr31347 ------
NM_021238chr1231652 1465 496 11813 ----
NM_021240chr92669 529 ------
NM_021269chr1931676 611 98 ------
NM_021622chr1052167 1778 1468 948 137 ------
NM_021627chr32978 85 ------
NM_021629chr394982 4714 4436 1941 1347 1292 1080 744 461 ------
NM_021638chr484542 3711 3099 1924 1756 1334 304 79 33225 1818 158 21437 362 --
NM_021648chr672232 2110 2041 1952 782 727 452 22026 886 12192 --
NM_021813chr655231 4477 4090 2317 489 --45093 3984 1289 297 --
NM_021814chr6--11269 ----
NM_021815chr253053 2400 1106 983 885 1335 11192 --
NM_021831chr21272 123 1108 --
NM_021907chr2--128 ----
NM_021911chr543501 1768 1618 1474 ------
NM_021913chr1961779 1698 1127 731 694 238 ------
NM_021923chr441501 1219 1003 283 11235 ----
NM_021940chr611179 ------
NM_021945chr662705 882 823 668 412 114 21227 155 ----
NM_021947chr17------21106 409
NM_021949chrX52703 1943 1875 1794 267 ------
NM_021954chr1332738 1434 98 1573 1390 12672
NM_021956chr6--1322 ----
NM_021960chr142283 2190 1840 1770 1527 1459 --
NM_021961chr1196649 6285 5667 5471 4578 2757 2746 2133 322 11406 24567 1864 14783
NM_021962chr1792541 2198 2041 2026 1832 1714 1704 560 549 ------
NM_021964chr345690 5543 4200 121 1635 ----
NM_021977chr632977 2518 322 --2649 432 --
NM_022048chr1565306 5256 4490 1637 1095 28 25893 4168 15542 --
NM_022051chr11227 ------
NM_022114chr143572 3302 680 172 14689 14079 --
NM_022143chr751365 1233 1044 449 109 ------
NM_022166chr16155100 4531 4241 2481 2273 1941 1815 1688 1523 1280 1024 743 682 257 99 25354 444 ----
NM_022361chr6--1534 ----
NM_022373chr71983 ------
NM_022455chr5--1291 ----
NM_022456chr1235081 427 95 32735 2303 1436 --56286 2928 2790 2289 2165
NM_022458chr741925 971 684 603 --11945 11115
NM_022459chr1396253 5946 5164 4747 4487 4273 4203 4060 525 26097 4150 --24393 461
NM_022465chr122400 353 1733 22138 441 --
NM_022469chr172711 2312 2217 1152 680 607 248 32815 930 86 ----
NM_022473chr1531497 663 141 44127 1604 853 713 11784 --
NM_022483chr511320 ------
NM_022497chr3103224 2822 2662 2617 1439 805 791 697 590 83 13624 --32994 2594 1030
NM_022648chr2134419 4259 4040 3836 3563 1784 1649 1525 1418 1379 895 382 264 ----11563
NM_022659chr81407 ------
NM_022716chr162887 2804 2615 702 689 474 12191 ----
NM_022719chr2293085 2575 2526 2359 1420 1347 888 512 300 ------
NM_022728chr71479 ------
NM_022739chr1711098 ------
NM_022742chr7--130 ----
NM_022748chr762707 2504 2254 918 544 44 1116 --11104
NM_022755chr982454 2291 2121 2104 1837 1830 962 322 1596 1251 --
NM_022758chr61740 12071 1779 33006 2890 2020
NM_022763chr342392 2282 321 81 ------
NM_022768chr1184 ------
NM_022771chr122392 334 ------
NM_022780chr21111 --1381 --
NM_022781chr921148 706 23079 2127 ----
NM_022782chr12----196 --
NM_022802chr101416 11382 ----
NM_022817chr242196 2126 1598 328 2915 666 12167 --
NM_022824chr541501 1360 636 519 ------
NM_022838chrX2252 25 ------
NM_022842chr363177 2484 2458 2393 2315 308 42976 2831 2766 1175 ----
NM_022894chr221570 337 ------
NM_022898chr1444458 4076 455 159 ------
NM_022900chr71846 ------
NM_022912chr252826 2775 2494 300 73 1830 ----
NM_022918chr1141685 1393 192 84 12024 ----
NM_022970chr1011161 ------
NM_022977chrX32420 2234 1050 --171 12116
NM_023000chr142602 182 ------
NM_023001chr142602 182 ------
NM_023010chrX1141 ------
NM_023018chr141624 1381 459 21 11410 ----
NM_023039chr51336 ------
NM_023072chr194368 224 113 100 --1892 175
NM_023074chr191971 ------
NM_023079chr173738 628 138 ------
NM_023923chr1113690 2872 2738 2558 2467 1465 1395 1160 928 586 500 33089 1080 599 11065 --
NM_023927chr511098 ------
NM_023929chr81142 ------
NM_024007chr562044 1274 797 334 294 72 12722 12603 --
NM_024017chr1761249 1141 529 319 287 129 ------
NM_024052chr1772900 2558 2160 2024 446 389 247 11984 1603 --
NM_024085chr21317 ------
NM_024090chr41529 11706 ----
NM_024117chr9189 ------
NM_024122chrX1225 ------
NM_024294chr61740 12071 1779 33006 2890 2020
NM_024345chr975685 3939 1766 1393 1324 1282 1005 35225 4457 4253 16059 --
NM_024496chr141222 ------
NM_024501chr23468 200 42 ------
NM_024503chr11300 ------
NM_024509chr191154 ------
NM_024511chr42691 595 12931 12499 --
NM_024520chr2197 ------
NM_024524chr362727 2593 1209 702 480 209 ------
NM_024539chrX1495 ------
NM_024548chr33538 507 313 ------
NM_024556chr114491 443 411 45 ------
NM_024582chr41977 ------
NM_024607chr874209 3567 3536 3005 2951 1806 112 3892 296 46 1840 13278
NM_024612chr17--2157 143 ----
NM_024615chr5135 ------
NM_024624chr21637 --1155 --
NM_024626chr12466 415 ------
NM_024665chr344368 4134 2887 1378 ------
NM_024686chr11491 ------
NM_024689chrX21319 232 3410 180 30 11788 1284
NM_024692chr221195 631 ----2459 25
NM_024698chr11101236 1143 1136 1099 1078 1049 1028 986 553 167 ------
NM_024713chr1521511 567 ------
NM_024721chr822434 464 ------
NM_024725chr111220 ------
NM_024744chr2--1554 --22016 1661
NM_024759chr83608 341 167 --1241 --
NM_024761chr984364 2106 1816 1494 840 504 328 278 23391 1895 33310 1824 481 14461
NM_024770chr2136753 4851 4744 4736 4607 2140 1933 1704 966 957 844 642 62 1461 11837 --
NM_024772chr11448 ------
NM_024828chr921382 1110 11355 ----
NM_024837chr152683 565 ------
NM_024884chr1464471 4312 4062 3890 3578 1586 --21361 746 1518
NM_024900chr431532 760 631 11870 1299 --
NM_024900chr431532 760 631 11870 1299 --
NM_024915chr872501 884 285 233 206 153 67 1274 22248 212 --
NM_024920chr4----11186 --
NM_024939chr1691639 1551 1201 422 372 287 280 251 113 21250 137 1669 11193
NM_024944chr21----1119 --
NM_024947chr389635 8827 8333 7721 7582 2985 2376 1467 --12903 --
NM_024948chr103699 231 82 ------
NM_024949chr474852 4295 1584 1318 1145 504 329 44212 4111 3974 1167 --24377 760
NM_024960chr201136 --1456 --
NM_024971chr9--1806 ----
NM_024989chr263115 2555 2458 1344 505 440 15339 ----
NM_024991chr1052642 1186 739 377 155 1394 13037 --
NM_025047chr31334 ------
NM_025054chr843393 1277 919 665 32873 2584 349 24029 885 --
NM_025076chr21165 ------
NM_025077chr11210 ------
NM_025133chr23952 253 24 1147 ----
NM_025134chr1622145 740 ------
NM_025146chr352635 2581 1800 1753 550 157 ----
NM_025147chr21935 ------
NM_025152chr1421370 150 21294 296 ----
NM_025160chr153899 3732 1384 1376 137 ------
NM_025179chr194649 4534 4433 4316 1917 1533 1512 1291 93 14680 ----
NM_025181chr21749 ------
NM_025191chr131320 948 391 23320 3150 ----
NM_025208chr1132092 1622 797 --129 --
NM_025237chr1761382 1063 422 241 173 145 1360 ----
NM_030576chr1792601 2546 2309 1947 1908 1642 430 357 282 22154 291 ----
NM_030583chr83752 242 67 176 ----
NM_030623chr241411 1400 1200 158 11680 ----
NM_030625chr1052451 2004 1872 436 301 ------
NM_030647chr756114 5575 4552 1145 637 15955 ----
NM_030650chr243628 3156 1515 1079 --13422 --
NM_030660chr1421404 1377 11223 ----
NM_030674chr1255538 3855 3795 3687 48 --11127 1943
NM_030751chr1021749 405 ------
NM_030751chr1021749 405 ------
NM_030761chr162215 1784 1029 648 486 196 12615 11086 22126 1690
NM_030766chr12--2241 197 ----
NM_030767chr962634 2049 1149 1009 714 94 32349 1801 86 ----
NM_030773chr2011869 ------
NM_030780chr82146 49 ------
NM_030806chr1228987 8587 8309 8274 8231 7828 7566 7469 6953 6770 6686 6567 3583 3185 3138 1811 1570 1170 1050 660 528 471 38138 7861 3080 33504 1943 836 --
NM_030816chr143053 3023 2750 416 33704 3066 1060 22728 2627 --
NM_030918chr1135214 4499 4453 4055 3774 3577 3335 2169 2110 1605 941 86 27 14310 --11064
NM_030940chr9140 ------
NM_030978chr91457 ------
NM_031266chr51544 ------
NM_031268chr16134820 4750 4421 4265 3870 3513 2158 1746 1689 1111 853 566 478 24095 3976 --1805
NM_031292chr1221070 213 11203 ----
NM_031314chr1431980 645 213 11649 ----
NM_031411chr521515 189 12178 1101 --
NM_031444chr22102537 1835 847 716 647 622 460 352 309 249 1278 127 --
NM_031445chr263170 2382 971 644 607 204 12421 --12336
NM_031453chr1052411 2313 2216 2181 79 21784 619 ----
NM_031468chr7117926 7437 7013 6714 6602 5591 5189 3258 2814 2244 874 66499 6399 2911 2539 1444 694 11824 --
NM_031480chr63228 163 64 --1170 --
NM_031483chr201362 13160 1401 --
NM_031844chr132794 906 521 ------
NM_031849chr521515 189 12178 1101 --
NM_031857chr521515 189 12178 1101 --
NM_031860chr521515 189 12178 1101 --
NM_031892chrX--1745 ----
NM_031899chr331588 387 364 41277 1214 46 24 1539 --
NM_031905chr71285 --1406 11167
NM_031922chr62536 479 ------
NM_031936chr11180 ------
NM_031938chr113807 722 218 1180 ----
NM_031954chr1242603 2389 952 681 ------
NM_032012chr951655 1021 716 623 124 24826 4475 --11488
NM_032017chr1102019 1902 1808 1372 1314 693 498 455 417 393 21586 223 ----
NM_032028chr53633 606 103 148 ----
NM_032047chr31791 2929 121 ----
NM_032105chr186957 6347 5812 5361 3204 3182 2406 1781 25904 5206 17006 --
NM_032124chr181806 11177 1177 --
NM_032144chr241486 1419 1223 500 1345 ----
NM_032153chr352516 2001 522 190 183 1935 --11769
NM_032160chr1894229 3890 2880 1419 1321 1203 671 633 541 ------
NM_032189chr1394489 4228 4058 3881 3810 3211 1205 525 134 11463 ----
NM_032193chr1151925 1723 1616 133 126 --1426 --
NM_032199chr1043753 3120 2915 2781 23472 2551 ----
NM_032221chr2012014 ----11311
NM_032229chr13------152
NM_032239chr41505 ------
NM_032242chr363000 2648 2274 2189 892 504 23142 2865 12569 --
NM_032283chr181830 1639 1616 1307 438 369 299 278 ------
NM_032289chr561982 1454 343 257 130 91 21489 735 11305 --
NM_032303chr961653 1462 1246 1148 251 188 154 ----
NM_032321chr22817 464 33325 1022 391 21308 1064 1692
NM_032348chr11899 ------
NM_032352chr141552 ------
NM_032373chr1095540 4473 4116 3890 3697 1227 546 506 484 ------
NM_032379chr112691 603 1168 ----
NM_032408chr73951 889 324 2911 299 ----
NM_032432chr441637 1576 1483 1014 ------
NM_032434chr231519 348 217 ------
NM_032435chr132362 2282 563 ------
NM_032438chr6--21488 45 ----
NM_032439chr10--1446 ----
NM_032440chr1052965 2687 2128 1943 385 22315 1184 ----
NM_032441chrX--2478 180 ----
NM_032445chr1511730 ------
NM_032457chr42380 341 ----11194
NM_032458chrX3940 646 622 --22654 494 --
NM_032517chr101129 ------
NM_032521chr2021144 952 22966 350 --1199
NM_032538chr692872 2745 2093 1973 1846 1835 1815 1780 461 --12409 --
NM_032539chrX3832 793 670 ------
NM_032557chr41277 ------
NM_032558chr911472 ------
NM_032560chr14----1205 --
NM_032561chr223481 230 35 1515 ----
NM_032562chr101402 ------
NM_032569chr1681835 1759 1626 1278 730 518 425 222 ------
NM_032575chr1691999 1698 1428 1394 620 564 553 434 228 --11740 --
NM_032582chr171200 ------
NM_032622chr421056 263 ------
NM_032632chr141742 1163 ----
NM_032663chr1241872 1836 1780 1269 21451 394 ----
NM_032682chr342388 880 403 390 11130 ----
NM_032778chr342554 878 571 68 22739 442 13053 --
NM_032786chr121211 ------
NM_032810chr1021078 277 ------
NM_032812chr102110 104 ------
NM_032826chr754883 4011 1877 1087 107 11076 14219 --
NM_032832chr62424 242 --1557 1381
NM_032839chr31385 ------
NM_032859chr1333228 1303 837 13118 ----
NM_032869chr821814 773 ------
NM_032870chr61556 ------
NM_032873chr1142935 2785 1725 1078 13534 ----
NM_032876chr141419 11367 1671 --
NM_032892chr151106 1128 ----
NM_032943chr112691 603 1168 ----
NM_032961chr431365 1226 927 --1298 --
NM_032966chr1191385 1320 1308 1206 1110 1102 966 571 563 31561 600 209 ----
NM_032968chrX--1372 1828 --
NM_032969chrX--1372 1828 --
NM_032973chrY--1372 1828 --
NM_032983chr773325 3311 3261 2525 2286 2084 1009 1379 12700 --
NM_033012chr131745 1997 ----
NM_033020chr164415 3078 1906 1314 1037 1024 ----14385
NM_033030chr21155 --11482 --
NM_033044chr111130 1293 ----
NM_033055chr12463 240 ------
NM_033132chr1362025 1881 1743 496 433 408 ------
NM_033135chr1132092 1622 797 --129 --
NM_033136chr521783 1661 ------
NM_033137chr521783 1661 ------
NM_033147chr2--128 ----
NM_033148chr2--128 ----
NM_033181chr643544 3066 3044 211 --13152 33866 3129 51
NM_033196chr192989 330 --1401 --
NM_033222chr921405 1025 ------
NM_033224chr7146951 6876 6579 6277 5442 5300 3183 3169 2879 2792 2589 2434 986 431 17845 11089 --
NM_033225chr81934 ------
NM_033274chr563016 2926 2771 1058 705 336 53390 2712 2552 1091 184 ----
NM_033290chrX53741 3727 3606 1202 1068 22587 304 12611 --
NM_033300chr111340 ------
NM_033331chr941311 1238 269 97 ------
NM_033380chrX1439 ------
NM_033381chrX1439 ------
NM_033389chr1743402 3022 1683 1550 14607 --14469
NM_033393chr4102805 2703 2637 2480 2424 2416 2116 1016 457 271 12268 21138 185 1594
NM_033394chr211053 ----11168
NM_033401chr162500 157 ------
NM_033428chr921776 1695 1675 1706 --
NM_033429chr1542983 2896 895 339 22236 567 ----
NM_033430chr453749 2631 2566 559 448 13718 12677 11231
NM_033437chr453749 2631 2566 559 448 13718 12677 11231
NM_033503chr15103570 2885 2796 2354 1192 807 729 698 423 188 21504 1410 ----
NM_033505chr286636 6306 6256 6193 2538 2281 1817 452 --14218 25078 180
NM_033515chr631243 1087 942 --2932 136 --
NM_033551chr573066 2989 2976 2359 2268 1212 434 13213 12875 --
NM_033631chr193917 3480 2790 2373 1361 854 734 301 106 1207 13652 --
NM_033644chr541905 1694 628 236 11985 ----
NM_033645chr541905 1694 628 236 11985 ----
NM_033656chr2155407 5206 5033 4705 4427 ------
NM_044472chr1199 ------
NM_052845chr12123139 2778 2393 2364 2275 2263 2008 1320 543 441 390 216 12718 12885 --
NM_052847chr19103790 3523 3336 3067 2881 2613 2344 2298 1092 118 13505 ----
NM_052860chr5376 40 22 ------
NM_052875chr1152165 1343 834 667 638 --1266 --
NM_052879chr1233368 2578 1456 ------
NM_052896chr172391 2200 1933 1582 926 153 38 1811 11598 --
NM_052906chr2284864 4296 3667 3511 3259 1299 582 414 44352 1978 531 105 14473 --
NM_052913chr6----188 --
NM_052918chr1042914 2864 2612 500 --21163 349 --
NM_052927chr532105 1859 830 ----12151
NM_052928chr1761488 1433 1274 595 388 297 21126 38 ----
NM_052934chr162001 574 355 273 253 67 31782 1771 423 12257 1234
NM_052937chr842700 2189 1010 356 ------
NM_052938chr1148 ------
NM_052978chr1431370 1334 208 11847 ----
NM_053002chr3--1946 ----
NM_053016chr9147660 7073 7042 6520 6263 6188 6182 5948 3216 3028 2312 1056 819 553 37327 6419 6402 25749 4923 26793 6650
NM_053023chr1133131 1097 782 ------
NM_053024chr3268 62 ------
NM_053043chr795227 5134 4921 4212 4141 4083 2312 2215 1327 --14576 --
NM_057169chr1251239 1214 1152 783 629 148 12722 --
NM_057170chr1251239 1214 1152 783 629 148 12722 --
NM_058172chr4--21353 495 ----
NM_058179chr92995 737 ------
NM_058237chr141783 ------
NM_078469chr102944 546 11237 ----
NM_078483chr584087 3451 3065 2852 2660 2580 810 541 11045 23656 1324 --
NM_078485chr61142 ------
NM_080391chr11539 ----1582
NM_080392chr11588 ----1631
NM_080425chr20130 ------
NM_080426chr20130 ------
NM_080491chr1193490 3053 2987 2940 2794 2780 2442 866 351 43960 3711 2909 23 13098 1830
NM_080546chr912112 --1453 --
NM_080597chr18143 ------
NM_080629chr111196 --1545 --
NM_080630chr111196 --1545 --
NM_080632chrX1141 ------
NM_080645chr631900 477 462 11522 11679 --
NM_080650chr15--1802 ----
NM_080654chr1141140 1114 435 173 ------
NM_080676chr2062838 2631 891 501 416 100 ----1447
NM_080683chr41398 ------
NM_080684chr41398 ------
NM_080685chr41398 ------
NM_080738chr162007 1839 1823 1361 710 264 ----1720
NM_080743chr61416 ----21853 566
NM_080759chr1352599 2408 2237 664 88 11994 ----
NM_080760chr1352599 2408 2237 664 88 11994 ----
NM_080792chr2062249 1828 1710 1599 1473 359 1924 ----
NM_080867chr1454903 4814 3842 3448 1167 ------
NM_080872chr863394 3146 1190 907 802 187 ----12997
NM_080927chr343004 2247 671 263 --1356 --
NM_100264chr101104 ------
NM_100486chr101104 ------
NM_130385chr1142893 2701 2675 2449 32305 2181 78 13165 --
NM_130387chr331110 870 101 1362 ----
NM_130391chr95654 492 88 66 37 --13206 --
NM_130392chr95654 492 88 66 37 --13206 --
NM_130393chr95654 492 88 66 37 --13206 --
NM_130395chr61291 ------
NM_130435chr1072660 2281 1998 1976 1846 1811 1096 22408 353 ----
NM_130436chr2112162 11888 1491 --
NM_130438chr2122739 155 12465 11068 --
NM_130439chr1062091 877 809 727 603 516 21874 565 ----
NM_130439chr1062091 877 809 727 603 516 21874 565 ----
NM_130440chr161483 1244 321 261 250 67 ------
NM_130807chr1972100 2072 2011 1484 742 495 379 22170 263 11867 --
NM_133170chr20207134 6940 6709 6451 5965 5473 5229 3183 2727 2207 1987 1841 1533 1310 1230 1078 1032 559 546 52 88021 5402 5210 2609 2535 1924 1206 208 15110 25439 1801
NM_133172chr5198 ------
NM_133173chr5198 ------
NM_133174chr5198 ------
NM_133264chr1793771 3620 3591 3260 3238 3023 1041 245 123 --11089 --
NM_133265chrX21267 514 13141 ----
NM_133329chr221673 1588 ------
NM_133334chr496260 5780 5632 4974 4714 4154 2339 1275 633 11305 ----
NM_133445chr973015 2865 2426 2394 1026 953 741 1176 2237 48 --
NM_133468chr762427 2206 2193 1015 365 245 --12554 --
NM_133478chr242529 1842 1773 367 ----12125
NM_133507chr123885 618 193 ------
NM_133646chr295389 4441 2075 1541 924 824 624 198 118 35505 4518 1894 12115 --
NM_133647chr1573610 3082 2797 2386 285 142 100 22834 2353 ----
NM_134265chr171260 ------
NM_134325chr131536 651 109 21317 1306 11792 --
NM_134428chr9----176 --
NM_138270chrX33373 2943 260 12858 ----
NM_138292chr1152916 2434 1396 1362 1288 22658 1127 1698 --
NM_138316chr1031405 965 922 ------
NM_138319chr1511025 1973 ----
NM_138328chr1763193 3028 2210 1160 1064 93 ------
NM_138338chr22123107 3085 2975 2784 2508 2189 2163 1363 1288 1279 1169 932 33358 2469 2338 1168 --
NM_138346chr12218 60 ------
NM_138357chr10--11127 --1195
NM_138392chr191180 ------
NM_138409chr631376 361 168 ------
NM_138426chr7----1310 --
NM_138444chr1364052 3084 938 773 565 429 21786 1403 13123 13959
NM_138457chr6102826 2477 2370 1325 1107 792 669 432 126 58 52923 2133 830 622 105 12439 --
NM_138468chr284885 4471 4161 4135 2020 1991 1198 1036 25879 4462 14915 1702
NM_138473chr1274769 4214 4113 3937 3583 3561 548 44421 1933 1608 845 14382 --
NM_138569chr61260 ------
NM_138576chr1444458 4076 455 159 ------
NM_138612chr16--178 ----
NM_138633chr62624 38 --11506 --
NM_138635chr742346 2221 493 330 32654 1213 822 1782 --
NM_138694chr662644 2622 2523 2390 833 65 --1274 --
NM_138713chr1666958 6322 5433 3315 2365 1239 13233 17864 --
NM_138714chr1666958 6322 5433 3315 2365 1239 13233 17864 --
NM_138727chr162452 2026 1787 775 518 394 21549 674 ----
NM_138728chr162452 2026 1787 775 518 394 21549 674 ----
NM_138731chr1461356 1198 760 753 396 83 ------
NM_138782chr521626 639 1952 ----
NM_138957chr221115 ------
NM_138959chr195719 5509 2316 2082 1390 1362 882 774 341 26330 1235 25332 5265 --
NM_138967chr1552453 2218 2185 1840 952 1825 31980 1604 962 1724
NM_138971chr1123204 257 22825 508 22445 944 --
NM_138971chr1123204 257 22825 508 22445 944 --
NM_138972chr1123204 257 22825 508 22445 944 --
NM_138972chr1123204 257 22825 508 22445 944 --
NM_138973chr1123204 257 22825 508 22445 944 --
NM_138973chr1123204 257 22825 508 22445 944 --
NM_138980chr42610 286 1135 --1195
NM_138981chr42741 102 1266 --1326
NM_138982chr42610 286 1135 --1195
NM_138994chr162500 157 ------
NM_139012chr632119 2107 668 22299 454 11692 --
NM_139014chr632199 2187 748 22379 534 11772 --
NM_139015chr1231480 475 176 11382 ----
NM_139035chrX--1153 ----
NM_139045chr9----1806 --
NM_139048chr31876 ------
NM_139057chr1562419 2218 1966 1843 836 457 41954 1019 65 30 ----
NM_139067chr121122 ------
NM_139135chr121044 263 ------
NM_139168chr511680 ------
NM_139182chr411165 31377 642 363 ----
NM_139276chr1742265 2171 1952 815 --22135 499 --
NM_139283chr1221696 120 1809 ----
NM_139321chr20103909 3558 3496 3140 2611 1578 1290 1083 1012 450 13748 13260 1837
NM_139323chr2021827 1313 ------
NM_144567chr162467 2003 626 577 464 344 1646 --12335
NM_144570chr16112743 2588 2327 2223 2111 1993 1971 1885 1204 843 117 --12263 --
NM_144571chr431808 358 96 35035 2337 299 1723 --
NM_144578chr1463907 3765 1996 1368 1125 1051 24978 2091 --24952 3958
NM_144579chr2122874 2860 2839 2743 2288 2034 1977 1914 1008 863 434 376 32089 2078 704 22508 2381 --
NM_144583chr231723 320 180 21553 1239 1413 --
NM_144607chr1732255 1911 154 1956 1860 12577
NM_144609chr173979 931 259 11020 ----
NM_144628chr2032996 2270 2010 32890 2389 636 ----
NM_144633chr321280 289 ------
NM_144643chr4178 ------
NM_144664chr1122500 66 1794 ----
NM_144728chr12293 243 ------
NM_144729chr12293 243 ------
NM_144767chr1574048 3546 2852 1656 1401 1380 534 31753 473 189 1936 --
NM_144949chr242533 2010 1614 112 1457 ----
NM_144967chrX1233 ------
NM_144969chrX2524 106 1289 ----
NM_145000chr51519 ------
NM_145011chr1051957 1678 894 486 392 1378 ----
NM_145012chr10--1965 ----
NM_145025chr61227 1775 ----
NM_145049chr5----1950 --
NM_145053chr113520 215 45 1399 --1189
NM_145055chr1843814 3500 3216 554 ------
NM_145074chr2----1552 --
NM_145113chr1471427 426 349 275 254 236 226 ------
NM_145159chr141790 ------
NM_145175chr2--11112 ----
NM_145206chr1082920 2517 2442 2197 1106 640 399 96 12873 22801 744 --
NM_145207chr474354 2002 1204 1111 978 947 739 ----34795 655 644
NM_145246chr1011093 ----11232
NM_145247chr101452 ------
NM_145259chr246567 6230 5320 4377 26618 6278 1286 --
NM_145263chr442286 1737 1465 275 1911 ----
NM_145268chr71342 ------
NM_145305chrX--11053 ----
NM_145307chr1044175 4051 532 123 13862 2632 295 --
NM_145320chr763580 2700 2645 2207 429 139 33031 1362 1334 11346 --
NM_145321chr763580 2700 2645 2207 429 139 33031 1362 1334 11346 --
NM_145322chr763580 2700 2645 2207 429 139 33031 1362 1334 11346 --
NM_145332chr6169 ------
NM_145333chr6169 ------
NM_145341chr102394 248 21847 1266 ----
NM_145690chr8--11792 11885 --
NM_145733chr2241057 899 150 65 11076 1447 1304
NM_145735chr1372574 2500 2316 1986 815 771 217 11776 --1501
NM_145753chr31673 --11634 --
NM_145793chr101764 1783 1746 --
NM_145800chrX3642 234 78 ------
NM_145802chrX2183 27 ------
NM_145804chr1151226 1183 1056 343 334 --2444 78 --
NM_145808chr722719 555 --2839 232 --
NM_145858chr212411 355 ------
NM_145861chr162007 1839 1823 1361 710 264 ----1720
NM_145912chr22174246 3980 3937 3581 3561 3036 1707 1565 1431 1156 1008 930 786 317 240 134 94 44394 3162 1113 621 ----
NM_147150chr933520 3302 173 ------
NM_147175chrX21948 1362 ------
NM_147192chr161667 1195 1056 1038 415 343 1165 --197
NM_147223chr22551 446 32447 146 118 ----
NM_148174chr8144 1293 ----
NM_148894chr4----1117 --
NM_148898chr72696 145 11058 ----
NM_148899chr72696 145 11058 ----
NM_148957chr1352390 1994 182 166 144 ------
NM_148977chr1031405 965 922 ------
NM_148978chr1031405 965 922 ------
NM_152253chr22124165 4128 3907 2967 2711 1722 1556 757 478 414 286 110 33864 1654 1189 11575 --
NM_152261chr125968 489 462 398 278 ------
NM_152263chr1105835 5715 5639 5255 5124 2417 1767 958 182 62 15346 --23683 1462
NM_152271chr81942 ------
NM_152275chr22955 185 --1559 --
NM_152280chr122582 893 12378 ----
NM_152284chr81699 --1131 1382
NM_152330chr1441974 680 274 150 12042 12015 --
NM_152390chr21548 ------
NM_152409chr523152 1122 ----22392 363
NM_152422chr951694 1201 747 463 183 --11818 --
NM_152424chrX73054 2961 1759 1265 1203 921 657 23352 1530 11229 --
NM_152437chr1252038 1976 1966 1678 1554 22420 2129 ----
NM_152449chr152593 180 1529 --125
NM_152453chr151179 ------
NM_152470chr1873667 3470 2969 1375 1298 110 88 1901 23607 3194 --
NM_152493chr141089 149 102 64 11080 21203 541 --
NM_152512chr221399 ------
NM_152529chr284406 3536 3464 1416 575 346 324 105 13369 1850 --
NM_152556chr7--1593 ----
NM_152588chr1241736 1482 454 299 ------
NM_152594chr1521887 1604 11541 --1114
NM_152608chr152076 1949 1602 760 559 --22509 911 --
NM_152609chr121194 781 ------
NM_152622chr521071 1058 2921 629 1245 --
NM_152624chr537348 2010 72 25272 1027 1978 --
NM_152625chr51278 ------
NM_152629chr923729 2706 23967 1301 11356 --
NM_152638chr1211275 ------
NM_152641chr1252409 2119 1874 558 433 22825 1036 ----
NM_152671chr2--1356 ----
NM_152682chr43436 346 243 ------
NM_152688chr61648 ------
NM_152692chrX----1457 --
NM_152705chr1331077 484 217 11201 ----
NM_152716chr1111083 ------
NM_152721chr18----2467 180 --
NM_152724chr1032424 2099 244 ------
NM_152726chr13189 ------
NM_152733chr6146334 6181 6146 5814 5391 5295 5240 4687 4443 2165 2091 1967 1920 793 2853 253 15536 --
NM_152739chr74754 216 185 35 ------
NM_152745chr7129 ------
NM_152749chr75767 402 280 245 100 ------
NM_152753chr631882 1398 500 31876 1864 351 135 --
NM_152756chr564323 2976 1681 1022 200 67 ------
NM_152758chr842755 2709 88 67 --1547 --
NM_152788chr121221 134 ----
NM_152835chr122815 2151 --1971 --
NM_152838chr2033189 884 461 1649 ----
NM_152879chr2102623 2146 2057 1911 1702 1681 647 612 164 99 ------
NM_152924chr1586653 5792 5607 5219 4717 2477 1238 285 ------
NM_152932chr3141 ------
NM_152989chr122232 44 11627 ----
NM_152999chr764609 4498 3536 2011 1337 353 11097 ----
NM_153005chr63228 163 64 --1170 --
NM_153013chr542072 1934 1608 719 ------
NM_153020chr611210 ------
NM_153035chr183219 2749 2125 828 625 586 490 155 ------
NM_153050chr2254209 1031 853 550 80 44979 1623 289 54 34721 4155 1473 1865
NM_153051chr2254209 1031 853 550 80 44979 1623 289 54 34721 4155 1473 1865
NM_153182chr342554 878 571 68 22739 442 13053 --
NM_153186chr9142 1126 1867 --
NM_153188chr595552 4362 3952 3939 1897 1404 1098 834 188 15018 24249 4112 --
NM_153207chr1253885 3139 2647 2512 319 ------
NM_153208chr161765 1702 1389 --
NM_153211chr182138 74 ------
NM_153223chr551583 1418 1221 350 35 ------
NM_153234chr552434 1006 489 480 291 12568 12464 --
NM_153262chr142375 912 479 75 --11254 --
NM_153267chr91596 ------
NM_153273chr342746 2147 988 370 12164 32651 2602 2233 --
NM_153340chr11119 ------
NM_153347chr1142110 895 484 471 42169 1862 696 689 12745 --
NM_153367chr1093573 3522 3488 3059 1546 1431 1228 855 292 31376 822 279 1558 --
NM_153371chr1332188 875 546 1282 ----
NM_153456chr13155777 5697 5446 4265 2163 2111 1877 1763 1555 1540 1381 1091 650 242 83 31842 1647 1505 ----
NM_153487chr6104790 4262 3801 3392 3294 3281 468 403 350 181 34604 3467 1277 11244 --
NM_153499chr1253063 2598 2299 757 92 --23035 2608 12004
NM_153500chr1253063 2598 2299 757 92 --23035 2608 12004
NM_153607chr521955 1226 13116 --12184
NM_153619chr1552466 1241 1184 783 477 1403 ----
NM_153620chr721404 1133 21691 326 ----
NM_153640chr201136 --1456 --
NM_153695chr9174 ------
NM_153756chr161654 1330 750 532 487 179 1613 ----
NM_153757chr431241 1216 46 131 ----
NM_153828chr24894 661 364 206 ------
NM_153831chr81273 ------
NM_170600chr91360 ------
NM_170665chr1294348 4068 3624 2798 1780 1410 1263 462 312 12913 ----
NM_170674chr1551434 1363 1033 938 260 ------
NM_170677chr1551434 1363 1033 938 260 ------
NM_170679chr511323 ------
NM_170706chr113562 23842 3149 --11237
NM_170709chr872319 2249 1922 1815 821 216 38 ----11467
NM_170731chr1152071 1148 1093 813 780 12826 --11999
NM_170732chr1152071 1148 1093 813 780 12826 --11999
NM_170733chr1152071 1148 1093 813 780 12826 --11999
NM_170734chr1152071 1148 1093 813 780 12826 --11999
NM_170735chr1152071 1148 1093 813 780 12826 --11999
NM_170774chr20103841 3575 3544 3233 3153 2634 1458 1191 1183 1148 ----1664
NM_170782chr11469 ------
NM_171999chr182215 177 134 1694 --
NM_172020chr751390 734 633 218 181 21740 1275 ----
NM_172037chr821468 1139 ------
NM_172069chr242014 1949 1873 597 --22091 1711 --
NM_172070chr22131 65 --12050 --
NM_172103chr632296 2255 782 12480 ----
NM_172105chr632296 2255 782 12480 ----
NM_172130chr171810 1739 1460 1329 644 254 66 31359 328 196 ----
NM_172200chr101126 1107 129 1539
NM_172216chr1242965 2500 2201 659 --22937 2510 11906
NM_172225chr161667 1195 1056 1038 415 343 1165 --197
NM_172226chr1253063 2598 2299 757 92 --23035 2608 12004
NM_172315chr1551434 1363 1033 938 260 ------
NM_172316chr1551434 1363 1033 938 260 ------
NM_172344chr221673 1588 ------
NM_172349chr5--1291 ----
NM_173039chr111243 ------
NM_173075chr431669 1537 587 --1404 11861
NM_173083chr11497 ------
NM_173156chr182010 1853 1770 1680 1594 724 665 550 ------
NM_173172chr21188 ------
NM_173214chr1666958 6322 5433 3315 2365 1239 13233 17864 --
NM_173355chr2------1292
NM_173359chr331242 712 706 11660 11435 --
NM_173468chr494533 4051 3749 2057 1762 851 844 653 358 ----14329
NM_173469chr15------21407 351
NM_173475chr1631100 648 265 --1282 --
NM_173476chr1662232 2202 1788 834 827 554 31840 265 52 2636 234 --
NM_173495chrX12121 ------
NM_173500chr152922 278 --1352 --
NM_173510chr2252390 2170 1963 1099 403 12685 1493 1687
NM_173557chr181544 1675 ----
NM_173576chr1032205 713 401 --1277 --
NM_173582chr11105912 5707 5320 5094 5047 4524 4189 2482 1702 1461 ----1328
NM_173595chr12105200 4507 4167 3578 1817 1799 1180 461 209 129 23873 1013 14143 13272
NM_173609chr153272 150 82 ------
NM_173653chr351280 1093 432 342 133 31113 567 524 ----
NM_173667chr541828 969 524 170 21818 134 --11925
NM_173683chr851562 1129 1102 185 165 ------
NM_173694chrX11633 ----22348 734
NM_173797chr52945 531 ------
NM_173808chr174453 4398 3612 3218 1028 552 234 --24292 3035 --
NM_173814chr153597 398 218 ------
NM_173829chr554414 4293 3807 1154 727 --14380 --
NM_173848chr81181 ------
NM_174937chr101171 --125 --
NM_174938chr91345 ------
NM_175607chr311110 1679 ----
NM_175612chr311110 1679 ----
NM_175623chr1235081 427 95 32735 2303 1436 --56286 2928 2790 2289 2165
NM_175624chr1235176 522 190 32830 2398 1531 --56381 3023 2885 2384 2260
NM_175625chr1235176 522 190 32830 2398 1531 --56381 3023 2885 2384 2260
NM_175733chr1141910 1551 1517 327 11402 --11819
NM_175747chr61883 ------
NM_175748chr1461788 1483 1464 855 660 482 --11598 1567
NM_175861chr1274160 4144 1680 1535 620 439 65 --12058 15454
NM_175884chr71361 1533 ----
NM_175895chr1211118 ------
NM_175907chr1822801 2190 ------
NM_175910chr194976 815 619 563 ------
NM_176081chr1065651 5442 4061 1726 1461 948 25526 1021 15049 14660
NM_176083chr1065651 5442 4061 1726 1461 948 25526 1021 15049 14660
NM_176801chr4111693 1618 1479 678 614 460 358 280 158 147 54 1132 ----
NM_176816chr541330 769 682 436 21700 1542 --11835
NM_176895chr52212 98 ------
NM_177947chrX----1292 --
NM_177948chrX----1292 --
NM_177952chr141718 ------
NM_177968chr21445 1896 ----
NM_177969chr2------1726
NM_177972chr1174276 3776 1571 556 527 501 94 ----11644
NM_177995chr951694 1201 747 463 183 --11818 --
NM_177999chr9143523 3398 3365 2747 2637 2629 2495 1404 991 959 895 793 492 378 32573 2546 2300 13233 --
NM_178010chr122232 44 11627 ----
NM_178013chr14122569 2525 2242 2203 1013 965 839 833 435 245 126 120 32390 1984 397 21100 209 --
NM_178123chr22299 107 ------
NM_178140chr552464 761 724 191 145 ------
NM_178151chrX77824 7593 6457 5203 2887 2498 526 37047 2031 44 12010 11997
NM_178152chrX77824 7593 6457 5203 2887 2498 526 37047 2031 44 12010 11997
NM_178153chrX77824 7593 6457 5203 2887 2498 526 37047 2031 44 12010 11997
NM_178177chr3140 ------
NM_178234chr81215 ------
NM_178326chr21409 ------
NM_178426chr111960 --12124 --
NM_178427chr111860 --12024 --
NM_178450chr53696 225 89 --1101 --
NM_178454chr11626 ------
NM_178509chr1763249 1478 1214 905 683 651 33359 1105 1098 ----
NM_178565chr861705 1566 1437 1211 1134 572 ------
NM_178585chr4--1613 13020 --
NM_178586chr1431659 919 187 11973 1679 --
NM_178815chr1021930 1696 2721 659 ----
NM_178819chr81257 ------
NM_180989chr1332000 845 545 ------
NM_181054chr141239 ------
NM_181093chr11183 --1382 --
NM_181340chr141211 ------
NM_181351chr1112056 32235 454 344 ----
NM_181358chr164013 3574 3526 3243 1695 378 --13313 --
NM_181361chr321147 953 137 1441 --
NM_181442chr203793 231 154 ------
NM_181443chr2042062 918 797 641 ----12723
NM_181491chr993115 3075 3050 2756 2618 1968 602 286 242 42541 2429 2140 510 ----
NM_181504chr553421 2888 1113 867 206 ------
NM_181521chr1677117 7002 6686 6261 6143 5346 286 35524 800 185 --16345
NM_181523chr553421 2888 1113 867 206 ------
NM_181524chr553421 2888 1113 867 206 ------
NM_181571chr1031147 729 157 21141 1023 ----
NM_181645chr11156 ------
NM_181727chr32391 155 ------
NM_181747chr7172 ------
NM_181762chrX1300 ------
NM_181777chrX1300 ------
NM_181780chr312090 11392 ----
NM_181784chr242393 826 726 622 11704 12507 --
NM_181809chr153211 2766 826 515 278 12637 11549 --
NM_181828chr22113850 3449 3382 3258 3232 3110 2750 2361 586 439 33 43557 3192 2395 207 1953 --
NM_181829chr22113850 3449 3382 3258 3232 3110 2750 2361 586 439 33 43557 3192 2395 207 1953 --
NM_181830chr22113850 3449 3382 3258 3232 3110 2750 2361 586 439 33 43557 3192 2395 207 1953 --
NM_181832chr22113865 3464 3397 3273 3247 3125 2765 2376 601 454 48 43572 3207 2410 222 1968 --
NM_181833chr22103790 3389 3322 3198 3172 3050 2690 2301 526 379 43497 3132 2335 147 1893 --
NM_181838chr551526 1249 1168 1076 62 ----197
NM_181839chr821110 1047 ------
NM_181844chr1752015 1787 1678 1599 1523 156 11246 1792
NM_181861chr1262368 2045 870 851 563 92 --12471 --
NM_181868chr1262368 2045 870 851 563 92 --12471 --
NM_181869chr1262453 2130 955 936 648 177 --12556 --
NM_181874chr34934 343 269 25 ------
NM_181886chr411039 --1441 --
NM_181887chr411039 --1441 --
NM_181888chr411039 --1441 --
NM_181889chr411039 --1441 --
NM_181890chr411039 --1441 --
NM_181891chr411039 --1441 --
NM_181892chr411086 --1488 --
NM_181893chr411039 --1441 --
NM_182314chrX2262 178 11615 1439 --
NM_182485chr42821 160 ------
NM_182488chr131161 1105 ----
NM_182492chr22--1333 ----
NM_182493chr1685051 3989 3284 1978 1341 1114 684 463 ------
NM_182503chr694927 4849 4722 4627 4539 4059 1653 1104 993 11093 34697 4546 3779 --
NM_182515chr19125309 5107 4770 4225 1996 1385 838 526 369 358 275 68 ----16700
NM_182529chr7138 ------
NM_182551chr253377 2841 2776 2344 558 1308 --22595 68
NM_182641chr171643 11653 ----
NM_182646chr42821 160 ------
NM_182648chr14------1515
NM_182649chr20----135 --
NM_182663chr142284 1731 1572 272 11594 1474 --
NM_182664chr142414 1861 1702 402 11724 1604 --
NM_182665chr142284 1731 1572 272 11594 1474 --
NM_182666chr32660 589 ------
NM_182700chr741912 567 443 48 ------
NM_182715chr72268 150 --1301 --
NM_182717chr1031552 1134 562 31546 1428 338 ----
NM_182718chr1031147 729 157 21141 1023 ----
NM_182719chr1031147 729 157 21141 1023 ----
NM_182720chr1031552 1134 562 31546 1428 338 ----
NM_182721chr1031552 1134 562 31546 1428 338 ----
NM_182722chr1031552 1134 562 31546 1428 338 ----
NM_182723chr1031552 1134 562 31546 1428 338 ----
NM_182724chr1031147 729 157 21141 1023 ----
NM_182725chr1031147 729 157 21141 1023 ----
NM_182756chr22495 152 ------
NM_182758chr1553356 2806 2733 2451 871 11056 ----
NM_182763chr142272 2179 1829 1759 1516 1448 --
NM_182765chr10--51941 1906 1609 213 105 ----
NM_182769chr1031147 729 157 21141 1023 ----
NM_182770chr1031147 729 157 21141 1023 ----
NM_182771chr1031147 729 157 21141 1023 ----
NM_182772chr1031147 729 157 21141 1023 ----
NM_182796chr51741 ------
NM_182830chr1442149 1823 838 639 --1511 --
NM_182850chr1031147 729 157 21141 1023 ----
NM_182853chr1031552 1134 562 31546 1428 338 ----
NM_182898chr7116438 6255 6080 5694 5684 5076 5025 4549 4539 4475 1605 36134 4903 971 24347 955 25846 1158
NM_182899chr7116438 6255 6080 5694 5684 5076 5025 4549 4539 4475 1605 36134 4903 971 24347 955 25846 1158
NM_182918chr2111353 ------
NM_182920chr341367 1338 1260 1074 ------
NM_182944chr14191 ------
NM_182948chr142694 2503 2056 1127 --12942 --
NM_182970chr20134091 3915 3881 3522 3413 3127 2850 1356 1283 1198 995 510 348 43869 2986 2920 71 ----
NM_182975chr111124 ------
NM_182976chr11245 ------
NM_182977chr521131 104 ------
NM_183004chr1463803 3622 3154 1149 728 335 23554 1267 12575 1159
NM_183011chr1031552 1134 562 31546 1428 338 ----
NM_183012chr1031552 1134 562 31546 1428 338 ----
NM_183013chr1031552 1134 562 31546 1428 338 ----
NM_183060chr1031147 729 157 21141 1023 ----
NM_183360chr2--128 ----
NM_183361chr2--128 ----
NM_183393chr3--1998 ----
NM_183394chr3--1998 ----
NM_183397chr20124769 4529 4494 4281 3313 3274 1607 939 754 704 497 311 ------
NM_183398chr53434 266 210 1535 ----
NM_183399chr53434 266 210 1535 ----
NM_183400chr53434 266 210 1535 ----
NM_183401chr53434 266 210 1535 ----
NM_183416chr131367 1283 537 11889 ----
NM_184234chr20--1338 1735 --
NM_194071chr7115201 4825 4796 4693 4327 4007 2171 1690 1067 1008 521 --13852 21717 1618
NM_194247chr233081 1501 1397 23204 1057 1997 --
NM_194272chr152199 133 ------
NM_194278chr1493586 2949 1630 1255 1018 929 628 423 263 23657 861 11234 --
NM_194285chr1152722 2697 2161 1339 75 22242 1193 ----
NM_194286chr12115754 5534 5323 4613 4086 3791 1292 1259 1071 941 379 2714 536 45566 2342 1777 326 16022
NM_194291chr832947 2812 1024 ----12781
NM_194314chr133791 1986 112 11108 ----
NM_194317chr242657 2347 808 206 11932 ----
NM_194318chr1362278 1592 821 714 372 320 ----11828
NM_194328chr921148 706 23079 2127 ----
NM_194329chr921148 706 23079 2127 ----
NM_194330chr921148 706 23079 2127 ----
NM_194332chr921148 706 23079 2127 ----
NM_194358chr1231357 249 112 11830 ----
NM_194359chr1231357 249 112 11830 ----
NM_194452chr1141258 1107 494 431 2875 796 ----
NM_194453chr1141258 1107 494 431 2875 796 ----
NM_194454chr761481 1433 1276 573 500 312 ------
NM_194455chr761481 1433 1276 573 500 312 ------
NM_194456chr761481 1433 1276 573 500 312 ------
NM_194463chrX1495 ------
NM_197941chr552697 1904 861 636 447 --12449 --
NM_197968chr131538 ------
NM_197970chr21155 --11482 --
NM_198066chr1442954 1115 813 465 ------
NM_198086chr141419 11367 1671 --
NM_198217chr132928 251 ------
NM_198218chr132928 251 ------
NM_198219chr132928 251 ------
NM_198225chr1021840 187 21625 174 ----
NM_198240chr122981 410 ------
NM_198256chr221790 739 11646 ----
NM_198268chr164013 3574 3526 3243 1695 378 --13313 --
NM_198269chr164013 3574 3526 3243 1695 378 --13313 --
NM_198270chrX43402 3368 884 344 ------
NM_198275chr11172 ------
NM_198324chr1241140 461 393 383 146 11042 --
NM_198381chr11--122 ----
NM_198392chr662060 1857 915 670 352 77 1415 11444 --
NM_198395chr51407 ------
NM_198396chr17148 ------
NM_198400chr152976 740 --1290 --
NM_198401chr831278 546 313 1241 ----
NM_198427chr12470 355 ------
NM_198451chrX1650 --1544 --
NM_198465chrX72525 2372 1909 746 664 629 193 12965 11138 1587
NM_198490chr362439 2306 2140 961 493 121 165 13029 --
NM_198504chr33969 611 311 ------
NM_198513chr851597 723 436 256 206 ------
NM_198560chr3113800 3558 3118 2925 2532 516 349 186 157 133 80 --31099 791 260 --
NM_198571chr731208 496 105 11262 ----
NM_198581chr296692 6661 6144 6065 5748 5420 5120 2878 157 ------
NM_198595chr484542 3711 3099 1924 1756 1334 304 79 33225 1818 158 21437 362 --
NM_198686chr1462559 1715 1620 640 577 192 22457 22 12341 --
NM_198715chr185999 5885 5671 4684 4427 4225 1064 707 15915 14912 --
NM_198793chr334148 3984 3115 13069 13530 --
NM_198829chr72264 253 ------
NM_198859chr344491 4206 3227 718 ----14043
NM_198880chr31117 ------
NM_198896chr1131630 1562 1362 2496 36 ----
NM_198903chr5--1469 --170
NM_198904chr532069 1497 299 1469 --170
NM_198956chr741912 567 443 48 ------
NM_198991chr18197 ------
NM_199000chr7--1834 ----
NM_199040chr1263776 3461 3107 2436 1514 193 --13534 --
NM_199131chr1063380 2700 2620 756 562 362 --12908 --
NM_199169chr2073484 3459 3036 2838 2483 1312 1211 23094 2629 22748 734 --
NM_199170chr2073484 3459 3036 2838 2483 1312 1211 23094 2629 22748 734 --
NM_199171chr2073484 3459 3036 2838 2483 1312 1211 23094 2629 22748 734 --
NM_199188chr1233368 2578 1456 ------
NM_199190chr1233368 2578 1456 ------
NM_199192chr24421 390 290 90 ------
NM_199193chr24421 390 290 90 ------
NM_199244chr92827 282 ------
NM_199245chr1242182 681 608 174 1925 --11822
NM_199246chr54249 99 90 38 1224 ----
NM_199262chr1772175 2168 1633 1508 745 336 54 11732 ----
NM_199320chr442482 812 676 25 12292 21108 306 --
NM_199320chr442482 812 676 25 12292 21108 306 --
NM_199324chr4--12591 --12792
NM_199328chr211159 ------
NM_199415chr2082361 2345 2174 1998 1929 1692 197 93 12135 --1249
NM_199420chr3134 ------
NM_199421chr1454903 4814 3842 3448 1167 ------
NM_199424chr1671185 625 466 209 166 151 93 ------
NM_199437chr1132141 63 54 1674 11643 --
NM_199438chr1132141 63 54 1674 11643 --
NM_199439chr1132141 63 54 1674 11643 --
NM_199454chr143572 3302 680 172 14689 14079 --
NM_199461chr1043168 2948 2343 413 11004 --12466
NM_199462chr1104342 4043 3978 3163 1960 1685 1172 917 660 540 13935 ----
NM_199478chrX31702 1436 633 ------
NM_199482chr21172 ------
NM_201263chr112060 --12027 --
NM_201266chr263035 2941 2477 2442 2351 216 22150 1095 22267 946 --
NM_201267chr21394 ------
NM_201274chr17172 ------
NM_201278chr1142397 2022 1544 1493 ------
NM_201279chr263035 2941 2477 2442 2351 216 22150 1095 22267 946 --
NM_201281chr1142397 2022 1544 1493 ------
NM_201413chr21----1363 --
NM_201414chr21----1363 --
NM_201432chr17125968 5896 5478 5357 4990 4410 2360 2269 1217 761 419 341 34018 1451 185 25484 2051 --
NM_201433chr17125968 5896 5478 5357 4990 4410 2360 2269 1217 761 419 341 34018 1451 185 25484 2051 --
NM_201568chr182010 1853 1770 1680 1594 724 665 550 ------
NM_201569chr182010 1853 1770 1680 1594 724 665 550 ------
NM_201632chr581924 1733 1621 1308 717 556 506 156 21246 683 ----
NM_201634chr572023 1832 1720 1407 655 605 255 21345 782 ----
NM_201999chr41774 ------
NM_203283chr42535 401 ------
NM_203284chr42535 401 ------
NM_203301chr1411395 11217 ----
NM_203327chr2054603 3837 3653 390 349 23879 1185 23740 199 --
NM_203329chr11176974 6632 6488 6411 6193 4841 4817 4588 4560 4441 2335 2258 2039 1867 1720 1049 192 66697 6518 5192 4553 2365 1579 --12595
NM_203330chr11176974 6632 6488 6411 6193 4841 4817 4588 4560 4441 2335 2258 2039 1867 1720 1049 192 66697 6518 5192 4553 2365 1579 --12595
NM_203331chr11176974 6632 6488 6411 6193 4841 4817 4588 4560 4441 2335 2258 2039 1867 1720 1049 192 66697 6518 5192 4553 2365 1579 --12595
NM_203339chr831094 122 108 21060 957 ----
NM_203341chr1--1771 1905 --
NM_203342chr143441 2720 852 604 12379 11146 --
NM_203343chr143441 2720 852 604 12379 11146 --
NM_203350chr131725 1671 183 ------
NM_203364chr1121145 424 --11170 --
NM_203370chr3132 ------
NM_203406chr542124 2090 203 139 12801 12038 --
NM_203434chr921077 449 ------
NM_203437chr22180 129 ------
NM_203459chr122139 836 --1121 1196
NM_203487chr131508 ------
NM_203504chr422028 831 ------
NM_203505chr422028 831 ------
NM_203506chr1742148 1451 1383 852 1624 ----
NM_205842chr2--1614 ----
NM_206832chr171216 ------
NM_206853chr643529 2607 1589 1309 22857 543 ----
NM_206854chr624790 3868 24118 1804 ----
NM_206855chr625755 4833 15083 ----
NM_206876chr253560 3163 2924 2581 1002 ------
NM_206907chr542539 827 773 51 2877 163 ----
NM_206909chr877923 7106 7010 6616 2694 2424 2044 --16894 --
NM_206914chr1231891 1655 205 42052 1440 883 69 ----
NM_206927chr112691 603 1168 ----
NM_206928chr112691 603 1168 ----
NM_206929chr112691 603 1168 ----
NM_206930chr112691 603 1168 ----
NM_206937chr13127 ------
NM_206943chr22705 132 --1165 2738 26
NM_206944chr9--1806 ----
NM_206945chr9--1806 ----
NM_206946chr9--1806 ----
NM_206947chr9--1806 ----
NM_207009chr104358 313 78 41 1751 ----
NM_207015chr332123 1914 53 ----11899
NM_207033chr20--11508 ----
NM_207034chr20--11508 ----
NM_207111chr772762 2351 2065 2008 296 103 34 12152 ----
NM_207116chr772762 2351 2065 2008 296 103 34 12152 ----
NM_207119chr1082348 2014 1848 1659 727 642 274 88 173 22341 403 --
NM_207123chr4----1721 --
NM_207325chr1911611 --1707 --
NM_207343chr113470 460 414 ------
NM_207361chr1376256 5899 5066 1810 1540 1349 880 36332 5923 4112 --14860
NM_207406chr442103 1487 1098 89 25398 2578 ----
NM_207520chr24894 661 364 206 ------
NM_207521chr24894 661 364 206 ------
NM_212464chr1541931 805 362 354 11526 1514 --
NM_212467chr1532508 849 348 32103 1812 276 1329 --
NM_212471chr1712015 ------
NM_212472chr1712015 ------
NM_212554chr1021463 1301 --11216 --
NM_213589chr214175 34700 1332 1193 22237 774 --
NM_213606chr1041997 904 740 363 12157 12599 --
NM_213609chr3----1846 --
NM_213648chr581924 1733 1621 1308 717 556 506 156 21246 683 ----
NM_213654chr321357 269 1522 1590 --
NM_213662chr1742359 2265 2046 909 --22229 593 --