TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-27b-3p
miRNA Sequence: UUCACAGUGGCUAAGUUCUGC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr531964 801 431 1468 ----
NM_000052chrX33103 2381 467 23084 3017 ----
NM_000081chr11213 ------
NM_000084chrX96783 5952 5567 4876 4579 2429 2154 1201 889 12003 --1508
NM_000088chr17--11045 ----
NM_000089chr72167 129 ----1797
NM_000109chrX32662 2535 1972 1189 ----
NM_000127chr8199 ------
NM_000138chr1522372 1771 12523 ----
NM_000163chr552178 597 268 230 204 12362 ----
NM_000167chrX21570 149 ----21736 1655
NM_000176chr563615 2891 2723 2669 1233 1039 11317 --1881
NM_000212chr1732328 2088 1783 --1227 --
NM_000216chrX44058 3693 3490 3378 123 ----
NM_000217chr1245235 4594 3994 1205 --24395 1797 11940
NM_000237chr841898 1773 1596 1488 147 --11293
NM_000240chrX4812 730 249 77 1381 --22162 2140
NM_000245chr722129 1400 21949 1416 --11571
NM_000252chrX1961 11476 ----
NM_000264chr943083 1292 612 473 --2914 654 --
NM_000280chr112131 38 ------
NM_000289chr122396 313 ------
NM_000291chrX2617 235 ------
NM_000314chr1083232 3123 2962 2886 2755 387 209 95 11024 ----
NM_000329chr12835 218 ------
NM_000332chr676220 5856 4869 4555 4422 1591 407 16477 16867 --
NM_000346chr1751657 1512 664 460 420 ------
NM_000368chr964024 3906 3483 3128 1673 1221 12946 21344 767 24859 676
NM_000390chrX32268 1208 1116 ----1275
NM_000397chrX52517 2424 1956 1840 689 12432 1336 --
NM_000399chr1031180 1022 842 11119 ----
NM_000408chr233328 374 267 ----12236
NM_000430chr1753730 2721 2516 1013 803 11235 ----
NM_000436chr531330 167 85 ------
NM_000441chr722087 337 12140 ----
NM_000459chr91865 ------
NM_000461chr354512 4045 3959 858 205 --13778 --
NM_000465chr2147 ------
NM_000480chr1161695 1621 1430 1327 505 54 31398 670 98 ----
NM_000489chrX43174 2518 583 540 12395 22312 1180 11045
NM_000492chr71215 11103 ----
NM_000503chr831897 1831 39 21671 288 --1207
NM_000516chr201313 ------
NM_000522chr711061 ----11204
NM_000523chr221122 856 1123 ----
NM_000527chr1942359 2068 1761 845 --12478 --
NM_000531chrX1290 ----1146
NM_000555chrX65702 2634 1788 1645 1545 168 17744 57750 7514 7162 888 594 --
NM_000582chr41389 ------
NM_000618chr1265526 5307 4624 1234 1215 594 34382 2594 2064 --24770 1135
NM_000618chr1265526 5307 4624 1234 1215 594 34382 2594 2064 --24770 1135
NM_000633chr18103850 1877 1782 1712 1371 1351 795 735 541 514 --12059 15251
NM_000641chr1961571 1514 1398 1057 1000 412 21128 598 ----
NM_000663chr1642888 1234 993 412 ----1651
NM_000676chr17------177
NM_000719chr12106123 5916 5536 5320 4267 2532 1960 1636 1292 968 26285 4553 22055 1438 --
NM_000800chr521658 383 --11497 11712
NM_000807chr4192 ------
NM_000809chr433715 1737 726 18125 ----
NM_000813chr575652 4962 1797 1559 843 533 136 11823 ----
NM_000814chr1533336 2767 2739 ----13215
NM_000817chr231203 1097 826 ------
NM_000818chr10187 ------
NM_000824chr42798 75 --2139 45 --
NM_000829chr1142267 2141 924 521 --1486 1342
NM_000831chr186170 5871 4829 4293 1448 1425 1344 209 --26248 1778 --
NM_000842chr11--2670 572 ----
NM_000844chr331081 390 234 ------
NM_000859chr561568 1517 1500 1230 1216 217 167 ----
NM_000868chrX--12550 ----
NM_000875chr1595767 4670 2466 2310 2138 2053 1747 727 422 ----14498
NM_000876chr62948 133 ------
NM_000899chr1243883 1698 1454 1267 13238 1540 1189
NM_000902chr32567 223 1839 11148 22019 1125
NM_000909chr411104 1246 ----
NM_000912chr853533 3152 516 491 318 33311 2656 1231 ----
NM_000926chr11107771 6267 6238 3036 2793 2214 2102 2075 1450 675 58420 8006 7886 6226 3737 47551 1221 795 148 39438 6357 3015
NM_000933chr202631 321 ------
NM_000958chr53487 226 84 11252 ----
NM_000961chr20----23130 850 --
NM_001001395chr121340 11824 ----
NM_001001396chr164478 4162 3309 1633 928 387 ----13017
NM_001001419chr555172 3788 3615 3484 151 11987 2129 78 --
NM_001001420chr555172 3788 3615 3484 151 11987 2129 78 --
NM_001001481chr843449 3201 1074 309 --1530 --
NM_001001521chr21308 ------
NM_001001664chr282493 1253 1228 975 924 852 717 266 --21467 647 13417
NM_001001668chr1954176 3956 3365 3025 483 --34284 3080 1613 23939 3927
NM_001001669chr592610 2489 1846 951 748 697 384 346 323 ----11065
NM_001001701chr422299 1670 --11775 --
NM_001001786chr111163 ------
NM_001001928chr22107112 6900 6349 5660 5567 5472 3309 2169 1152 388 16080 17156 --
NM_001001933chr11540 2630 452 ----
NM_001001971chr101558 ------
NM_001001974chr104855 648 477 245 ------
NM_001002006chr21918 ------
NM_001002243chr21638 2350 279 ----
NM_001002257chr223552 202 --12459 --
NM_001002269chr91492 1127 ----
NM_001002843chr151490 ------
NM_001002860chr1484295 4073 3803 3086 2979 1201 1077 850 ------
NM_001003652chr18158573 8370 7996 7627 6913 6696 6137 3422 3235 2562 2380 2185 1382 343 63 --48343 6502 3367 2786 16960
NM_001003665chr1103517 3250 2941 2803 2454 544 469 425 180 41 23438 2965 32877 409 217 11324
NM_001003674chr18107053 6809 5598 5535 4540 1849 1748 1333 562 418 55653 5298 5112 2554 658 25940 2571 1332
NM_001003675chr18107053 6809 5598 5535 4540 1849 1748 1333 562 418 55653 5298 5112 2554 658 25940 2571 1332
NM_001003679chr112227 ------
NM_001003698chr631269 409 389 1382 ----
NM_001003699chr631269 409 389 1382 ----
NM_001003800chr973059 2881 2635 2301 1190 715 162 23027 2544 ----
NM_001003940chr152248 79 23206 88 1353 1435
NM_001003942chr152248 79 23206 88 1353 1435
NM_001003943chr152252 83 23210 92 1357 1439
NM_001004317chr654061 4047 1809 890 872 33586 3214 2795 24017 1770 1125
NM_001004342chr1126008 5392 4968 4779 4727 4357 1807 1593 1151 663 30 23 25896 2253 34633 3967 1255 --
NM_001004419chr1254495 3557 3506 3427 3081 2940 648 ----
NM_001005158chr32482 171 ------
NM_001005159chr32482 171 ------
NM_001005404chr1723589 205 13809 --11432
NM_001005463chr1032293 1599 906 22642 352 1808 --
NM_001005473chr596596 5658 5131 4717 4662 4400 2175 2050 1945 1688 44558 4421 1572 1491 --
NM_001005609chrX83762 3700 3580 2574 1050 885 755 659 23144 83 22361 575 --
NM_001005753chr251931 582 501 225 84 ------
NM_001005782chr21170 --1376 1420
NM_001006600chr52968 320 ----12132
NM_001006605chr13845 355 238 1276 ----
NM_001006605chr13845 355 238 1276 ----
NM_001006612chrX--1328 ----
NM_001006613chrX--1328 ----
NM_001006614chrX--1328 ----
NM_001006623chr21604 2108 52 --22023 571
NM_001006945chr11711 1175 ----
NM_001007024chr1754221 3310 1572 186 144 --12743 23049 413
NM_001007025chr1754221 3310 1572 186 144 --12743 23049 413
NM_001007075chr421120 939 --1226 --
NM_001007189chr5----142 --
NM_001007226chr1771267 1099 934 504 218 130 110 2526 92 1251 --
NM_001007227chr1771267 1099 934 504 218 130 110 2526 92 1251 --
NM_001007228chr1771267 1099 934 504 218 130 110 2526 92 1251 --
NM_001007229chr1771267 1099 934 504 218 130 110 2526 92 1251 --
NM_001007230chr1771267 1099 934 504 218 130 110 2526 92 1251 --
NM_001007237chr172641 2525 1964 658 553 213 61 --1954 --
NM_001007246chr2131785 1397 67 31825 1700 106 --150
NM_001007279chr221597 ------
NM_001007466chr6115056 4318 4058 3214 1643 1604 1504 977 649 382 253 13829 ----
NM_001007559chr1832095 2038 278 179 21996 658 165
NM_001008220chr573800 3302 1520 1349 1291 1253 1194 23197 2787 ----
NM_001008239chr1853305 3279 2647 2550 59 12832 11499 --
NM_001008391chr11----1253 --
NM_001008392chr383306 3241 2912 2585 1293 1057 714 618 --12228 --
NM_001008408chr7116280 6119 5734 5312 5128 3875 2049 1650 1553 872 740 14428 --145
NM_001008410chr282061 2043 1696 1637 840 733 375 98 --1324 --
NM_001008495chr832167 1960 661 11874 ----
NM_001008540chr2--1142 ----
NM_001008541chr1032055 1806 1686 1521 --12371
NM_001008541chr1032055 1806 1686 1521 --12371
NM_001008564chr1322269 198 1442 ----
NM_001008707chr143565 514 118 11669 172 --
NM_001008708chr2------1483
NM_001008801chr1942132 1747 622 269 ------
NM_001008895chr1311485 2918 102 ----
NM_001008925chr443467 2172 585 389 1127 --151
NM_001008938chr112380 142 ------
NM_001009554chr464776 4221 3310 1494 1235 1108 14637 13865 --
NM_001009554chr464776 4221 3310 1494 1235 1108 14637 13865 --
NM_001009571chr731218 1189 279 --2510 393 --
NM_001009894chr1211317 1118 ----
NM_001009899chr386246 5332 5244 4927 4861 806 644 94 45883 5114 4731 1748 --16000
NM_001009909chr1143898 3397 2736 361 33674 2954 1506 ----
NM_001009958chr7152 ----1193
NM_001009959chr262624 2428 2366 1785 764 247 --1688 --
NM_001009960chr722408 950 ------
NM_001009993chr2114213 4127 3966 3758 3380 3241 2963 1631 1405 182 31 ------
NM_001010853chr6--12551 ----
NM_001010861chr132780 2598 725 12746 1166 11810
NM_001010862chrX63217 2552 2040 1065 981 799 --22339 1313 --
NM_001010867chr1156451 5863 5590 5514 4782 4600 4329 2218 1625 1289 1085 929 608 458 216 --16437 --
NM_001010888chrX43502 2890 2860 144 14016 14601 --
NM_001010927chr61170 ------
NM_001010986chrX22098 1539 21012 278 11904 11726
NM_001010989chr161135 ------
NM_001010990chr161135 ------
NM_001011513chr433271 1162 1015 12822 13286 11485
NM_001011546chr203791 667 531 ------
NM_001011551chrX2417 394 1387 ----
NM_001011553chr721009 392 ----1834
NM_001011663chr101677 11061 1947 --
NM_001011666chr746228 4272 1740 453 25360 1668 ----
NM_001011708chr241813 1147 1083 157 --32953 2372 460 --
NM_001012393chr1185175 4895 4807 4799 3793 3469 588 451 23414 1082 11300 --
NM_001012642chr1542047 2035 96 79 2709 561 1789 11471
NM_001012755chrX114776 3806 3415 3240 1784 1696 1644 1487 1170 538 511 13366 25116 4746 --
NM_001012989chrX1622 1225 1577 --
NM_001013031chr1052937 1309 1260 1203 549 11364 12680 --
NM_001013399chr611098 1987 --1794
NM_001013415chr431550 1119 31 11094 --21386 510
NM_001013620chr12138401 8007 7310 6391 6037 5699 3112 2404 1604 1395 1091 692 388 18282 11839 12263
NM_001013635chr121323 ------
NM_001013659chr1954394 4120 4020 3917 275 1879 1768 --
NM_001014380chr13125860 5663 5502 4693 4430 4089 1870 1826 1064 923 805 622 15355 23771 2029 --
NM_001014797chr10107138 6484 6462 6243 6076 5438 2967 2580 2270 1682 12731 57335 7102 5276 3117 1873 21923 1597
NM_001014812chr152432 97 ------
NM_001015045chr432469 2181 1884 1447 1400 --
NM_001015877chrX22265 932 --12057 --
NM_001015880chr1021621 415 1675 11403 --
NM_001015881chrX31177 1052 782 ----11094
NM_001017371chr2127 ------
NM_001017395chr343472 2880 2675 314 13544 --1443
NM_001017424chr151375 1246 1236 1216 90 --11277 11911
NM_001017425chr151375 1246 1236 1216 90 --11277 11911
NM_001017434chr11161 ------
NM_001017440chr777756 6730 5750 3066 2417 1744 24 --27176 2656 --
NM_001017523chr124660 585 441 398 11806 --11461
NM_001017923chr1411629 ------
NM_001017926chr8----11831 163
NM_001017969chr91103 ----1461
NM_001017977chr11157 ------
NM_001017992chr5----1944 1537
NM_001017995chr51854 --64525 3949 3807 3160 1119 124 --
NM_001017999chr151857 1616 938 450 424 ------
NM_001017999chr151857 1616 938 450 424 ------
NM_001018000chr151857 1616 938 450 424 ------
NM_001018000chr151857 1616 938 450 424 ------
NM_001018001chr151857 1616 938 450 424 ------
NM_001018009chr32262 63 --1217 --
NM_001018065chr986024 5308 4118 3845 2367 2111 762 408 --15679 --
NM_001018066chr986024 5308 4118 3845 2367 2111 762 408 --15679 --
NM_001018067chr143770 3482 3319 505 24295 36 --12096
NM_001018068chr143770 3482 3319 505 24295 36 --12096
NM_001018069chr143770 3482 3319 505 24295 36 --12096
NM_001018072chr124660 585 441 398 11806 --11461
NM_001018074chr563615 2891 2723 2669 1233 1039 11317 --1881
NM_001018075chr563615 2891 2723 2669 1233 1039 11317 --1881
NM_001018076chr563615 2891 2723 2669 1233 1039 11317 --1881
NM_001018077chr563615 2891 2723 2669 1233 1039 11317 --1881
NM_001018090chr1532664 236 198 12607 ----
NM_001018091chr1532774 346 308 12717 ----
NM_001018102chr1532664 236 198 12607 ----
NM_001018108chr1582258 2200 2112 1445 809 498 373 236 ------
NM_001020658chr121320 611 ------
NM_001020658chr121320 611 ------
NM_001024094chr563615 2891 2723 2669 1233 1039 11317 --1881
NM_001024647chr12157688 6576 6552 6122 5995 2960 2883 2245 2097 1239 1202 1166 1117 380 167 --12367 12702
NM_001024649chr54864 773 186 26 1240 11000 --
NM_001024666chrX3679 236 215 ------
NM_001024934chr61572 ------
NM_001024935chr61572 ------
NM_001024936chr61572 ------
NM_001024948chr163136 2906 2830 2647 1051 1036 1151 ----
NM_001024956chr1164541 4304 1901 1376 1216 375 1185 1727 --
NM_001025076chr1085911 3898 1250 1135 1008 776 316 92 31364 981 797 15814 25783 3844
NM_001025077chr10117269 5256 5065 4579 2608 2493 2366 2134 1674 1450 1240 42722 2339 2155 1247 17172 27141 5202
NM_001025105chr561535 1306 590 437 412 312 ----1207
NM_001025107chr142583 2482 2011 483 --22634 2474 --
NM_001025107chr142583 2482 2011 483 --22634 2474 --
NM_001025108chr253888 3553 2607 846 67 22661 2570 24104 892 --
NM_001025252chr82680 580 12018 11272 --
NM_001025253chr82680 580 12018 11272 --
NM_001025266chr353233 1811 1523 1370 710 --1251 --
NM_001025356chr1242899 2397 1061 1027 42565 2484 2215 993 ----
NM_001025366chr621771 1193 1492 ----
NM_001025366chr621771 1193 1492 ----
NM_001025367chr621771 1193 1492 ----
NM_001025367chr621771 1193 1492 ----
NM_001025368chr621771 1193 1492 ----
NM_001025368chr621771 1193 1492 ----
NM_001025369chr621787 1209 1508 ----
NM_001025369chr621787 1209 1508 ----
NM_001025370chr621771 1193 1492 ----
NM_001025370chr621771 1193 1492 ----
NM_001025389chr1161695 1621 1430 1327 505 54 31398 670 98 ----
NM_001025390chr1161695 1621 1430 1327 505 54 31398 670 98 ----
NM_001025580chrX32832 1712 712 24261 1324 11661 1407
NM_001025595chr421617 638 --1247 --
NM_001025780chr91205 1227 --21582 1479
NM_001029858chr643364 1003 959 582 1145 22198 767 1255
NM_001029859chr1162473 2366 2214 1762 535 117 12422 ----
NM_001029875chr531109 450 247 ------
NM_001029884chr642456 1735 582 371 ------
NM_001029989chr151252 1131 ----
NM_001030007chr1653985 3736 2897 1454 65 1416 12606 --
NM_001030055chr1464112 3569 3467 3184 1120 283 --13009 34631 4401 309
NM_001031681chr1712343 22164 899 ----
NM_001031684chr2163 ------
NM_001031695chr2255181 1916 1266 527 229 14765 1259 15293
NM_001031732chr443041 2609 1356 115 --23368 2576 --
NM_001031804chr1674439 3117 3080 1334 832 817 541 --11620 --
NM_001031812chr53701 494 57 ------
NM_001032280chr611590 1320 --1541
NM_001032393chrX2521 219 --1726 --
NM_001032394chr612490 32722 603 275 12773 --
NM_001032395chr612357 32589 470 142 12640 --
NM_001033045chr233438 571 167 23643 2742 ----
NM_001033047chr43730 643 232 1459 ----
NM_001033057chr331624 1381 180 22097 1806 1628 --
NM_001033081chr111878 ------
NM_001033082chr111878 ------
NM_001033085chr22271 89 156 ----
NM_001033087chr2043024 2774 2280 908 22847 70 ----
NM_001033112chr5195 1257 --150
NM_001033117chr3104247 3519 3452 1819 1780 1547 1174 1107 1030 36 14903 24711 1185 --
NM_001033602chr1342348 2124 941 335 1622 11904 --
NM_001034841chr1635292 1894 1695 --15263 14757
NM_001034850chr551606 1507 1476 1151 242 ----1404
NM_001037132chr712266 21716 481 ----
NM_001037133chr712266 21716 481 ----
NM_001037172chr331282 868 481 ------
NM_001037317chr132780 2598 725 12746 1166 11810
NM_001037334chr1862279 861 620 485 304 196 11683 1582 1642
NM_001037339chr121840 1413 --11703 --
NM_001037340chr121840 1413 --11703 --
NM_001037341chr121840 1413 --11703 --
NM_001037341chr121840 1413 --11703 --
NM_001037553chr21104604 4195 4003 3404 3233 3177 1845 1638 1074 883 25133 4710 11118 14084
NM_001037954chr1133388 1265 936 23498 1070 ----
NM_001038493chr211464 21430 1402 ----
NM_001039372chr7--1595 ----
NM_001039538chr243558 809 799 617 22772 2267 ----
NM_001039547chr3108095 7013 6998 6231 5637 5376 2846 2059 1811 1008 27899 2446 17729 --
NM_001039569chr223280 2162 ------
NM_001039577chr184080 3942 1174 621 335 309 158 141 13822 11119 --
NM_001039590chrX42674 2631 1483 35 23387 2552 ----
NM_001039591chrX42674 2631 1483 35 23387 2552 ----
NM_001039618chr1134951 4016 2262 34335 1293 1058 12151 --
NM_001039840chrX55975 4079 3975 3910 90 35904 5079 3931 11912 --
NM_001039937chr1344073 1229 876 70 --13213 --
NM_001040058chr41389 ------
NM_001040060chr41389 ------
NM_001040100chr32196 76 ------
NM_001040110chr721218 243 1433 --11720
NM_001040113chr162957 652 ------
NM_001040135chr7----1547 --
NM_001040142chr2129 1409 ----
NM_001040143chr2129 1409 ----
NM_001040151chr1153858 3823 2779 1471 778 14483 13186 --
NM_001040152chr753674 3618 1817 1220 1032 24566 3119 --13100
NM_001040153chr131961 --1224 --
NM_001040159chr431246 1168 541 ------
NM_001040202chr452171 1930 892 796 508 ------
NM_001040284chr1645634 3626 1961 497 --11133 21998 1838
NM_001040402chr433127 2584 165 11959 1246 13072
NM_001040424chr2173001 2777 2690 2543 2200 891 789 22613 2561 --12922
NM_001040429chr1331085 447 440 ------
NM_001040446chr532526 907 629 ----22439 23
NM_001040624chr842724 2532 2477 346 1565 1717 1859
NM_001040625chr842724 2532 2477 346 1565 1717 1859
NM_001040626chr842724 2532 2477 346 1565 1717 1859
NM_001040627chr842724 2532 2477 346 1565 1717 1859
NM_001040628chr842724 2532 2477 346 1565 1717 1859
NM_001040629chr842724 2532 2477 346 1565 1717 1859
NM_001040630chr842724 2532 2477 346 1565 1717 1859
NM_001040633chr72911 257 ------
NM_001040665chr734866 4482 681 ----23828 3671
NM_001040666chr72568 184 ------
NM_001040708chr831152 288 273 --1990 --
NM_001040876chr411632 21909 1547 ----
NM_001042355chr1664859 3848 3764 3537 1212 315 25374 1148 --15061
NM_001042406chr62360 328 --1852 11233
NM_001042412chr1664859 3848 3764 3537 1212 315 25374 1148 --15061
NM_001042413chr973764 3672 2970 1560 1323 887 739 12795 11145 --
NM_001042414chr131224 ----1260
NM_001042424chr483248 3234 2968 2680 2444 2208 1278 1111 --1496 --
NM_001042425chr611590 1320 --1541
NM_001042473chr10293 65 21956 1846 1361 --
NM_001042479chrX32113 605 536 --11888 --
NM_001042480chrX32113 605 536 --11888 --
NM_001042481chr1461834 919 665 627 617 132 12573 ----
NM_001042510chr831910 487 274 1710 ----
NM_001042511chr831910 487 274 1710 ----
NM_001042537chrX21997 1013 1596 --2166 52
NM_001042550chr951445 701 210 203 102 ----11351
NM_001042599chr2107466 7395 7349 6684 5797 5077 4782 2435 1969 968 47069 6349 5608 2122 27418 4764 11216
NM_001042603chr1285154 5103 4352 3781 2041 1710 1536 163 ------
NM_001042604chr374803 4481 3426 1200 991 183 171 34074 3607 566 11695 --
NM_001042681chr11350 129 1586 1619
NM_001042682chr11350 129 1586 1619
NM_001042682chr11350 129 1586 1619
NM_001042749chrX41496 748 540 25 11745 ----
NM_001042750chrX41496 748 540 25 11745 ----
NM_001042751chrX41496 748 540 25 11745 ----
NM_001042784chr4149 ------
NM_001043318chr1464017 3938 3705 3093 191 138 ------
NM_001044385chr263429 3154 3147 1442 738 157 32823 2808 1499 23741 1274 11225
NM_001044722chr53701 494 57 ------
NM_001044723chr53701 494 57 ------
NM_001046chr521901 240 12445 22605 2341 --
NM_001077628chr12731 511 --1699 --
NM_001096chr171237 1703 ----
NM_001099678chr356020 5175 4242 1921 808 35850 210 23 15221 --
NM_001100108chr1118155 8094 6660 6461 6411 5886 3049 2531 1441 1245 977 --37499 7406 6953 28260 7806
NM_001106chr3178989 7522 7333 7029 6129 3821 3714 3266 2972 2879 2859 2702 2383 2023 1552 1175 366 57791 6656 2035 1710 268 19596 --
NM_001111chr142583 2482 2011 483 --22634 2474 --
NM_001113490chrX53484 3322 3116 2371 605 --13584 --
NM_001128chr1653985 3736 2897 1454 65 1416 12606 --
NM_001149chr1031429 1268 1179 ------
NM_001151chr4166 ------
NM_001166chr111457 ------
NM_001167chrX35540 4989 4454 36754 6641 2551 --16598
NM_001173chr1464112 3569 3467 3184 1120 283 --13009 34631 4401 309
NM_001174chrX12061 ------
NM_001200chr201881 ------
NM_001201chr431512 1404 1338 11502 --13889
NM_001204chr257065 5573 1862 1822 1314 --26032 1206 16063
NM_001218chr1542188 1968 924 251 --32658 2275 591 1263
NM_001232chr121139 1057 ------
NM_001254chr171816 ----1897
NM_001256chr1722372 760 12814 ----
NM_001259chr742090 1522 461 282 35397 1406 88 24113 3923 14313
NM_001270chr52874 380 ------
NM_001271chr1583110 2832 2558 1184 915 744 605 275 23158 2530 1784 --
NM_001288chr61192 ------
NM_001289chrX31599 603 35 ------
NM_001304chr1723707 2894 2822 145 11248 1705
NM_001310chr1252393 2262 2040 540 256 1563 11107 11148
NM_001326chr111301 ------
NM_001329chr1051338 1029 494 399 233 ------
NM_001346chr322068 830 2768 601 12630 12093
NM_001356chrX52512 2447 311 280 113 ------
NM_001358chr4--1367 ----
NM_001364chr1154218 4049 4010 3564 1718 1768 14132 --
NM_001386chr842105 1508 975 114 --22278 2272 1127
NM_001387chr573139 3085 3070 689 532 492 103 ------
NM_001389chr21--1380 ----
NM_001390chr1853611 3096 1189 681 96 ----22997 894
NM_001399chrX83762 3700 3580 2574 1050 885 755 659 23144 83 22361 575 --
NM_001401chr921391 450 ------
NM_001412chrX53091 2532 1310 503 389 12494 ----
NM_001418chr11126 --1755 --
NM_001418chr11126 --1755 --
NM_001419chr1984876 4697 4310 3022 3001 1821 1772 1346 24437 1423 ----
NM_001427chr732047 1647 112 ----22064 407
NM_001429chr2231110 759 129 1287 ----
NM_001438chr173517 3501 3132 2553 2459 2419 1431 ----1631
NM_001448chrX2273 187 --1344 --
NM_001452chr6----1558 --
NM_001453chr631168 1091 600 ------
NM_001463chr2----1222 --
NM_001482chr15----1648 --
NM_001483chr75942 780 124 71 39 --1192 --
NM_001491chr651988 1748 875 429 65 ----1166
NM_001497chr982727 2715 2670 2569 1094 873 530 52 ------
NM_001542chr172641 2525 1964 658 553 213 61 --1954 --
NM_001543chr5104589 4392 4132 3141 2968 1163 1002 881 737 309 34170 126 35 ----
NM_001546chr621441 364 1252 ----
NM_001584chr1121045 98 --11192 1204
NM_001604chr112131 38 ------
NM_001609chr1034326 3104 1574 ------
NM_001614chr171688 ------
NM_001614chr171688 ------
NM_001616chr252827 1205 967 910 682 22807 492 ----
NM_001622chr31255 --1299 --
NM_001629chr131270 ------
NM_001642chr1141202 1181 1073 928 21313 1046 --11055
NM_001650chr1843668 3567 1582 1032 24138 3703 14091 1188
NM_001656chr531849 1724 1590 ----21561 710
NM_001660chr31656 ------
NM_001663chr1412726 12231 12689 --
NM_001664chr3--1316 ----
NM_001679chr3--1747 --2809 783
NM_001681chr12----1634 --
NM_001684chr164195 3879 3026 1350 645 104 ----12734
NM_001690chr342407 568 438 101 32604 418 197 32133 1755 24 --
NM_001693chr82490 143 134 ----
NM_001695chr854255 4013 905 543 326 ------
NM_001701chr911364 ------
NM_001709chr1142693 2601 2456 962 2945 676 --1317
NM_001730chr1311532 ------
NM_001730chr1311532 ------
NM_001731chr122872 212 2799 112 1643 --
NM_001742chr711640 31282 216 110 ----
NM_001745chr511178 ------
NM_001746chr54864 773 186 26 1240 11000 --
NM_001753chr741721 1703 1608 1196 --11422 --
NM_001788chr721009 392 ----1834
NM_001792chr1811121 ------
NM_001797chr16134 ----1176
NM_001801chr51217 1461 ----
NM_001806chr1932918 1145 431 12379 12339 --
NM_001850chr31144 ------
NM_001858chr6114869 4802 4435 4329 3379 3161 1809 1649 785 312 85 23271 1525 ----
NM_001859chr944014 3429 3302 846 13157 22898 1178 --
NM_001875chr2------11093
NM_001892chr561535 1306 590 437 412 312 ----1207
NM_001901chr61151 ------
NM_001902chr1--2354 37 ----
NM_001903chr51804 ------
NM_001904chr321036 820 --1343 --
NM_001931chr112313 187 ----1866
NM_001938chr141903 1416 419 153 1390 11940 --
NM_001939chrX73537 3327 2997 2700 2688 2361 963 13454 23819 2778 --
NM_001945chr5--1402 --1504
NM_001949chr673205 1254 1157 845 751 579 336 --12046 --
NM_001951chr8141 1492 ----
NM_001964chr5----1819 --
NM_001967chr33391 168 68 ------
NM_001968chr41762 ------
NM_001969chr1453242 3151 3006 1487 1061 --2553 139 12398
NM_001973chr11329 1434 1113 --
NM_001977chr41126 2313 32 ----
NM_001999chr531455 1144 948 ------
NM_002015chr1333017 2366 238 23348 2546 1432 --
NM_002024chrX11393 ------
NM_002025chrX88498 8212 6915 5653 3513 1757 1392 335 11805 28817 1898 11224
NM_002040chr2132923 2810 244 1152 --12386
NM_002048chr92488 83 ----11126
NM_002069chr721873 1749 ----11743
NM_002106chr4--190 1287 --
NM_002114chr61192 ------
NM_002119chr682642 2316 1688 1618 393 283 103 60 32232 818 407 11861 --
NM_002136chr122518 180 2220 76 ----
NM_002137chr742386 2171 838 521 1182 --1219
NM_002139chrX2156 100 ------
NM_002140chr9--21153 807 --1338
NM_002158chr221507 225 13175 23204 2585 --
NM_002166chr2--1489 1201 --
NM_002202chr51741 ----1178
NM_002210chr243579 3404 2290 887 12684 ----
NM_002214chr73846 369 351 14607 24083 2279 --
NM_002222chr321312 359 ------
NM_002223chr1273507 3399 3032 944 423 407 165 --13606 --
NM_002233chr112497 354 ------
NM_002241chr133063 1972 1191 1829 --22428 545
NM_002247chr1041884 1779 316 23 22361 2349 ----
NM_002253chr43950 555 180 ------
NM_002264chr395053 4580 3712 3514 1352 1249 1027 931 183 13441 ----
NM_002265chr1731094 1066 397 ----1879
NM_002267chr1342244 1936 1846 786 21553 368 22138 1518 12034
NM_002270chr575224 5110 4742 4446 2047 1150 320 21631 669 34962 4614 3625 11694
NM_002285chr253888 3553 2607 846 67 22661 2570 24104 892 --
NM_002293chr1150 --1437 12650
NM_002310chr596179 4759 2625 2349 1309 1235 833 696 234 36359 1683 96 25536 2103 15931
NM_002336chr1253071 1921 1547 1249 654 11617 --24187 1353
NM_002345chr121625 1641 ----
NM_002349chr221564 1259 ------
NM_002351chrX21326 492 1331 ----
NM_002358chr42596 138 --1253 --
NM_002374chr243558 809 799 617 22772 2267 ----
NM_002381chr2--1651 --1245
NM_002401chr1772418 2394 2240 1941 1818 773 627 1100 --22428 2093
NM_002402chr7----11231 --
NM_002408chr141546 ------
NM_002427chr1111162 1110 11019 --
NM_002444chrX31854 718 83 11800 ----
NM_002445chr841639 1619 377 104 11660 ----
NM_002460chr623241 2862 --1121 1444
NM_002481chr187998 5741 4991 2860 1388 1195 785 235 37816 1530 290 11159 --
NM_002486chr942515 2063 1886 247 ------
NM_002487chr152565 176 2720 50 ----
NM_002500chr22446 43 ------
NM_002515chr1441969 1926 1689 1382 --21616 821 1561
NM_002519chr1141420 1195 330 280 ------
NM_002527chr121209 ------
NM_002539chr21305 ------
NM_002545chr1185175 4895 4807 4799 3793 3469 588 451 23414 1082 11300 --
NM_002546chr81297 ------
NM_002556chr1141796 1512 581 75 ----1475
NM_002576chr1151153 1011 420 42 27 ------
NM_002577chr343644 1589 868 217 ----13049
NM_002581chr964380 3893 3738 1456 592 557 --15019 --
NM_002583chr121606 ------
NM_002591chr201546 ------
NM_002592chr201241 ------
NM_002595chr1241792 1735 1412 788 11401 ----
NM_002600chr121840 1413 --11703 --
NM_002610chr232479 2408 1929 22105 613 22727 2708 --
NM_002613chr16204807 4753 4628 4342 4156 3593 3312 1894 1841 1751 1727 1698 1508 630 619 594 552 447 400 384 14565 14996 --
NM_002628chr32935 917 --1997 --
NM_002641chrX21294 670 21943 815 --11239
NM_002643chr21198 ------
NM_002645chr111395 --12877 --
NM_002655chr874126 4087 3419 3350 982 927 45 1420 14571 --
NM_002667chr6--1123 ----
NM_002703chr451952 1941 1576 1463 580 1772 11718 11917
NM_002706chr22550 27 ------
NM_002709chr233113 1386 753 --23380 1400 --
NM_002716chr1143224 2483 838 699 --22980 785 1299
NM_002718chr312586 157 --1659
NM_002719chr1451964 1894 1668 653 357 ------
NM_002731chr153139 2862 2490 1124 1107 ------
NM_002737chr1786182 6138 5820 5189 2004 1848 1796 1351 1341 ----
NM_002742chr143591 284 195 ----2241 35
NM_002745chr22114426 4137 4061 3911 3745 3382 2905 2876 1337 1266 879 13976 1731 11275
NM_002748chr152970 872 ------
NM_002757chr151362 ------
NM_002814chrX3493 281 272 ------
NM_002829chr941309 1268 994 99 11239 ----
NM_002834chr1221541 303 --13640 --
NM_002836chr20182 ------
NM_002843chr11113241 3230 2207 2201 1172 842 453 417 368 269 120 21074 187 22982 2243 --
NM_002845chr18--1694 ----
NM_002848chr1221317 1164 1928 21326 1172 11210
NM_002849chr121132 1417 ----
NM_002851chr72650 247 ------
NM_002857chr172684 2182 1729 791 678 221 137 1206 ----
NM_002869chr1122040 1556 --11546 --
NM_002886chr364875 4779 4728 4220 3571 1380 43899 1590 1086 842 ----
NM_002890chr51411 1987 ----
NM_002892chr1421591 261 11277 --31584 682 562
NM_002897chr2181 ------
NM_002902chr152218 66 ------
NM_002912chr63869 692 664 --1655 --
NM_002924chr1167 ------
NM_002940chr411632 21909 1547 ----
NM_002941chr311143 ------
NM_002942chr33411 385 170 ------
NM_002955chr631269 409 389 1382 ----
NM_002956chr1221290 71 ------
NM_002959chr174371 4157 3557 2713 1416 812 64 11724 ----
NM_002977chr253253 3001 2371 873 700 136 ----
NM_002994chr431844 1677 532 31620 1544 398 ----
NM_002998chr832074 2030 1505 22189 207 21754 1689 --
NM_003010chr1732051 1678 236 --32211 1588 288 12185
NM_003011chr951446 1215 1147 416 287 --1606 --
NM_003017chr61932 1440 ----
NM_003034chr1286067 5513 5472 3063 2044 1795 1176 685 48144 6950 2503 915 2955 559 --
NM_003042chr321694 1548 1632 11933 11943
NM_003043chr353643 1619 592 428 137 13102 23950 2757 --
NM_003045chr1384964 4807 4662 1049 892 814 393 246 11653 23163 1091 13451
NM_003054chr101279 ------
NM_003060chr521121 1060 11279 ----
NM_003070chr91319 --1205 --
NM_003072chr191169 ------
NM_003074chr312157 1596 11961 --
NM_003079chr171968 1186 ----
NM_003081chr201983 21170 925 21109 360 1121
NM_003095chr12--177 ----
NM_003100chr51429 ------
NM_003108chr297325 6618 5335 5093 4565 4549 1325 1005 324 56929 6240 6058 5585 1779 --24460 757
NM_003111chr2127 ------
NM_003128chr272692 2656 2459 2088 858 290 283 --12054 --
NM_003144chr62723 140 31700 1684 716 --1634
NM_003151chr21176 ------
NM_003155chr832535 2292 79 ----1732
NM_003161chr1753319 2811 1057 684 342 12405 22227 1006 12457
NM_003178chr392243 2092 1921 822 647 483 264 225 129 ------
NM_003182chr73515 444 148 ------
NM_003182chr73515 444 148 ------
NM_003188chr63722 288 216 --2663 266 --
NM_003199chr1865669 3835 2158 1931 1141 1091 11035 23810 2021 1316
NM_003211chr1241481 1354 1316 554 ----11293
NM_003220chr611590 1320 --1541
NM_003236chr253495 2879 2742 2609 1367 --137 --
NM_003246chr1511791 --1330 --
NM_003257chr1541270 1258 251 199 ------
NM_003262chr344090 3764 3266 874 25094 1056 24905 1739 24962 1394
NM_003269chr6--11287 ----
NM_003270chrX1341 163 --1394
NM_003274chr2162850 2709 704 649 496 183 22365 2314 159 12250
NM_003286chr201984 128 ----
NM_003292chr1--22195 2131 12183 128
NM_003298chr3125251 5166 4621 4011 3952 2383 1766 1296 928 589 488 466 46021 2123 624 524 11113 --
NM_003300chr141102 ------
NM_003315chr17--1228 ----
NM_003320chr1164450 4347 4116 693 632 373 22947 63 33678 3229 2885 --
NM_003338chr101536 1489 1183 11695
NM_003341chr31676 1564 ----
NM_003342chr1753218 3056 3001 2933 752 11295 12955 --
NM_003348chr1261620 1605 1332 1202 1046 612 1225 --1299
NM_003350chr81750 1870 ----
NM_003352chr21170 --1376 1420
NM_003369chr1192645 2562 2033 838 806 649 470 460 77 ------
NM_003371chr92546 81 32020 1845 1727 2575 527 --
NM_003374chr5----1336 --
NM_003375chr102296 288 --166 --
NM_003376chr621771 1193 1492 ----
NM_003376chr621771 1193 1492 ----
NM_003387chr232627 2374 187 11128 ----
NM_003390chr111998 --2259 35 2455 133
NM_003392chr393577 3548 3081 3053 1612 1601 1058 308 157 13944 --12952
NM_003404chr2021901 249 11939 2437 280 --
NM_003405chr221223 ------
NM_003406chr861925 1668 555 443 408 285 1494 ----
NM_003410chrX52981 2397 2345 693 109 ------
NM_003411chrY3699 240 104 11135 ----
NM_003412chr321020 444 13118 --13064
NM_003413chrX11652 1474 1555 --
NM_003442chr111203 ------
NM_003458chr394030 3974 3077 1551 1535 1512 1142 996 556 33946 3011 52 14014 --
NM_003467chr2--1142 ----
NM_003470chr1651779 1671 1451 653 511 ------
NM_003473chr104903 785 402 313 ------
NM_003477chr111785 ----1634
NM_003478chr111850 13097 ----
NM_003483chr1252927 2317 1074 453 410 12265 ----
NM_003489chr2143091 2963 1327 898 23106 2573 1250 --
NM_003558chr92702 628 ----1231
NM_003563chr1771267 1099 934 504 218 130 110 2526 92 1251 --
NM_003566chr1273312 3286 3272 3057 2992 1063 176 21253 461 ----
NM_003574chr1885045 3998 3531 1550 1535 1503 895 521 45087 4845 4625 1117 ----
NM_003583chr1273767 3740 3700 2795 2526 904 862 13542 ----
NM_003589chr1311485 2918 102 ----
NM_003590chr253008 2565 1083 985 403 ------
NM_003592chr72520 24 ------
NM_003597chr252186 1543 1400 918 698 ------
NM_003599chr6--167 ----
NM_003603chr452146 2061 771 428 165 ------
NM_003613chr15--1203 154 --
NM_003615chr343223 2857 1033 446 11398 1643 13942
NM_003617chr144911 1847 1637 32 --1778 --
NM_003618chr22841 124 1250 11251 --
NM_003620chr171404 --1287 --
NM_003621chr113476 123 52 ------
NM_003622chr1251811 1724 1033 550 239 ------
NM_003626chr1121189 1103 ------
NM_003629chr183401 3324 3070 1344 1203 1162 763 468 33229 2415 119 ----
NM_003630chr61661 ------
NM_003633chr562371 2121 2100 1783 272 248 12223 21710 470 --
NM_003642chr22271 89 156 ----
NM_003644chr1776079 5360 4945 4518 4126 2219 249 24101 1919 ----
NM_003663chr373489 3061 2699 2632 2218 343 64 --123 --
NM_003671chr953218 2398 405 319 300 1589 ----
NM_003672chr1--11680 --1342
NM_003679chr142893 2427 905 41 --13290 --
NM_003692chr91409 1762 --1634
NM_003713chr151589 1502 1079 342 319 --1463 --
NM_003718chr7------1502
NM_003743chr221874 1426 11484 ----
NM_003749chr134529 314 219 123 1141 12276 --
NM_003758chr1521622 325 ----1493
NM_003758chr1521622 325 ----1493
NM_003759chr453815 3398 3079 2932 522 --14237 --
NM_003772chr11240 33 1104 ----
NM_003774chr1223316 1284 3953 744 119 --11038
NM_003787chr1821553 1117 --21432 1426 11466
NM_003794chr321125 140 ------
NM_003795chr61391 ------
NM_003796chr19--1202 ----
NM_003799chr1864550 4486 3640 3121 1793 162 23487 1263 1700 --
NM_003800chr612408 21859 621 3875 367 96 12193
NM_003858chr141231 ----1673
NM_003862chr51117 ------
NM_003872chr2103012 2641 2054 2014 1105 963 777 355 298 236 --22973 559 --
NM_003884chr311750 11624 ----
NM_003885chr1772680 2587 2187 2043 1856 811 549 12248 12527 --
NM_003887chr242111 1862 843 564 1612 ----
NM_003895chr2131832 1633 1620 22195 2053 11732 --
NM_003902chr12282 35 ------
NM_003913chr611017 11284 1675 --
NM_003922chr152343 182 ------
NM_003924chr451337 1329 381 336 296 21566 612 ----
NM_003927chr181732 --1385 --
NM_003930chr7--12429 11635 11667
NM_003931chr61572 ------
NM_003941chr721736 210 32181 247 66 12268 --
NM_003958chr683924 3703 3364 3205 3111 2968 2751 2454 23907 434 --11286
NM_003966chr567760 7391 2442 1341 516 242 36942 6898 2416 1610 --
NM_003968chr32705 466 ------
NM_003994chr1243883 1698 1454 1267 13238 1540 1189
NM_004006chrX32662 2535 1972 1189 ----
NM_004007chrX32662 2535 1972 1189 ----
NM_004009chrX32662 2535 1972 1189 ----
NM_004010chrX32662 2535 1972 1189 ----
NM_004011chrX32662 2535 1972 1189 ----
NM_004012chrX32662 2535 1972 1189 ----
NM_004013chrX32662 2535 1972 1189 ----
NM_004014chrX32662 2535 1972 1189 ----
NM_004015chrX32662 2535 1972 1189 ----
NM_004016chrX32576 2449 1886 1103 ----
NM_004017chrX32662 2535 1972 1189 ----
NM_004018chrX32576 2449 1886 1103 ----
NM_004019chrX1374 ------
NM_004020chrX32662 2535 1972 1189 ----
NM_004021chrX32576 2449 1886 1103 ----
NM_004022chrX32576 2449 1886 1103 ----
NM_004023chrX32576 2449 1886 1103 ----
NM_004028chr1843668 3567 1582 1032 24138 3703 14091 1188
NM_004087chr32406 271 ------
NM_004089chrX31177 1052 782 ----11094
NM_004093chr1352873 652 347 249 222 12315 --12539
NM_004096chr1032019 1646 618 11926 ----
NM_004099chr91104 21982 1502 ----
NM_004100chr652657 2301 2231 1767 746 1241 31928 952 514 22174 1816
NM_004109chr1122366 801 ------
NM_004114chrX2957 446 --1868 1861
NM_004115chr13123 ------
NM_004124chr1463503 3278 3107 1409 793 256 23441 762 1333 --
NM_004133chr832114 521 257 11786 22687 340 12570
NM_004136chr1553256 2886 657 435 366 --1734 --
NM_004161chr2----11299 --
NM_004170chr911526 ------
NM_004171chr1179002 2622 1698 1033 668 178 151 49619 8293 2299 1329 --28444 6745
NM_004200chr1162892 2639 1295 886 567 537 1631 ----
NM_004210chr1042147 1762 1490 367 ----12155
NM_004229chrX11937 --1407 --
NM_004232chr1841164 1155 905 853 1638 1319 --
NM_004235chr93355 206 142 --1665 --
NM_004241chr101177 1258 ----
NM_004274chr143915 470 192 ------
NM_004275chr62411 136 1606 --11431
NM_004282chr6--2258 161 --1621
NM_004287chr1762310 1571 1027 825 170 138 --22342 756 1118
NM_004293chr933825 2342 477 --22781 803 --
NM_004321chr2143542 3443 3400 3335 3227 3139 2737 2480 2328 1142 1014 845 189 171 ------
NM_004323chr982434 1764 1727 631 389 209 165 22 --1510 --
NM_004330chr1521193 1116 ------
NM_004331chr832281 2020 938 140 12323 --
NM_004338chr18107053 6809 5598 5535 4540 1849 1748 1333 562 418 55653 5298 5112 2554 658 25940 2571 1332
NM_004342chr711567 22180 240 --12259
NM_004360chr1611942 ------
NM_004370chr621699 399 ----12151
NM_004379chr211576 ----2491 171
NM_004380chr1652596 2548 887 509 471 12485 ----
NM_004384chr53701 494 57 ------
NM_004396chr17154 ------
NM_004397chr1153680 3584 945 210 45 11549 11680 --
NM_004412chr1041979 1470 1355 975 24369 333 --15871
NM_004430chr842734 1761 840 603 11971 12705 12570
NM_004432chr932246 958 337 --11969 --
NM_004434chr143565 514 118 11669 172 --
NM_004440chr611303 --11370 --
NM_004454chr332290 880 873 11670 ----
NM_004458chrX42492 2330 2246 228 1594 ----
NM_004459chr1742010 1828 1371 236 ------
NM_004480chr141310 --1802 --
NM_004481chr182508 2030 1855 1721 905 879 798 160 21967 917 ----
NM_004482chr22809 689 --154 --
NM_004504chr222320 132 42881 2798 877 194 11031 --
NM_004505chr172579 281 --12004 --
NM_004514chr17102960 2655 2620 2047 899 720 322 293 94 40 12602 ----
NM_004538chrX3745 705 289 1328 ----
NM_004571chr2133046 1036 355 53433 3285 3022 2480 2102 1253 --
NM_004577chr72536 454 ------
NM_004582chr11109 ------
NM_004583chr17----1577 --
NM_004588chr1173976 3783 3653 2667 1433 545 452 ----1689
NM_004595chrX------196
NM_004600chr1----21221 443 --
NM_004602chr2071463 1167 1000 250 201 185 169 ------
NM_004612chr954194 3900 3017 938 313 34737 3740 1055 11623 --
NM_004615chrX3954 769 711 2728 212 --1945
NM_004622chr252443 2024 1569 1539 342 11585 1500 --
NM_004626chr11--1102 ----
NM_004630chr111110 ------
NM_004654chrY21245 356 ------
NM_004660chrY3278 112 77 --1310 --
NM_004670chr1021621 415 1675 11403 --
NM_004686chr821442 363 --21484 591 --
NM_004687chr1752068 2054 1800 1581 830 3814 728 544 11322 1778
NM_004703chr1742478 2445 1996 151 --21894 603 --
NM_004709chrX51373 1160 337 244 68 11248 ----
NM_004713chr141718 ------
NM_004719chr1221816 264 12069 190 --
NM_004726chrX95204 4993 4724 4573 4264 3847 534 110 98 25705 4956 25646 172 --
NM_004741chr1031150 448 343 1279 ----
NM_004745chr876741 6713 4536 1244 1011 592 362 --24921 1195 --
NM_004755chr142996 976 --1348 1188
NM_004768chr11411 ------
NM_004788chr1111020 12064 ----
NM_004796chr1432367 1541 958 22187 414 ----
NM_004800chr13170 --1201 --
NM_004801chr21599 ------
NM_004815chr164800 3725 3233 1857 1224 55 2238 68 11793 --
NM_004822chr1773797 3603 3206 3006 2540 2489 1374 1729 --1442
NM_004831chr1931074 845 379 1188 1874 --
NM_004844chr32262 63 --1217 --
NM_004856chr15----1386 --
NM_004857chr1434592 3698 3247 21076 478 ----
NM_004859chr1763010 2378 2037 1053 794 701 22027 296 --1912
NM_004863chr1481895 1789 1751 922 591 90 62 53 34424 1952 283 15309 --
NM_004865chr6--1352 ----
NM_004867chrX2632 615 ------
NM_004871chr1754221 3310 1572 186 144 --12743 23049 413
NM_004874chr8----1420 --
NM_004896chr1011556 ------
NM_004897chr101905 --1303 --
NM_004904chr746228 4272 1740 453 25360 1668 ----
NM_004929chr82505 55 11002 --11253
NM_004937chr1712708 12529 ----
NM_004956chr743355 3171 1063 170 ----11323
NM_004965chr211519 2572 526 ----
NM_004966chr10--1115 --1972
NM_004985chr1264316 3802 1748 1153 1054 935 24468 228 12880 1313
NM_004992chrX97620 6962 6070 5356 3257 1946 1914 1638 883 35787 3348 1460 27769 7097 --
NM_004992chrX97620 6962 6070 5356 3257 1946 1914 1638 883 35787 3348 1460 27769 7097 --
NM_005010chr712266 21716 481 ----
NM_005011chr721218 243 1433 --11720
NM_005016chr12--1369 ----
NM_005025chr31201 ------
NM_005028chr1022264 1718 11946 11958 1458
NM_005036chr22107112 6900 6349 5660 5567 5472 3309 2169 1152 388 16080 17156 --
NM_005045chr75840 798 760 688 232 199 --1164
NM_005054chr231205 648 505 ----21541 355
NM_005056chr12115398 5347 4596 4025 3471 3433 1954 1780 407 146 68 ------
NM_005063chr1083862 3793 3743 3387 3371 2777 1015 398 ------
NM_005065chr1445092 3955 677 378 34020 1716 723 14630 13868
NM_005066chr12637 308 ------
NM_005068chr631436 1335 1258 --1330 --
NM_005078chr1531500 1215 424 1444 --11309
NM_005079chr82680 580 12018 11272 --
NM_005095chr132109 1561 850 2746 137 1462 153
NM_005105chr142099 462 299 88 ----1231
NM_005114chr41223 --1473 --
NM_005116chr2064328 4160 4117 3769 1341 149 34539 1225 1041 ----
NM_005121chr174766 703 100 21 1281 33769 3398 1262 12768
NM_005126chr32315 217 11883 21830 1733 1868
NM_005151chr1862279 861 620 485 304 196 11683 1582 1642
NM_005156chr975181 5157 4274 3985 3854 1119 1028 11885 11315 --
NM_005159chr1532192 2015 691 11664 ----
NM_005180chr1011385 1396 --1489
NM_005184chr1931564 566 479 21582 1514 ----
NM_005188chr11187374 7320 7091 6432 6253 3063 2962 2479 2281 1900 1420 1336 947 720 425 404 386 121 13044 1502 --
NM_005190chr611098 1987 --1794
NM_005197chr1496182 5623 4844 4256 3941 2354 1063 898 327 14924 45480 4635 4541 2283 --
NM_005203chr101283 ------
NM_005204chr104822 678 286 126 ------
NM_005229chrX1112 ------
NM_005230chr12------193
NM_005233chr342438 2118 1871 1756 144 ----
NM_005235chr2107466 7395 7349 6684 5797 5077 4782 2435 1969 968 47069 6349 5608 2122 27418 4764 11216
NM_005238chr1163565 3277 3053 2920 2485 161 ------
NM_005243chr223315 269 249 ------
NM_005254chr15--2294 182 ----
NM_005257chr181567 --1540 1942
NM_005259chr211260 171 ----
NM_005277chr441740 1545 1387 689 --1743 11408
NM_005296chrX1384 ------
NM_005302chr71374 --1403 --
NM_005324chr1741865 1751 840 63 --1396 --
NM_005328chr83506 255 69 1738 ----
NM_005342chrX52740 2087 1766 1022 465 2613 28 22502 513 --
NM_005358chr1331651 1579 202 ----11479
NM_005359chr1866500 4218 2111 1778 1480 983 14488 --24037 1987
NM_005378chr2169 1660 ----
NM_005385chr342568 2235 1845 977 ----1391
NM_005386chr201764 ------
NM_005392chr921431 676 11412 ----
NM_005400chr223033 1053 12779 12945 --
NM_005402chr721282 1271 1525 11724 1415
NM_005414chr31298 ------
NM_005430chr121748 ------
NM_005433chr1822210 2105 --1888 --
NM_005436chr1053629 2701 1408 588 137 11293 ----
NM_005455chr151834 1584 707 650 250 1262 ----
NM_005458chr942138 1919 890 441 1200 ----
NM_005461chr2021832 1780 ------
NM_005479chr1021464 1370 ----11313
NM_005493chr6133 ------
NM_005497chr1765840 5348 5128 4983 1345 1109 22437 901 13910 --
NM_005502chr963290 2728 2440 2388 1114 872 22500 556 --22600 2292
NM_005504chr1276256 5594 5149 2194 1990 1559 818 26337 1264 25681 80 22215 1153
NM_005506chr462478 1871 1150 313 302 30 1696 ----
NM_005517chr12517 25 21243 579 ----
NM_005520chr52517 222 --1718 --
NM_005522chr711010 ------
NM_005527chr6--1339 1391 1403
NM_005542chr741920 1417 1389 465 11311 --160
NM_005544chr22390 211 --1239 --
NM_005570chr18------11068
NM_005578chr365095 4053 2042 1801 1063 435 1972 --11634
NM_005584chr131792 ------
NM_005596chr9106238 5942 5466 5088 4969 4606 4501 4383 2568 1709 23913 2108 12163 15289
NM_005599chr121317 1106 21370 539 2990 625 --
NM_005602chr31899 ------
NM_005604chr631888 452 439 1721 11652 11029
NM_005605chr8--1268 ----
NM_005610chr12910 21 1627 ----
NM_005626chr1--1462 1540 --
NM_005637chr1832095 2038 278 179 21996 658 165
NM_005646chr11233 --191 --
NM_005657chr15148 ------
NM_005708chr131321 ------
NM_005717chr13290 198 86 ------
NM_005721chr21190 1939 ----
NM_005737chr272838 2517 2496 2341 1016 1009 675 32940 544 444 ----
NM_005748chr1213185 ----1396
NM_005749chr172647 498 ------
NM_005751chr71182 ----185
NM_005752chr16--11165 ----
NM_005756chrX21442 470 ----1951
NM_005759chr264587 4388 2922 538 374 273 --11409 1846
NM_005778chr31384 ------
NM_005779chr542730 881 814 384 32647 575 45 13410 --
NM_005808chr383306 3241 2912 2585 1293 1057 714 618 --12228 --
NM_005819chr132891 1046 540 23310 3091 --12859
NM_005822chr631857 852 330 11705 1616 22232 1550
NM_005826chr12507 144 ------
NM_005828chr1784893 4471 3976 1941 1043 328 192 176 44900 3814 3496 2032 23569 1219 14066
NM_005840chrX67085 4668 2896 2636 1608 379 11744 ----
NM_005841chr41947 ------
NM_005842chr13--1284 ----
NM_005843chr22705 57 --11289 1784
NM_005855chr21303 ------
NM_005862chr311008 11053 164 --
NM_005868chr742473 2097 985 737 11751 1102 --
NM_005869chr51157 ------
NM_005875chr31357 171 ----
NM_005877chr2221757 752 21912 415 11792 11001
NM_005901chr18158573 8370 7996 7627 6913 6696 6137 3422 3235 2562 2380 2185 1382 343 63 --48343 6502 3367 2786 16960
NM_005903chr555172 3788 3615 3484 151 11987 2129 78 --
NM_005911chr21370 ------
NM_005917chr2--1151 ----
NM_005922chr6171 ----1398
NM_005924chr7145 ------
NM_005935chr495137 4391 3509 3474 3384 2009 984 702 551 15087 34174 1271 181 14935
NM_005941chr844200 4174 2874 987 13805 1850 --
NM_005955chr184984 4465 3918 3807 2191 1278 651 516 25097 3455 ----
NM_005962chr1032055 1806 1686 1521 --12371
NM_005962chr1032055 1806 1686 1521 --12371
NM_005964chr1731369 1209 116 ----2535 463
NM_005966chr272408 2360 2340 1915 1771 1753 558 2463 150 ----
NM_005977chr13176 ------
NM_005986chr13------22764 657
NM_005999chr121439 91 ------
NM_006007chr943152 2984 2849 1187 1598 ----
NM_006037chr2104276 4210 4149 3959 3097 2966 1821 783 513 317 21296 528 14288 --
NM_006038chr2042105 1492 794 141 21461 456 12035 11596
NM_006060chr764127 2871 2775 2765 580 451 13714 13223 13484
NM_006083chr51114 ------
NM_006095chr444391 4342 3685 170 14459 1315 14311
NM_006100chr31411 1153 --1520
NM_006106chr1133223 3068 2991 22355 34 12561 11148
NM_006139chr21201 --12828 11155
NM_006141chr1641780 1719 647 529 12037 1789 --
NM_006154chr1532425 2059 398 12356 --1388
NM_006167chr852373 2102 1870 1593 682 12153 12091 --
NM_006183chr121115 --2480 33 --
NM_006194chr14--11221 --11098
NM_006195chr9----11198 --
NM_006197chr831826 776 200 --1254 12209
NM_006201chrX1465 ------
NM_006206chr452527 2285 1993 1975 381 12599 12730 --
NM_006224chr174698 465 362 282 ----1172
NM_006243chr12322 216 ------
NM_006251chr532709 2453 204 --23226 2435 --
NM_006252chr197401 6944 6784 6168 5666 2577 1826 410 201 22696 2265 1583 16993
NM_006265chr81574 11278 ----
NM_006267chr21763 ------
NM_006282chr2053268 1880 1656 967 851 1120 --1480
NM_006283chr884842 4759 4300 1963 1538 386 283 52 --23645 1810 --
NM_006284chr11----175 --
NM_006305chr15----135 --
NM_006306chrX84445 4138 2179 1785 1616 1283 1233 315 25929 2055 ----
NM_006310chr17--1387 11266 1264
NM_006313chr1221437 1410 ----1648
NM_006320chr43719 427 118 11065 ----
NM_006321chr351970 1864 1577 789 705 11466 21678 1474 11750
NM_006346chr13--1379 ----
NM_006352chr152074 1864 1657 667 536 11752 11908 --
NM_006359chrX21997 1013 1596 --2166 52
NM_006366chr611141 1236 11346 --
NM_006372chr6187 ------
NM_006379chr721989 335 12212 ----
NM_006380chr1754263 1764 1483 1311 1020 23415 3032 14361 159
NM_006393chr1084419 4360 4054 4040 3858 1747 1490 240 --23766 1503 --
NM_006405chr14192 ------
NM_006410chr112480 465 ------
NM_006416chr62523 240 1749 ----
NM_006417chr1--1236 --1192
NM_006420chr2052835 1283 1065 1004 379 --11091 --
NM_006457chr433271 1162 1015 12822 13286 11485
NM_006464chr233664 3054 50 14349 44155 1572 425 149 --
NM_006475chr132199 182 --168 --
NM_006482chr1273767 3740 3700 2795 2526 904 862 13542 ----
NM_006489chr1441969 1926 1689 1382 --21616 821 1561
NM_006538chr273949 3846 3484 2705 1327 744 698 31497 370 211 23456 2641 --
NM_006539chr16190 ------
NM_006540chr851455 1311 1296 167 74 ------
NM_006544chr1475595 4845 4782 4473 4098 4001 1255 25588 121 --15561
NM_006547chr731446 1297 162 ----11376
NM_006549chr1272892 2803 2386 2359 2090 681 348 12170 1312 1370
NM_006558chr8--122 ----
NM_006561chr1085911 3898 1250 1135 1008 776 316 92 31364 981 797 15814 25783 3844
NM_006577chr211214 ------
NM_006595chr1111433 1782 1661 1318
NM_006599chr16138193 5749 3085 2897 2276 2216 2098 1692 1642 1632 704 455 107 15324 17766 12861
NM_006603chrX41496 748 540 25 11745 ----
NM_006609chr222063 762 22714 2577 ----
NM_006614chr313405 12927 --12334
NM_006618chr111564 21360 1290 ----
NM_006620chr644260 2964 913 659 1552 ----
NM_006624chr1062056 1920 1883 1740 1613 584 11440 ----
NM_006625chr12925 832 ------
NM_006625chr12925 832 ------
NM_006625chr12925 832 ------
NM_006626chr922329 1779 32369 857 734 ----
NM_006628chr1544508 3420 1569 142 ------
NM_006633chr52715 268 --1230 --
NM_006644chr13--1211 --2643 219
NM_006650chr573800 3302 1520 1349 1291 1253 1194 23197 2787 ----
NM_006667chrX11103 11132 ----
NM_006698chr2031195 365 135 11408 21393 285 --
NM_006704chr133404 53 29 ------
NM_006706chr5--1132 ----
NM_006713chr5------1867
NM_006717chr973121 2869 2763 2564 2489 2115 913 1720 ----
NM_006724chr6171 ----1398
NM_006726chr42995 440 21063 1009 ----
NM_006729chrX55512 4946 4859 894 256 12051 21387 272 25563 3861
NM_006751chr22924 282 ------
NM_006754chr7------1955
NM_006759chr21308 ------
NM_006769chr13720 658 496 ------
NM_006791chr151588 ------
NM_006815chr1211094 ------
NM_006823chr881332 1326 1288 1269 478 354 161 107 ------
NM_006826chr231148 918 323 1960 11156 1340
NM_006870chr203791 667 531 ------
NM_006873chr283222 3022 2876 2811 2768 2365 2247 129 13229 12712 --
NM_006874chr42793 422 ------
NM_006885chr1642989 2943 1441 251 --14252 13827
NM_006887chr22483 299 ------
NM_006908chr741441 1334 1318 589 ------
NM_006914chr92976 462 21326 1004 21401 536 --
NM_006916chr231396 933 142 --1437 --
NM_006918chr1164541 4304 1901 1376 1216 375 1185 1727 --
NM_006924chr1764201 3628 1666 650 411 253 --1246 --
NM_006939chr1411157 1329 --1475
NM_006947chr431382 1221 1183 --11782 --
NM_006948chr2132412 2380 2342 21789 29 ----
NM_006951chr101249 ------
NM_006954chr1052365 2168 1151 995 342 23377 162 --1932
NM_006955chr1042372 2168 1253 441 33380 937 261 --21033 67
NM_006974chr1052365 2168 1151 995 342 23377 162 --1932
NM_006999chr511686 1195 11963 11744
NM_007005chr961493 1135 1121 1113 515 192 21560 1236 --1172
NM_007006chr1663388 2155 1360 507 433 45 1762 12493 --
NM_007007chr1252967 2924 1497 716 86 13707 --1893
NM_007008chr22885 151 1915 --1927
NM_007010chr1731716 1442 374 2660 500 11514 --
NM_007011chr1586839 5910 5183 4318 2018 1828 1449 929 36295 2319 969 32527 2387 1710 --
NM_007017chr5167 ------
NM_007030chr5105197 4920 4662 4499 4398 4207 1061 813 467 350 34347 3591 3380 1715 13494
NM_007038chr2175930 5662 4376 3821 3755 876 152 21535 528 24803 4791 --
NM_007039chr14--12086 ----
NM_007050chr20108099 8072 7885 7110 5640 4954 1199 664 344 43 ----12365
NM_007054chr543039 2874 373 241 13647 ----
NM_007067chr172472 88 --11394 --
NM_007106chr1322796 805 ------
NM_007107chr332272 479 48 12145 22289 970 --
NM_007114chr342899 1207 992 509 11123 22115 1132 --
NM_007129chr1351032 971 802 348 83 1717 ----
NM_007137chrX74719 3938 2210 2149 1397 725 363 15123 25039 1118 15574
NM_007146chr1722776 752 --1641 --
NM_007159chr321388 1329 --1188 --
NM_007207chr11954 1115 ----
NM_007212chr121798 1688 11902 11758 --
NM_007222chr8----11831 163
NM_007246chr41972 2327 62 ----
NM_007249chr1378152 6437 3628 3277 2216 1654 261 39307 8394 8226 16137 --
NM_007278chr171387 ------
NM_007287chr32567 223 1839 11148 22019 1125
NM_007288chr32567 223 1839 11148 22019 1125
NM_007289chr32567 223 1839 11148 22019 1125
NM_007331chr412075 12461 ----
NM_007345chr1821735 1642 152 ----
NM_007347chr1563108 2944 2632 842 578 139 22760 1104 13055 --
NM_007358chr12546 330 ----11931
NM_007359chr1761721 1651 1588 1369 701 240 21272 668 21733 1626 --
NM_007361chr14--1157 ----
NM_007372chr171849 1858 ----
NM_012072chr2084289 4157 4090 1546 1527 1036 914 202 23664 727 14451 --
NM_012090chr131087 519 116 ----1802
NM_012096chr343426 854 552 327 11142 --1297
NM_012102chr11350 129 1586 1619
NM_012104chr1163679 2898 958 745 398 92 13520 --13777
NM_012104chr1163679 2898 958 745 398 92 13520 --13777
NM_012110chr41225 ------
NM_012120chr632372 214 101 --12492 187
NM_012137chr152966 2389 1936 102 94 2412 198 1666 --
NM_012141chr1344073 1229 876 70 --13213 --
NM_012153chr1142577 2157 999 255 1231 12368 1278
NM_012158chr1341405 1145 718 453 ------
NM_012161chr41733 ------
NM_012164chr9106840 5864 5239 5164 5114 5076 2012 1574 1539 1319 27501 1946 16764 14934
NM_012177chr61465 --182 --
NM_012193chr1195186 5049 4958 4267 4123 2008 1014 527 356 24913 240 ----
NM_012197chr921531 80 1157 ----
NM_012198chr2--1534 --136
NM_012199chr154498 4267 3641 1358 59 23697 1581 --14577
NM_012207chr1011129 --1149 --
NM_012214chr286348 6041 5656 4343 4048 1789 1268 757 2102 34 ----
NM_012215chr1011432 152 --11824
NM_012229chr1041339 1227 392 281 --1274 --
NM_012234chr383313 3072 2617 2333 1289 1163 386 292 33564 3404 97 --1554
NM_012245chr141409 ------
NM_012247chr102983 95 1845 ----
NM_012250chr11--31254 340 151 11030 11223
NM_012252chr754701 4389 4125 3972 3514 11696 ----
NM_012262chr185200 4644 4198 1341 1241 845 469 431 11587 ----
NM_012281chr752278 939 891 617 216 2233 45 ----
NM_012286chrX1579 ------
NM_012288chr6105356 5107 5087 4571 4493 4333 2270 1306 750 95 14562 14441 --
NM_012290chr2--1142 ----
NM_012293chr272147 1998 1784 1630 853 711 35 1819 12030 --
NM_012300chr512127 11921 --12407
NM_012302chr13958 411 113 2330 157 --1282
NM_012309chr1183702 3534 3098 1898 1808 613 455 90 11831 --14972
NM_012311chr103504 422 81 ------
NM_012316chr175169 5092 4328 1686 966 213 128 24251 1837 21879 1251 --
NM_012325chr201477 ------
NM_012329chr1741682 1586 1067 152 ----1137
NM_012330chr10--11793 ----
NM_012343chr511108 ------
NM_012347chr653038 2586 2320 1877 289 ------
NM_012388chr1543066 2449 811 131 1678 22672 278 --
NM_012399chr221145 21780 466 --11911
NM_012412chr72864 700 ------
NM_012416chr911191 162 21183 407 --
NM_012434chr651496 1287 1156 176 77 21694 445 ----
NM_012448chr1752445 2101 2074 294 130 ------
NM_012454chr61170 ------
NM_012464chr42997 791 12537 1325 --
NM_013233chr2------2541 132
NM_013236chr222341 206 11032 2441 268 --
NM_013255chr758471 8009 6187 3446 3355 78785 7614 7594 7154 1635 1222 1110 12276 --
NM_013261chr443732 3008 2571 2374 12752 12983 --
NM_013269chr1254422 3484 3433 3354 3008 2867 575 ----
NM_013280chr11------1875
NM_013281chr2031458 1438 349 --11210 1330
NM_013283chr5----1103 --
NM_013286chr383165 2703 968 758 733 668 599 248 22346 533 13620 --
NM_013300chr12154 ------
NM_013309chr1532260 681 103 ----12402
NM_013333chr19170 ------
NM_013339chr1--169 ----
NM_013341chr241813 1147 1083 157 --32953 2372 460 --
NM_013354chr811005 ----11182
NM_013372chr1543273 2706 2370 177 1592 12781 --
NM_013377chr123609 211 103 --1656 --
NM_013396chr211370 11212 --21119 988
NM_013411chr152840 1875 1016 796 713 22115 1835 1821 --
NM_013438chr9----1407 --
NM_013444chrX1888 --1364 --
NM_013445chr2----134 --
NM_013448chr141627 1561 ----
NM_013449chr1272911 1201 1066 1039 1000 947 430 12515 22065 2040 --
NM_013943chr132699 322 309 --12212 --
NM_013986chr223315 269 249 ------
NM_013996chr73515 444 148 ------
NM_013996chr73515 444 148 ------
NM_013997chr73515 444 148 ------
NM_013997chr73515 444 148 ------
NM_013998chr73515 444 148 ------
NM_013998chr73515 444 148 ------
NM_014011chr242546 2404 2220 264 21857 828 --11668
NM_014016chr341081 539 483 45 ------
NM_014021chr142841 2821 2676 2264 23263 226 ----
NM_014023chr1052266 2215 1811 273 90 12672 1414 12895
NM_014034chr61158 21356 411 ----
NM_014043chr31624 ------
NM_014048chr16114348 4332 3612 3342 3212 1752 1735 1407 1076 605 173 21875 1531 1805 --
NM_014089chr1322269 198 1442 ----
NM_014117chr164566 521 380 228 ------
NM_014141chr744948 3403 1165 1019 45303 5212 5157 5037 ----
NM_014154chr331486 1271 397 ----1247
NM_014155chr11107160 6903 5840 5696 5200 2740 2398 1193 1050 280 47278 6795 6283 929 16767 22854 131
NM_014178chr141519 ------
NM_014181chr282868 2200 1902 1878 1165 384 255 245 ----11001
NM_014211chr521663 171 ----11759
NM_014217chr151375 1246 1236 1216 90 --11277 11911
NM_014234chr61145 ------
NM_014240chr363138 3111 2880 2610 2556 125 --14157 --
NM_014241chr10--188 ----
NM_014243chr42301 258 ----11593
NM_014253chrX42469 2364 637 591 12158 1344 --
NM_014263chr1031269 1136 334 11383 ----
NM_014268chr18133 ------
NM_014283chr121199 156 ----11540
NM_014294chr81532 ------
NM_014309chr2255171 1906 1256 517 219 14755 1249 15283
NM_014319chr1211488 2382 369 ----
NM_014323chr2221037 991 159 ----
NM_014325chr1242133 1562 516 335 ------
NM_014332chrX------195
NM_014345chr62404 26 1860 1811 --
NM_014363chr131959 ------
NM_014372chr12313 276 12125 ----
NM_014382chr32597 220 ------
NM_014393chr822287 1861 --21812 1449 --
NM_014402chr52130 114 ------
NM_014409chr1--11031 --192
NM_014415chr361661 1611 1487 1436 528 427 ------
NM_014418chr14----11672 --
NM_014421chr4----1831 137
NM_014423chr575582 4173 3908 3458 1851 566 45 --25276 1020 2912 697
NM_014447chr421616 638 --1247 --
NM_014452chr6--2437 258 1398 --
NM_014476chr42370 87 ------
NM_014480chr195840 686 658 174 116 1329 ----
NM_014491chr71775 --193 --
NM_014495chr11228 ------
NM_014500chrX1289 ------
NM_014547chr15----1313 --
NM_014547chr15----1313 --
NM_014583chr3--1517 ----
NM_014606chr411208 1278 11374 --
NM_014612chr931500 1454 982 11136 ----
NM_014615chr1632255 1299 787 13526 11425 --
NM_014616chr322250 748 11207 23399 2916 --
NM_014620chr121715 ------
NM_014633chr11161 ----195
NM_014635chr231168 612 469 ----21513 319
NM_014636chr993200 2846 1450 952 911 706 360 139 88 34191 2891 390 13923 22665 809
NM_014637chr82177 48 --11308 --
NM_014662chr22--1442 ----
NM_014670chr21441 11502 ----
NM_014676chr121320 611 ------
NM_014677chr81167 1207 11374 --
NM_014682chr812311 12092 ----
NM_014683chr1731994 848 617 ------
NM_014685chr161135 ------
NM_014686chr19102505 2350 2314 2306 1881 1836 1674 615 350 51 11031 1909 --
NM_014701chr1531131 1062 197 43213 2668 2403 36 ----
NM_014702chr633073 2992 2418 ------
NM_014705chr71844 1624 ----
NM_014707chr741573 1426 768 542 ------
NM_014711chr1641766 1719 671 512 ------
NM_014712chr16----1621 --
NM_014713chr21522 --1462 1474
NM_014720chr10--11310 --11375
NM_014721chr677030 6780 6510 4882 2192 1927 1333 25812 2464 36699 6022 5847 --
NM_014732chr1694876 4735 1398 1137 830 694 539 505 272 15830 ----
NM_014733chr522201 274 11536 ----
NM_014739chr674167 3636 3078 2574 1528 774 712 1314 ----
NM_014743chr472769 2560 1196 1147 959 584 235 12175 12235 1882
NM_014746chr284339 3506 2889 2808 1193 676 292 261 13070 14232 --
NM_014751chr852134 2054 1758 1713 583 ------
NM_014752chr1131816 1382 600 ----11299
NM_014756chr112380 142 ------
NM_014764chr1211161 --11240 21017 825
NM_014766chr743634 3121 644 250 --22319 1503 --
NM_014774chr162919 2424 1106 1000 478 469 11295 12723 --
NM_014781chr821065 298 1393 ----
NM_014787chr142119 1822 1783 958 11868 1753 --
NM_014791chr9--1341 ----
NM_014795chr231130 231 72 21241 567 11150 --
NM_014803chr1031981 1820 676 2450 141 ----
NM_014819chr552350 2225 1689 1545 380 11984 ----
NM_014822chr41549 ------
NM_014827chr1--11106 ----
NM_014828chr1422424 391 22299 2175 ----
NM_014830chr1243318 2705 1332 794 --1403 12393
NM_014832chr1332016 703 575 ------
NM_014839chr182534 2521 2429 2331 1020 854 687 358 2981 510 ----
NM_014841chr62541 25 --31276 1011 906 --
NM_014848chr1562676 2467 2053 1918 895 126 32751 2560 976 ----
NM_014850chr3104247 3519 3452 1819 1780 1547 1174 1107 1030 36 14903 24711 1185 --
NM_014853chr1761456 1425 1071 456 417 127 ------
NM_014862chr15114102 3961 3916 2999 2981 2891 1480 1356 952 558 133 24109 294 148 --
NM_014873chr154718 4430 3463 642 565 --24456 1705 --
NM_014877chr1765704 2427 1978 1754 928 294 ----15200
NM_014883chr432469 2181 1884 1447 1400 --
NM_014893chrY52298 1746 625 531 307 1556 1184 --
NM_014897chr1773050 2695 2419 1982 1112 421 388 ------
NM_014900chr2--1764 1782 --
NM_014903chr1221848 542 32213 2034 224 1568 --
NM_014904chr102972 365 13062 --1126
NM_014905chr241877 1384 139 45 1301 ----
NM_014906chr1753354 3274 2675 591 224 22646 411 12891 1650
NM_014912chr1042873 2639 781 339 12581 23059 1221 22661 1182
NM_014916chr71652 1624 --1490
NM_014917chr12856 266 ------
NM_014920chr633560 3112 2566 12521 13474 --
NM_014923chr1311852 2799 444 ----
NM_014932chr331712 646 426 ------
NM_014936chr61529 22445 431 1845 --
NM_014937chr1031332 1096 1018 ------
NM_014946chr21319 1885 12594 --
NM_014978chr1021582 1262 2481 335 ----
NM_014982chr1465288 4953 4616 3659 1960 696 21452 838 24833 4423 11216
NM_014989chr651774 1645 1385 1299 524 1345 11749 --
NM_014990chr142901 527 --1486 --
NM_014991chr463182 3091 2873 2392 2055 591 --12072 --
NM_014999chr1241401 1111 467 179 11487 --143
NM_015000chr1262711 2311 1147 1062 786 317 --11234 --
NM_015002chr124459 274 261 229 2764 431 ----
NM_015008chr343472 2880 2675 314 13544 --1443
NM_015020chr1662932 2706 720 432 373 35 21019 665 --33123 1051 895
NM_015025chr262641 2540 2375 1775 1095 794 12551 12441 12664
NM_015026chr1254609 3672 3630 1031 70 --14831 --
NM_015027chr1661991 734 584 569 499 76 ------
NM_015032chr1321807 882 32945 209 30 --32111 635 442
NM_015033chr933206 1087 844 3522 375 89 --12621
NM_015035chr2066574 6193 5988 5940 1822 1218 36631 4550 2267 16505 --
NM_015040chr253174 2879 2869 2198 128 32991 643 198 --21002 32
NM_015042chr1564128 3588 1311 1183 699 263 33948 788 274 --1578
NM_015046chr962481 2168 1112 954 686 201 32651 2512 886 1816 --
NM_015051chr92483 476 --13000 --
NM_015055chr1132798 2037 1068 42558 2231 2128 693 ----
NM_015057chr132483 231 1270 ----
NM_015061chr93599 224 76 1632 ----
NM_015064chr1242763 2260 1401 952 22821 2241 1650 12274
NM_015069chr161450 ------
NM_015071chr5106343 6207 4772 4198 2377 2147 1640 1174 371 143 25941 2619 11308 --
NM_015074chr1104943 4458 4259 3724 3259 1390 465 338 105 71 ----23503 1729
NM_015076chr643488 3425 1267 146 34268 3335 193 21598 233 --
NM_015077chr17114556 3964 3430 3285 3073 2982 1596 781 526 488 29 34485 3204 918 14628 --
NM_015091chr14------1574
NM_015092chr1684547 4336 3373 1749 1408 1000 894 859 11298 ----
NM_015097chr332137 1671 1565 1803 ----
NM_015100chr171357 787 676 547 414 286 255 21671 160 ----
NM_015101chr152714 1970 917 819 624 22902 1158 22426 1901 12339
NM_015110chr922468 2133 11805 ----
NM_015115chr433127 2584 165 11959 1246 13072
NM_015120chr2174 ------
NM_015130chr411284 ------
NM_015132chr75692 580 473 402 145 ------
NM_015137chr872390 1831 1620 791 762 720 652 1866 1986 --
NM_015141chr372651 2381 2258 2102 1807 691 509 22483 236 1149 --
NM_015143chr42595 40 21421 940 ----
NM_015144chr1683561 3326 2594 1528 1104 910 901 229 ------
NM_015153chr6189 ------
NM_015155chr1072700 2681 804 523 143 116 36 12163 1555 1720
NM_015156chr1453897 2825 2643 265 39 13977 1742 --
NM_015180chr142861 175 1295 ----
NM_015185chrX52698 1855 713 678 386 12431 --1729
NM_015192chr2052835 2818 2802 2565 2548 --12519 --
NM_015206chr1523473 3463 13412 ----
NM_015208chr183866 857 535 11025 --161
NM_015209chr151857 1616 938 450 424 ------
NM_015215chr143059 2899 2176 2060 11989 11964 12666
NM_015216chr541052 1039 580 185 11487 --21513 1115
NM_015225chr91179 ----1691
NM_015233chr1342348 2124 941 335 1622 11904 --
NM_015234chr631205 1100 47 11331 ----
NM_015247chr1664859 3848 3764 3537 1212 315 25374 1148 --15061
NM_015252chr24664 647 266 213 2911 241 ----
NM_015265chr232537 2375 2359 32518 1017 891 --1493
NM_015268chr3--1194 --2631 281
NM_015271chr444176 3730 1549 481 33243 346 244 13113 --
NM_015272chr1621920 1540 11322 --1460
NM_015277chr1811244 ----11171
NM_015278chr663339 2840 2555 2172 927 48 12685 23371 1026 --
NM_015291chr12704 429 21416 55 1774 13484
NM_015296chr1321085 347 --1907 --
NM_015308chr111822 1159 ----
NM_015310chr8108241 8218 7760 5686 2642 2421 1418 969 229 101 25849 3145 27739 5903 27848 375
NM_015313chr1134266 1594 200 23092 117 ----
NM_015326chr132325 970 575 --12420 1285
NM_015335chr1232184 636 424 --1128 --
NM_015336chr1232573 1837 50 22612 2227 2525 495 --
NM_015339chr2031051 996 96 1308 1114 --
NM_015343chr17--1281 ----
NM_015347chr1262848 2517 2340 573 310 107 ------
NM_015350chr1--1515 ----
NM_015352chr2062421 1278 1102 666 653 395 --23965 2670 --
NM_015365chrX32832 1712 712 24261 1324 11661 1407
NM_015387chr21581 ----12027
NM_015396chr31309 ----11103
NM_015397chr941236 487 412 84 1397 11333 --
NM_015435chr82583 151 ------
NM_015439chr62477 27 ------
NM_015455chr543478 1069 1036 939 147 --11087
NM_015465chr51197 ------
NM_015483chr73986 880 353 ------
NM_015509chr123572 549 68 41494 1188 1046 392 11076 --
NM_015520chr352322 2079 1962 1743 878 22795 2504 ----
NM_015532chr1532664 236 198 12607 ----
NM_015534chr11754 1392 11100 --
NM_015542chr101355 ------
NM_015548chr6--186 ----
NM_015553chr6134994 4445 3721 3673 3312 3196 2009 1900 1450 1170 1083 810 422 13445 --14609
NM_015554chr1542020 1959 1879 473 12163 1767 --
NM_015565chr2122082 1558 1320 ----
NM_015568chr2044303 3626 713 607 11087 24240 3413 11493
NM_015569chr154146 3988 3241 2993 2933 11777 13336 14826
NM_015570chr731848 1583 564 11600 ----
NM_015575chr2103685 3075 3068 3018 2732 2682 2471 1358 1338 286 --1490 --
NM_015589chr141144 ------
NM_015601chr10--1659 ----
NM_015626chr17--1991 --1226
NM_015635chr932059 794 593 1610 11391 12238
NM_015640chr143770 3482 3319 505 24295 36 --12096
NM_015649chr191157 ------
NM_015676chr142365 299 ------
NM_015678chr1321254 516 ------
NM_015691chrX62914 2159 1891 1134 885 769 1202 ----
NM_015713chr843383 3328 1213 891 --1519 --
NM_015726chr121252 1241 ------
NM_015840chr142583 2482 2011 483 --22634 2474 --
NM_015841chr142583 2482 2011 483 --22634 2474 --
NM_015878chr8------1750
NM_015879chr18138351 7961 7881 7529 6666 5570 3224 3210 1964 1279 1151 750 670 28516 3145 38502 6095 861 17923
NM_015888chr123133 2533 23372 811 12450 13150
NM_015906chr174598 3825 3337 3280 3098 1427 312 ------
NM_015957chr111359 ------
NM_015975chrX31759 1672 714 ------
NM_015981chr552675 2593 2476 992 31 13100 1882 22661 1091
NM_015990chr421120 939 --1226 --
NM_016002chr12663 189 ------
NM_016009chr154827 3868 1947 1779 1114 24387 462 1791 23010 348
NM_016018chr841887 1131 755 122 21842 984 --12488
NM_016021chr662964 2040 1875 509 165 26 ------
NM_016022chr131123 903 151 --11091 --
NM_016025chr1621419 810 1778 ----
NM_016037chr1------1193
NM_016045chr202673 449 1244 ----
NM_016048chr51284 1324 ----
NM_016061chr21121 ----1345
NM_016072chr122462 37 11607 1321 --
NM_016073chr151427 --2936 893 --
NM_016076chr112731 13102 ----
NM_016079chr251931 582 501 225 84 ------
NM_016096chr831910 487 274 1710 ----
NM_016097chr183978 885 268 ----1827
NM_016101chr162317 211 ------
NM_016120chrX1797 --1908 --
NM_016127chr83486 290 120 2726 609 --1256
NM_016131chr22219 154 ----11610
NM_016132chr1563423 2948 2910 2696 2112 925 ------
NM_016141chr31772 ------
NM_016156chr1162289 2177 1480 913 402 360 ------
NM_016201chr372287 2113 2081 710 596 369 182 21953 1670 --11598
NM_016203chr72911 257 ------
NM_016206chr368436 2719 2627 1890 750 233 13150 18794 --
NM_016217chr663631 2311 1418 724 185 80 23660 2434 ----
NM_016227chr121199 156 ----11540
NM_016230chr6149 ------
NM_016231chr171641 11482 ----
NM_016234chr104766 369 46 34 1901 ----
NM_016248chr1373988 3815 3784 2564 1591 1350 840 ------
NM_016252chr2----1208 --
NM_016258chr11265 ------
NM_016260chr277385 7245 4845 2314 1830 1445 667 27480 1712 25505 1685 15192
NM_016271chr1811980 11997 ----
NM_016275chr342371 2066 1790 655 11940 12266 12786
NM_016279chr51365 1164 ----
NM_016282chr921249 439 11623 21704 504 --
NM_016287chr121807 122 ----11745
NM_016303chrX--1328 ----
NM_016319chr122712 210 ------
NM_016322chr953149 3020 2581 2003 1189 1436 13046 --
NM_016329chr32482 171 ------
NM_016333chr16--2441 170 1345 --
NM_016356chr642828 2553 1171 928 22631 760 12440 --
NM_016374chr121170 225 11623 1256 --
NM_016374chr121170 225 11623 1256 --
NM_016376chr1744328 3872 1633 789 33384 735 459 1198 --
NM_016395chr1521941 1226 1384 ----
NM_016396chr1543016 2216 1103 884 --1804 12032
NM_016410chr92493 420 1478 ----
NM_016422chr1143091 3075 2959 32 12785 --12526
NM_016436chr2042009 1729 1019 292 21808 496 21954 479 12611
NM_016441chr2--11733 1107 --
NM_016467chr261097 890 559 380 346 85 ------
NM_016470chr202472 115 ------
NM_016480chr5195 1257 --150
NM_016488chr1231205 705 351 11968 ----
NM_016507chr1721069 404 --11183 --
NM_016513chr633560 3112 2566 12521 13474 --
NM_016522chr1151433 1345 1171 1129 462 1484 ----
NM_016530chr1544051 3233 3125 1234 22531 813 1885 --
NM_016531chr442625 800 690 423 11253 --13690
NM_016547chr11709 ------
NM_016570chr12171 --1473 --
NM_016577chr384490 4411 3973 3714 3522 1213 1017 648 --11203 --
NM_016588chr63132 105 95 ------
NM_016603chr562213 2080 2070 2026 1824 477 ------
NM_016613chr442765 2685 2373 584 ------
NM_016626chr18----1528 1670
NM_016631chr213952 306 133 ------
NM_016651chr1421093 969 ------
NM_016654chr15--2294 182 ----
NM_016836chr2181 ------
NM_016839chr2181 ------
NM_016941chr19----1453 --
NM_016950chr431246 1168 541 ------
NM_016952chr11114113 3552 3400 2955 2783 2741 2569 2555 1577 771 74 13912 ----
NM_017412chr83485 356 120 ------
NM_017415chr5124594 4356 3968 3419 3356 3321 1772 1290 1176 412 113 51 --24143 585 --
NM_017423chr431877 1680 580 --21432 154 --
NM_017425chr11--2126 103 ----
NM_017452chr2071463 1167 1000 250 201 185 169 ------
NM_017453chr2071463 1167 1000 250 201 185 169 ------
NM_017454chr2071463 1167 1000 250 201 185 169 ------
NM_017548chr331893 645 358 ----12063
NM_017563chr366063 4547 4303 3991 909 793 86171 6131 6052 4916 4294 1709 1170 407 ----
NM_017577chr321537 1211 1222 ----
NM_017583chr1131577 515 182 51708 1699 637 508 85 ----
NM_017593chr41352 ------
NM_017594chr953047 2638 1053 809 29 12431 ----
NM_017610chr1532149 468 288 1771 ----
NM_017628chr464143 1016 859 692 561 475 35118 816 88 14976 --
NM_017629chr131316 458 324 21473 682 ----
NM_017633chr653344 3087 2964 1141 24 42482 927 538 437 --23901 3390
NM_017637chr968194 8016 6442 6342 3600 135 58005 6149 2548 2201 474 19195 --
NM_017641chr126923 435 322 250 164 36 ------
NM_017644chr364597 3583 3547 1828 1569 1289 1845 21456 584 --
NM_017650chr796010 5211 5160 4859 4610 1804 813 248 134 25172 545 ----
NM_017657chr21638 2350 279 ----
NM_017658chr1464633 4359 3854 3401 3244 2896 ----12934
NM_017660chr1922670 2183 --33300 2272 374 --
NM_017661chr151490 ------
NM_017672chr152935 55 ------
NM_017684chr1541316 1299 1291 643 ----1292
NM_017694chr222029 1996 21730 1337 11958 --
NM_017709chr194010 3804 3196 3047 943 923 760 508 396 11155 11423 --
NM_017719chr372508 2393 2275 2103 1875 451 382 1351 11643 --
NM_017734chr1--1161 ----
NM_017737chr141845 1615 1539 1356 1661 ----
NM_017753chr91292 --187 --
NM_017754chr684540 3599 3258 1212 1196 930 871 674 25039 3574 21040 667 --
NM_017762chr1531985 1970 545 ------
NM_017770chr621869 965 2978 697 12768 --
NM_017772chr631752 1278 69 1368 161 --
NM_017776chrX21491 425 ----21250 582
NM_017780chr82858 183 ------
NM_017787chr1082866 2157 1915 1853 909 533 346 233 --22902 2492 12789
NM_017794chr9--1267 ----
NM_017798chr202329 298 ------
NM_017799chr1431951 1292 341 ------
NM_017801chr33942 152 47 --11932 --
NM_017813chr854703 4300 1803 1214 1201 42261 1243 741 266 ----
NM_017824chr1042478 937 304 93 ----12618
NM_017830chr42875 184 1252 ----
NM_017831chr1814255 1640 --14464
NM_017848chrX84614 3767 3543 2946 1871 835 434 133 ----14705
NM_017856chrX32113 605 536 --11888 --
NM_017873chr971003 819 763 727 626 609 152 --22768 2297 --
NM_017893chr10----11355 --
NM_017902chr10115768 4995 4705 4071 3872 3568 1455 1260 816 723 638 --14763 --
NM_017922chr14--2624 459 1465 --
NM_017925chr941379 1351 1290 751 1246 --11755
NM_017938chrX52185 876 586 562 34 ------
NM_017944chr1142581 2506 2072 386 12943 32873 2823 2420 1555
NM_017945chr311355 ------
NM_017954chr731218 1189 279 --2510 393 --
NM_017958chr252953 905 377 179 80 12744 12717 --
NM_017964chr22387 171 ------
NM_017987chr1021798 1390 ----12075
NM_017998chr931338 1088 1043 ------
NM_018011chr132627 486 ------
NM_018014chr22320 83 ------
NM_018015chrX21106 1002 1301 ----
NM_018023chr332003 1243 724 --11836 --
NM_018028chr1911340 ------
NM_018036chr1473444 3233 3047 1590 1564 548 96 1346 23307 1075 --
NM_018078chr421051 23 --1138 --
NM_018084chr222815 2652 ------
NM_018086chr2----1640 --
NM_018092chr1661369 1353 1263 1143 650 549 --11659 --
NM_018112chr92234 61 ------
NM_018120chr82426 26 11017 ----
NM_018151chr2------1779
NM_018157chr1253071 2529 2196 926 171 --23263 2866 --
NM_018159chrX31653 1410 27 --11489 --
NM_018169chr12--1495 1414 --
NM_018181chr1821496 469 11534 ----
NM_018199chr1411203 ------
NM_018200chr1552007 687 633 581 49 2622 123 ----
NM_018206chr164690 254 126 82 ------
NM_018234chr282061 2043 1696 1637 840 733 375 98 --1324 --
NM_018243chr423381 3258 13729 ----
NM_018247chr642337 2160 873 328 32968 2082 1932 12667 --
NM_018254chr132129 1613 124 --11973 32457 2314 392
NM_018260chr1941316 1055 516 182 ------
NM_018263chr242367 801 340 223 1216 ----
NM_018265chr182099 2055 2029 1835 1758 665 533 208 ----11573
NM_018293chr332634 2456 515 ------
NM_018299chr843449 3201 1074 309 --1530 --
NM_018313chr33749 730 666 12331 --11048
NM_018314chr111303 ------
NM_018315chr431550 1119 31 11094 --21386 510
NM_018326chr7--2225 185 ----
NM_018351chr1254118 3179 1024 913 26 --31200 672 436 1550
NM_018361chr851569 1313 1138 294 141 --1696 --
NM_018362chr1131449 813 58 23672 431 21458 1233 --
NM_018368chr61228 ------
NM_018371chr81244 1216 --11178
NM_018372chr11711 1175 ----
NM_018374chr734769 2019 742 1684 13641 --
NM_018388chrX41461 488 478 293 ------
NM_018394chr331515 1400 1162 ----1164
NM_018398chr31319 ----170
NM_018400chr1153858 3823 2779 1471 778 14483 13186 --
NM_018403chr363793 3631 2644 1619 1046 253 41475 1358 582 298 --1183
NM_018413chr121269 ------
NM_018439chr1851931 847 805 477 75 ----1652
NM_018440chr8118464 8147 7499 5459 2548 1935 1796 1787 821 467 32 46094 1439 945 61 16576 12265
NM_018442chr11157 ------
NM_018444chr852005 1902 1444 556 340 --12065 11526
NM_018448chr122983 345 ------
NM_018451chr133244 136 88 ----169
NM_018452chr6_random23570 638 12834 --11318
NM_018460chr2--1122 ----
NM_018469chr172550 488 --2156 31 --
NM_018471chr21476 ------
NM_018475chr41119 ------
NM_018482chr851936 1803 964 390 161 --12174 --
NM_018490chr1141516 1383 750 711 --1495 --
NM_018553chr173663 578 310 11704 21448 689 --
NM_018638chr1275157 4810 4758 2239 2065 1851 318 25451 45 11973 14455
NM_018640chr121340 11824 ----
NM_018650chr131439 421 231 21864 95 22025 1548 --
NM_018657chr32342 99 ------
NM_018682chr71626 1639 ----
NM_018686chr123255 131 116 ------
NM_018695chr52968 320 ----12132
NM_018712chr112974 209 1370 ----
NM_018840chr201167 ------
NM_018847chr941873 1488 440 240 --1268 --
NM_018890chr741441 1334 1318 589 ------
NM_018939chr52557 518 ------
NM_018945chr643651 3588 3198 763 ----1877
NM_018951chr721242 471 21289 895 --11039
NM_018968chr21109 ------
NM_018970chr752932 2898 2739 1266 59 31217 1126 31 12156 12939
NM_018975chr162740 135 --162 --
NM_019000chr551606 1507 1476 1151 242 ----1404
NM_019001chr374803 4481 3426 1200 991 183 171 34074 3607 566 11695 --
NM_019036chr62360 328 --1852 11233
NM_019053chr1021100 871 ------
NM_019063chr252160 1627 1437 259 51 12219 ----
NM_019071chr7--1520 ----
NM_019072chr553877 3818 3635 1043 938 --12807 --
NM_019083chr131591 1313 119 --1479 --
NM_019084chr1052341 2045 877 329 40 --11032 12438
NM_019088chr19176 --142 --
NM_019094chr1283853 3691 3049 2679 2543 412 320 232 12651 ----
NM_019117chrX43003 2488 1262 547 23275 1189 1771 11271
NM_019556chrX11342 1588 ----
NM_019557chr11199 ------
NM_019593chr2053011 2748 2260 1138 812 ------
NM_019597chrX2521 219 --1726 --
NM_019610chr131874 160 105 ------
NM_019885chr242929 2236 871 315 ------
NM_019891chr131149 1122 469 ----145
NM_020117chr52727 58 ------
NM_020122chr265107 4224 4086 1775 313 120 ----11519
NM_020123chr1021485 487 ------
NM_020132chr21104604 4195 4003 3404 3233 3177 1845 1638 1074 883 25133 4710 11118 14084
NM_020135chr6----1387 --
NM_020144chr721954 715 ------
NM_020150chr1022096 1962 21989 802 2661 311 1714
NM_020159chr421752 1224 ------
NM_020168chr1541173 964 920 319 11345 --1539
NM_020177chr563285 3081 2251 771 112 73 2342 205 ----
NM_020178chr1731221 1086 767 ----150
NM_020199chr5162 ------
NM_020228chr1152192 1903 1578 788 334 ------
NM_020235chr3127 ------
NM_020245chr6114962 4224 3964 3120 1549 1510 1410 883 555 288 159 13735 ----
NM_020310chr1762645 2569 2234 2148 2140 988 12133 21884 621 --
NM_020315chr2241021 964 814 795 ------
NM_020338chr1053175 2583 833 198 118 --13542 1443
NM_020341chr2022017 1505 ------
NM_020342chr252369 2298 646 318 205 ------
NM_020346chr1131538 223 37 1625 152 2495 180
NM_020351chr31144 ------
NM_020374chr1231700 1631 625 2469 250 1748 12025
NM_020390chr364874 4486 4460 1592 230 130 --13373 --
NM_020403chr1341703 476 367 236 ------
NM_020416chr432055 740 188 --1889 32465 2314 272
NM_020432chr742343 2255 1546 699 ----1310
NM_020440chr153009 1008 869 859 668 --13325 --
NM_020443chr196445 6345 5946 4778 4314 2321 2275 2260 403 12219 ----
NM_020445chr7----1547 --
NM_020455chr612490 32722 603 275 12773 --
NM_020473chrX21294 670 21943 815 --11239
NM_020532chr22885 151 1915 --1927
NM_020640chr342123 1934 648 237 1259 ----
NM_020644chr111233 --1655 --
NM_020651chr221718 1637 ------
NM_020654chr321516 467 ------
NM_020666chr52846 57 --1591 --
NM_020686chr1642888 1234 993 412 ----1651
NM_020689chr2021582 381 ----21435 1310
NM_020699chr165238 4830 3612 3547 1412 641 34450 4290 3702 33928 1843 1468 13606
NM_020704chr7154 22473 538 ----
NM_020711chr262624 2428 2366 1785 764 247 --1688 --
NM_020718chr16116155 5809 4377 4347 4215 4028 1567 1005 721 648 120 45294 1806 1607 351 21843 467 25780 433
NM_020727chr2142762 1125 268 199 13028 1583 23354 58
NM_020734chr121390 ----23181 2181
NM_020738chr251448 1217 1150 468 197 11730 ----
NM_020742chrX52368 1812 738 639 544 22240 224 ----
NM_020752chr1042897 2828 1963 750 12137 1765 --
NM_020766chrX63982 1263 910 577 451 153 33839 543 266 ----
NM_020768chr542123 1234 1212 609 --23096 2710 1766
NM_020771chr621134 184 ------
NM_020772chr1756994 2962 2379 2236 429 ------
NM_020774chr1874494 4366 2250 1960 856 350 180 15380 --16160
NM_020783chr1822291 285 31711 795 386 1647 --
NM_020792chr312118 32603 2524 498 22467 2269 --
NM_020796chr522781 1859 22417 1129 12896 1575
NM_020799chr101253 ------
NM_020801chr52602 347 12041 ----
NM_020804chr652689 2657 2610 2575 705 12557 --12672
NM_020805chr1851653 771 397 346 209 ------
NM_020810chr142533 474 13428 ----
NM_020819chr62438 189 11083 11137 --
NM_020821chr1541316 1299 1291 643 ----1292
NM_020839chr3--11637 ----
NM_020843chr151270 ------
NM_020854chr182572 534 --1193 11468
NM_020856chr1931207 635 256 ----151
NM_020858chr1522364 2126 1317 --1949
NM_020860chr431030 980 970 1925 1725 1941
NM_020861chr61952 ------
NM_020866chr131329 ------
NM_020870chr421399 707 ------
NM_020871chrX12261 1839 1729 12582
NM_020899chr1722230 708 --22284 486 --
NM_020918chr1083582 2758 2689 1242 998 580 354 161 12959 22417 332 13564
NM_020925chr131451 1251 1148 1192 --11054
NM_020927chr1622349 255 1699 --22264 1560
NM_020929chr11----1155 --
NM_020935chr274483 4467 3926 3910 3422 1377 664 ------
NM_020940chr1042562 2521 718 40 --12850 1288
NM_020943chr2--1234 ----
NM_020946chr921655 654 11287 11251 --
NM_020951chr1921862 363 ----155
NM_020975chr1031471 1460 1315 182 11602 --
NM_020987chr1031429 1268 1179 ------
NM_021005chr151459 ----2772 149
NM_021007chr2129 1409 ----
NM_021033chr1332977 2694 596 --22788 809 --
NM_021045chr1031811 1006 680 128 12452 --
NM_021064chr621118 556 1624 ----
NM_021069chr452146 2061 771 428 165 ------
NM_021077chr15142 ------
NM_021083chrX43568 3383 699 120 --11061 --
NM_021090chr2243353 3164 1757 785 23982 3106 34744 3651 3418 --
NM_021097chr232934 2896 1070 --1776 --
NM_021111chr921046 980 ------
NM_021120chrX63056 2914 2357 1123 1011 231 32278 377 29 12104 --
NM_021132chr101119 --2932 476 --
NM_021151chr72943 783 1967 ----
NM_021165chr12827 689 ------
NM_021183chrX32051 1618 613 21965 795 ----
NM_021190chr11334 ------
NM_021202chr2042484 2316 2230 778 1610 1655 --
NM_021239chr14--2536 456 191 --
NM_021240chr92204 118 1629 --1650
NM_021252chr1051847 1539 1321 688 663 ------
NM_021255chr1434143 3980 3339 14078 12935 145
NM_021620chr61770 ------
NM_021622chr104855 648 477 245 ------
NM_021629chr374579 3867 3597 3139 1950 1263 320 35090 1537 69 --14186
NM_021637chrX41318 1266 957 306 --2299 270 --
NM_021639chr12638 367 ------
NM_021643chr221925 1767 11489 11213 --
NM_021644chr1011129 --1149 --
NM_021647chr464776 4221 3310 1494 1235 1108 14637 13865 --
NM_021648chr652048 1770 423 325 214 12573 --1109
NM_021813chr695775 5627 5279 4797 4580 4442 4348 251 65 24742 4035 ----
NM_021911chr575652 4962 1797 1559 843 533 136 11823 ----
NM_021912chr1533336 2767 2739 ----13215
NM_021914chr1441868 844 566 421 --12125 --
NM_021956chr641444 1051 144 121 174 11486 --
NM_021961chr1166900 6569 6124 5570 1036 336 76965 6307 5394 4977 2015 1133 203 24563 1011 --
NM_021964chr386403 6369 5480 4798 4155 2050 1980 345 --15856 24234 2453
NM_021998chrX21411 1285 ------
NM_022044chr221103 ------
NM_022048chr1536370 803 625 36311 5901 600 11113 22229 1675
NM_022079chr10--1659 ----
NM_022114chr1114641 4562 4389 3804 3657 3589 3237 2990 2953 926 612 14003 13831 11499
NM_022130chr51953 ------
NM_022138chr661389 1344 1336 1249 426 385 1166 ----
NM_022166chr1686323 6182 5700 5216 4638 4555 4312 860 1107 23861 224 --
NM_022167chr171800 ------
NM_022170chr731434 528 135 11754 ----
NM_022336chr292335 1929 1880 1856 1753 928 818 105 65 --11706 --
NM_022346chr43961 537 120 ------
NM_022351chr853759 1516 667 629 428 --1445 23601 314
NM_022456chr12157688 6576 6552 6122 5995 2960 2883 2245 2097 1239 1202 1166 1117 380 167 --12367 12702
NM_022459chr1335253 2460 1552 11937 24458 4177 --
NM_022469chr163199 3034 2755 2268 523 494 22536 2078 ----
NM_022474chr1442408 1931 967 441 22689 326 ----
NM_022484chr721047 564 ------
NM_022497chr352878 2548 671 439 412 ----23658 3511
NM_022550chr51143 ----1487
NM_022650chr51411 1987 ----
NM_022658chr1211138 ------
NM_022719chr2283286 3198 1513 1433 613 589 394 145 --32786 1380 1198 --
NM_022726chr641787 1562 1123 704 11712 1686 --
NM_022728chr71736 1206 2215 138 --
NM_022735chr1--1130 ----
NM_022776chr331445 1395 493 11575 ----
NM_022780chr251622 1545 1141 519 471 21227 397 --21805 1564
NM_022781chr972968 2706 2565 2492 1154 983 134 --1394 13073
NM_022802chr1051338 1029 494 399 233 ------
NM_022824chr52768 384 11413 1557 --
NM_022841chr1532008 1747 663 --1100 --
NM_022843chr1311223 ------
NM_022844chr162957 652 ------
NM_022898chr1454109 4098 3185 215 199 1478 --13267
NM_022912chr252998 2928 2791 2198 1234 ------
NM_022913chr51319 ------
NM_022918chr1121723 1655 --11802 --
NM_022977chrX42492 2330 2246 228 1594 ----
NM_023000chr1421591 261 11277 --31584 682 562
NM_023001chr1421591 261 11277 --31584 682 562
NM_023003chr15--1230 ----
NM_023016chr212022 22902 1012 ----
NM_023074chr1911194 --1926 --
NM_023929chr812365 32762 1901 123 ----
NM_024007chr563191 2314 2145 850 658 395 ------
NM_024019chr421108 412 ------
NM_024052chr1772930 2137 2083 2012 1918 575 68 ------
NM_024061chr7152 ----1193
NM_024086chr17103641 3593 3438 3086 1303 1093 1017 738 218 58 11321 12650 --
NM_024090chr421839 402 ------
NM_024312chr1221600 79 11489 ----
NM_024345chr965931 4403 4363 2083 1244 142 34599 4171 1374 --23758 660
NM_024408chr132843 2521 692 ------
NM_024429chr72911 257 ------
NM_024496chr141638 ----1115
NM_024524chr322950 424 23036 2171 ----
NM_024525chr1----1414 --
NM_024539chrX--1965 ----
NM_024563chr551559 1543 1438 658 386 --1130 11770
NM_024574chr4198 ------
NM_024582chr44980 952 289 220 ------
NM_024595chr13495 388 216 1427 1227 --
NM_024607chr874304 3796 1288 496 467 416 61 --21359 237 --
NM_024613chr831826 1501 702 ----11238
NM_024624chr2--145 ----
NM_024630chr62737 305 2633 540 ----
NM_024638chr352454 2322 725 587 533 1788 2294 220 --
NM_024646chr143571 3122 174 46 21284 836 ----
NM_024665chr374513 4365 3745 3651 3501 1345 233 1197 --1969
NM_024689chrX41663 1270 312 73 --21284 255 --
NM_024700chr131087 200 153 ------
NM_024713chr1531550 537 415 11626 --2100 93
NM_024721chr821956 1639 1845 32692 2083 477 --
NM_024744chr242618 2269 578 371 2571 459 ----
NM_024751chr442067 2028 1847 116 ------
NM_024761chr9154801 4391 3698 3351 2060 1921 1672 1563 1501 1331 1128 532 520 413 313 2544 203 11312 --
NM_024770chr296626 6491 6033 4422 1880 1657 1018 801 39 14927 --24571 2012
NM_024785chr211166 ------
NM_024811chr1111957 ------
NM_024814chr71354 ------
NM_024837chr152479 209 ------
NM_024874chr161402 1374 1094 892 364 333 1184 1401 --
NM_024894chr2124 ----1298
NM_024899chr18----2721 646 --
NM_024913chr721148 602 1499 2303 284 --
NM_024930chr542407 1946 1050 825 22770 1030 ----
NM_024940chr831682 1179 403 ----11359
NM_024946chr1631608 450 166 11473 11319 1595
NM_024947chr398898 8766 6896 6574 6434 2311 1670 537 98 17929 13420 --
NM_024953chr1232191 872 661 ------
NM_024989chr278183 7379 6540 5832 5458 2151 922 38067 1491 1385 16738 15899
NM_024997chr1631154 947 354 --1102 2272 250
NM_025004chr111581 1207 1652 --
NM_025054chr854044 3952 1317 678 374 11457 --140
NM_025090chr1791493 1428 1361 1239 1130 1114 314 180 129 ------
NM_025107chr631559 1502 394 --12214 22295 1579
NM_025133chr221085 216 1809 ----
NM_025134chr161496 ------
NM_025138chr1341022 930 270 150 --1131 --
NM_025146chr341083 975 811 213 --12420 --
NM_025147chr221093 1001 ------
NM_025160chr164337 4257 4017 1663 1399 254 21280 246 ----
NM_025164chr11--2498 252 --11358
NM_025187chr1681208 1037 1015 499 348 121 80 40 --11238 --
NM_025191chr15813 715 449 167 50 13272 23461 1024 --
NM_025222chr332584 946 881 11857 --1895
NM_025235chr1082149 1948 1918 1635 885 692 351 111 1822 ----
NM_025248chr1773146 3097 2906 2385 2136 1988 591 33087 1205 789 1579 --
NM_025263chr651555 763 671 628 41 2622 465 187 --
NM_030576chr1741982 750 702 380 ----11030
NM_030594chr1551351 1277 1261 1183 29 11271 ----
NM_030621chr1473070 2760 2629 1494 1231 1169 528 13089 ----
NM_030625chr1052545 2346 1869 794 726 --32585 2467 165 --
NM_030627chr543903 3374 2836 1238 11644 13634 --
NM_030640chr12------1667
NM_030647chr785960 4949 4665 2277 2261 2009 734 155 25746 5596 24671 836 25658 2345
NM_030648chr475462 5251 5020 4812 1439 394 98 --11932 13546
NM_030665chr1711357 ------
NM_030667chr1221317 1164 1928 21326 1172 11210
NM_030668chr1221317 1164 1928 21326 1172 11210
NM_030669chr1221317 1164 1928 21326 1172 11210
NM_030670chr1232349 2196 1651 11960 22358 2204 12242
NM_030671chr1232349 2196 1651 11960 22358 2204 12242
NM_030674chr1224135 1317 34179 1210 1171 --1212
NM_030755chr1421177 395 13081 22821 83 --
NM_030763chrX5647 627 586 238 191 ------
NM_030791chr141747 ------
NM_030795chr81444 ------
NM_030796chr732043 1968 746 ----11978
NM_030806chr188957 7029 6697 1987 1772 1475 583 38 27580 3556 ----
NM_030809chr1222137 957 --22484 861 --
NM_030816chr153239 2522 2291 692 285 13602 13629 --
NM_030885chr312287 1232 ----
NM_030915chr252283 1970 1597 713 54 11640 12375 --
NM_030918chr195317 5114 4889 4783 4080 4028 2116 1629 75 1563 ----
NM_030920chr142107 2049 1869 219 1845 ----
NM_030925chr1341981 1583 469 202 --12080 1734
NM_030939chr62877 206 ------
NM_030949chr611158 21434 76 ----
NM_030962chr1121347 998 11427 --1283
NM_031157chr122518 180 2220 76 ----
NM_031215chr2052176 2062 2002 1644 527 --1860 1707
NM_031243chr742386 2171 838 521 1182 --1219
NM_031262chr9--21096 750 --1281
NM_031263chr9--21153 807 --1338
NM_031267chr7------1502
NM_031268chr16204807 4753 4628 4342 4156 3593 3312 1894 1841 1751 1727 1698 1508 630 619 594 552 447 400 384 14565 14996 --
NM_031371chr121170 225 11623 1256 --
NM_031371chr121170 225 11623 1256 --
NM_031372chr42565 133 --1391 --
NM_031427chr1485993 5966 5657 3971 1285 684 668 263 --14142 15922
NM_031435chr1273319 3135 3101 2206 1271 1138 236 1127 1451 --
NM_031442chrX12946 1514 1294 --
NM_031468chr777756 6730 5750 3066 2417 1744 24 --27176 2656 --
NM_031469chr633798 3579 3079 33099 955 904 186 --
NM_031845chr243558 809 799 617 22772 2267 ----
NM_031847chr243558 809 799 617 22772 2267 ----
NM_031889chr411327 ------
NM_031890chr2292604 2572 2440 2307 2264 988 603 515 374 12960 --12296
NM_031892chrX5841 830 679 236 215 1812 ----
NM_031922chr62557 215 ----122
NM_031953chr41170 ----2427 358
NM_031989chr12--1369 ----
NM_031992chr731434 528 135 11754 ----
NM_032012chr964689 4559 4539 3443 88 66 11276 24442 3341 14268
NM_032041chr842724 2532 2477 346 1565 1717 1859
NM_032042chr541960 1839 1786 871 22281 929 1712 --
NM_032047chr311992 11953 ----
NM_032050chr2221037 991 159 ----
NM_032105chr188131 5874 5124 2993 1521 1328 918 368 37949 1663 423 11292 --
NM_032116chr13125860 5663 5502 4693 4430 4089 1870 1826 1064 923 805 622 15355 23771 2029 --
NM_032117chr4--138 ----
NM_032121chrX32427 2095 672 32668 2014 962 12369 12120
NM_032124chr181283 --11080 2450 363
NM_032132chr12416 150 ------
NM_032143chr23310 299 210 ------
NM_032145chr631666 346 114 31871 1586 729 11556 11289
NM_032146chr31381 1389 ----
NM_032153chr372718 2566 2234 2184 1968 1777 1045 ------
NM_032154chr101677 11061 1947 --
NM_032181chr2----3793 279 103 1253
NM_032182chr101549 ------
NM_032189chr1384672 4207 3853 3699 1194 758 429 29 21392 22 1124 --
NM_032199chr1033232 2920 1526 41014 976 285 273 --12835
NM_032228chr1143350 803 310 189 --12399 --
NM_032268chr1683002 2579 2486 2363 2193 2075 1257 282 11248 ----
NM_032291chr12684 144 --21581 325 --
NM_032312chr22270 256 ------
NM_032320chr11--1239 194 --
NM_032329chr2104190 3823 3413 3103 2903 2856 2759 1064 866 367 21741 922 13376 1761
NM_032408chr72150 49 ------
NM_032410chr81364 ------
NM_032412chr5--1261 ----
NM_032429chr101545 ------
NM_032434chr22442 110 21393 386 ----
NM_032435chr162367 1568 1499 590 104 89 ------
NM_032440chr1012563 22920 2722 196 --
NM_032445chr1532588 2406 179 11853 ----
NM_032457chr433582 3575 2666 ------
NM_032458chrX42595 2099 1262 282 --12387 --
NM_032466chr871657 1583 1393 427 361 278 70 31449 509 84 ----
NM_032468chr871657 1583 1393 427 361 278 70 31449 509 84 ----
NM_032471chr62144 138 --194 --
NM_032491chr1251248 1076 995 971 842 1855 ----
NM_032505chr362719 1830 839 422 262 167 1683 12064 --
NM_032509chr832310 1748 863 1192 12464 --
NM_032511chr6----1355 --
NM_032521chr2043046 2459 2189 341 1254 --12974
NM_032523chr21485 ------
NM_032547chr431406 1380 1333 1339 ----
NM_032560chr141910 199 ----
NM_032569chr1621944 260 31890 1816 637 ----
NM_032595chr171484 ------
NM_032622chr431566 1084 973 --11130 --
NM_032632chr1421439 201 1737 ----
NM_032663chr1222054 1864 2797 745 --2829 495
NM_032765chr5--1790 ----
NM_032804chr1052462 751 704 436 61 1548 12511 --
NM_032810chr1011069 ----11462
NM_032837chr1731699 1406 43 129 ----
NM_032867chr111485 ------
NM_032873chr1153327 2871 1310 1209 154 1675 ----
NM_032875chr172214 193 --2624 334 --
NM_032905chr10----1912 --
NM_032932chr1796314 6231 6116 5357 1493 1274 601 189 156 16008 1436 14731
NM_032961chr421126 478 --1457 --
NM_032967chrX----155 --
NM_032968chrX84094 4074 4005 3257 3108 3021 1632 341 --32978 2791 1658 --
NM_032969chrX84094 4074 4005 3257 3108 3021 1632 341 --32978 2791 1658 --
NM_032971chrY----182 --
NM_032972chrY----182 --
NM_032973chrY74086 4066 3997 3252 3103 3016 341 --32973 2786 1652 --
NM_032975chr1853611 3096 1189 681 96 ----22997 894
NM_032980chr1853611 3096 1189 681 96 ----22997 894
NM_033018chrX1465 ------
NM_033020chr174598 3825 3337 3280 3098 1427 312 ------
NM_033044chr131087 519 116 ----1802
NM_033132chr1351908 1806 1515 921 710 --2828 768 1821
NM_033136chr521839 564 --11678 11893
NM_033137chr521839 564 --11678 11893
NM_033138chr711567 22180 240 --12259
NM_033139chr711567 22180 240 --12259
NM_033140chr711567 22180 240 --12259
NM_033157chr711567 22180 240 --12259
NM_033222chr921232 539 --1372 --
NM_033228chr52419 160 ----1131
NM_033253chr21918 ------
NM_033281chr51748 ----1889
NM_033285chr884408 3863 2889 2840 1724 1455 731 166 --11212 14097
NM_033326chr112764 390 1409 --1463
NM_033331chr953218 2398 405 319 300 1589 ----
NM_033360chr1254437 3923 1274 1175 1056 24589 349 13001 1434
NM_033389chr1753775 3734 3544 1470 419 ------
NM_033425chr1133388 1265 936 23498 1070 ----
NM_033426chr1432128 293 112 12190 12579 12931
NM_033430chr454128 3658 612 436 264 13325 11076 --
NM_033437chr454128 3658 612 436 264 13325 11076 --
NM_033480chr653038 2586 2320 1877 289 ------
NM_033481chr653038 2586 2320 1877 289 ------
NM_033503chr152248 79 23206 88 1353 1435
NM_033505chr2125726 5247 4655 4148 2554 2413 2338 1746 1347 961 757 285 36678 5001 4750 ----
NM_033515chr6--31328 463 269 11074 --
NM_033535chr41733 ------
NM_033624chr124459 274 261 229 2764 431 ----
NM_033632chr431550 1119 31 11094 --21386 510
NM_033642chrX2957 446 --1868 1861
NM_033644chr512127 11921 --12407
NM_033645chr512127 11921 --12407
NM_033656chr2185989 5069 4984 4023 3924 1496 1381 753 23793 857 15312 13980
NM_044472chr12728 182 --1710 --
NM_052818chr1312119 ------
NM_052855chr171533 --1539 --
NM_052864chr441410 649 232 157 1115 1494 --
NM_052879chr1263813 3685 3075 939 819 145 --21603 56 11582
NM_052886chr832019 1607 627 11980 ----
NM_052903chr151498 ------
NM_052904chr62250 217 ------
NM_052906chr22104894 4821 3941 3638 3180 3150 1736 771 681 267 24883 4150 11027 1174
NM_052910chr132686 324 1405 1139 2721 207
NM_052917chr252689 2380 2093 1000 255 --1707 --
NM_052918chr1043136 1459 1402 748 --12879 --
NM_052927chr521394 156 ------
NM_052936chrX1943 ------
NM_052937chr812133 ------
NM_053002chr31407 ----1763
NM_053016chr957586 7145 5439 2782 572 47346 5622 1586 428 15840 189
NM_053023chr111126 11234 ----
NM_053024chr321257 1239 --11319 --
NM_053043chr7116280 6119 5734 5312 5128 3875 2049 1650 1553 872 740 14428 --145
NM_053053chr11288 2952 156 ----
NM_053064chr1441911 750 727 465 12988 ----
NM_053281chrX140 ------
NM_054012chr9172 --188 --
NM_057159chr921391 450 ------
NM_057749chr831309 309 93 1904 1939 --
NM_078487chr933251 2957 1227 ------
NM_080425chr201313 ------
NM_080426chr201313 ------
NM_080546chr912294 ------
NM_080599chr101355 ------
NM_080645chr621699 399 ----12151
NM_080654chr1131015 378 122 1984 ----
NM_080669chr1774366 3502 1535 1273 1208 786 536 14839 --14383
NM_080670chr51115 ------
NM_080676chr2043024 2774 2280 908 22847 70 ----
NM_080743chr622472 244 12307 --11931
NM_080798chr101283 ------
NM_080799chr101283 ------
NM_080800chr101283 ------
NM_080801chr101283 ------
NM_080802chr101283 ------
NM_080803chr101283 ------
NM_080804chr101283 ------
NM_080805chr101283 ------
NM_080806chr101283 ------
NM_080807chr101283 ------
NM_080808chr101283 ------
NM_080809chr101283 ------
NM_080810chr101283 ------
NM_080811chr101283 ------
NM_080812chr101283 ------
NM_080813chr101283 ------
NM_080814chr101283 ------
NM_080815chr101283 ------
NM_080832chrX164 1552 ----
NM_080840chr20182 ------
NM_080841chr20182 ------
NM_080867chr1453848 3199 1861 866 354 12010 13266 --
NM_080872chr883791 2684 2620 1300 1201 1033 433 290 13569 12772 --
NM_080927chr333092 2159 601 22882 424 13063 12620
NM_130386chr182650 217 ------
NM_130395chr6----1387 --
NM_130439chr1032055 1806 1686 1521 --12371
NM_130439chr1032055 1806 1686 1521 --12371
NM_130811chr201983 21170 925 21109 360 1121
NM_130846chr121132 1417 ----
NM_130901chr15159 ------
NM_133170chr20108099 8072 7885 7110 5640 4954 1199 664 344 43 ----12365
NM_133171chr2011231 ------
NM_133264chr1743045 3013 2567 314 13587 1378 --
NM_133265chrX53484 3322 3116 2371 605 --13584 --
NM_133329chr2------11505
NM_133330chr483248 3234 2968 2680 2444 2208 1278 1111 --1496 --
NM_133331chr483248 3234 2968 2680 2444 2208 1278 1111 --1496 --
NM_133334chr496053 5811 5197 4785 4687 4664 1278 997 884 15432 26125 4998 25298 606
NM_133335chr483248 3234 2968 2680 2444 2208 1278 1111 --1496 --
NM_133370chr443041 2609 1356 115 --23368 2576 --
NM_133445chr943691 3629 3303 2749 33613 2736 256 1922 23798 656
NM_133496chr131390 1301 1205 13298 ----
NM_133510chr14--147 ----
NM_133631chr311143 ------
NM_133634chr2151746 1679 1602 1492 156 1604 11857 --
NM_133638chr531439 1052 974 ------
NM_133646chr2105187 5113 4711 4244 1842 1618 954 428 287 253 ------
NM_134265chr17--1991 --1226
NM_134442chr211576 ----2491 171
NM_134447chr19--1202 ----
NM_138270chrX43174 2518 583 540 12395 22312 1180 11045
NM_138288chr1442215 2007 1424 273 ------
NM_138335chr41325 ------
NM_138340chr18------144
NM_138348chr5106615 6054 5617 5580 5232 4680 2533 1744 1021 763 16537 15704 46416 5205 4634 1733
NM_138357chr1031407 1361 182 ------
NM_138389chr41207 ------
NM_138395chr241099 209 180 121 1131 ----
NM_138426chr752235 914 741 354 270 --1858 --
NM_138444chr1344332 3104 1771 1747 ------
NM_138459chr663664 2656 2561 2400 1150 1112 ------
NM_138468chr275007 4970 4733 4013 1087 988 371 1111 --15945
NM_138473chr12114944 4906 4594 4522 3975 3965 3475 3168 1508 557 494 --11669 1870
NM_138494chr722408 950 ------
NM_138555chr15----1386 --
NM_138559chr22310 73 ------
NM_138576chr1454109 4098 3185 215 199 1478 --13267
NM_138621chr273949 3846 3484 2705 1327 744 698 31497 370 211 23456 2641 --
NM_138635chr71279 12487 ----
NM_138638chr1441868 844 566 421 --12125 --
NM_138713chr16138193 5749 3085 2897 2276 2216 2098 1692 1642 1632 704 455 107 15324 17766 12861
NM_138714chr16138193 5749 3085 2897 2276 2216 2098 1692 1642 1632 704 455 107 15324 17766 12861
NM_138731chr1473477 3377 2669 1121 872 409 68 --12855 --
NM_138735chr21599 ------
NM_138773chr51924 ------
NM_138779chr13----172 --
NM_138782chr531860 1580 697 ------
NM_138927chr212795 248 --175 --
NM_138966chr18------275 49
NM_138970chr1432367 1541 958 22187 414 ----
NM_138971chr1163679 2898 958 745 398 92 13520 --13777
NM_138971chr1163679 2898 958 745 398 92 13520 --13777
NM_138972chr1163679 2898 958 745 398 92 13520 --13777
NM_138972chr1163679 2898 958 745 398 92 13520 --13777
NM_138973chr1163679 2898 958 745 398 92 13520 --13777
NM_138973chr1163679 2898 958 745 398 92 13520 --13777
NM_139045chr91319 --1205 --
NM_139072chr22293 227 1182 1708 --
NM_139136chr121867 21037 434 ----
NM_139167chr82159 81 ------
NM_139168chr531764 545 521 ----11899
NM_139169chr1021958 865 2307 214 --1241
NM_139312chr1031269 1136 334 11383 ----
NM_139319chr12----1666 11851
NM_139321chr2074076 3607 2653 1520 1372 345 90 11657 --21007 316
NM_139323chr2021901 249 11939 2437 280 --
NM_144567chr111987 12288 12324 22642 101
NM_144571chr466240 6080 5719 4386 2577 1261 15665 ----
NM_144576chr12----1640 --
NM_144578chr1435122 3791 1320 --14611 11488
NM_144595chr131961 --1224 --
NM_144632chr252319 2246 2155 639 481 --11757 --
NM_144642chr31570 1159 11406 --
NM_144643chr41472 ------
NM_144664chr1142351 1028 885 461 22437 62 ----
NM_144665chr11173 ------
NM_144721chr442235 561 523 199 11996 1907 --
NM_144726chr51179 1254 ----
NM_144728chr11954 1115 ----
NM_144729chr11954 1115 ----
NM_144775chr1774917 4900 3400 1897 1168 674 34 14659 23971 21 --
NM_144949chr242546 2404 2220 264 21857 828 --11668
NM_144963chr8--12073 22725 844 --
NM_144967chrX21040 875 --11090 --
NM_144973chr1294438 3563 2077 1246 1007 884 705 482 292 11031 25369 5259 14426
NM_144979chr41532 ------
NM_145049chr53672 394 353 ------
NM_145055chr1853305 3279 2647 2550 59 12832 11499 --
NM_145062chr61214 ------
NM_145117chr1152908 2307 2148 837 257 ----12250
NM_145160chr151362 ------
NM_145203chr13--1106 --1206
NM_145206chr1072841 2385 2218 2099 1217 1150 407 --1765 --
NM_145253chr161612 ------
NM_145259chr236085 2801 740 37110 6810 1275 25585 4669 16534
NM_145284chrX2877 170 12508 ----
NM_145290chr41327 --141 --
NM_145307chr1044569 3387 1776 1525 --2752 384 145
NM_145330chr2148 ----166
NM_145331chr63722 288 216 --2663 266 --
NM_145332chr62870 364 --1811 --
NM_145333chr62870 364 --1811 --
NM_145351chr1771932 1785 1041 1011 717 504 484 1590 2492 448 --
NM_145649chr651988 1748 875 429 65 ----1166
NM_145655chr651988 1748 875 429 65 ----1166
NM_145690chr861925 1668 555 443 408 285 1494 ----
NM_145698chr10293 65 21956 1846 1361 --
NM_145725chr141102 ------
NM_145726chr141102 ------
NM_145735chr1392662 2586 2337 2285 2032 901 516 495 368 12677 ----
NM_145739chr21485 ------
NM_145805chr15----1581 --
NM_145808chr763161 3114 2845 415 339 44 ------
NM_147166chr7--1865 ----
NM_147171chr71182 ----185
NM_147175chrX51999 1839 1432 841 169 ----11476
NM_147185chr71182 ----185
NM_147189chr851598 1432 330 82 61 2500 53 ----
NM_147223chr232057 1609 1498 11667 ----
NM_147233chr221874 1426 11484 ----
NM_148174chr8------1750
NM_148898chr71775 --193 --
NM_148899chr71775 --193 --
NM_148957chr1342329 1952 370 317 12689 12369 --
NM_152262chr191347 ------
NM_152263chr176092 5086 4728 4243 3709 1987 918 11301 ----
NM_152271chr821090 290 ----2733 237
NM_152277chr541677 1408 590 157 ------
NM_152282chr331282 868 481 ------
NM_152300chr1731716 1442 374 2660 500 11514 --
NM_152305chr32584 340 11436 11495 2426 330
NM_152330chr1461834 919 665 627 617 132 12573 ----
NM_152332chr1432714 922 278 --22316 1016 --
NM_152342chr161476 ------
NM_152388chr263429 3154 3147 1442 738 157 32823 2808 1499 23741 1274 11225
NM_152390chr21456 --1219 1181
NM_152400chr421597 724 --31699 549 237 --
NM_152409chr562914 2525 2376 1298 1131 450 22806 354 --144
NM_152414chr831552 1198 402 2651 96 --11270
NM_152417chr821323 178 --1541 --
NM_152441chr12--1158 ----
NM_152446chr14--1164 2745 704 --
NM_152523chr21281 2704 299 ----
NM_152525chr2121 ------
NM_152529chr233438 571 167 23643 2742 ----
NM_152556chr71445 12560 1483 1285
NM_152574chr9--192 ----
NM_152588chr1231810 1684 542 --1361 --
NM_152594chr1522147 1729 22136 2033 ----
NM_152605chr19--11249 11378 11393
NM_152622chr553346 2974 2813 659 230 --12656 11204
NM_152624chr5137422 6501 5726 5048 4905 4667 2930 2040 1666 1635 699 673 660 37178 6766 5440 1267 35783 2593 2105
NM_152629chr973764 3672 2970 1560 1323 887 739 12795 11145 --
NM_152630chrX31382 1291 295 --1313 --
NM_152636chr1142957 2661 882 767 31979 931 127 22345 2214 --
NM_152641chr1232528 678 228 1627 32839 845 747 --
NM_152653chr32552 129 --1737 1688
NM_152678chr352264 1841 1048 603 194 22707 2109 11985 --
NM_152692chrX2417 394 1387 ----
NM_152707chr10168 ----1914
NM_152737chr621986 489 --22102 1744 --
NM_152745chr7--21031 746 ----
NM_152756chr534270 3606 1639 21497 1144 --14013
NM_152787chrX63199 2497 2408 989 934 290 23857 254 --1390
NM_152793chr774374 4103 3558 1495 1040 993 166 11367 11773 25052 3298
NM_152896chr92770 550 1540 1809 --
NM_152924chr1586839 5910 5183 4318 2018 1828 1449 929 36295 2319 969 32527 2387 1710 --
NM_152991chr111493 ------
NM_152996chr1--11485 2285 58 1843
NM_152999chr734866 4482 681 ----23828 3671
NM_153013chr582361 2145 2117 2105 2058 1889 946 367 ------
NM_153015chr82984 764 1390 ----
NM_153020chr611081 1625 --2641 127
NM_153042chr631604 626 421 ------
NM_153050chr2243353 3164 1757 785 23982 3106 34744 3651 3418 --
NM_153051chr2243353 3164 1757 785 23982 3106 34744 3651 3418 --
NM_153181chr18------275 49
NM_153183chrX31091 477 218 --1951 176
NM_153184chr331720 1677 1359 ------
NM_153188chr575224 5110 4742 4446 2047 1150 320 21631 669 34962 4614 3625 11694
NM_153207chr1234105 3336 2875 1171 1243 --
NM_153211chr18--181 ----
NM_153218chr132809 324 ------
NM_153226chr10--11185 ----
NM_153240chr31913 --1167 --
NM_153261chr1641232 1111 1097 614 11018 ----
NM_153262chr143182 2248 1051 562 ------
NM_153371chr134700 293 218 75 ------
NM_153456chr13106352 5274 5241 4939 2407 2152 1691 1593 293 105 15799 26244 1225 --
NM_153499chr1272990 2901 2484 2457 2188 779 446 12268 1410 1468
NM_153500chr1272990 2901 2484 2457 2188 779 446 12268 1410 1468
NM_153607chr553023 2862 2830 475 322 11988 12109 23147 1055
NM_153616chr1522364 2126 1317 --1949
NM_153617chr1522364 2126 1317 --1949
NM_153618chr1522364 2126 1317 --1949
NM_153619chr1533602 3364 2248 ------
NM_153633chr121715 ------
NM_153634chr121315 21159 1066 --11235
NM_153686chr44580 350 187 99 --22080 319 --
NM_153688chr1621745 425 --11563 125
NM_153689chr242286 713 706 688 1174 ----
NM_153690chr33800 766 709 1734 ----
NM_153695chr91256 ------
NM_153700chr15129 ------
NM_153705chr1122048 1959 169 --1903
NM_153715chr721242 471 21289 895 --11039
NM_153746chr62737 305 2633 540 ----
NM_153748chr121867 21037 434 ----
NM_153810chr10145111 4644 4590 4564 4416 4083 3760 3377 3199 3132 1628 1128 627 255 13337 ----
NM_153819chr11--1178 ----
NM_153828chr22885 151 1915 --1927
NM_170665chr12113550 3446 3279 3255 1635 1471 1452 1434 1039 984 402 --34469 1283 615 --
NM_170719chr1341022 930 270 150 --1131 --
NM_170721chr171948 --1241 11246
NM_170725chr11161 ------
NM_170731chr1142693 2601 2456 962 2945 676 --1317
NM_170732chr1142693 2601 2456 962 2945 676 --1317
NM_170733chr1142693 2601 2456 962 2945 676 --1317
NM_170734chr1142693 2601 2456 962 2945 676 --1317
NM_170735chr1142693 2601 2456 962 2945 676 --1317
NM_171825chr552675 2593 2476 992 31 13100 1882 22661 1091
NM_171999chr182837 563 ----1636
NM_172058chr831897 1831 39 21671 288 --1207
NM_172059chr831897 1831 39 21671 288 --1207
NM_172060chr831897 1831 39 21671 288 --1207
NM_172069chr252144 1933 1685 286 44 --11472 --
NM_172070chr2--12276 1551 --
NM_172071chr136572 2877 500 66963 6863 5635 2641 1035 262 ----
NM_172103chr652657 2301 2231 1767 746 1241 31928 952 514 22174 1816
NM_172105chr652657 2301 2231 1767 746 1241 31928 952 514 22174 1816
NM_172127chr452130 1459 1313 767 659 31842 1791 154 11985 --
NM_172128chr452086 1415 1269 723 615 31798 1747 110 11941 --
NM_172216chr1272892 2803 2386 2359 2090 681 348 12170 1312 1370
NM_172226chr1272990 2901 2484 2457 2188 779 446 12268 1410 1468
NM_172344chr2------11505
NM_173054chr75840 798 760 688 232 199 --1164
NM_173074chr21342 ------
NM_173083chr111225 1917 ----
NM_173214chr16138193 5749 3085 2897 2276 2216 2098 1692 1642 1632 704 455 107 15324 17766 12861
NM_173359chr331889 495 178 1729 1515 --
NM_173468chr4105871 5736 5354 5027 4673 2136 1903 690 341 276 --1817 --
NM_173470chrX82848 2767 2687 780 539 387 376 309 12072 22528 2210 --
NM_173487chr43815 350 144 ------
NM_173495chrX21659 483 22447 539 1369 12597
NM_173496chr1012711 --23009 2955 --
NM_173511chr283810 3232 3154 1147 1054 1027 926 92 43803 3533 2512 176 --13394
NM_173515chr6----1319 --
NM_173517chr71486 ------
NM_173531chr1962950 2666 2527 1425 686 78 ----2419 85
NM_173552chr321640 585 1372 ----
NM_173570chr362205 2076 1695 1519 339 235 21508 369 11886 1605
NM_173576chr102876 865 ------
NM_173582chr1176248 6166 4020 1773 921 349 28 15800 1482 14123
NM_173595chr12125002 4883 4793 4740 4539 3798 3515 1981 1934 945 807 478 ------
NM_173602chr1263679 1487 1026 423 173 132 22894 2642 ----
NM_173642chr1128705 7976 7376 7299 6430 6121 6019 3591 2410 2400 2276 243 13526 15993 16647
NM_173645chr2------1133
NM_173665chr52779 289 1283 1756 --
NM_173681chr721852 1415 ------
NM_173683chr821303 1094 ------
NM_173694chrX22164 1605 1344 11970 11792
NM_173794chrX1382 ------
NM_173808chr143413 3400 823 572 21121 196 21746 265 11432
NM_173814chr152519 64 1226 ----
NM_173822chr23689 655 56 1224 21526 318 185
NM_173825chr322596 64 ----12632
NM_174909chr5----1345 146
NM_174911chr8113699 3576 3503 2580 1508 1095 1006 981 957 919 492 23625 161 11399 22986 277
NM_174916chr1542190 2090 778 421 --12251 --
NM_174921chr42443 313 --1298 --
NM_175061chr752053 2038 2015 1904 486 12046 11969 --
NM_175607chr331532 1280 583 1620 ----
NM_175610chr1541270 1258 251 199 ------
NM_175612chr331532 1280 583 1620 ----
NM_175623chr12157688 6576 6552 6122 5995 2960 2883 2245 2097 1239 1202 1166 1117 380 167 --12367 12702
NM_175624chr12157783 6671 6647 6217 6090 3055 2978 2340 2192 1334 1297 1261 1212 475 262 --12462 12797
NM_175625chr12157783 6671 6647 6217 6090 3055 2978 2340 2192 1334 1297 1261 1212 475 262 --12462 12797
NM_175854chr1332672 1073 811 22057 215 ----
NM_175866chr11492 1513 ----
NM_175873chr511357 --11332 --
NM_175876chr142756 1966 1797 991 22051 614 ----
NM_175921chr553943 1414 1299 538 317 13912 ----
NM_175929chr13123 ------
NM_176081chr1041979 1470 1355 975 24369 333 --15871
NM_176083chr1041979 1470 1355 975 24369 333 --15871
NM_177414chr151589 1502 1079 342 319 --1463 --
NM_177438chr1473070 2760 2629 1494 1231 1169 528 13089 ----
NM_177524chr7----11231 --
NM_177525chr7----11231 --
NM_177938chr31163 ------
NM_177939chr31163 ------
NM_177968chr231417 460 115 --21653 789 --
NM_177969chr22550 27 ------
NM_177972chr1164450 4347 4116 693 632 373 22947 63 33678 3229 2885 --
NM_177976chr31381 1389 ----
NM_177990chr2022017 1505 ------
NM_177999chr971382 1326 1290 1189 1172 715 351 1475 23331 2860 --
NM_178011chr1042664 899 525 78 --11105 --
NM_178037chr1242763 2260 1401 952 22821 2241 1650 12274
NM_178038chr1242763 2260 1401 952 22821 2241 1650 12274
NM_178120chr211286 21252 1224 ----
NM_178123chr2----1667 1783
NM_178151chrX65702 2634 1788 1645 1545 168 17744 57750 7514 7162 888 594 --
NM_178152chrX65702 2634 1788 1645 1545 168 17744 57750 7514 7162 888 594 --
NM_178153chrX65702 2634 1788 1645 1545 168 17744 57750 7514 7162 888 594 --
NM_178154chr141310 --1802 --
NM_178155chr141310 --1802 --
NM_178156chr141310 --1802 --
NM_178157chr141310 --1802 --
NM_178270chrX1943 ------
NM_178423chr731227 209 46 11239 --11110
NM_178425chr731227 209 46 11239 --11110
NM_178496chr331201 579 63 ------
NM_178517chr172546 70 ------
NM_178539chr1242093 1582 1343 221 ------
NM_178565chr821176 388 11334 --1196
NM_178582chr205938 415 272 216 192 ------
NM_178585chr463182 3091 2873 2392 2055 591 --12072 --
NM_178586chr1451964 1894 1668 653 357 ------
NM_178812chr831149 1068 304 178 21416 1282 --
NM_178858chr10----11046 11386
NM_181054chr141957 11314 --168
NM_181332chrX52368 1812 738 639 544 22240 224 ----
NM_181358chr154153 3948 3537 1358 234 --23185 406 --
NM_181442chr2031051 996 96 1308 1114 --
NM_181453chr231168 612 469 ----21513 319
NM_181481chr18107053 6809 5598 5535 4540 1849 1748 1333 562 418 55653 5298 5112 2554 658 25940 2571 1332
NM_181482chr18107053 6809 5598 5535 4540 1849 1748 1333 562 418 55653 5298 5112 2554 658 25940 2571 1332
NM_181483chr18107053 6809 5598 5535 4540 1849 1748 1333 562 418 55653 5298 5112 2554 658 25940 2571 1332
NM_181504chr543469 3050 2902 462 188 13363 21252 493
NM_181521chr1676568 6322 5934 4812 2686 1450 1175 26130 211 36931 4481 1370 --
NM_181523chr543469 3050 2902 462 188 13363 21252 493
NM_181524chr543469 3050 2902 462 188 13363 21252 493
NM_181532chrX1307 ------
NM_181670chr1211342 11184 --11303
NM_181689chr201764 ------
NM_181705chr545670 2270 1670 1447 34252 4176 2150 ----
NM_181713chr22871 715 ------
NM_181714chr631472 1355 354 ------
NM_181782chr612219 11851 12199 2337 320
NM_181783chr1221921 1746 --11784 --
NM_181784chr242353 1663 865 748 12188 ----
NM_181794chr62144 138 --194 --
NM_181795chr62144 138 --194 --
NM_181836chr532331 1808 873 ----1154
NM_181839chr881332 1326 1288 1269 478 354 161 107 ------
NM_181869chr122580 463 --22242 2074 145
NM_181876chr432055 740 188 --1889 32465 2314 272
NM_181897chr312586 157 --1659
NM_182485chr452935 1041 970 208 58 --1892 12740
NM_182503chr6115388 5225 4119 3570 3396 1958 1574 1419 1249 1049 468 ------
NM_182515chr1985658 4234 4218 4141 2316 2271 2045 1947 --16669 1178
NM_182551chr223552 202 --12459 --
NM_182553chr111582 ------
NM_182641chr1742010 1828 1371 236 ------
NM_182646chr452935 1041 970 208 58 --1892 12740
NM_182648chr141627 1561 ----
NM_182649chr201241 ------
NM_182666chr31676 1564 ----
NM_182691chr71907 --1168 11374
NM_182692chr71907 --1168 11374
NM_182715chr7------1955
NM_182757chr673221 2866 2208 1056 768 637 571 --11412 --
NM_182764chr2011231 ------
NM_182767chr1231579 769 118 11826 ----
NM_182796chr5----1103 --
NM_182797chr202651 341 ------
NM_182798chr561222 1131 522 438 326 320 ------
NM_182799chr561222 1131 522 438 326 320 ------
NM_182801chr561222 1131 522 438 326 320 ------
NM_182898chr746228 4272 1740 453 25360 1668 ----
NM_182899chr746228 4272 1740 453 25360 1668 ----
NM_182910chr142861 175 1295 ----
NM_182913chr142861 175 1295 ----
NM_182914chr142861 175 1295 ----
NM_182915chr282061 2043 1696 1637 840 733 375 98 --1324 --
NM_182920chr3----1255 11140
NM_182931chr71626 1639 ----
NM_182948chr153139 2862 2490 1124 1107 ------
NM_182964chr1152908 2307 2148 837 257 ----12250
NM_182972chr192458 2198 2191 2135 1734 956 645 278 152 12120 ----
NM_182975chr121183 1165 ----11107
NM_182977chr511108 ------
NM_183004chr1453242 3151 3006 1487 1061 --2553 139 12398
NM_183043chr13176 ------
NM_183044chr13176 ------
NM_183078chr683830 3609 3270 3111 3017 2874 2657 2360 23813 340 --11192
NM_183238chr1283872 3853 3843 3292 2359 686 578 262 13135 12818 12708
NM_183353chrX1797 --1908 --
NM_183380chr6--186 ----
NM_183419chr82583 151 ------
NM_194247chr242957 817 464 340 23035 690 ----
NM_194278chr1464017 3938 3705 3093 191 138 ------
NM_194283chr542976 887 663 111 12780 ----
NM_194285chr1142132 745 547 385 21129 22 --11066
NM_194291chr831977 801 148 --11928 --
NM_194301chr142729 355 --1314 --
NM_194314chr155520 5341 4892 4016 214 25595 1486 15208 25498 4163
NM_194328chr972968 2706 2565 2492 1154 983 134 --1394 13073
NM_194329chr972968 2706 2565 2492 1154 983 134 --1394 13073
NM_194330chr972968 2706 2565 2492 1154 983 134 --1394 13073
NM_194332chr972968 2706 2565 2492 1154 983 134 --1394 13073
NM_194434chr1885045 3998 3531 1550 1535 1503 895 521 45087 4845 4625 1117 ----
NM_194463chrX--1965 ----
NM_197941chr552127 1198 760 711 632 2174 113 32855 2261 744 1270
NM_198057chrX31177 1052 782 ----11094
NM_198066chr1442913 2769 2592 1937 43026 2732 674 181 ----
NM_198077chr13476 208 74 ----1215
NM_198081chr652313 1183 1054 587 234 2690 147 ----
NM_198128chr1811980 11997 ----
NM_198151chr7--1595 ----
NM_198181chr1532684 1109 796 11882 --22941 871
NM_198195chr32705 466 ------
NM_198215chr101558 ------
NM_198240chr1221290 71 ------
NM_198268chr154153 3948 3537 1358 234 --23185 406 --
NM_198269chr154153 3948 3537 1358 234 --23185 406 --
NM_198270chrX23388 791 2582 263 12577 43445 2900 2738 1219
NM_198279chrX11072 11003 ----
NM_198336chr741832 1329 1301 377 11223 ----
NM_198353chr4--1116 ----
NM_198391chr2031458 1438 349 --11210 1330
NM_198396chr171347 ------
NM_198400chr1532425 2059 398 12356 --1388
NM_198450chrX21413 864 ----1183
NM_198465chrX42433 1996 743 412 ----1254
NM_198468chr684559 3918 1134 557 485 447 357 185 24537 1493 14437 13774
NM_198504chr33615 369 89 ----1770
NM_198513chr841736 1346 612 320 11531 11777 11238
NM_198521chr12--1119 ----
NM_198569chr612357 32589 470 142 12640 --
NM_198581chr2107179 5988 5754 2522 1888 1554 824 733 161 37 --46007 2549 2220 744 22799 2659
NM_198829chr741441 1334 1318 589 ------
NM_198830chr171237 1703 ----
NM_198844chr173952 677 268 ------
NM_198859chr343478 1582 924 833 13660 1910 --
NM_198896chr1122040 1556 --11546 --
NM_198935chr2043161 2122 1041 215 22924 2611 185 22739 2218
NM_198965chr12------1160
NM_198966chr12------1160
NM_199003chr831386 1155 43 --11370 161
NM_199005chr91782 ------
NM_199039chr421120 939 --1226 --
NM_199040chr1283853 3691 3049 2679 2543 412 320 232 12651 ----
NM_199072chr752441 1998 1182 875 655 --1899 --
NM_199129chr2011139 ------
NM_199132chr1942132 1747 622 269 ------
NM_199188chr1263813 3685 3075 939 819 145 --21603 56 11582
NM_199190chr1263813 3685 3075 939 819 145 --21603 56 11582
NM_199229chr221396 142 --1437 --
NM_199320chr442917 2366 680 168 --1444 --
NM_199320chr442917 2366 680 168 --1444 --
NM_199321chr173952 677 268 ------
NM_199324chr463754 3528 3430 2895 899 625 12923 11057 --
NM_199327chr41947 ------
NM_199355chr1641267 519 118 106 1470 ----
NM_199421chr1453848 3199 1861 866 354 12010 13266 --
NM_199436chr21319 1885 12594 --
NM_199437chr1152192 1903 1578 788 334 ------
NM_199438chr1152192 1903 1578 788 334 ------
NM_199439chr1152192 1903 1578 788 334 ------
NM_199454chr1114641 4562 4389 3804 3657 3589 3237 2990 2953 926 612 14003 13831 11499
NM_199461chr102810 774 ------
NM_199482chr21581 ----12027
NM_201263chr13413 296 131 1649 --12102
NM_201266chr2103012 2641 2054 2014 1105 963 777 355 298 236 --22973 559 --
NM_201278chr1162289 2177 1480 913 402 360 ------
NM_201279chr2103012 2641 2054 2014 1105 963 777 355 298 236 --22973 559 --
NM_201281chr1162289 2177 1480 913 402 360 ------
NM_201432chr1776079 5360 4945 4518 4126 2219 249 24101 1919 ----
NM_201433chr1776079 5360 4945 4518 4126 2219 249 24101 1919 ----
NM_201434chr17----1577 --
NM_201436chr72864 700 ------
NM_201439chr123353 93 64 ------
NM_201440chr123353 93 64 ------
NM_201515chr123353 93 64 ------
NM_201516chr72920 756 ------
NM_201517chr72864 700 ------
NM_201591chr441740 1545 1387 689 --1743 11408
NM_201592chr441740 1545 1387 689 --1743 11408
NM_201999chr42793 422 ------
NM_203282chr19------11372
NM_203327chr2064328 4160 4117 3769 1341 149 34539 1225 1041 ----
NM_203341chr11359 ------
NM_203349chr1542227 1927 1629 567 --11635 1108
NM_203350chr151729 1479 602 545 145 1157 ----
NM_203351chr1772418 2394 2240 1941 1818 773 627 1100 --22428 2093
NM_203379chr104766 369 46 34 1901 ----
NM_203380chr104766 369 46 34 1901 ----
NM_203391chrX21570 149 ----21736 1655
NM_203394chr1262365 823 779 699 385 174 1464 1715 1671
NM_203406chr531807 878 677 --12290 --
NM_203437chr21638 2350 279 ----
NM_203451chr1331507 740 657 ------
NM_203459chr142564 1914 1667 1602 ------
NM_203486chr19----1209 --
NM_203487chr1341703 476 367 236 ------
NM_203488chr141285 ------
NM_203499chr171849 1858 ----
NM_205768chr152074 1864 1657 667 536 11752 11908 --
NM_205836chr51643 ------
NM_206594chr173517 3501 3132 2553 2459 2419 1431 ----1631
NM_206595chr173517 3501 3132 2553 2459 2419 1431 ----1631
NM_206839chr151588 ------
NM_206853chr661575 1548 1528 959 619 598 23150 710 1812 11375
NM_206854chr631880 1859 543 24411 1971 12073 --
NM_206876chr233113 1386 753 --23380 1400 --
NM_206907chr532709 2453 204 --23226 2435 --
NM_206909chr8108241 8218 7760 5686 2642 2421 1418 969 229 101 25849 3145 27739 5903 27848 375
NM_206925chr1542188 1968 924 251 --32658 2275 591 1263
NM_207032chr20----11067 11363
NM_207033chr201557 --1975 11271
NM_207034chr201557 --1975 11271
NM_207171chr171357 787 676 547 414 286 255 21671 160 ----
NM_207299chr91292 --187 --
NM_207306chr1274358 4102 3927 3790 1267 1231 1195 1159 1123 1051 943 907 875 803 767 731 695 659 587 551 515 479 443 287 265 201 147 ----1426
NM_207362chr2173 1436 --189
NM_207390chr192723 87 --1699 --
NM_207406chr496259 5946 5193 4980 4277 2631 1107 617 173 26340 5874 26180 5861 155
NM_207435chr1231077 819 291 ------
NM_207442chr14----1988 --
NM_207481chr21460 --180 --
NM_207491chr411116 --11425 --
NM_207506chr831427 570 128 --1257 --
NM_207520chr22885 151 1915 --1927
NM_207521chr22885 151 1915 --1927
NM_207645chr112833 165 1926 ----
NM_213589chr255350 5126 4091 2140 1283 21428 70 12003 --
NM_213594chr1251248 1076 995 971 842 1855 ----
NM_213609chr321023 145 ------
NM_213654chr331486 1271 397 ----1247