TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-27b-5p
miRNA Sequence: AGAGCUUAGCUGAUUGGUGAAC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr51268 1135 ----
NM_000016chr11610 ------
NM_000020chr1251994 1875 1549 296 213 22038 1519 1473 --
NM_000037chr811944 --11555 --
NM_000052chrX22798 850 ------
NM_000061chrX1431 180 ----
NM_000070chr151491 ------
NM_000081chr131845 1445 180 ----11194
NM_000084chrX96473 5001 2644 2349 2169 1150 947 708 200 46369 4891 4867 1586 16285 --
NM_000089chr71725 ------
NM_000090chr2----1908 --
NM_000092chr214008 --44265 3447 3068 1658 --
NM_000109chrX32238 2077 1711 11677 ----
NM_000112chr595172 4975 4099 2115 1847 1613 1488 1458 718 35491 3391 1998 24447 807 --
NM_000125chr664076 1705 1517 682 539 332 24098 1533 1790 --
NM_000138chr1542431 1926 1813 218 11633 11779 --
NM_000139chr1132269 761 640 1964 ----
NM_000142chr411391 ------
NM_000146chr191135 ------
NM_000163chr5--32048 1975 1903 ----
NM_000165chr6----1516 --
NM_000176chr523636 2435 21216 774 13051 --
NM_000210chr231547 354 208 12219 ----
NM_000212chr1742475 1628 888 243 22491 2272 21986 249 --
NM_000214chr2041548 1240 264 119 11348 21626 299 --
NM_000216chrX2675 615 12984 22519 44 12728
NM_000217chr1235132 1612 184 11089 --1937
NM_000222chr432062 796 586 ------
NM_000232chr453222 2998 2098 1273 1080 --12208 --
NM_000255chr61119 ------
NM_000259chr15116202 6077 5713 5181 4586 2354 2347 1867 1592 687 376 --24909 181 15342
NM_000264chr943310 3207 1326 322 1945 1709 --
NM_000274chr10165 1626 ----
NM_000289chr12----1296 --
NM_000310chr131216 1178 963 2253 27 --191
NM_000313chr31839 ------
NM_000314chr1032012 1049 436 23030 2649 ----
NM_000321chr1321476 1238 ----11626
NM_000332chr676353 5352 4552 4523 1231 958 69 12831 15477 --
NM_000333chr31912 1218 ----
NM_000337chr586644 6192 5096 4611 2628 2312 785 464 12279 ----
NM_000340chr341362 988 613 168 11336 1445 --
NM_000346chr1721880 160 --1806 --
NM_000351chrX53878 3746 2909 887 399 54242 742 711 154 40 21640 543 --
NM_000362chr2282934 2921 2873 2519 2391 2380 1038 46 1789 ----
NM_000368chr9114286 4015 3562 3119 3070 1236 1076 990 701 629 76 63415 3139 1790 543 384 106 33965 3092 617 --
NM_000379chr221019 334 1384 --1996
NM_000387chr3--2744 22 ----
NM_000388chr331213 1066 832 --2942 796 --
NM_000390chrX53416 3314 3041 2521 737 --22720 1038 1691
NM_000393chr21701 ----12048
NM_000397chrX72541 2149 1977 719 390 181 164 ------
NM_000399chr10--21161 237 ----
NM_000408chr223136 662 --22335 2265 22959 450
NM_000411chr213977 721 181 1761 1663 --
NM_000430chr1723009 131 13494 2748 77 --
NM_000439chr522133 277 1179 --1166
NM_000444chrX1249 1383 ----
NM_000448chr1121108 173 1237 ----
NM_000461chr364241 1579 1114 921 893 884 14663 13662 24640 802
NM_000480chr112442 375 --11165 --
NM_000489chrX43025 2998 2103 896 12156 ----
NM_000493chr681057 974 700 348 342 225 130 87 ------
NM_000495chrX21011 873 ----1441
NM_000508chr42890 283 ------
NM_000516chr201228 ------
NM_000533chrX2285 39 --21703 1437 --
NM_000539chr331377 1329 161 11432 1119 --
NM_000555chrX107824 6526 6216 4949 2887 2627 2215 1840 1638 996 22031 291 26683 2570 --
NM_000572chr16837 392 354 307 251 174 ------
NM_000582chr42370 199 ------
NM_000596chr71171 ------
NM_000611chr11106632 6433 6411 4805 2623 2280 2258 1867 1188 1049 22665 1579 14842 26490 2337
NM_000615chr1142685 2156 1100 512 22569 344 ----
NM_000618chr1285948 5696 5025 4541 4509 644 615 101 --14060 --
NM_000618chr1285948 5696 5025 4541 4509 644 615 101 --14060 --
NM_000633chr1885010 4916 4879 4818 4691 3784 1538 725 23920 1103 ----
NM_000663chr1652506 1099 996 954 486 12606 --12937
NM_000675chr22----1858 --
NM_000685chr32165 152 ------
NM_000685chr32165 152 ------
NM_000689chr92116 27 1517 ----
NM_000700chr9------168
NM_000719chr12126468 6303 5447 5425 5105 4438 2678 1741 1666 686 608 514 12448 14748 --
NM_000745chr154734 119 105 81 1303 ----
NM_000791chr562490 983 651 373 231 26 22193 2078 1867 --
NM_000793chr1464447 4091 1923 1287 1155 756 21320 832 13361 --
NM_000800chr521602 452 ------
NM_000807chr41492 1586 ----
NM_000813chr554047 3501 1768 1618 1548 32089 1650 322 ----
NM_000814chr1521403 420 ------
NM_000817chr21150 11169 1791 --
NM_000829chr1121878 346 --12248 1174
NM_000831chr1106193 5951 5511 5055 4757 4146 4015 1976 1781 165 1471 11918 --
NM_000839chr31388 ------
NM_000859chr521596 305 31551 339 80 1485 1493
NM_000868chrX12189 12124 12302 --
NM_000872chr1041455 649 511 296 ------
NM_000875chr1527066 4610 15327 21521 1114 --
NM_000891chr1753396 2731 2273 696 230 21018 482 1160 --
NM_000899chr1254023 2809 1430 1387 1170 ------
NM_000901chr421585 34 22459 391 ----
NM_000919chr52151 77 1189 ----
NM_000921chr122517 196 --1266 --
NM_000926chr1178090 7382 6094 6044 5720 3414 1540 17749 12461 --
NM_000933chr202492 296 ------
NM_000949chr53894 647 107 ------
NM_000956chr142822 134 --1281 --
NM_000961chr2073868 3762 3660 3099 2864 373 196 --13013 12758
NM_000965chr33861 317 245 ------
NM_001001323chr1252533 785 454 295 42 ------
NM_001001342chr10--1273 --11287
NM_001001349chr1721333 115 11698 --11523
NM_001001395chr1272683 2655 2512 1878 1761 1721 451 1744 ----
NM_001001396chr1114446 3552 2896 2842 2807 1481 1365 1186 843 661 150 --34296 3946 471 --
NM_001001419chr584909 4746 4466 4215 1885 1206 381 81 ------
NM_001001420chr584909 4746 4466 4215 1885 1206 381 81 ------
NM_001001433chr2082816 2693 2342 1140 809 773 669 299 ------
NM_001001481chr831046 877 290 --21368 278 --
NM_001001483chr112363 143 ------
NM_001001484chr1022277 2039 ------
NM_001001549chr722093 621 --12479 --
NM_001001550chr722093 621 --12479 --
NM_001001555chr722093 621 --12479 --
NM_001001556chr1521489 154 ------
NM_001001664chr252626 1643 661 519 346 13051 33668 480 427 --
NM_001001665chr292788 2382 2243 1323 1144 1037 800 649 417 ----1777
NM_001001711chr114896 236 227 60 ------
NM_001001713chr211333 ------
NM_001001890chr2133678 638 583 11084 13535 13736
NM_001001933chr12506 441 ------
NM_001001974chr1041911 1778 674 137 ------
NM_001001995chrX31509 677 466 ------
NM_001002027chr17----175 --
NM_001002243chr21798 1110 ----
NM_001002255chr61343 ------
NM_001002257chr253299 2746 2291 663 452 --23378 721 22595 68
NM_001002811chr111385 11611 ----
NM_001002812chr111385 11611 ----
NM_001002812chr111385 11611 ----
NM_001002814chr853774 2993 2484 408 98 23527 395 ----
NM_001002838chrX21342 340 ----1289
NM_001002860chr1464182 3442 3279 1789 1521 784 34406 3109 893 14173 --
NM_001003407chr10114812 4789 4643 4110 1696 1688 1450 1041 790 607 245 24492 3763 11624 --
NM_001003408chr10114812 4789 4643 4110 1696 1688 1450 1041 790 607 245 24492 3763 11624 --
NM_001003652chr18158540 8436 8373 7294 7118 6303 5604 5463 3419 3282 3263 2286 1971 1356 1340 37217 3154 100 37875 6211 2301 --
NM_001003674chr18106812 6463 5001 2659 1772 1195 907 816 633 549 16442 1860 --
NM_001003675chr18106812 6463 5001 2659 1772 1195 907 816 633 549 16442 1860 --
NM_001003712chr1284064 3340 2857 2623 1089 1063 626 202 ------
NM_001004051chrX3331 268 239 ------
NM_001004065chr933768 3251 1481 12685 13103 --
NM_001004317chr623301 3221 --1677 11574
NM_001004342chr1105749 5682 5441 4695 4432 2450 1935 1387 1037 335 24487 1713 15035 175
NM_001004360chr241887 1864 1806 407 41471 1236 592 42 --11463
NM_001004419chr1254632 4099 4089 3778 2798 33526 3160 1350 14311 24596 4119
NM_001004431chr172227 173 ------
NM_001005368chr10122 ------
NM_001005375chrY31419 519 141 ------
NM_001005386chr251878 1673 510 282 152 --11762 --
NM_001005404chr1773031 2773 1194 1188 896 555 477 ------
NM_001005473chr524630 1102 143 ----
NM_001005474chr321389 101 ----11040
NM_001005502chr1254475 4268 3655 1047 1007 11358 12062 --
NM_001005609chrX43804 3565 3524 1419 11337 ----
NM_001005743chr1441366 1298 542 213 11252 ----
NM_001005744chr1441366 1298 542 213 11252 ----
NM_001005745chr1441366 1298 542 213 11252 ----
NM_001005781chr21161 ------
NM_001005845chr841403 1313 430 225 ------
NM_001006115chr32694 205 1929 1989 --
NM_001006634chr16196 ------
NM_001006635chr2--1261 ----
NM_001006946chr251523 707 584 575 166 ------
NM_001007023chr1464447 4091 1923 1287 1155 756 21320 832 13361 --
NM_001007024chr1744398 4298 954 161 14134 13683 13076
NM_001007025chr1744398 4298 954 161 14134 13683 13076
NM_001007075chr431023 1000 690 ----1400
NM_001007097chr984620 4498 3351 1099 807 687 183 66 ------
NM_001007098chr14603 314 91 37 127 ----
NM_001007099chr12774 317 ------
NM_001007100chr12774 317 ------
NM_001007102chr651586 1386 451 232 179 145 11419 --
NM_001007156chr1571847 1587 1311 780 744 70 45 1553 11789 --
NM_001007214chr13711 354 76 ------
NM_001007237chr172433 2157 1103 1036 923 138 46 ------
NM_001007246chr2141799 1545 219 210 2727 652 ----
NM_001007257chr11100 ------
NM_001007277chr1121110 71 ------
NM_001007559chr1811363 ------
NM_001007565chr3--190 ----
NM_001007794chr11720 ------
NM_001008239chr1843216 3119 2810 1095 171 ----
NM_001008392chr362996 1436 1267 1088 638 283 --12762 --
NM_001008405chr73125 116 86 ------
NM_001008408chr7105959 5403 5134 4212 4141 1467 1224 484 366 29 1451 11900 --
NM_001008495chr852270 1533 1388 845 84 21562 606 ----
NM_001008530chr14121 ------
NM_001008539chr864261 3767 2029 1781 1384 569 24178 872 --14370
NM_001008540chr22494 51 ------
NM_001008541chr1041523 809 479 394 1565 12092 --
NM_001008541chr1041523 809 479 394 1565 12092 --
NM_001008738chr522845 2450 --12266 --
NM_001008895chr131289 21016 156 11386 --
NM_001008925chr452937 2571 1419 1348 491 --1598 --
NM_001009554chr434692 2882 875 --11314 1804
NM_001009554chr434692 2882 875 --11314 1804
NM_001009555chr42209 111 1292 --11119
NM_001009571chr711658 --11169 --
NM_001009881chr11634 ------
NM_001009882chr11634 ------
NM_001009894chr1231207 1171 599 1545 2227 219 1322
NM_001009899chr352552 2301 1972 1408 372 16149 11010 --
NM_001009955chr11405 ------
NM_001009955chr11405 ------
NM_001009993chr234344 673 320 1711 --14500
NM_001009996chr31104 ------
NM_001009997chr101353 ------
NM_001010861chr132613 867 855 --1170 12269
NM_001010862chrX52671 1179 857 611 357 12922 ----
NM_001010867chr1116591 6128 5937 5866 5587 4863 4142 2493 1273 1089 884 22032 1701 26649 830 --
NM_001010888chrX54329 4054 3281 1465 929 11360 23011 1053 11323
NM_001010891chr5126476 6469 6429 6171 4941 2484 2400 1333 1302 988 820 163 35877 2121 1345 ----
NM_001010895chr931680 1444 1356 --21555 541 --
NM_001010922chr1114152 4000 3383 2824 1627 1135 1049 800 564 467 135 11690 ----
NM_001010927chr63533 410 154 ------
NM_001010934chr71477 1338 --1284
NM_001010984chr152356 2003 1827 1675 276 1520 ----
NM_001010986chrX42158 1637 1567 176 ------
NM_001011513chr483991 3259 2789 2506 1362 1271 949 524 --22940 236 13146
NM_001011515chr41311 ----1428
NM_001011516chr41311 ----1428
NM_001011546chr20128 --1619 1257
NM_001011658chrX21888 70 --22090 579 --
NM_001011666chr755719 5684 5025 4792 4549 --66439 6281 6081 6009 4347 634 15846
NM_001011708chr272741 2468 1914 1100 988 880 249 12144 12937 --
NM_001012333chr112316 205 ------
NM_001012334chr112316 205 ------
NM_001012393chr1185199 4527 4212 3708 3291 1612 1603 345 24838 752 ----
NM_001012398chr161291 --1884 --
NM_001012410chr31350 ------
NM_001012420chr1572950 2802 2714 2166 1055 780 345 --1452 1146
NM_001012423chr1582950 2802 2714 2166 1055 780 345 144 --1452 --
NM_001012751chr101632 ------
NM_001012755chrX84663 4309 3655 3312 3235 3133 560 135 14108 1347 --
NM_001012989chrX1514 --1618 --
NM_001013031chr1053045 2413 835 489 445 ------
NM_001013399chr62431 147 1731 ----
NM_001013406chr721276 500 --1574 11328
NM_001013415chr41540 21024 494 ----
NM_001013438chr34823 218 167 69 ------
NM_001013439chr32669 64 ------
NM_001013620chr12118339 7787 7056 6945 2723 1140 869 643 501 303 279 1188 16688 --
NM_001013746chr73579 495 415 ------
NM_001014283chr1342063 1817 744 184 ------
NM_001015045chr452164 2034 1938 1657 1634 1414 ----
NM_001015048chr1462982 2571 2135 796 742 718 12921 --11169
NM_001015049chr1462982 2571 2135 796 742 718 12921 --11169
NM_001015508chr81682 166 ----
NM_001015877chrX72625 1004 610 541 338 316 292 --1618 --
NM_001015881chrX11157 ------
NM_001017368chr1742817 2666 1024 711 ------
NM_001017369chr43866 803 179 1331 21098 258 --
NM_001017371chr21483 --170 --
NM_001017395chr353583 2709 2340 2300 1392 ------
NM_001017424chr121827 1742 ----2550 100
NM_001017425chr121827 1742 ----2550 100
NM_001017524chr1151133 374 285 269 164 ------
NM_001017923chr1421200 390 1677 1668 --
NM_001017926chr821221 191 --21502 1268 1419
NM_001017967chr162923 720 ------
NM_001017995chr594861 4788 4202 4087 4041 3769 3592 1281 726 1215 13346 --
NM_001018037chr921307 503 ------
NM_001018054chr111062 11004 ----
NM_001018056chr91138 ------
NM_001018065chr985220 4332 4075 3718 2427 1509 476 24 21235 280 35695 4112 2035 --
NM_001018066chr985220 4332 4075 3718 2427 1509 476 24 21235 280 35695 4112 2035 --
NM_001018067chr1114642 4586 3853 3479 3243 1997 1213 894 388 348 54 23762 3631 --13523
NM_001018068chr1114642 4586 3853 3479 3243 1997 1213 894 388 348 54 23762 3631 --13523
NM_001018069chr1114642 4586 3853 3479 3243 1997 1213 894 388 348 54 23762 3631 --13523
NM_001018074chr523636 2435 21216 774 13051 --
NM_001018075chr523636 2435 21216 774 13051 --
NM_001018076chr523636 2435 21216 774 13051 --
NM_001018077chr523636 2435 21216 774 13051 --
NM_001018111chr743670 2889 1534 39 53372 2936 2760 2604 1224 --1219
NM_001018115chr31632 --1668 --
NM_001018136chr171128 ------
NM_001018137chr171128 ------
NM_001018138chr171128 ------
NM_001018139chr171128 ------
NM_001020658chr13620 601 366 ------
NM_001020658chr13620 601 366 ------
NM_001023567chr1552194 2101 1655 783 144 --2454 346 --
NM_001024094chr523636 2435 21216 774 13051 --
NM_001024218chr14123 ------
NM_001024463chr1511090 ------
NM_001024647chr1265776 5497 2154 2041 1602 1016 15620 ----
NM_001024649chr531933 606 127 --2992 830 --
NM_001024660chr321168 389 ----1339
NM_001024668chr121874 ------
NM_001024680chr231329 559 146 11632 --1403
NM_001024807chr191241 ------
NM_001024847chr361765 1622 983 538 212 130 --1709 --
NM_001024947chr5--1885 ----
NM_001024948chr153290 2317 704 139 128 21377 212 ----
NM_001024956chr11115177 5167 5120 4714 4511 4254 2078 1696 1557 1084 329 23666 608 --14827
NM_001025068chr341675 341 324 90 11283 ----
NM_001025069chr341675 341 324 90 11283 ----
NM_001025076chr1085116 5019 4944 2234 2202 1549 964 804 36097 5183 2060 ----
NM_001025077chr1076474 6377 6302 5043 2907 2322 2162 37455 6541 1038 ----
NM_001025079chr394073 3988 3882 3119 3087 2806 2752 1389 162 13073 24153 3534 --
NM_001025105chr511357 ------
NM_001025108chr221293 450 33272 3261 816 ----
NM_001025389chr112442 375 --11165 --
NM_001025390chr112442 375 --11165 --
NM_001025579chr171474 ------
NM_001025580chrX53908 3578 2993 1012 132 23274 1175 ----
NM_001025595chr411320 ----1652
NM_001025616chr441249 604 367 343 ------
NM_001025780chr911366 21347 474 ----
NM_001029858chr642084 486 180 140 1158 --13314
NM_001029863chr663150 2257 2006 731 383 93 ----1866
NM_001029875chr542697 2641 2484 944 --1950 --
NM_001029884chr632640 2595 905 ------
NM_001030001chr14--175 ----
NM_001030006chr1762674 2556 2366 1977 1781 1649 1335 ----
NM_001030007chr1663858 3775 2894 2831 1350 756 --1571 --
NM_001030055chr1494679 4514 4481 4393 3755 3464 3196 3140 1429 --11493 --
NM_001030272chr11--176 ----
NM_001030273chr11--176 ----
NM_001031684chr241498 1261 1194 502 ------
NM_001031695chr2264876 4801 3711 3552 1281 819 24903 3581 14013 --
NM_001031700chr432495 1691 294 12467 --11631
NM_001031723chr4157 ------
NM_001031732chr463501 2845 2373 2332 2313 1162 2942 110 ----
NM_001031745chrX1112 145 ----
NM_001031803chr171273 ------
NM_001031804chr1673604 3543 3114 3077 3007 1702 662 --13437 --
NM_001031812chr52306 203 1484 ----
NM_001032280chr62569 305 ------
NM_001032282chr81232 ------
NM_001032288chr202195 123 ------
NM_001032293chr17174 ------
NM_001032296chr1352618 2514 2259 815 379 12962 ----
NM_001032381chrX139 ------
NM_001032382chrX139 ------
NM_001032383chrX139 ------
NM_001032384chrX139 ------
NM_001032393chrX1192 1271 ----
NM_001033044chr131696 1668 227 1569 --11594
NM_001033047chr42993 485 ----11919
NM_001033049chr2142297 2040 737 331 --1917 --
NM_001033056chr131696 1668 227 1569 --11594
NM_001033057chr342144 2037 1757 391 ------
NM_001033081chr161699 653 508 463 388 381 11853 ----
NM_001033082chr161699 653 508 463 388 381 11853 ----
NM_001033085chr22212 28 ------
NM_001033112chr53853 819 82 ------
NM_001033503chr51177 1338 ----
NM_001033554chr172285 255 ------
NM_001033561chr172246 184 ------
NM_001033566chr171366 --167 --
NM_001033568chr171366 --167 --
NM_001033578chr852319 2249 2231 1964 308 ----21924 218
NM_001033723chr822193 761 22399 2132 22377 361 --
NM_001033925chr1031387 183 39 ----1415
NM_001034837chr5------1302
NM_001034838chr5------1302
NM_001034841chr16115069 3975 2110 1633 1096 1087 979 660 504 346 133 14953 23646 1640 23985 1469
NM_001034845chr42440 280 21153 429 ----
NM_001034852chr1421285 249 ------
NM_001034915chr851481 1224 409 343 197 ------
NM_001035260chr1031351 404 317 ----1144
NM_001037131chr21451 11124 ----
NM_001037132chr742135 1633 1512 638 ------
NM_001037133chr742135 1633 1512 638 ------
NM_001037164chr792012 1958 1854 1714 1677 1268 596 519 116 ------
NM_001037174chr22649 207 1485 11754 --
NM_001037317chr132613 867 855 --1170 12269
NM_001037332chr551927 1710 1703 1008 554 12325 ----
NM_001037333chr551927 1710 1703 1008 554 12325 ----
NM_001037334chr1832082 1992 704 2269 240 ----
NM_001037339chr131296 307 207 --1483 --
NM_001037340chr131296 307 207 --1483 --
NM_001037341chr131296 307 207 --1483 --
NM_001037341chr131296 307 207 --1483 --
NM_001037535chrX21188 1074 ------
NM_001037536chrX21188 1074 ------
NM_001037540chrX21188 1074 ------
NM_001037553chr2154530 4488 3579 3275 749 ----23487 968
NM_001037582chr431702 588 534 --11254 11244
NM_001037637chr51246 ------
NM_001037954chr1172922 2893 2515 1383 1019 801 122 12196 ----
NM_001038493chr231554 1223 540 11352 ----
NM_001038707chr13805 550 430 1250 21762 1555 --
NM_001038707chr13805 550 430 1250 21762 1555 --
NM_001039199chr2084828 3113 2005 1987 1949 1258 903 676 ------
NM_001039366chr222181 53 ------
NM_001039538chr242310 614 522 473 13424 22623 46 --
NM_001039547chr387808 7601 6899 5996 5222 1696 1455 541 21679 66 24989 116 25405 567
NM_001039573chr171120 1177 ----
NM_001039577chr153979 2795 873 487 75 --1531 --
NM_001039585chr143677 1620 1019 515 --1131 1668
NM_001039618chr1195604 4728 4700 3896 3748 2290 1531 652 244 ----12183
NM_001039690chr16--21694 230 ----
NM_001039693chr243708 3022 1439 515 13196 23903 3746 --
NM_001039716chr13285 55 35 1919 ----
NM_001039762chr1031945 1766 770 --12374 --
NM_001039792chr91505 ------
NM_001039840chrX45303 4956 1350 368 --1413 --
NM_001039937chr1374019 3674 3637 3201 2750 1050 455 1643 11574 --
NM_001039960chr1231415 479 52 ------
NM_001040020chr71983 ------
NM_001040057chr721225 957 ----11005
NM_001040058chr42370 199 ------
NM_001040060chr42370 199 ------
NM_001040102chr101993 ----12043
NM_001040103chr101993 ----12043
NM_001040142chr2--11563 ----
NM_001040143chr2--11563 ----
NM_001040144chr16--21694 230 ----
NM_001040146chr16--21694 230 ----
NM_001040147chr181699 ------
NM_001040152chr7124522 4325 4089 3792 3670 3318 3129 1501 1430 1236 819 768 24867 3580 ----
NM_001040157chr432606 442 402 ------
NM_001040159chr421227 271 ------
NM_001040167chr731148 398 93 ------
NM_001040202chr462553 2375 2272 1767 618 599 ------
NM_001040214chr652252 2051 626 410 375 1296 ----
NM_001040272chr952199 1683 1649 1632 623 1747 176 --
NM_001040284chr1675831 5358 4683 4202 1927 1524 280 15047 ----
NM_001040402chr452845 2464 1096 1040 644 --1946 --
NM_001040409chr2--1134 1671 --
NM_001040429chr1353223 2303 1383 1312 835 --22840 2731 --
NM_001040440chr53240 144 48 ------
NM_001040441chr143471 2107 2077 2038 13400 13629 14301
NM_001040446chr582662 2654 2334 1996 1713 893 558 398 1434 ----
NM_001040633chr71709 ----1149
NM_001040647chr741376 592 441 146 ------
NM_001040648chr741376 592 441 146 ------
NM_001040665chr794735 4301 4181 3536 3043 2011 1474 1147 35 --33297 1139 354 --
NM_001040712chr933584 2774 654 11218 ----
NM_001041chr3152 ------
NM_001042355chr1694273 3832 3635 3518 1678 937 706 266 260 ------
NM_001042361chr1021204 176 --1416 --
NM_001042364chr1021204 176 --1416 --
NM_001042365chr1021204 176 --1416 --
NM_001042387chr1021204 176 --1416 --
NM_001042388chr181843 ------
NM_001042393chr1021204 176 --1416 --
NM_001042396chr1021204 176 --1416 --
NM_001042397chr1021204 176 --1416 --
NM_001042403chr121973 1302 ----
NM_001042412chr1694273 3832 3635 3518 1678 937 706 266 260 ------
NM_001042425chr62569 305 ------
NM_001042453chrX3401 391 280 --21168 88 --
NM_001042481chr1442535 1819 1711 680 2944 231 166 --
NM_001042494chr1543610 1058 166 137 ------
NM_001042495chr1543610 1058 166 137 ------
NM_001042496chr1543610 1058 166 137 ------
NM_001042497chr1543610 1058 166 137 ------
NM_001042510chr851613 1526 1439 1415 840 11979 ----
NM_001042511chr851613 1526 1439 1415 840 11979 ----
NM_001042533chr333230 2954 2033 --12555 --
NM_001042537chrX41944 864 187 103 ------
NM_001042552chr121024 363 --1928 --
NM_001042555chr1254689 4491 1172 1058 392 ----24398 707
NM_001042599chr287683 6182 5719 5132 2381 2185 1092 739 22456 1475 ----
NM_001042601chr332890 1253 273 22459 232 1998 --
NM_001042604chr373907 3521 3183 1497 1228 137 22 33774 3646 1596 34310 3717 948 11533
NM_001042610chr1641423 1411 1140 104 21003 465 11194 11066
NM_001042632chr2092233 1697 1583 835 819 776 570 312 220 12000 --1826
NM_001042633chr2092233 1697 1583 835 819 776 570 312 220 12000 --1826
NM_001042646chr321327 125 ----12023
NM_001042669chr441249 604 367 343 ------
NM_001042681chr142469 1822 510 265 ------
NM_001042682chr142469 1822 510 265 ------
NM_001042682chr142469 1822 510 265 ------
NM_001042683chr631737 555 498 11549 ----
NM_001042749chrX21704 207 1799 ----
NM_001042750chrX21704 207 1799 ----
NM_001042751chrX21704 207 1799 ----
NM_001042762chr71169 --1107 1280
NM_001043318chr1433786 3212 1028 21349 861 --12951
NM_001044385chr294059 3986 3822 3418 3197 2858 1449 1305 741 32601 968 714 ----
NM_001044722chr52306 203 1484 ----
NM_001044723chr52306 203 1484 ----
NM_001045556chr821280 45 ----11434
NM_001045557chr821280 45 ----11434
NM_001046chr542740 2461 2313 1046 --12883 --
NM_001048183chr163479 3454 3193 3141 1516 269 23030 599 1405 --
NM_001071775chr1321754 36 ------
NM_001079874chr11618 --11396 --
NM_001083621chr1114457 4303 4022 3289 2882 1797 1601 1381 1049 670 154 23996 3004 14612 --
NM_001095chr1231605 1196 634 ----1657
NM_001096chr171188 ------
NM_001099678chr3106395 6178 5167 4573 4565 4452 4060 1918 1360 990 2535 77 15882 --
NM_001100108chr177946 7053 6272 5741 5213 1804 1548 11585 12480 --
NM_001106chr3149642 9124 8986 7508 6870 6052 3632 3412 3261 2472 2326 1541 541 263 36753 6685 2260 39345 7667 7253 --
NM_001113490chrX53608 2971 2902 2420 514 1236 ----
NM_001116chr1632768 2125 1992 ------
NM_001117chr1822401 1553 1290 ----
NM_001121chr1021347 67 ------
NM_001122631chr111227 ------
NM_001122679chr51268 1135 ----
NM_001124chr112461 149 ------
NM_001126chr12355 108 ------
NM_001128chr1663858 3775 2894 2831 1350 756 --1571 --
NM_001135chr151326 ------
NM_001146chr842316 939 864 271 ------
NM_001149chr10130 ------
NM_001151chr4--153 ----
NM_001153chr2--2938 209 1757 --
NM_001160chr1242045 1081 1043 92 ------
NM_001173chr1494679 4514 4481 4393 3755 3464 3196 3140 1429 --11493 --
NM_001174chrX3674 266 201 ------
NM_001177chr1262043 1840 785 644 512 495 21965 1814 12398 --
NM_001178chr11--176 ----
NM_001186chr2133275 846 584 ------
NM_001198chr62100 35 ------
NM_001201chr453515 2619 1582 1568 414 11137 23917 474 --
NM_001204chr297530 7501 7316 7165 6929 5886 4823 4691 203 46988 6857 6366 5679 35364 550 538 25984 968
NM_001206chr953060 2077 2038 825 789 ----12098
NM_001207chr51246 ------
NM_001219chr721850 612 --11823 --
NM_001256chr1732090 1883 90 --1755 21927 842
NM_001257chr1621276 22 11218 ----
NM_001259chr795834 5683 5008 4890 2289 1863 1183 135 23 12437 1824 12363
NM_001260chr131134 ------
NM_001263chr41307 ------
NM_001278chr102858 474 --1882 --
NM_001282chr1762674 2556 2366 1977 1781 1649 1335 ----
NM_001284chr5154 1162 ----
NM_001290chr41891 --1191 --
NM_001292chr15195 --1158 --
NM_001304chr1763031 2902 2887 1182 422 261 11171 ----
NM_001310chr1263046 2601 2093 1086 558 441 --1460 --
NM_001329chr102645 242 --11192 1599
NM_001346chr352323 2225 2010 461 434 11873 ----
NM_001351chr33421 120 53 --1726 --
NM_001356chrX41952 788 610 603 1148 ----
NM_001358chr42114 65 ------
NM_001364chr1144539 3938 1739 335 --13771 11422
NM_001378chr2----1336 --
NM_001387chr532910 2714 1952 13174 12997 12258
NM_001391chr181261 1792 ----
NM_001399chrX43804 3565 3524 1419 11337 ----
NM_001401chr92522 241 ------
NM_001402chr64801 576 201 88 --22057 773 --
NM_001417chr121678 11986 11299 --
NM_001418chr11----1260 --
NM_001418chr11----1260 --
NM_001419chr19104726 4519 4175 4109 3970 1568 1085 482 214 205 --24344 726 --
NM_001420chr1932689 2627 2240 13191 ----
NM_001422chr1111190 122 ----
NM_001430chr241889 549 453 375 11289 11694 --
NM_001432chr453661 1373 1165 262 242 --13056 --
NM_001438chr123678 2701 --21202 906 --
NM_001453chr61322 ------
NM_001465chr542163 1341 819 683 --11830 --
NM_001478chr122607 372 --1746 --
NM_001482chr151783 150 ----
NM_001498chr611061 ------
NM_001527chr694725 3733 3658 3569 3286 3179 1815 1334 293 --23679 1659 23427 1953
NM_001540chr7--1108 ----
NM_001542chr172433 2157 1103 1036 923 138 46 ------
NM_001543chr584080 3848 3731 3343 1777 1412 506 465 14521 ----
NM_001546chr631422 1143 394 21130 376 --1300
NM_001553chr4177 ------
NM_001560chrX52647 2544 2389 1618 970 ----12445
NM_001565chr41201 --1241 --
NM_001567chr111743 ----1210
NM_001584chr1131124 326 281 1883 ----
NM_001609chr1033508 1683 755 23191 2926 ----
NM_001614chr171136 ------
NM_001614chr171136 ------
NM_001616chr263112 2446 981 964 707 57 13441 ----
NM_001618chr12624 87 ------
NM_001621chr752893 2574 2298 1023 383 196 ----
NM_001621chr752893 2574 2298 1023 383 196 ----
NM_001625chr1178 ------
NM_001655chr1131392 316 268 ----1582
NM_001661chr172576 520 ------
NM_001663chr1462637 2046 1984 1957 762 698 --21902 722 --
NM_001668chr12906 89 --32024 1861 474 --
NM_001677chr1140 ------
NM_001679chr32839 648 1312 ----
NM_001682chr1232247 499 168 ------
NM_001684chr1104163 3269 2613 2559 1588 1198 1082 903 560 378 --34013 3663 188 --
NM_001686chr12153 ------
NM_001693chr841177 1016 836 437 ------
NM_001696chr222181 53 ------
NM_001699chr1961547 1405 1360 1150 1127 731 ------
NM_001701chr91631 ----11120
NM_001706chr31307 ------
NM_001709chr1132842 1991 813 ----11095
NM_001717chr15--11142 134 --
NM_001729chr41379 ------
NM_001730chr1311329 ------
NM_001730chr1311329 ------
NM_001735chr9158 1116 ----
NM_001746chr531933 606 127 --2992 830 --
NM_001753chr731397 172 71 ----11317
NM_001754chr2133678 638 583 11084 13535 13736
NM_001755chr1652242 2141 1879 803 338 2367 290 ----
NM_001762chr75896 841 703 156 82 ------
NM_001767chr11438 ------
NM_001777chr394073 3988 3882 3119 3087 2806 2752 1389 162 13073 24153 3534 --
NM_001789chr331742 617 34 ------
NM_001792chr1861076 946 865 354 131 79 ----1196
NM_001800chr191475 ------
NM_001802chr163805 702 638 --1197 --
NM_001833chr92218 58 ------
NM_001839chr1------1107
NM_001845chr1321115 902 --31389 1310 201 --
NM_001854chr141047 1028 198 175 ------
NM_001858chr685147 4780 4058 3181 1922 1073 885 53 14602 14818 1683
NM_001859chr942484 1328 1189 215 12870 33933 2887 1470 --
NM_001874chr1254475 4268 3655 1047 1007 11358 12062 --
NM_001892chr511357 ------
NM_001904chr32707 109 ------
NM_001918chr1169307 9070 8658 7987 7966 7869 7163 6184 3455 3308 3267 3090 2358 2018 521 33 17275 ----
NM_001920chr124632 305 234 213 1550 --1709
NM_001924chr11477 ------
NM_001931chr113459 364 132 ------
NM_001933chr144943 930 233 183 1428 1367 --
NM_001935chr2--131 ----
NM_001938chr151699 1589 1226 337 141 --1689 --
NM_001939chrX32339 1367 238 13554 ----
NM_001949chr6103150 2662 2596 2300 2084 1275 690 569 236 205 22872 2508 12877 12200
NM_001951chr81519 ------
NM_001964chr52907 243 ------
NM_001968chr41693 ------
NM_001969chr1423735 335 13177 13804 --
NM_001977chr421224 533 ------
NM_001981chr142227 1762 308 260 --12186 --
NM_001987chr1233272 1110 600 13092 13648 13768
NM_001995chr421248 271 11145 ----
NM_002006chr4105246 4956 4658 4360 4134 3663 1525 1030 736 521 34821 927 234 --34651 4075 3681
NM_002009chr1552734 991 957 924 799 ------
NM_002015chr1352923 2725 2101 1305 455 --13326 --
NM_002017chr1111352 1434 ----
NM_002024chrX41843 1605 1372 610 ------
NM_002025chrX149239 8605 8510 8449 7022 5747 2905 2818 2437 2059 1905 1754 348 161 --18979 25904 2163
NM_002044chr1521489 154 ------
NM_002048chr931295 244 192 ------
NM_002049chrX1117 ------
NM_002054chr21481 ------
NM_002063chrX1331 ------
NM_002065chr131696 1668 227 1569 --11594
NM_002072chr91931 ------
NM_002074chr121641 1263 ------
NM_002077chr962147 1911 1507 759 496 25 --12059 --
NM_002086chr1712162 1564 ----
NM_002092chr454091 3516 3155 1899 1701 13679 34960 4916 3825 --
NM_002106chr4------1355
NM_002107chr11498 ------
NM_002126chr1771444 1162 1154 640 540 476 452 11235 ----
NM_002128chr1341813 924 638 594 ------
NM_002130chr5----11506 --
NM_002136chr121654 1529 ----
NM_002137chr72551 343 --1921 1818
NM_002139chrX----1129 --
NM_002140chr911146 ------
NM_002147chr171762 --1636 --
NM_002154chr54513 370 48 42 ------
NM_002157chr2155 ------
NM_002158chr252675 2593 1007 796 763 11369 13280 --
NM_002166chr2--1728 ----
NM_002190chr651056 876 415 260 144 11270 ----
NM_002196chr2021087 327 ------
NM_002196chr2021087 327 ------
NM_002199chr42961 779 1246 --1972
NM_002207chr32517 236 ------
NM_002210chr242827 2807 2789 1282 ----1175
NM_002214chr784860 4332 3749 3637 3580 2158 728 687 54702 3826 3674 3588 1690 11151 --
NM_002223chr1273649 2917 1468 1441 738 667 453 23284 2773 --12930
NM_002241chr172934 2220 580 549 416 387 261 --12623 --
NM_002245chr11488 ------
NM_002247chr1042102 1590 559 460 11819 ----
NM_002264chr354516 4060 3831 3715 251 ------
NM_002266chr171165 ------
NM_002267chr1362319 1882 841 806 585 90 11841 ----
NM_002268chr341896 617 408 114 ------
NM_002270chr5135552 5387 5149 4597 4443 3982 2259 2044 1648 1449 1025 487 449 --11405 --
NM_002271chr1341893 1639 845 571 12042 ----
NM_002285chr221293 450 33272 3261 816 ----
NM_002290chr641483 948 102 34 ----1925
NM_002310chr5136014 5943 5469 5149 4864 2343 2333 1896 1669 1232 995 227 133 11545 142 --
NM_002313chr10114812 4789 4643 4110 1696 1688 1450 1041 790 607 245 24492 3763 11624 --
NM_002314chr741068 863 455 277 ------
NM_002336chr1285048 3606 3107 1656 1598 1362 871 795 13879 14828 --
NM_002345chr122588 458 ------
NM_002351chrX61758 1709 1552 437 337 88 --21291 463 --
NM_002356chr632508 1101 733 ------
NM_002373chr15--11382 ----
NM_002374chr242310 614 522 473 13424 22623 46 --
NM_002391chr112316 205 ------
NM_002395chr6----11017 --
NM_002397chr522151 1528 ----1200
NM_002399chr1521141 1061 --11364 --
NM_002402chr741026 872 467 170 ------
NM_002408chr141740 1213 ----
NM_002448chr41786 1522 ----
NM_002469chr12--1336 ----
NM_002480chr123918 598 480 11468 ----
NM_002481chr176824 6490 5895 5844 2878 2538 1624 25251 282 15516 12504
NM_002500chr23825 178 118 ------
NM_002512chr171128 ------
NM_002515chr1441975 686 579 485 ----1676
NM_002524chr131029 176 120 --1378 --
NM_002526chr631684 238 110 2610 455 ----
NM_002527chr12195 ------
NM_002539chr2--1296 ----
NM_002543chr1261199 1137 984 284 222 59 ------
NM_002545chr1185199 4527 4212 3708 3291 1612 1603 345 24838 752 ----
NM_002547chrX43815 3574 3075 1270 1324 ----
NM_002553chr71493 ------
NM_002570chr1531222 1025 305 ------
NM_002578chrX1354 ------
NM_002581chr965669 5388 4502 1253 1022 440 1531 ----
NM_002590chr13155 1503 ----
NM_002595chr1231951 690 531 ------
NM_002600chr131296 307 207 --1483 --
NM_002609chr551425 502 292 127 34 11664 ----
NM_002627chr10163 ------
NM_002628chr31300 ------
NM_002648chr63944 836 57 ------
NM_002655chr8104828 4181 4147 4059 3926 3496 1484 1383 192 165 13262 25108 4367 --
NM_002656chr621051 446 --1884 --
NM_002667chr631269 846 405 1337 ----
NM_002669chr4159 ------
NM_002670chr321574 476 1573 ----
NM_002687chr14--1937 ----
NM_002691chr19154 ------
NM_002698chr1932565 2135 1176 ------
NM_002699chr121504 187 ------
NM_002701chr6--1179 194 --
NM_002709chr273569 3511 3196 2841 1427 1221 385 22791 782 13561 --
NM_002710chr1231003 907 800 ------
NM_002711chr73344 140 35 ------
NM_002715chr511241 ------
NM_002716chr1193333 3052 2534 2316 2306 2276 1044 941 740 1557 ----
NM_002719chr1432254 842 102 22456 1973 ----
NM_002721chr91396 ------
NM_002731chr122261 820 ----127
NM_002734chr1732045 1798 705 11792 ----
NM_002737chr1755815 5004 1605 1399 976 25637 2212 22174 1524 --
NM_002745chr2274065 3651 3559 3510 1219 942 876 21120 1071 ----
NM_002753chr41741 --1819 1326
NM_002755chr151697 ------
NM_002758chr17--165 --1505
NM_002809chr173369 339 42 ------
NM_002810chr11107 ------
NM_002825chr72265 79 ------
NM_002828chr18125 ------
NM_002833chr1531259 1129 637 --11489 --
NM_002835chr7128 ------
NM_002836chr204525 365 356 122 ------
NM_002837chr1224531 1350 --31707 1650 237 --
NM_002839chr933584 2774 654 11218 ----
NM_002844chr631185 548 441 ------
NM_002845chr181561 ------
NM_002849chr124974 929 357 105 ------
NM_002852chr33580 531 191 ------
NM_002857chr132600 1773 243 12590 --1784
NM_002868chr1222085 678 1507 22272 1747 --
NM_002869chr1151562 1362 840 649 540 136 ----
NM_002873chr51482 ------
NM_002890chr531007 184 126 ------
NM_002892chr143688 309 182 11708 ----
NM_002897chr21688 --1168 --
NM_002902chr151501 ------
NM_002906chr1142358 2320 151 35 12419 ----
NM_002911chr1941104 650 605 412 --11676 --
NM_002918chr19163 ------
NM_002922chr13566 525 248 ------
NM_002924chr1--1249 ----
NM_002941chr321509 1203 ------
NM_002942chr33974 527 382 1311 1939 --
NM_002968chr16--1180 ----
NM_002970chrX1114 ------
NM_002971chr3----1894 1941
NM_002973chr121515 ------
NM_002979chr12774 317 ------
NM_002982chr171144 ------
NM_002990chr1642365 1754 662 285 147 ----
NM_002997chr251523 707 584 575 166 ------
NM_002998chr841595 880 723 56 11528 ----
NM_003011chr931560 1380 282 1227 21473 1324 --
NM_003014chr711403 ------
NM_003016chr17--1187 ----
NM_003017chr641293 1191 550 398 11317 196 --
NM_003022chrX41137 462 394 93 ------
NM_003027chr15------1413
NM_003028chr983897 3373 3316 2847 2819 2400 605 339 23141 920 ----
NM_003030chr351872 1801 1770 1710 207 2721 686 ----
NM_003034chr1277237 6878 6243 2094 1721 1644 1041 55980 5205 1294 1168 904 23151 2241 --
NM_003035chr14716 672 621 84 --1174 --
NM_003036chr11299 1190 11252 --
NM_003043chr374171 3197 3077 3002 1373 942 445 32743 1646 857 ----
NM_003045chr1394575 4562 4508 4050 4015 1782 1110 1032 230 14374 ----
NM_003046chr864261 3767 2029 1781 1384 569 24178 872 --14370
NM_003070chr92570 249 ------
NM_003071chr321805 44 --1198 --
NM_003074chr361552 817 542 442 278 42 ------
NM_003076chr1261675 1340 1220 1087 431 219 11515 11687 --
NM_003079chr171839 2892 757 1979 --
NM_003106chr321065 362 ------
NM_003107chr61564 12576 11985 --
NM_003108chr266175 5385 4905 1911 1725 456 15928 26308 5638 --
NM_003111chr21483 --170 --
NM_003112chr753112 2112 2077 2014 229 --1555 --
NM_003115chr1----1423 --
NM_003128chr242774 2352 1888 1821 164 --12106
NM_003129chr81214 ------
NM_003135chr54347 291 277 85 ------
NM_003136chr141270 ------
NM_003137chr662112 1962 1715 1490 538 91 ------
NM_003144chr621694 1590 11888 11599 --
NM_003150chr1732265 2118 1914 12067 --11954
NM_003155chr852466 2065 1737 513 149 --12687 --
NM_003161chr1733474 847 426 ----1819
NM_003162chr22405 358 1199 ----
NM_003178chr331853 659 640 21424 421 ----
NM_003180chr19----195 --
NM_003184chr841148 873 723 58 --1137 --
NM_003199chr1855261 4894 3917 1458 520 11264 22229 686 --
NM_003202chr541314 760 717 638 1683 ----
NM_003216chr2272969 2956 2567 2519 1207 1019 806 ------
NM_003217chr1241536 1365 554 113 21411 457 ----
NM_003220chr62569 305 ------
NM_003221chr683975 3953 3208 3039 2642 1023 1002 777 11146 ----
NM_003222chr202303 190 --1253 --
NM_003234chr332411 1956 1508 22374 2038 11949 --
NM_003242chr361765 1622 983 538 212 130 --1709 --
NM_003246chr1522036 1268 ------
NM_003253chr2141867 1845 1629 610 --1209 --
NM_003274chr2132603 2351 1096 ------
NM_003290chr1941129 158 74 42 ------
NM_003291chr131852 ------
NM_003298chr3115410 5219 5111 4836 4772 4031 3848 2345 1519 702 612 11803 1959 --
NM_003314chr51468 ------
NM_003319chr21276 1134 ----
NM_003337chr541561 1331 196 149 ------
NM_003339chr551244 1168 544 359 274 --11250 11078
NM_003340chr421039 945 --1174 --
NM_003342chr1712805 --1756 --
NM_003348chr1241678 1339 608 512 ------
NM_003349chr202195 123 ------
NM_003350chr81644 ------
NM_003355chr11--2329 263 ----
NM_003373chr1051914 1548 1280 537 467 --11352 1291
NM_003375chr10------1398
NM_003383chr91138 ------
NM_003387chr252945 2766 1941 1167 255 130 12369 --
NM_003388chr762072 1312 828 693 569 425 ------
NM_003390chr1121148 833 ------
NM_003392chr383885 3583 3551 3518 2648 1658 1592 1140 ------
NM_003394chr121749 1108 ----
NM_003404chr201783 2665 564 ----
NM_003406chr821778 1369 11792 11885 --
NM_003410chrX43065 2861 2380 550 ------
NM_003411chrY31382 503 271 ------
NM_003413chrX11887 11574 ----
NM_003423chr1932055 1839 747 ------
NM_003427chr61727 ------
NM_003439chr732995 1256 510 23533 3396 ----
NM_003442chr11--1859 ----
NM_003457chr17174 ------
NM_003463chr643070 2495 1064 100 ------
NM_003467chr22494 51 ------
NM_003468chr263336 3151 824 736 537 348 13105 1874 1586
NM_003470chr1621862 209 --1404 --
NM_003478chr1153336 3288 3180 716 485 1736 ----
NM_003483chr1222572 1877 ------
NM_003489chr2112959 --23100 2110 --
NM_003506chr8------1415
NM_003507chr21140 11604 ----
NM_003566chr1232947 2179 798 --23211 3116 --
NM_003567chr11114 166 ----
NM_003574chr18105733 4635 4572 4398 4298 3965 2198 1784 1589 131 --21861 925 --
NM_003576chr1352618 2514 2259 815 379 12962 ----
NM_003580chr81524 ------
NM_003583chr1252628 2562 2553 698 194 11171 --11522
NM_003589chr131289 21016 156 11386 --
NM_003590chr253906 1354 409 179 60 ------
NM_003592chr71479 176 ----
NM_003603chr41747 11820 2834 236 --
NM_003607chr143816 3686 2851 1582 1695 2766 440 --
NM_003615chr333383 1295 869 ------
NM_003620chr1721057 200 ------
NM_003626chr1111109 ------
NM_003629chr182921 2736 1322 1263 868 604 303 220 ------
NM_003631chr10288 57 ------
NM_003633chr522485 1839 ----136
NM_003637chr1--11579 ----
NM_003642chr22212 28 ------
NM_003644chr17115357 5061 4658 4497 4427 2346 1312 977 817 807 349 ------
NM_003659chr22127 46 ------
NM_003663chr322824 2449 --22854 1197 --
NM_003670chr33991 352 218 1938 ----
NM_003676chr14851 279 125 97 ------
NM_003679chr152941 2847 2785 2632 2621 ------
NM_003701chr131717 ------
NM_003705chr23822 198 101 ------
NM_003709chr21110 ------
NM_003713chr131777 53 21 ------
NM_003714chr543015 2085 580 392 --22734 872 --
NM_003718chr71346 ------
NM_003722chr31274 1749 22648 1669 --
NM_003743chr241411 1389 368 349 11904 ----
NM_003744chr1441366 1298 542 213 11252 ----
NM_003758chr1521389 212 ------
NM_003758chr1521389 212 ------
NM_003762chr111289 ------
NM_003763chr2082816 2693 2342 1140 809 773 669 299 ------
NM_003774chr1293155 2868 2829 2679 790 730 674 524 27 13278 13090 1367
NM_003784chr181699 ------
NM_003795chr62598 63 ------
NM_003798chr91159 ------
NM_003800chr652302 1895 1570 609 530 ------
NM_003812chr2186 ------
NM_003825chr153518 496 80 ------
NM_003829chr92310 134 ------
NM_003839chr183990 878 30 11212 --11020
NM_003846chr11212 1798 ----
NM_003861chr1442817 2768 2163 278 1970 --12360
NM_003870chr151480 --1323 --
NM_003872chr232648 2408 2306 1264 ----
NM_003884chr311875 ------
NM_003887chr222294 1520 ------
NM_003893chr102523 448 ------
NM_003895chr212578 547 ------
NM_003899chr1332368 800 218 --11759 1270
NM_003908chr20128 ------
NM_003909chr832930 1960 238 1270 ----
NM_003913chr621127 538 ------
NM_003930chr71214 ------
NM_003932chr2221767 1628 ------
NM_003941chr731604 783 726 ----11747
NM_003948chr462587 2178 1955 1008 964 335 ------
NM_003966chr576533 5169 2877 2794 2423 1792 772 46559 5620 1500 684 16978 12072
NM_003971chr17196 ------
NM_003972chr1021103 73 ------
NM_003983chr1664269 4125 3854 3790 572 155 23584 2867 --13158
NM_003994chr1254023 2809 1430 1387 1170 ------
NM_004006chrX32238 2077 1711 11677 ----
NM_004007chrX32238 2077 1711 11677 ----
NM_004009chrX32238 2077 1711 11677 ----
NM_004010chrX32238 2077 1711 11677 ----
NM_004011chrX32238 2077 1711 11677 ----
NM_004012chrX32238 2077 1711 11677 ----
NM_004013chrX32238 2077 1711 11677 ----
NM_004014chrX32238 2077 1711 11677 ----
NM_004015chrX32238 2077 1711 11677 ----
NM_004016chrX32152 1991 1625 11591 ----
NM_004017chrX32238 2077 1711 11677 ----
NM_004018chrX32152 1991 1625 11591 ----
NM_004020chrX32238 2077 1711 11677 ----
NM_004021chrX32152 1991 1625 11591 ----
NM_004022chrX32152 1991 1625 11591 ----
NM_004023chrX32152 1991 1625 11591 ----
NM_004035chr1743489 1012 817 410 1228 ----
NM_004040chr231332 1324 1302 ------
NM_004050chr1412652 22711 409 ----
NM_004060chr53869 431 90 ----1820
NM_004061chr51169 1679 ----
NM_004071chr2170 ------
NM_004075chr12167 --1569 --
NM_004081chrY31419 519 141 ------
NM_004085chrX1711 1168 ----
NM_004087chr331962 757 327 ------
NM_004089chrX11157 ------
NM_004094chr1472955 1948 1850 991 881 738 429 ------
NM_004100chr651840 1086 859 782 619 ------
NM_004109chr112818 445 12349 11678 --
NM_004114chrX1193 188 ----
NM_004117chr632130 1809 774 --1451 --
NM_004124chr1413500 --12364 --
NM_004133chr83569 481 415 11026 ----
NM_004136chr1521101 499 13240 --23196 2465
NM_004161chr211468 1362 ----
NM_004162chr3--11137 ----
NM_004171chr1168008 2353 1582 497 145 74 --39537 5948 1503 --
NM_004172chr551981 1799 1768 342 322 --11270 --
NM_004181chr41291 ------
NM_004187chrX41102 939 919 577 11377 ----
NM_004229chrX32094 2065 1402 ------
NM_004235chr92870 122 ------
NM_004238chr21227 ------
NM_004241chr10----187 --
NM_004251chrX1253 ------
NM_004272chr531990 1500 787 --169 --
NM_004274chr1442900 2388 2260 354 1240 ----
NM_004277chr61165 11290 ----
NM_004279chr771848 1734 1601 789 776 618 372 --11871 --
NM_004281chr10158 ------
NM_004286chr2262661 2392 1916 1903 687 170 12324 11117 --
NM_004293chr952997 2771 2744 369 24 --13837 1252
NM_004294chr132731 69 ------
NM_004311chr1032607 2211 809 1932 ----
NM_004327chr2211002 ----12461
NM_004331chr862704 2551 2480 2343 485 433 12035 ----
NM_004338chr18106812 6463 5001 2659 1772 1195 907 816 633 549 16442 1860 --
NM_004339chr2151934 1780 1540 750 379 11440 ----
NM_004342chr732052 1955 1825 31999 45 27 ----
NM_004370chr61260 --1463 --
NM_004380chr1622500 1721 41799 1748 447 341 ----
NM_004384chr52306 203 1484 ----
NM_004386chr1932237 537 151 31533 281 218 ----
NM_004389chr2126 ------
NM_004392chr1331953 672 238 172 --11699
NM_004393chr321678 489 --1573 --
NM_004397chr1161387 1337 1299 1003 346 31 23438 127 13511 --
NM_004411chr71255 151 1609 --
NM_004412chr10116010 5893 5651 4558 4449 4423 4279 4208 3823 1536 705 15225 ----
NM_004430chr842800 2267 1771 590 ------
NM_004438chr272924 2287 2253 2151 2082 1273 330 --12620 --
NM_004449chr211107 --11354 --
NM_004454chr342023 505 446 101 1462 --11443
NM_004458chrX32653 2631 678 ------
NM_004487chr31919 1376 ----
NM_004496chr142991 505 ------
NM_004500chr1411855 ----21735 354
NM_004501chr1104063 3959 3695 3650 2794 1650 906 521 131 75 1689 --13414
NM_004504chr231188 511 248 ------
NM_004506chr61234 1515 ----
NM_004514chr1743069 2515 1947 242 1608 22678 1955 12097
NM_004516chr19--1213 ----
NM_004524chr171245 ------
NM_004525chr221531 987 --11025 --
NM_004539chr183956 228 48 --2776 214 --
NM_004543chr21166 --187 --
NM_004554chr1461276 1182 519 369 361 91 1739 ----
NM_004571chr2132957 2570 966 1502 12155 1124
NM_004576chr51371 ------
NM_004586chrX84892 4867 4492 3972 2040 1863 53 39 --15370 14588
NM_004588chr1153685 3089 2753 1037 826 ------
NM_004612chr964839 4208 4191 4079 1532 922 23342 736 ----
NM_004631chr111062 11004 ----
NM_004637chr31853 2503 339 ----
NM_004642chr121642 1720 ----
NM_004655chr1751203 1034 481 187 43 ------
NM_004657chr221077 462 --1360 --
NM_004660chrY31881 820 720 32350 2269 139 1606 --
NM_004663chr151369 1319 ----
NM_004681chrY2184 31 ------
NM_004694chr172846 353 --1185 --
NM_004703chr1731955 883 857 22099 412 12490 --
NM_004709chrX51796 1460 698 510 75 ------
NM_004711chr2243445 2784 2217 357 ----12390
NM_004718chr2151 1179 ----
NM_004719chr1232209 2100 501 --11831 --
NM_004726chrX145414 5163 5150 4978 4798 3820 3702 3573 3530 2038 1726 1518 709 686 11552 --11177
NM_004730chr521956 561 --1221 --
NM_004734chr1332596 1210 70 ------
NM_004736chr12832 125 1161 ----
NM_004741chr1011558 ------
NM_004744chr413932 12678 --1496
NM_004745chr8116160 5800 5496 4797 2249 1286 866 714 585 571 175 12766 14959 25875 5268
NM_004748chr1532679 1414 694 44069 3598 772 379 13982 --
NM_004758chr171952 1290 ----
NM_004768chr141122 1091 167 131 --1878 1335
NM_004774chr1732966 2141 55 11227 ----
NM_004776chr2053184 2578 2231 2178 203 12309 ----
NM_004779chr521278 420 21230 1069 ----
NM_004781chr11669 181 1251 --
NM_004781chr11669 181 1251 --
NM_004786chr18--1204 ----
NM_004788chr1142472 1903 1015 540 12146 11671 --
NM_004792chr2145 ------
NM_004796chr1442308 2261 1905 418 1195 ----
NM_004798chr2033586 1252 765 11339 --11201
NM_004799chr1----191 --
NM_004801chr211092 ------
NM_004804chr252760 1988 1796 1749 955 ----12648
NM_004808chr1033235 2822 2246 11060 ----
NM_004815chr133883 3506 996 44199 4083 1623 271 24632 523 --
NM_004817chr91538 ------
NM_004820chr8------158
NM_004824chr651204 1196 976 286 201 1100 ----
NM_004827chr421565 1320 ------
NM_004831chr191691 ------
NM_004834chr252658 2442 2246 2177 79 ----12556
NM_004835chr32165 152 ------
NM_004835chr32165 152 ------
NM_004836chr23638 255 144 ------
NM_004839chr151520 ------
NM_004840chrX42200 1604 844 713 12398 ----
NM_004842chr63714 417 92 --11506 --
NM_004857chr1474667 4376 3978 1559 467 408 392 137 23169 328 --
NM_004863chr1485330 3954 3502 3361 1824 1694 722 541 1586 ----
NM_004869chr1831475 1320 550 --1600 21334 1264
NM_004871chr1744398 4298 954 161 14134 13683 13076
NM_004873chr1462982 2571 2135 796 742 718 12921 --11169
NM_004891chr21167 ------
NM_004896chr1031266 319 232 ----159
NM_004898chr422133 89 1292 ----
NM_004904chr755719 5684 5025 4792 4549 --66439 6281 6081 6009 4347 634 15846
NM_004912chr721276 500 --1574 11328
NM_004926chr1411538 11162 --1119
NM_004929chr821400 74 ----1440
NM_004947chr321842 934 12228 ----
NM_004949chr1832075 1384 850 --11359 --
NM_004953chr3------1450
NM_004956chr734017 3025 277 24226 2965 11299 --
NM_004961chrX1139 ------
NM_004967chr41161 164 ----
NM_004976chr1124081 1575 21697 600 35132 4311 1996 --
NM_004985chr1233635 1024 342 23653 1683 13510 --
NM_004992chrX96350 6073 5740 3236 3045 2637 2173 1162 89 --1262 --
NM_004992chrX96350 6073 5740 3236 3045 2637 2173 1162 89 --1262 --
NM_004993chr1431404 1377 384 ------
NM_004996chr1641700 1668 1434 1112 ------
NM_004999chr641683 761 573 397 13726 21655 993 --
NM_005000chr72909 352 11048 ----
NM_005010chr742135 1633 1512 638 ------
NM_005028chr1021950 1490 1904 ----
NM_005045chr7----1719 --
NM_005054chr251319 1277 671 502 404 ------
NM_005056chr1284075 4038 3725 3667 3609 3551 1832 206 35446 5038 2201 1525 --
NM_005063chr1093186 2517 934 776 523 422 401 391 185 12837 ----
NM_005065chr14115352 5160 4938 4860 4144 4101 3857 3570 680 473 196 11309 1349 --
NM_005066chr11729 ------
NM_005087chr32669 64 ------
NM_005088chrX1688 1824 ----
NM_005109chr312392 ------
NM_005112chr41181 ------
NM_005113chr142133 118 ------
NM_005116chr2064603 3837 3509 1426 1058 258 ------
NM_005119chr131237 1030 1021 ------
NM_005121chr1753563 3340 726 455 68 32660 2445 761 12912 --
NM_005134chr181843 ------
NM_005135chr1543610 1058 166 137 ------
NM_005151chr1832082 1992 704 2269 240 ----
NM_005153chr161510 ------
NM_005155chr62715 509 ------
NM_005159chr1522062 890 21675 264 ----
NM_005160chr2295602 5079 4373 2226 2052 1995 1937 205 110 11803 --25431 2620
NM_005164chr1292690 2628 2305 2279 2180 1979 1055 311 82 145 ----
NM_005166chr191241 ------
NM_005168chr231646 1107 257 ------
NM_005171chr123204 106 94 ------
NM_005175chr17----175 --
NM_005190chr62431 147 1731 ----
NM_005197chr1484335 4237 4110 2400 1433 1331 535 255 --13811 15592
NM_005207chr2231462 948 350 23137 2576 23674 3399 --
NM_005221chr72123 91 ------
NM_005233chr31100 ------
NM_005235chr287683 6182 5719 5132 2381 2185 1092 739 22456 1475 ----
NM_005238chr1163242 1294 915 659 267 259 --1624 --
NM_005249chr142909 328 ------
NM_005254chr151480 11097 1141 --
NM_005257chr1811187 1560 ----
NM_005259chr241524 581 228 127 ------
NM_005277chr421507 212 ------
NM_005311chr722093 621 --12479 --
NM_005316chr113444 345 226 ------
NM_005324chr1711925 11711 21666 1370 --
NM_005328chr81657 --1612 --
NM_005329chr1632135 2014 720 ------
NM_005339chr443116 3065 249 31 ----11216
NM_005342chrX32583 2170 2163 1747 ----
NM_005359chr1855956 5413 1919 523 394 ------
NM_005369chrX1172 ----189
NM_005370chr1931174 364 203 11318 ----
NM_005373chr121496 139 1207 21588 220 --
NM_005378chr21811 --1347 --
NM_005388chr921527 688 ------
NM_005389chr63776 519 113 ------
NM_005397chr743670 2889 1534 39 53372 2936 2760 2604 1224 --1219
NM_005398chr1031453 463 116 1395 ----
NM_005399chr123189 2930 34063 1175 835 13808 12820
NM_005400chr252516 2505 2292 896 632 1941 1977 --
NM_005402chr741805 1609 1503 1268 2354 202 1257 --
NM_005406chr181466 1245 ----
NM_005407chr1431322 980 150 --21521 106 --
NM_005433chr1842663 1119 492 283 ------
NM_005437chr1031009 303 54 --11149 --
NM_005442chr32508 156 ------
NM_005455chr151776 1530 1505 1183 450 193 ----
NM_005475chr121528 32361 2125 1322 22196 1072 --
NM_005476chr941126 243 56 38 ------
NM_005494chr71533 ----1567
NM_005497chr1785693 5119 4885 1348 1339 888 768 423 31706 580 132 ----
NM_005502chr933172 1165 651 --11064 --
NM_005503chr1511085 ------
NM_005504chr1296125 5894 5660 5634 5557 5146 1177 872 337 ------
NM_005506chr472513 2407 1065 1052 982 971 36 --2666 188 --
NM_005509chr521689 520 ------
NM_005520chr53617 594 218 --1601 --
NM_005530chr1551458 1136 1124 1118 299 1495 11405 --
NM_005537chr131797 11070 ----
NM_005542chr711908 11372 11485 --
NM_005561chr13--1128 ----
NM_005573chr52744 118 ------
NM_005578chr371252 1102 700 577 561 545 398 14578 11349 --
NM_005587chr151732 ------
NM_005596chr986451 6329 5405 4413 4151 2342 773 448 34866 4852 1234 ----
NM_005599chr141265 588 417 140 2405 390 ----
NM_005602chr331141 864 100 ------
NM_005606chr14121 ------
NM_005607chr82770 157 --1274 --
NM_005613chr162097 893 858 704 424 224 --31371 886 84 --
NM_005623chr171169 144 ----
NM_005626chr11416 ------
NM_005627chr62390 157 1124 --1188
NM_005629chrX2889 332 1527 ----
NM_005637chr1811363 ------
NM_005638chrX1330 31648 636 518 ----
NM_005639chr1231309 1263 526 ------
NM_005655chr81232 ------
NM_005665chr164676 3836 3770 1827 1541 949 1326 --13158
NM_005667chr2----128 --
NM_005668chr554158 3403 1736 737 631 34545 4539 752 ----
NM_005669chr521984 144 ------
NM_005710chrX139 ------
NM_005711chr51431 ------
NM_005715chr662580 2191 1074 1028 567 48 ------
NM_005721chr21837 ------
NM_005722chr251878 1673 510 282 152 --11762 --
NM_005725chr13507 456 35 --12062 --
NM_005737chr222748 1978 2407 353 ----
NM_005738chr792012 1958 1854 1714 1677 1268 596 519 116 ------
NM_005746chr711009 --1211 --
NM_005748chr1242984 2376 2152 856 23254 2770 ----
NM_005749chr172730 113 ----191
NM_005752chr1611213 1349 ----
NM_005754chr51115 ------
NM_005759chr254295 3833 3251 771 212 24458 1571 --14282
NM_005761chr12134 ------
NM_005765chrX1757 ------
NM_005776chr141339 ------
NM_005779chr531045 589 250 ------
NM_005785chr1221667 1562 21830 1789 21358 622 --
NM_005786chr181241 --1812 --
NM_005801chr17--124 ----
NM_005808chr362996 1436 1267 1088 638 283 --12762 --
NM_005813chr242440 1939 1743 211 12655 11689 1288
NM_005826chr11445 ------
NM_005828chr1764509 4502 4322 1761 1291 852 --24676 1661 --
NM_005832chr32299 78 137 ----
NM_005834chrX1221 ------
NM_005839chr13946 720 80 1124 ----
NM_005840chrX116667 6168 5534 5525 4661 2990 2393 2259 1786 392 353 32477 1547 1526 ----
NM_005862chr311060 ------
NM_005863chr1021096 1085 11063 ----
NM_005871chr101326 ------
NM_005880chr1651015 404 378 267 181 ------
NM_005881chr16--1288 ----
NM_005885chr581508 1388 1278 1180 1171 1111 223 104 ------
NM_005895chr1263955 2939 1660 628 104 43 --1228 13908
NM_005896chr22717 142 ------
NM_005897chr14943 803 490 234 1374 ----
NM_005898chr1133050 968 673 23150 2520 22989 2070 --
NM_005901chr18158540 8436 8373 7294 7118 6303 5604 5463 3419 3282 3263 2286 1971 1356 1340 37217 3154 100 37875 6211 2301 --
NM_005902chr1554637 3224 1719 1098 550 24653 3447 ----
NM_005903chr584909 4746 4466 4215 1885 1206 381 81 ------
NM_005906chr631093 487 53 ------
NM_005907chr661577 1471 1262 1064 433 381 --1114 --
NM_005909chr533923 1653 1513 24331 1201 23720 688 --
NM_005911chr26991 590 577 172 60 40 --1460 --
NM_005923chr61565 ------
NM_005926chr15------1408
NM_005930chr141804 1103 1861 --
NM_005933chr1152559 930 842 355 87 --1133 --
NM_005935chr424916 1284 ------
NM_005937chr1783573 3348 2659 1465 1254 665 544 146 1230 ----
NM_005941chr81185 33531 1121 1112 12765 --
NM_005943chr631643 1216 420 ------
NM_005955chr164744 3901 1257 1230 729 224 11431 ----
NM_005962chr1041523 809 479 394 1565 12092 --
NM_005962chr1041523 809 479 394 1565 12092 --
NM_005966chr242040 1706 870 815 22077 475 ----
NM_005977chr131365 --1403 1931
NM_005982chr14--1186 ----
NM_005994chr17----1622 --
NM_005999chr161493 1266 542 510 475 371 ------
NM_006007chr973968 3707 3657 2954 2846 911 836 1673 ----
NM_006011chr1543855 3487 3435 1243 --24235 3481 --
NM_006015chr141155 1137 516 263 ------
NM_006016chr621955 832 --22031 680 --
NM_006036chr232277 281 104 --1518 --
NM_006037chr244647 3651 1360 621 153 ----
NM_006039chr17----1790 --
NM_006047chr2042610 1421 1301 449 1282 ----
NM_006048chr1--1224 ----
NM_006054chr111116 ------
NM_006063chr2181 ------
NM_006067chr161261 41044 917 702 670 ----
NM_006070chr3--190 ----
NM_006079chr61770 ------
NM_006080chr742321 698 407 179 --11874 --
NM_006089chrX21628 1552 1631 1638 --
NM_006090chr11720 ------
NM_006095chr463946 3790 3612 2900 958 25 ----1119
NM_006099chr13896 835 296 1744 1733 1706
NM_006100chr34588 561 237 210 --1478 1459
NM_006108chr1151850 1842 1810 1541 253 12292 --1715
NM_006113chr11618 --11396 --
NM_006114chr191449 ------
NM_006136chr7--1149 ----
NM_006139chr21457 ----12833
NM_006141chr1632087 1045 603 12630 ----
NM_006142chr11484 ------
NM_006143chr12144 ------
NM_006152chr122207 40 ------
NM_006154chr1542952 2385 1980 976 ------
NM_006158chr821617 1470 ------
NM_006187chr1252990 2557 2544 2490 1066 12041 1708 --
NM_006194chr1421036 1008 --1480 --
NM_006203chr575250 4951 4824 4709 3642 1387 538 25057 3848 11011 --
NM_006204chr10--1175 ----
NM_006218chr3--127 1215 --
NM_006223chrX3143 71 25 --1414 --
NM_006224chr1752382 2010 1010 845 481 1608 11758 1389
NM_006226chr221274 997 ----189
NM_006237chr1322108 652 ------
NM_006246chr142453 398 ------
NM_006252chr176064 5384 4860 2614 1535 1141 400 --27577 1439 --
NM_006256chr132079 1004 233 --22148 1966 --
NM_006264chr4--198 1399 --
NM_006265chr831563 1170 950 ------
NM_006267chr221645 1567 155 ----
NM_006275chr2081995 1936 1905 846 452 388 236 160 ----1264
NM_006277chr21584 --1708 --
NM_006281chr821115 375 ----1873
NM_006281chr821115 375 ----1873
NM_006283chr873648 3545 1909 1791 1698 1291 264 34344 3452 1011 ----
NM_006288chr113866 847 39 ------
NM_006292chr11181 --130 --
NM_006298chr653427 3257 2620 803 218 22994 2588 32744 2666 2638 --
NM_006306chrX145835 5204 5090 4999 4549 2294 968 756 734 596 465 421 227 40 --24003 811 11357
NM_006313chr122429 266 11429 ----
NM_006315chr483949 3323 2743 1616 1021 907 425 308 24365 4009 11701 --
NM_006321chr332257 1540 78 ------
NM_006322chr132774 215 --1292 --
NM_006330chr81179 ------
NM_006335chr12403 116 ------
NM_006343chr22335 147 ------
NM_006345chr421107 931 ------
NM_006353chr62106 21 2963 570 ----
NM_006359chrX41944 864 187 103 ------
NM_006361chr173411 367 329 ----11709
NM_006364chr1431250 930 165 ------
NM_006379chr722206 402 ------
NM_006380chr1754134 3582 2809 2776 1557 --11692 14121
NM_006386chr2231603 530 318 ------
NM_006391chr111271 ------
NM_006393chr1093704 3242 3047 2928 1781 1764 789 585 24 13299 12882 --
NM_006401chr92358 200 ------
NM_006406chrX--148 ----
NM_006409chr71226 ------
NM_006420chr201640 ------
NM_006424chr431726 1567 378 1419 ----
NM_006430chr21446 ------
NM_006431chr12--1205 ----
NM_006449chr251919 1803 1699 742 625 ----1451
NM_006451chr5--11090 ----
NM_006457chr483991 3259 2789 2506 1362 1271 949 524 --22940 236 13146
NM_006459chr104738 611 511 326 11405 --1419
NM_006464chr2104635 4585 4366 3680 3441 3235 3174 1765 1547 1275 23604 1883 12887 --
NM_006469chr121217 118 1491 ----
NM_006475chr133668 426 259 ------
NM_006482chr1252628 2562 2553 698 194 11171 --11522
NM_006489chr1441975 686 579 485 ----1676
NM_006496chr11668 12027 --1706
NM_006497chr172791 519 ------
NM_006504chr1022754 495 32377 876 353 11847 --
NM_006517chrX32185 237 149 22303 1456 1285 --
NM_006524chr74826 406 238 188 1175 ----
NM_006526chr2032118 423 113 ------
NM_006527chr44541 514 287 237 ------
NM_006534chr2063398 3004 2466 2291 1092 555 12140 1119 --
NM_006540chr841260 605 493 206 ------
NM_006544chr14105048 4907 4380 4087 3884 1646 1494 1438 1330 1009 --25684 1724 --
NM_006546chr1745807 5785 4861 274 --26014 1133 11323
NM_006554chr2--1261 ----
NM_006559chr141104 981 454 393 1941 ----
NM_006561chr1085116 5019 4944 2234 2202 1549 964 804 36097 5183 2060 ----
NM_006565chr162934 512 ------
NM_006591chr1141856 1419 639 517 11276 11256 21214 84
NM_006599chr1676958 6751 2982 2828 2757 1245 833 23233 437 17864 --
NM_006603chrX21704 207 1799 ----
NM_006609chr212773 ------
NM_006614chr333686 3459 3249 11435 1576 --
NM_006618chr13469 426 296 --11107 --
NM_006620chr654051 3938 3251 610 182 14542 21083 439 --
NM_006621chr161544 1385 1370 1296 490 148 21973 201 ----
NM_006625chr11389 ------
NM_006625chr11389 ------
NM_006625chr11389 ------
NM_006626chr922289 788 12503 ----
NM_006628chr1554340 1736 1564 1513 1206 --21348 930 11397
NM_006629chr1842177 1123 666 160 21759 295 12413 --
NM_006636chr2--1134 1671 --
NM_006644chr131657 2672 148 1233 --
NM_006646chr1352775 2240 857 477 223 11022 32804 2708 2583 --
NM_006654chr1254689 4491 1172 1058 392 ----24398 707
NM_006667chrX1119 ----11031
NM_006670chr63473 422 70 --155 --
NM_006682chr732193 1764 637 --12777 --
NM_006693chr71864 ------
NM_006698chr2021483 967 ------
NM_006699chr131012 644 574 12208 ----
NM_006705chr91446 ------
NM_006713chr51872 ------
NM_006717chr973246 3062 3037 1065 1034 994 259 2661 94 1795 12384
NM_006718chr621051 446 --1884 --
NM_006720chr10114812 4789 4643 4110 1696 1688 1450 1041 790 607 245 24492 3763 11624 --
NM_006726chr41342 ------
NM_006727chr51354 ------
NM_006729chrX44304 2165 1635 126 45432 4355 4040 3871 ----
NM_006734chr61103 ------
NM_006745chr43866 803 179 1331 21098 258 --
NM_006746chrX21188 1074 ------
NM_006748chr821280 45 ----11434
NM_006750chr16167957 7431 7108 6548 6434 6221 5961 5438 5408 5004 2156 1830 1637 1503 621 209 11921 ----
NM_006754chr72390 268 21111 209 ----
NM_006763chr152044 1978 666 583 421 21777 415 ----
NM_006766chr842550 2436 2153 533 ------
NM_006774chr761709 1604 641 533 469 166 ----11383
NM_006777chrX62277 1164 1096 752 454 256 12294 12890 --
NM_006788chr1832170 1675 1355 1162 ----
NM_006806chr212349 78 ------
NM_006822chr172194 46 ------
NM_006825chr121967 --1185 --
NM_006827chr1422419 570 --23172 3002 --
NM_006831chr11--2385 126 ----
NM_006832chr142694 288 --189 --
NM_006838chr1261705 1698 1494 1410 187 41 1249 ----
NM_006852chr1752904 2606 2344 1891 460 22050 476 11105 --
NM_006857chr21332 ------
NM_006870chr20128 --1619 1257
NM_006874chr4--2912 906 ----
NM_006884chr351872 1801 1770 1710 207 2721 686 ----
NM_006885chr1654183 3836 2986 804 94 --22841 1035 --
NM_006887chr21474 --1539 --
NM_006888chr1442877 1167 768 268 195 ----
NM_006902chr162960 2433 2256 931 845 630 22347 1166 1859 --
NM_006910chr16----1327 --
NM_006912chr132347 1786 609 --12266 21951 321
NM_006915chrX52437 1992 1663 898 877 12206 22109 234 --
NM_006918chr11115177 5167 5120 4714 4511 4254 2078 1696 1557 1084 329 23666 608 --14827
NM_006922chr241966 1026 737 728 12233 ----
NM_006924chr17104462 4335 4276 4050 3980 3363 3167 3132 1234 328 ------
NM_006939chr1421033 997 --1137 --
NM_006940chr121232 1749 ----
NM_006950chrX1375 ------
NM_006973chr10122 ------
NM_006981chr952806 2723 2576 2270 24 ------
NM_006990chr132456 642 124 --11922 --
NM_006997chr101310 ------
NM_006999chr531570 615 546 1585 1412 --
NM_007006chr1653512 3312 2647 2267 1115 1666 13204 --
NM_007008chr23894 661 206 1956 ----
NM_007011chr1554717 2497 2490 2145 172 21045 430 --11026
NM_007017chr5----1777 --
NM_007026chr172505 385 ------
NM_007034chr11356 ----1739
NM_007040chr192956 743 ------
NM_007050chr2097536 6940 6766 5352 1841 1032 443 368 90 36459 6227 5402 15625 --
NM_007052chrX4209 201 192 165 ------
NM_007053chr11154 --1227 --
NM_007064chr321168 389 ----1339
NM_007084chr1321210 989 ------
NM_007096chr92218 58 ------
NM_007106chr1352664 2599 2061 1136 218 --11733 --
NM_007107chr322332 555 1453 ----
NM_007111chr131115 1684 ----
NM_007114chr332493 2190 838 ------
NM_007124chr63627 90 73 1368 11735 --
NM_007125chrY11079 --11394 --
NM_007129chr13--1773 ----
NM_007137chrX75458 5313 4582 4080 2122 856 294 1887 ----
NM_007144chr172413 349 --11042 --
NM_007146chr1732414 2245 812 22076 1765 ----
NM_007150chrX51943 1399 1329 838 453 1257 11549 --
NM_007179chr9--136 ----
NM_007187chr13--11069 ----
NM_007189chr731186 438 30 21455 1344 --21296 1063
NM_007191chr123165 141 27 139 ----
NM_007195chr1843510 3325 2763 405 --22653 70 --
NM_007203chr933768 3251 1481 12685 13103 --
NM_007207chr12293 109 ------
NM_007212chr12905 569 22076 483 21808 678 --
NM_007214chr62884 540 --1460 --
NM_007216chr1131064 823 378 ------
NM_007222chr821221 191 --21502 1268 1419
NM_007225chr1721047 701 ------
NM_007236chr1522373 337 ------
NM_007238chr2074241 3270 3260 3143 3089 1711 446 1292 33319 3174 413 1599
NM_007249chr13109302 9028 8711 8123 8078 6902 3220 2636 452 307 35922 3493 217 13319 --
NM_007276chr72756 202 11003 ----
NM_007292chr1743489 1012 817 410 1228 ----
NM_007315chr211486 ------
NM_007324chr1----191 --
NM_007341chr211333 ------
NM_007345chr182546 86 1445 ----
NM_007347chr1532163 508 232 23204 2780 ----
NM_007373chr1021295 193 ------
NM_007375chr122561 190 ----12191
NM_009585chr32165 152 ------
NM_009585chr32165 152 ------
NM_012069chrX52625 2449 2234 1777 544 ------
NM_012081chr533400 2357 1293 23712 3591 13140 141
NM_012090chr121130 153 ------
NM_012095chr1033223 2280 175 2899 643 ----
NM_012096chr343475 2699 900 432 1642 1104 --
NM_012097chr22649 207 1485 11754 --
NM_012102chr142469 1822 510 265 ------
NM_012108chr42384 59 ------
NM_012110chr41219 ------
NM_012115chr6152 ------
NM_012137chr172885 2372 2243 1994 824 193 138 11943 1365 --
NM_012141chr1374019 3674 3637 3201 2750 1050 455 1643 11574 --
NM_012155chr191222 ------
NM_012157chr34822 709 375 303 1893 ----
NM_012158chr1331730 1625 1186 ------
NM_012164chr967156 6892 6270 743 378 94 24903 833 ----
NM_012193chr11124978 4938 4785 3626 3429 2047 1713 1464 1283 979 863 353 14645 25087 1905 13769
NM_012199chr194553 4189 3608 3555 3346 2841 1429 951 39 13173 ----
NM_012214chr265553 4428 4273 1655 1484 183 --1543 14263
NM_012215chr1031406 1367 503 11940 ----
NM_012224chr4170 --1801 --
NM_012234chr353137 3066 2418 1348 424 ------
NM_012238chr1011252 21272 1207 ----
NM_012239chr1151133 374 285 269 164 ------
NM_012249chr252830 1192 1077 933 417 43293 2621 1254 600 ----
NM_012250chr111310 --11196 --
NM_012252chr723693 1236 1489 11833 --
NM_012259chr641130 1061 508 411 ------
NM_012262chr173253 1646 1599 1483 842 759 183 11630 11122 --
NM_012281chr732194 2079 136 11631 ----
NM_012287chr364261 4187 3334 3173 1713 693 1248 13591 11768
NM_012290chr251425 1244 569 151 58 --11677 --
NM_012294chr772490 1581 1233 940 792 424 43 --12630 --
NM_012300chr512071 --11906 --
NM_012302chr121136 397 --1779 --
NM_012309chr1194993 4166 3731 3606 3593 3350 3019 839 313 --1948 --
NM_012316chr185670 5195 4059 1907 1301 1157 1017 620 22012 197 24544 950 --
NM_012322chr72153 104 ------
NM_012325chr2041007 566 361 171 ------
NM_012330chr101532 ------
NM_012334chr5124472 3480 1740 1423 1367 980 507 485 222 187 121 59 --24142 4053 --
NM_012343chr521131 104 ------
NM_012347chr63266 255 69 32188 900 464 12894 --
NM_012382chr5114197 3539 3361 3112 2931 2828 2744 1463 853 462 185 --14435 13619
NM_012388chr1573144 2360 2132 889 851 514 197 ------
NM_012395chr722924 37 --1247 --
NM_012399chr2211382 ------
NM_012414chr11699 ------
NM_012419chr61174 ------
NM_012420chr1042248 2240 1961 30 --22270 406 --
NM_012434chr641374 1313 301 201 ------
NM_012446chr51481 ------
NM_012454chr63533 410 154 ------
NM_012463chr1251712 1311 536 232 25 ------
NM_012465chr1062882 2555 2303 1257 993 169 ------
NM_012467chr16134 ------
NM_012470chr71454 ------
NM_012479chr721828 724 --1351 --
NM_013227chr151326 ------
NM_013229chr1242045 1081 1043 92 ------
NM_013252chr74685 525 473 130 22315 1991 --11957
NM_013255chr7108554 8243 6249 6092 5352 1891 1859 1547 889 204 25764 3002 36023 3015 2030 --
NM_013257chr852319 2249 2231 1964 308 ----21924 218
NM_013261chr453772 3396 3005 1376 673 ------
NM_013269chr1244559 4026 4016 3705 33453 3087 1277 14238 24523 4046
NM_013282chr1921286 339 ------
NM_013286chr363629 3298 1522 805 665 517 1465 1161 --
NM_013293chr72593 506 ------
NM_013308chr34567 380 187 175 ------
NM_013309chr1522614 1863 ------
NM_013322chr7165 31530 1067 94 1181 --
NM_013325chr211578 ------
NM_013341chr272741 2468 1914 1100 988 880 249 12144 12937 --
NM_013348chr1921084 1044 ------
NM_013354chr811457 ------
NM_013357chr81688 ------
NM_013363chr32180 24 ------
NM_013372chr1552631 2197 719 502 389 ------
NM_013374chr372576 2306 2261 2204 1096 567 377 ------
NM_013390chr911779 ------
NM_013396chr2121469 622 ------
NM_013444chrX--1806 ----
NM_013446chr731239 1102 406 ------
NM_013448chr142726 203 ------
NM_013958chr82407 374 ------
NM_013959chr82407 374 ------
NM_013961chr82407 374 ------
NM_013962chr82407 374 ------
NM_013989chr1464447 4091 1923 1287 1155 756 21320 832 13361 --
NM_013995chrX31001 642 52 --1250 --
NM_013999chr172527 215 21508 31 11124 --
NM_014000chr1051914 1548 1280 537 467 --11352 1291
NM_014007chr931222 1166 512 1106 ----
NM_014011chr262131 2082 1614 761 447 91 12177 --1114
NM_014016chr31476 1466 ----
NM_014021chr153227 3088 1227 184 56 --11107 11196
NM_014023chr1042921 2830 2231 2074 2483 243 11048 12287
NM_014034chr621266 32 ------
NM_014056chr31483 1535 --11713
NM_014059chr13251 41 1141 1341 --
NM_014071chr20165 1205 ----
NM_014112chr875082 4150 4043 3463 1740 1220 581 --24617 1856 --
NM_014117chr1652505 2010 1779 978 149 42602 2297 2026 1067 ----
NM_014154chr331357 1114 251 --1590 --
NM_014155chr1186988 6070 5472 4898 4682 4593 1929 567 25409 4848 32319 810 753 --
NM_014159chr31198 --1489 --
NM_014176chr1156 ------
NM_014181chr272481 2384 1819 1139 1070 904 519 ------
NM_014182chr12------1513
NM_014190chr431460 1137 304 ------
NM_014191chr121395 ------
NM_014217chr121827 1742 ----2550 100
NM_014230chr172528 71 ------
NM_014241chr102303 279 ------
NM_014243chr432081 1703 1523 ------
NM_014253chrX22521 2335 --12110 11745
NM_014279chr91397 1785 ----
NM_014283chr131322 1209 176 2958 500 ----
NM_014294chr841309 1096 394 204 ------
NM_014299chr1941874 613 574 469 31861 690 565 11477 --
NM_014300chr151322 ------
NM_014309chr2264866 4791 3701 3542 1271 809 24893 3571 14003 --
NM_014319chr1221928 1677 21369 215 1652 --
NM_014321chr161786 ------
NM_014325chr1231415 230 214 22110 723 11447 --
NM_014331chr446791 2853 2278 1203 ----12247
NM_014333chr1111047 --12628 --
NM_014335chr1521300 1213 1457 11013 --
NM_014344chr111183 ------
NM_014363chr131211 1284 174 --
NM_014368chr9--21784 1406 ----
NM_014372chr122096 712 --1485 --
NM_014376chr551927 1710 1703 1008 554 12325 ----
NM_014382chr331798 1354 1220 169 ----
NM_014386chr5------1303
NM_014390chr71501 ------
NM_014393chr831881 1551 118 21750 73 11646 --
NM_014394chr102930 908 --11165 --
NM_014409chr121090 69 ------
NM_014415chr331376 1123 109 --11262 --
NM_014419chr19174 ------
NM_014423chr565632 4582 4301 1062 904 249 13706 21260 325 --
NM_014445chr341935 1724 561 283 12179 ----
NM_014447chr411319 ----1652
NM_014456chr103394 371 248 11382 ----
NM_014478chr741376 592 441 146 ------
NM_014480chr194655 630 352 25 1854 ----
NM_014494chr1652289 2155 2085 707 384 11966 21690 252 --
NM_014496chrX1265 ------
NM_014503chr121411 ------
NM_014522chrX1122 ------
NM_014548chr152416 94 11194 ----
NM_014554chr1262313 2256 1486 679 333 235 ------
NM_014562chr21679 ------
NM_014563chrX21888 70 --22090 579 --
NM_014572chr1331796 1509 202 11432 ----
NM_014574chr141171 1164 1418 --
NM_014575chr31489 1125 ----
NM_014584chr1441408 1177 1122 1109 11348 ----
NM_014586chr2194712 4362 4006 3887 3875 3217 1162 1072 54 13670 --11878
NM_014592chr5------1302
NM_014612chr921422 436 ------
NM_014615chr1693132 2623 2316 1397 1373 678 600 299 142 198 ----
NM_014616chr342307 1074 889 466 12766 --12640
NM_014620chr121527 ------
NM_014630chr1593670 3599 3177 2531 484 391 317 139 84 --23430 916 13261
NM_014635chr261287 1240 700 635 466 368 ------
NM_014636chr934069 1236 602 23517 1466 11096 --
NM_014637chr82493 160 --11219 --
NM_014646chr18103152 3145 2547 2271 2179 1240 1060 961 276 167 ----11194
NM_014659chr1511090 ------
NM_014660chr71989 --2820 140 1735
NM_014666chr51918 ----11145
NM_014667chr332309 1724 50 ------
NM_014670chr2--21421 611 ----
NM_014671chr741555 1217 315 101 --1111 --
NM_014676chr13620 601 366 ------
NM_014677chr8--1982 ----
NM_014686chr1942561 1847 1665 912 ----1583
NM_014699chr161371 ------
NM_014701chr1533406 2945 1252 ------
NM_014705chr741900 1828 731 526 31304 484 386 ----
NM_014709chr23422 136 65 ------
NM_014715chr111790 1719 ----
NM_014717chr191730 ------
NM_014721chr6107258 5501 2955 2765 2486 2348 1162 1152 856 270 --26135 5697 14727
NM_014729chr821959 133 ----12007
NM_014730chr12125019 4864 4617 4133 4097 3874 3397 3283 1690 1471 835 608 ------
NM_014730chr12125019 4864 4617 4133 4097 3874 3397 3283 1690 1471 835 608 ------
NM_014735chrX41356 846 831 412 ----12102
NM_014737chr2073841 3233 3153 1435 1329 1183 349 11651 ----
NM_014739chr683650 3283 1067 946 901 577 527 319 13327 14084 --
NM_014742chr2031321 254 24 11417 11172 --
NM_014743chr432435 1014 412 33155 2702 2127 ----
NM_014746chr283794 3772 3762 3192 2915 1696 673 116 ------
NM_014751chr821678 404 --11657 --
NM_014755chr253472 3056 1349 363 313 13592 13549 --
NM_014757chr522236 127 12286 ----
NM_014758chr1152036 1624 690 383 93 --11735 --
NM_014764chr121879 11212 ----
NM_014765chr162516 2119 1886 1835 691 588 ------
NM_014767chr1093376 3310 3218 3102 1406 1141 698 512 46 12791 ----
NM_014772chr1832899 2433 1275 1217 11202 --
NM_014776chr12113166 2932 2380 2200 1239 1152 733 665 629 472 36 --12722 12075
NM_014779chr321169 419 ------
NM_014787chr152269 2127 640 182 124 ------
NM_014791chr9--188 1285 --
NM_014795chr2179 --122 --
NM_014802chr121224 124 ----
NM_014810chr121099 1030 22866 477 12341 --
NM_014819chr552079 2068 721 350 189 22095 257 ----
NM_014824chr1111625 ------
NM_014826chr143816 3686 2851 1582 1695 2766 440 --
NM_014827chr11238 --1526 --
NM_014828chr1422549 2336 22304 2277 22346 2062 --
NM_014830chr1273151 3063 2850 962 644 163 29 --11380 13616
NM_014832chr1341964 1861 1528 1509 --11681 --
NM_014835chr2042038 1606 601 207 --11682 --
NM_014838chr2252768 2267 1848 916 348 --12310 --
NM_014840chr1232433 1335 480 ------
NM_014841chr611073 ----1985
NM_014848chr1552367 1986 702 604 387 1987 ----
NM_014864chr183798 3766 3293 3165 3083 2996 2658 104 14222 ----
NM_014869chr341461 1150 1140 509 31499 1057 70 ----
NM_014870chr1114457 4303 4022 3289 2882 1797 1601 1381 1049 670 154 23996 3004 14612 --
NM_014871chr122520 77 ------
NM_014872chr952317 2114 1782 912 502 ------
NM_014873chr164236 4117 3424 1765 1172 1013 1350 ----
NM_014877chr17107724 7510 6652 5640 4863 2348 2326 1663 725 509 12547 ----
NM_014881chr10----134 --
NM_014883chr452164 2034 1938 1657 1634 1414 ----
NM_014888chr71983 ------
NM_014891chr741707 1526 1463 1224 ------
NM_014892chr61108 ------
NM_014893chrY2668 453 1349 12163 1631
NM_014897chr1762627 2177 1006 902 471 258 --11977 1177
NM_014900chr231082 867 437 ------
NM_014901chr52186 42 22084 1649 ----
NM_014903chr1221751 238 1186 ----
NM_014904chr1083792 3670 2711 1593 1045 886 714 580 ----13121
NM_014906chr1743544 3135 2698 324 13330 ----
NM_014909chr1463982 3836 2798 2680 771 707 11191 1596 11524
NM_014910chr19--1300 ----
NM_014912chr1063453 2240 1427 961 836 593 11379 11307 --
NM_014914chr21451 11124 ----
NM_014916chr7--1629 ----
NM_014924chr144454 391 83 43 ----2851 743
NM_014932chr32706 267 1496 ----
NM_014935chr143269 3135 2749 43 12401 ----
NM_014936chr651891 1118 748 657 457 --12747 --
NM_014945chr521716 66 21272 506 ----
NM_014946chr262466 2110 1109 480 245 94 12790 12618 12137
NM_014947chr122639 453 12085 --11142
NM_014949chr11236 ------
NM_014950chr142356 139 ------
NM_014951chr1052278 1778 425 254 209 ------
NM_014952chr1531637 495 105 ------
NM_014953chr1354182 3885 3734 1416 518 --12738 --
NM_014961chr432069 1591 314 --2217 86 --
NM_014966chr3157 ------
NM_014969chr131059 408 251 1923 1196 --
NM_014982chr1484982 4481 3690 3460 911 256 218 133 15055 15117 --
NM_014988chr472413 976 669 508 496 399 120 22110 83 --1936
NM_014990chr1441153 1066 350 27 ------
NM_014991chr422784 674 1613 ----
NM_014996chr31852 --172 --
NM_015000chr1242782 2562 2077 382 ------
NM_015002chr1242131 2063 1678 147 ------
NM_015008chr353583 2709 2340 2300 1392 ------
NM_015009chr3--1807 ----
NM_015020chr1651442 1309 1056 516 270 23344 2897 13673 11563
NM_015024chr81490 ------
NM_015025chr242488 977 298 216 11955 ----
NM_015026chr1284739 4180 3794 3410 870 583 291 183 13662 11697 1658
NM_015027chr1661846 705 581 234 152 56 ------
NM_015032chr1342566 650 70 35 ----12397
NM_015039chr144193 3562 1486 915 13842 ----
NM_015042chr1583967 3627 3469 3211 1558 1371 1180 691 14096 ----
NM_015046chr972440 2385 1992 1815 787 509 186 --21901 82 --
NM_015051chr943118 2602 2500 782 13229 2854 655 33240 2085 1211
NM_015052chr731360 1122 315 ------
NM_015056chr2152177 1808 610 424 108 --3375 221 99 1985
NM_015057chr131600 ------
NM_015059chr1553979 2957 2801 1567 1427 --1594 --
NM_015068chr793374 3177 2941 2644 2522 1447 353 282 88 23719 2432 11254 --
NM_015070chr13----1414 --
NM_015071chr596179 5870 4564 4544 1768 1747 1539 1201 28 12039 22233 147 --
NM_015072chr141423 1444 ----
NM_015076chr653102 1507 1422 357 45 13951 --13368
NM_015090chr1105759 5657 4028 2424 2165 2071 1180 1090 794 640 --14437 1239
NM_015092chr1654082 3780 3180 2932 1414 22922 239 --34092 3304 1282
NM_015093chr631857 628 389 144 ----
NM_015094chr2234711 1828 110 --11541 --
NM_015097chr341992 1469 364 75 ----11746
NM_015100chr121489 1383 11793 ----
NM_015115chr452845 2464 1096 1040 644 --1946 --
NM_015129chrX11813 1133 ----
NM_015137chr842075 500 242 62 12244 ----
NM_015138chr1511772 ------
NM_015139chr1137 ------
NM_015141chr352772 2095 1798 739 31 1648 ----
NM_015143chr4----1429 --
NM_015147chr252967 2526 2278 2125 1006 42464 776 710 316 --22933 2423
NM_015153chr61800 --1649 --
NM_015155chr1043302 2754 1003 807 23276 2415 ----
NM_015156chr1453753 3405 3317 2637 203 --12560 --
NM_015158chr92145 42 --1867 1101
NM_015161chr1621135 577 1597 ----
NM_015163chr1431516 747 454 168 2537 408 --
NM_015176chr191614 1221 1192 1162 1141 704 357 283 106 --21397 99 --
NM_015180chr141747 ------
NM_015191chr11102727 2554 2457 2167 949 823 582 261 233 226 184 32381 1848 525 --
NM_015192chr2092885 2727 2633 842 613 349 330 280 173 ------
NM_015198chr71241 ------
NM_015199chr3136 ------
NM_015200chr432390 1907 48 1103 ----
NM_015202chr1641675 1283 1129 470 11595 ----
NM_015206chr1533367 1021 353 12597 ----
NM_015208chr1833454 2968 113 23193 2758 --11109
NM_015215chr113042 --12015 --
NM_015247chr1694273 3832 3635 3518 1678 937 706 266 260 ------
NM_015265chr222665 2209 ----1205
NM_015267chr121696 ------
NM_015268chr31663 1516 ----
NM_015269chr11634 ------
NM_015271chr464341 3689 3091 1546 1237 886 ------
NM_015272chr16156 2669 556 1222 11779
NM_015275chr122730 174 2441 156 --22018 1823
NM_015277chr1831418 150 41 ----11406
NM_015278chr642708 2264 799 713 --1607 --
NM_015293chr61277 ------
NM_015296chr132898 380 ------
NM_015308chr112890 833 ------
NM_015310chr8158283 8092 7923 7693 7582 7046 6779 6761 6349 5508 2363 2326 2084 1869 1310 37078 6165 1339 26894 6466 --
NM_015313chr1164484 3181 2925 1414 595 577 14323 --13947
NM_015317chr252687 2617 1042 874 531 ------
NM_015319chr121178 ------
NM_015321chr1984205 3523 3413 3240 3153 1955 1032 107 33022 1174 356 ----
NM_015326chr132115 569 110 12385 ----
NM_015328chr743059 2759 2127 949 1330 12876 --
NM_015331chr12590 264 ------
NM_015335chr1252468 2420 2044 2035 838 22520 903 ----
NM_015336chr1222532 445 ------
NM_015339chr202793 231 ------
NM_015344chr832095 450 206 ------
NM_015347chr1262837 1995 752 627 397 65 --22931 1050 --
NM_015349chr642587 2398 2062 1985 12535 12228 --
NM_015355chr17--12020 41529 1445 1321 585 --
NM_015365chrX53908 3578 2993 1012 132 23274 1175 ----
NM_015375chr154138 3802 1392 1172 436 ------
NM_015382chr141149 ------
NM_015387chr251710 1508 757 172 161 ------
NM_015393chr433865 3738 792 --23241 433 --
NM_015394chr1251589 860 791 767 68 ----12456
NM_015416chr121874 ------
NM_015435chr82418 78 1530 ----
NM_015436chr452756 2390 1238 1167 310 --1417 --
NM_015443chr172386 50 1236 ----
NM_015446chr121369 632 1625 ----
NM_015455chr553289 3118 2892 1066 776 14003 --13550
NM_015458chr895188 3904 3851 3635 2017 1806 1398 896 307 14516 --11596
NM_015460chr31658 1596 1214 --
NM_015461chr181629 ------
NM_015469chr91110 ------
NM_015475chr2--132 11114 --
NM_015477chr1511032 ------
NM_015481chr121856 ------
NM_015483chr7--1305 ----
NM_015497chr15--21143 187 ----
NM_015508chr321576 1239 ----1487
NM_015520chr352842 2735 2455 1089 634 ------
NM_015535chr243969 3734 3506 1502 33187 2574 291 ----
NM_015541chr341022 938 492 73 ------
NM_015548chr6149 ------
NM_015550chr753580 2596 1114 429 290 ----12209
NM_015564chr533208 632 445 ------
NM_015565chr2141863 1832 919 516 ------
NM_015568chr2063816 1663 1603 1141 526 375 11573 13661 --
NM_015569chr153642 1267 1010 676 319 44079 3466 1106 984 --13994
NM_015571chr642601 2011 878 235 12403 ----
NM_015576chr3122 11882 12650 11005
NM_015577chr541542 1522 658 410 1733 ----
NM_015578chr1911915 1193 ----
NM_015602chr151357 366 206 80 35 ------
NM_015605chr1021204 176 --1416 --
NM_015609chr122354 646 --2796 446 --
NM_015626chr173260 148 62 ------
NM_015634chr101472 ------
NM_015640chr1114642 4586 3853 3479 3243 1997 1213 894 388 348 54 23762 3631 --13523
NM_015652chr10------185
NM_015678chr1331651 1518 1438 21599 208 1354 --
NM_015680chr2165 ------
NM_015691chrX42862 2133 1080 56 ------
NM_015696chr11214 1568 ----
NM_015711chr191122 ------
NM_015723chr72624 198 --1226 --
NM_015833chr2142297 2040 737 331 --1917 --
NM_015850chr822073 345 22019 1980 ----
NM_015852chr792685 1084 1000 748 580 496 412 328 160 ------
NM_015866chr11100 ------
NM_015878chr822057 678 2755 378 145 --
NM_015885chr111208 ------
NM_015888chr132437 1295 1039 ----13057
NM_015906chr144154 4104 3104 1037 ------
NM_015912chr851925 1006 855 123 98 --21772 298 --
NM_015955chr21403 ------
NM_015975chrX51860 1283 586 301 181 ----11324
NM_015986chr1731081 945 277 11503 ----
NM_015990chr431023 1000 690 ----1400
NM_015999chr11136 --1651 --
NM_016002chr14693 628 508 270 ------
NM_016009chr161802 1753 1511 1435 903 317 --54557 4166 3950 3171 1959 --
NM_016018chr872639 2437 1868 1125 1022 525 281 3865 316 93 --1674
NM_016021chr673025 2202 2009 1213 209 133 23 --1346 --
NM_016025chr1621828 537 ------
NM_016045chr202312 124 1430 ----
NM_016061chr21285 21118 476 11446 --
NM_016073chr1511131 ------
NM_016076chr153003 2871 2486 269 260 ------
NM_016083chr623708 2757 ----151
NM_016094chr32508 159 ------
NM_016096chr851613 1526 1439 1415 840 11979 ----
NM_016103chr51177 1338 ----
NM_016107chr51422 ------
NM_016120chrX1395 ------
NM_016131chr2----21919 906 --
NM_016132chr1563348 3085 2936 2206 746 447 1605 ----
NM_016133chr211629 ------
NM_016138chr1631511 1468 1184 ------
NM_016141chr31575 ------
NM_016152chr33861 317 245 ------
NM_016156chr1142397 2022 2015 1664 1107 21545 1494 --
NM_016162chr12----1760 --
NM_016173chr383925 3787 3531 3354 3093 1552 1469 1308 23510 552 ----
NM_016203chr71709 ----1149
NM_016206chr3148668 8370 8225 6451 5438 3560 3134 2716 2528 1793 1136 1105 281 26 28647 1498 25462 2452 --
NM_016220chr73579 495 415 ------
NM_016221chr552400 2259 2182 2004 861 ------
NM_016227chr131322 1209 176 2958 500 ----
NM_016230chr6----1542 --
NM_016231chr1761547 1437 1413 1370 1050 495 ------
NM_016234chr101756 1327 ----
NM_016250chr14----1689 --
NM_016255chr643211 1339 758 726 ----11161
NM_016256chr163501 131 38 1219 ----
NM_016260chr256449 5841 5327 5010 4803 37183 2891 376 --25251 5049
NM_016269chr431182 230 81 123 ----
NM_016271chr184782 723 602 176 ------
NM_016275chr352805 1717 1107 455 131 1928 ----
NM_016287chr121402 684 ------
NM_016289chr212103 11917 ----
NM_016315chr211479 ------
NM_016322chr92896 424 --22782 1104 --
NM_016339chr1721350 251 ------
NM_016351chr73541 517 417 166 ----
NM_016356chr61325 12597 ----
NM_016376chr1773977 3303 1597 634 551 535 430 --11672 --
NM_016377chr63714 417 92 --11506 --
NM_016383chrX2204 171 ------
NM_016396chr152670 200 ------
NM_016401chr111102 ----1211
NM_016436chr2022476 1993 ----1484
NM_016441chr221598 909 1445 ----
NM_016451chr11126 ------
NM_016467chr221110 248 11190 ----
NM_016480chr53853 819 82 ------
NM_016485chr62871 863 --1311 1520
NM_016487chr6189 ------
NM_016488chr1251960 1717 1422 270 161 11555 ----
NM_016526chr1152473 2196 2068 1988 93 21840 1665 --1342
NM_016530chr1533992 824 367 23275 1314 ----
NM_016542chrX3401 391 280 --21168 88 --
NM_016545chr14718 673 645 247 1192 ----
NM_016547chr1--1618 ----
NM_016578chr11--1484 ----
NM_016586chr141171 ------
NM_016587chr72756 202 11003 ----
NM_016588chr6--1712 ----
NM_016592chr2031319 542 363 11279 ----
NM_016603chr522262 334 ------
NM_016604chr52899 21 ------
NM_016605chr562146 2018 1773 1741 786 155 ----11055
NM_016607chrX2540 511 --1292 --
NM_016613chr442495 1691 1031 294 12467 ----
NM_016623chr81514 ------
NM_016626chr181126 1271 ----
NM_016651chr1411148 ------
NM_016654chr151480 11097 1141 --
NM_016824chr1021347 67 ------
NM_016836chr21688 --1168 --
NM_016839chr21688 --1168 --
NM_016929chr6104350 3387 3181 3029 1794 1547 1402 1370 1337 877 11389 ----
NM_016950chr421227 271 ------
NM_016952chr1183956 2865 2816 1547 1492 1436 1169 311 ------
NM_017420chr1443301 1413 1202 1115 ------
NM_017423chr432058 2020 1459 11586 11805 --
NM_017443chr921443 73 1397 21018 492 --
NM_017491chr41181 ------
NM_017519chr61487 ------
NM_017522chr111062 11004 ----
NM_017528chr73274 123 83 ------
NM_017533chr17153 ------
NM_017544chrX1695 1880 ----
NM_017545chr20------1415
NM_017548chr31571 --1848 --
NM_017551chr1042536 1683 1031 725 ------
NM_017563chr386045 5918 4339 3871 2540 1661 1574 210 34927 4419 635 31923 538 354 --
NM_017577chr321595 217 ------
NM_017595chr1721333 115 11698 --11523
NM_017596chr154282 805 535 308 80 13422 14535 --
NM_017599chr12189 ------
NM_017610chr1522112 194 --11471 --
NM_017626chr1051530 578 570 252 189 ------
NM_017628chr4125138 4626 4427 4291 4108 3529 3223 1936 1573 1507 1196 1038 34774 50 33 13831 --
NM_017629chr121981 1932 ------
NM_017632chr41339 1427 ----
NM_017633chr663816 3702 3041 2426 1471 141 1153 23445 922 --
NM_017634chr821466 778 ------
NM_017635chr1111101 1256 ----
NM_017637chr9109286 7855 7483 6176 5902 3536 2235 1706 1468 1162 35833 3408 1774 28062 7398 --
NM_017643chr1742196 2075 947 227 11986 12171 --
NM_017644chr375091 5037 4947 3287 1658 1317 955 24535 1371 14492 --
NM_017649chr103990 393 87 ----1866
NM_017650chr734488 2385 2146 15127 15801 --
NM_017657chr21798 1110 ----
NM_017658chr1424285 1334 23842 127 ----
NM_017660chr1963367 3264 3183 3142 2978 493 --1455 --
NM_017664chr133892 399 146 ------
NM_017666chrX41381 451 67 52 ----2718 61
NM_017672chr1531258 1110 1098 11204 ----
NM_017679chr171242 1121 ----
NM_017680chr92979 780 --1755 --
NM_017693chr1321170 1021 --21258 152 --
NM_017697chr83409 343 197 ------
NM_017709chr184287 4143 3888 2729 2623 1416 393 362 22718 1394 22923 308 --
NM_017714chr202680 50 ----1691
NM_017737chr121999 472 186 1202 --
NM_017739chr11554 ------
NM_017742chr1831728 1626 732 21646 1510 ----
NM_017744chr172473 2253 1698 1630 833 775 139 1674 ----
NM_017752chrX21895 546 21464 1414 ----
NM_017754chr664794 4493 3191 1547 776 468 23154 593 1639 --
NM_017761chr131432 1041 1018 1512 1340 --
NM_017769chr1483115 2954 2824 1018 777 626 161 27 ------
NM_017772chr6--31253 297 116 ----
NM_017778chr831538 381 205 ------
NM_017780chr8197 1132 ----
NM_017786chr81596 ------
NM_017794chr91272 ------
NM_017798chr202814 792 ----1986
NM_017799chr1461929 1524 1383 1303 451 234 11663 21721 732 --
NM_017801chr352064 831 332 182 71 --12071 12304
NM_017810chr16151 --129 --
NM_017813chr865640 5584 4498 3541 1742 65 --13974 --
NM_017822chr121222 ------
NM_017824chr1031684 987 99 --11060 12298
NM_017848chrX54528 4507 3537 348 201 23846 1316 ----
NM_017864chr8171 ------
NM_017902chr1075730 5038 3778 3767 1292 1203 550 21683 678 31661 1075 732 --
NM_017919chr945139 1458 762 685 55781 4700 4335 2191 575 15364 --
NM_017922chr141631 --186 --
NM_017925chr921523 731 --11428 --
NM_017933chr241588 1177 536 292 --1249 --
NM_017938chrX1252 1150 ----
NM_017944chr1132881 2191 698 1149 ----
NM_017953chr11434 ----1132
NM_017954chr711658 --11169 --
NM_017983chr171166 ------
NM_017987chr1051892 1830 1385 833 371 ------
NM_017994chr732075 712 553 12541 ----
NM_017998chr931110 970 572 ------
NM_018003chr1532184 1608 323 ------
NM_018014chr211097 21247 1036 ----
NM_018030chr182834 691 ------
NM_018036chr1454340 3848 3415 3398 80 32842 260 50 13424 11766
NM_018045chr162707 2288 1133 694 494 104 ----1607
NM_018046chr521906 1332 1217 ----
NM_018048chr1211954 1147 ----
NM_018054chr16196 ------
NM_018061chr15630 541 196 113 101 ------
NM_018064chr61118 ------
NM_018070chr11405 ------
NM_018078chr42727 71 ------
NM_018084chr273292 2804 2508 2133 1292 920 717 ------
NM_018085chr1117468 7249 6425 5112 4986 2344 2326 1591 847 571 211 37528 2878 161 17858 15505
NM_018086chr23706 540 130 ------
NM_018092chr1611587 21138 298 11319 --
NM_018098chr31265 11019 ----
NM_018114chr31104 ------
NM_018121chr1042552 2336 672 428 ------
NM_018126chr411485 2632 172 ----
NM_018133chr32133 90 ------
NM_018155chr312655 22574 1158 ----
NM_018167chr14145 ------
NM_018171chr121836 ----1957
NM_018181chr1821742 103 ----11855
NM_018193chr151259 1426 1575 --
NM_018199chr1431188 998 433 11152 ----
NM_018214chr621011 366 ------
NM_018221chr21405 ------
NM_018227chr422221 2029 --22851 2510 --
NM_018229chr142847 375 --1472 1917
NM_018230chr12534 83 ------
NM_018237chr10--1277 ----
NM_018246chr832747 2375 1846 22886 2720 --12016
NM_018247chr632946 2739 2121 2752 567 11999 --
NM_018254chr13414 405 359 --1815 --
NM_018257chr2052378 2282 1625 584 54 1426 ----
NM_018264chr71931 ------
NM_018266chr311023 ------
NM_018286chr171833 ------
NM_018293chr312326 1605 1676 --
NM_018299chr831046 877 290 --21368 278 --
NM_018302chr42204 29 ----2747 562
NM_018307chr171366 --167 --
NM_018313chr3102662 2537 2260 2090 1983 1971 1026 927 188 161 1639 12324 --
NM_018315chr41540 21024 494 ----
NM_018323chr4186 ----11251
NM_018325chr971613 1596 1130 1061 502 485 128 ------
NM_018327chr2051381 1272 1213 676 487 ----1372
NM_018330chr1031458 631 380 --11524 --
NM_018339chr911677 ----1470
NM_018357chr153407 360 26 ------
NM_018361chr852569 1440 751 538 395 32802 1195 873 12700 --
NM_018362chr1153520 2942 2501 653 386 ------
NM_018364chr174058 3114 2690 2620 1077 494 77 ------
NM_018375chr1471703 1637 751 578 401 372 168 ------
NM_018383chr212020 11767 1308 --
NM_018394chr341544 1445 994 568 1472 --11505
NM_018403chr3114053 3948 3617 2632 1644 1089 1043 798 678 260 53 21638 378 11405 --
NM_018420chr142889 2091 826 396 12454 1234 1295
NM_018429chr552408 2267 705 147 134 --12019 --
NM_018434chr51142 ------
NM_018440chr8168429 7225 6891 6718 6366 3376 2857 2545 2108 1973 1293 1197 1068 1007 498 186 22409 1608 --27077 5954
NM_018444chr832378 1960 745 ------
NM_018448chr1221172 97 ----11229
NM_018452chr6_random32850 2818 1402 --32706 2368 1085 --
NM_018460chr2----1151 --
NM_018462chr3--1190 ----
NM_018464chr101367 ------
NM_018469chr172367 210 ------
NM_018471chr2------1193
NM_018534chr21614 ------
NM_018553chr17--1655 ----
NM_018555chr1921826 427 11442 ----
NM_018566chr1144603 4583 4502 3947 3582 3336 2045 2020 1834 1762 798 543 70 52 14377 --14534
NM_018569chr431534 1424 1246 ------
NM_018590chr1031671 1602 1442 ------
NM_018602chr1541722 1238 653 172 ------
NM_018638chr1285593 5406 4351 2145 1391 1316 386 377 15169 13655 11080
NM_018640chr1272683 2655 2512 1878 1761 1721 451 1744 ----
NM_018667chr1632877 2560 768 --1337 11054
NM_018682chr7186 ------
NM_018685chr711044 --11156 --
NM_018686chr12--1228 ----
NM_018691chr511069 --11030 --
NM_018703chr16----1327 --
NM_018704chr12613 536 2237 56 1716 --
NM_018710chr82308 55 1946 ----
NM_018712chr1121323 1259 ------
NM_018715chr121635 305 --11711 --
NM_018717chr452904 2609 2219 2091 661 2973 44 ----
NM_018719chr721383 306 1294 ----
NM_018834chr52257 187 ------
NM_018844chr73367 358 328 ----178
NM_018846chr7--1664 ----
NM_018898chr52180 133 --11516 --
NM_018899chr52180 133 --11516 --
NM_018900chr52180 133 --11516 --
NM_018901chr52180 133 --11516 --
NM_018902chr52180 133 --11516 --
NM_018903chr52180 133 --11516 --
NM_018904chr52180 133 --11516 --
NM_018905chr52180 133 --11516 --
NM_018906chr52180 133 --11516 --
NM_018907chr52180 133 --11516 --
NM_018908chr52180 133 --11516 --
NM_018909chr52180 133 --11516 --
NM_018910chr52180 133 --11516 --
NM_018911chr52180 133 --11516 --
NM_018945chr643532 3362 3209 256 22841 2527 11256 --
NM_018948chr131308 478 255 11320 ----
NM_018952chr172516 83 ------
NM_018958chr1523863 2894 ------
NM_018970chr732794 370 239 11223 1549 --
NM_018976chr1222466 2103 --11939 --
NM_018977chrX21007 33 ------
NM_018979chr1242000 1946 748 364 --1636 --
NM_018992chr1651665 1541 1240 512 76 ------
NM_018994chr11428 ------
NM_018999chr10154610 4155 3999 3897 3649 3294 3068 1587 1283 1259 1234 861 588 540 51 14963 1523 14727
NM_019001chr373907 3521 3183 1497 1228 137 22 33774 3646 1596 34310 3717 948 11533
NM_019004chr751956 792 318 272 138 ------
NM_019006chr151567 ------
NM_019027chr442612 2552 2413 693 11597 ----
NM_019028chr112363 143 ------
NM_019041chr642482 427 359 241 ------
NM_019045chrX3806 214 37 ------
NM_019050chr442305 1631 810 688 11675 --12175
NM_019060chr11311 ------
NM_019071chr7----1506 --
NM_019072chr543968 3180 2733 909 13116 32936 1443 357 --
NM_019083chr141518 1488 1461 1437 ----1387
NM_019084chr1022387 500 12130 --11902
NM_019091chr221130 846 ------
NM_019106chr2263079 2582 2495 613 496 252 ----11018
NM_019117chrX83515 2415 2188 1342 1320 1083 864 539 1446 23025 1239 --
NM_019555chr331233 527 183 ------
NM_019590chr1021295 159 ------
NM_019591chr123277 164 151 ------
NM_019592chr95897 797 740 623 143 ------
NM_019595chr21584 --1708 --
NM_019597chrX1192 1271 ----
NM_019600chr151619 1644 ----
NM_019606chr71136 ------
NM_019610chr111868 ------
NM_019617chr21129 ------
NM_019848chrX153 ------
NM_019860chr1031534 590 375 ------
NM_019862chr1641700 1668 1434 1112 ------
NM_019891chr11215 ----11072
NM_019898chr1641700 1668 1434 1112 ------
NM_019899chr1641700 1668 1434 1112 ------
NM_019900chr1641700 1668 1434 1112 ------
NM_019903chr1021347 67 ------
NM_020039chr1231605 1196 634 ----1657
NM_020116chr421585 627 ------
NM_020122chr275957 5498 5384 5225 3716 471 253 36027 3882 664 ----
NM_020132chr2154530 4488 3579 3275 749 ----23487 968
NM_020139chr411907 --1120 --
NM_020150chr103667 545 94 32105 1671 496 --1556
NM_020159chr431631 632 441 ------
NM_020182chr2063459 3241 2901 2401 298 237 23337 2668 23485 2748 --
NM_020193chr111105 1990 ----
NM_020198chr1721529 995 --142 --
NM_020209chr19183 ------
NM_020228chr1161936 1876 771 271 78 63 2674 371 ----
NM_020229chr111173 ------
NM_020239chr13805 550 430 1250 21762 1555 --
NM_020243chr22239 21 ------
NM_020309chr1911106 ------
NM_020311chr21765 ------
NM_020317chr1124 ------
NM_020337chr433118 1990 312 ------
NM_020338chr1053124 2845 2502 2429 759 1773 ----
NM_020342chr22665 201 1525 1931 --
NM_020346chr113641 285 184 ------
NM_020357chr311417 ------
NM_020362chr12118 82 --2831 604 --
NM_020382chr1241085 1015 535 461 1565 ----
NM_020390chr384374 3256 3032 1391 1129 726 383 67 ------
NM_020405chr1783941 2999 2968 2813 1559 1443 523 343 ----23591 1187
NM_020420chrY31419 519 141 ------
NM_020423chr11561 2199 125 1382 --
NM_020429chr752686 2642 2377 2242 586 2476 316 1329 --
NM_020432chr762323 1710 908 506 69 57 ------
NM_020440chr132671 970 156 --13136 --
NM_020443chr1146660 6436 6067 5955 4380 4276 2214 2129 1923 1916 1899 1754 1639 430 12445 22425 2150 --
NM_020463chr261376 1097 504 218 82 60 1540 ----
NM_020466chr694972 4610 3917 3807 3429 1587 1053 962 524 11337 13241 --
NM_020474chr1851776 1316 1285 717 702 11912 ----
NM_020478chr811944 --11555 --
NM_020532chr23894 661 206 1956 ----
NM_020546chr5102814 2585 2575 2409 2213 2169 2044 1090 777 415 ------
NM_020640chr342151 1625 847 296 ------
NM_020647chr832130 1837 313 12078 12061 --
NM_020651chr221625 42 ------
NM_020666chr51819 ------
NM_020673chr20117477 5747 5471 5378 3025 2630 2372 1841 1249 954 287 14891 32858 1212 689 36465 4739 2182
NM_020682chr1021064 884 ------
NM_020686chr1652506 1099 996 954 486 12606 --12937
NM_020689chr2031302 352 151 125 ----
NM_020698chr1252348 1935 357 210 26 43114 2698 1140 1061 --12656
NM_020699chr165360 5195 4833 4257 4091 3511 11796 24283 3427 --
NM_020704chr732550 452 237 --12052 --
NM_020717chrX94908 4100 2018 1935 1816 1343 1158 497 194 2629 377 1600 11264
NM_020718chr16115815 5431 5050 4701 4330 1510 1464 1329 984 844 455 ------
NM_020727chr2143431 2575 508 133 11344 13917 --
NM_020728chr761274 1001 882 857 637 484 12581 ----
NM_020732chr61487 ------
NM_020739chr1532679 1414 694 44069 3598 772 379 13982 --
NM_020744chr2----185 --
NM_020752chr1032152 930 878 --1695 --
NM_020760chr241924 1793 464 193 ----11279
NM_020766chrX84221 3495 1718 1395 1173 877 510 385 --1405 --
NM_020768chr572942 2578 2180 1280 784 657 409 --11016 --
NM_020771chr621192 1166 1612 ----
NM_020772chr17168099 7583 7146 7091 6882 6622 6080 5414 3403 2339 2229 2202 2059 1145 692 349 17364 12942 --
NM_020774chr1875698 5007 4683 2010 485 79 59 15876 25453 1407 --
NM_020778chr1594961 4383 3749 3584 1711 1484 1356 311 142 24745 1428 ----
NM_020782chr1264612 3638 3231 1721 1303 1179 --13648 1144
NM_020783chr18182 ------
NM_020794chr141529 1508 328 274 ------
NM_020796chr553017 2734 1062 887 868 ------
NM_020800chr3--21448 477 ----
NM_020801chr531842 565 463 11825 22580 210 --
NM_020803chr432071 1662 604 21689 598 ----
NM_020805chr1841942 1864 1839 663 --11427 --
NM_020806chr14123 ------
NM_020808chr121003 871 1989 --1911
NM_020813chr1992473 2278 2106 1176 1137 796 747 712 273 --11031 --
NM_020818chr141163 ------
NM_020819chr611115 --190 --
NM_020830chr253065 2334 1142 669 280 ------
NM_020839chr321519 194 ------
NM_020841chr1284064 3340 2857 2623 1089 1063 626 202 ------
NM_020844chr8117591 7457 5569 5350 4834 2923 2834 2586 1562 669 609 26895 5979 12084 --
NM_020853chr1252417 2349 2316 2069 1119 --1420 --
NM_020854chr181344 11426 ----
NM_020859chr432911 571 191 13765 13323 11124
NM_020860chr441088 1036 781 330 ------
NM_020868chr241887 1864 1806 407 41471 1236 592 42 --11463
NM_020870chr422004 1877 124 ----
NM_020890chr31190 ------
NM_020899chr1742264 1773 1659 411 1135 1776 --
NM_020920chr141407 ------
NM_020921chr1443615 2928 2507 1426 21380 665 13435 12744
NM_020922chrX21342 340 ----1289
NM_020926chrX199 ------
NM_020927chr1621829 132 --12286 11504
NM_020935chr264338 4020 1795 1741 1598 1089 13105 ----
NM_020940chr1062304 2134 2071 2012 1955 787 11946 ----
NM_020947chr1641971 1694 958 210 ------
NM_020956chr19134435 4048 3873 3816 3113 3012 2998 1615 1561 1547 1537 887 694 54118 3717 3435 3254 813 ----
NM_020962chr1552468 2306 486 275 126 --11967 --
NM_020975chr101221 --11609 --
NM_020981chr2----1134 --
NM_020987chr10130 ------
NM_021003chr141855 ------
NM_021005chr151473 ------
NM_021007chr2--11563 ----
NM_021033chr1321355 1276 --13192 1961
NM_021069chr41747 11820 2834 236 --
NM_021083chrX43578 2293 142 123 ----12877
NM_021090chr2284989 4679 4295 4076 3427 3235 3220 1251 24580 4236 11473 --
NM_021106chr91746 ------
NM_021110chr82751 188 1275 1568 --
NM_021111chr931376 1288 1144 ------
NM_021120chrX62931 2854 978 384 173 141 ------
NM_021129chr10187 ------
NM_021132chr1031352 1284 297 ------
NM_021140chrX31148 1017 200 ------
NM_021145chr71466 1313 ----
NM_021155chr1962486 2064 545 475 197 24 1401 ----
NM_021156chr202868 104 1251 ----
NM_021159chr421479 244 ------
NM_021176chr221566 230 ------
NM_021183chrX21873 799 --1270 --
NM_021190chr11427 ------
NM_021191chr1262017 1746 1590 572 134 66 1935 ----
NM_021194chr12265 75 ------
NM_021202chr2042782 2122 2063 346 12168 --12015
NM_021205chr162292 2002 1124 324 180 131 ------
NM_021215chr2062413 1584 1499 715 414 335 12373 ----
NM_021224chr91337 --1423 --
NM_021239chr1421378 1053 ------
NM_021240chr9----2670 530 --
NM_021249chr1411395 1258 ----
NM_021255chr1453273 3219 1208 1052 933 33331 1605 388 1897 --
NM_021574chr2211002 ----12461
NM_021622chr1041911 1778 674 137 ------
NM_021633chr121221 1110 ------
NM_021643chr21117 ------
NM_021647chr434692 2882 875 --11314 1804
NM_021648chr641952 1841 452 21 22069 836 ----
NM_021722chr73500 476 376 ------
NM_021723chr73541 517 417 166 ----
NM_021728chr143763 318 124 ------
NM_021813chr655599 4080 2317 2034 680 ------
NM_021815chr242941 862 515 261 ----23055 756
NM_021818chr1421102 24 11523 ----
NM_021908chr73708 699 573 --1826 --
NM_021911chr554047 3501 1768 1618 1548 32089 1650 322 ----
NM_021912chr1521403 420 ------
NM_021913chr1961547 1405 1360 1150 1127 731 ------
NM_021914chr1441789 554 524 331 ----12175
NM_021935chr31916 ------
NM_021943chr641833 1821 1485 381 22140 2059 ----
NM_021945chr62882 668 33479 1227 684 ----
NM_021960chr132019 1940 481 2627 217 ----
NM_021961chr1164578 2723 2551 1657 1372 207 11076 --26665 1439
NM_021963chrX--1130 1547 --
NM_021964chr364321 4207 2253 1861 373 121 1880 11954 --
NM_021979chr143315 291 167 ------
NM_021984chrX1139 ------
NM_021987chrX1139 ------
NM_021988chr202195 123 ------
NM_021990chrX1139 ------
NM_021998chrX21214 93 ------
NM_022037chr21994 --1830 --
NM_022048chr1555499 1465 1387 396 205 25893 1428 15218 --
NM_022049chr111206 11892 ----
NM_022073chr1411156 ------
NM_022091chr641833 1709 700 646 12276 ----
NM_022116chr71169 --1107 1280
NM_022117chrX3600 551 433 ------
NM_022137chr1421285 249 ------
NM_022143chr721350 1072 11215 1192 --
NM_022166chr16106059 5800 5210 4695 4479 2157 1815 1314 988 676 35354 1174 444 ----
NM_022173chr21994 --1830 --
NM_022336chr222186 480 21485 712 ----
NM_022340chr373511 3218 3013 1277 1246 749 506 --42403 712 683 470 --
NM_022343chr91905 1378 ----
NM_022346chr431401 1323 974 1356 ----
NM_022351chr853850 3054 2402 704 635 42659 2422 1043 194 ----
NM_022442chr202195 123 ------
NM_022456chr1265776 5497 2154 2041 1602 1016 15620 ----
NM_022459chr1366253 6072 4758 4487 1921 1308 24150 3984 1526 --
NM_022465chr1233050 427 400 --11029 --
NM_022474chr1442000 567 246 114 ------
NM_022476chr161291 --1884 --
NM_022483chr541877 1433 1320 1282 ------
NM_022484chr711341 ------
NM_022491chr1251392 1045 744 607 484 ------
NM_022497chr351448 1263 962 805 182 --12823 --
NM_022650chr531007 184 126 ------
NM_022716chr162804 2277 2100 775 689 474 22191 1010 21260 703 --
NM_022731chr11218 ------
NM_022739chr171998 ----11100
NM_022748chr732707 1164 690 12129 --11104
NM_022753chr142826 2315 1908 456 ------
NM_022756chr131486 1148 23 ------
NM_022763chr343025 2137 978 632 ------
NM_022771chr1241067 1026 392 144 ----1336
NM_022780chr231745 1455 111 ------
NM_022781chr932345 1148 962 23079 159 ----
NM_022782chr12--1395 ----
NM_022802chr102645 242 --11192 1599
NM_022818chr1631650 275 221 --1174 --
NM_022826chr21454 ------
NM_022831chr121305 425 11873 11568 --
NM_022832chr432579 2479 504 1666 1836 12030
NM_022841chr1562202 828 479 365 301 193 ------
NM_022845chr1652196 2095 1833 757 292 2321 244 ----
NM_022893chr222301 604 --13105 --
NM_022894chr211153 ------
NM_022898chr1484537 4472 3833 3242 2999 1389 938 455 ------
NM_022900chr73949 846 292 ------
NM_022901chr941751 1403 1306 350 ------
NM_022902chr51424 ------
NM_022909chr51534 ----1435
NM_022912chr243042 2775 1185 645 22081 830 ----
NM_022918chr112162 84 --1193 --
NM_022965chr411391 ------
NM_022977chrX32653 2631 678 ------
NM_023000chr143688 309 182 11708 ----
NM_023001chr143688 309 182 11708 ----
NM_023009chr12574 32 1514 ----
NM_023012chr121490 ------
NM_023033chr12180 ----1537
NM_023105chr822073 345 22019 1980 ----
NM_023106chr822073 345 22019 1980 ----
NM_023110chr822073 345 22019 1980 ----
NM_023111chr822073 345 22019 1980 ----
NM_023923chr163479 3454 3193 3141 1516 269 23030 599 1405 --
NM_023927chr511098 --11354 --
NM_024007chr542354 1274 473 334 1622 --1296
NM_024015chr171169 ------
NM_024043chr1641423 1411 1140 104 21003 465 11194 11066
NM_024052chr1752900 2615 534 472 247 11199 --12065
NM_024071chr14--1622 ----
NM_024090chr41169 ------
NM_024344chr151491 ------
NM_024345chr9115839 5465 5341 5229 5065 5034 2133 1282 795 608 97 --26059 6039 --
NM_024408chr1--13251 --13707
NM_024429chr71709 ----1149
NM_024509chr191169 ------
NM_024524chr352831 2648 941 702 419 ------
NM_024525chr1153 1519 ----
NM_024529chr141167 873 327 42 --1804 --
NM_024539chrX31035 505 495 ------
NM_024546chr132880 84 1869 21120 471 --
NM_024556chr113504 491 443 ----1413
NM_024558chr142242 27 ------
NM_024582chr41977 1829 ----
NM_024594chr531477 241 115 ------
NM_024595chr12795 373 ------
NM_024612chr17--2157 143 1742 --
NM_024639chr63906 730 470 195 12180 1240
NM_024665chr344134 2887 1652 1378 11092 13038 14173
NM_024674chr132982 2656 1266 ------
NM_024680chr112567 210 ------
NM_024692chr241700 670 585 227 11872 11196 125
NM_024721chr832011 254 85 ----1583
NM_024744chr242712 1946 955 122 --1424 --
NM_024751chr43507 310 159 11507 ----
NM_024761chr965337 5017 4364 3290 548 504 --33310 2107 329 --
NM_024770chr2106414 5568 2245 1045 966 957 869 362 283 218 1535 32580 1837 136 1711
NM_024806chr111263 ------
NM_024818chr311116 11238 ----
NM_024824chr1431403 585 170 31304 1248 1151 ----
NM_024837chr1541669 731 683 652 --11336 --
NM_024854chr125519 307 237 161 33 --11313 --
NM_024881chr1961424 1412 1349 1043 817 600 --23353 197 --
NM_024884chr1494130 1821 1535 770 541 531 493 345 260 --24313 1361 --
NM_024893chr202981 229 ------
NM_024915chr852653 1110 1046 438 33 ----12503
NM_024920chr431419 1136 57 1231 11186 --
NM_024921chrX21441 782 --11367 --
NM_024930chr552293 1920 1879 158 124 ------
NM_024939chr1641639 1596 372 113 ------
NM_024941chr531254 360 22 11218 ----
NM_024944chr211343 --1119 --
NM_024945chr91178 ----1279
NM_024947chr3158696 7958 7721 7100 7006 6571 6121 3650 3221 2883 2820 2665 2609 1677 1476 21919 948 38738 6004 2321 19614
NM_024948chr102172 82 1245 1232 --
NM_024949chr454466 3375 1839 1145 396 21564 1543 --1760
NM_024953chr1272838 2452 1016 1009 1002 698 479 ------
NM_024989chr266105 3021 2819 2386 2134 1615 26667 5229 --26385 2966
NM_025047chr32509 334 ------
NM_025054chr873678 3658 3543 3477 2568 1211 264 ------
NM_025076chr22165 134 ------
NM_025114chr12151 ------
NM_025126chr123774 500 204 ------
NM_025133chr23952 416 253 1147 ----
NM_025134chr163713 552 182 --11651 --
NM_025141chr151481 ----1461
NM_025146chr352686 2635 2541 2309 97 22262 964 22093 1801 21755 552
NM_025147chr231046 935 387 ------
NM_025152chr141150 21294 1242 ----
NM_025154chr721125 272 ------
NM_025160chr143732 2947 2620 999 --11561 12756
NM_025179chr194649 4450 4433 3864 3720 1786 1512 1291 763 34249 4049 739 ----
NM_025182chr92277 154 ------
NM_025191chr153052 2910 957 421 391 23150 2772 ----
NM_025235chr103762 728 162 --11788 --
NM_025244chr2--1296 ----
NM_025264chr2296 41 ------
NM_030569chr1043368 1223 814 710 22785 2044 ----
NM_030623chr221400 321 11680 ----
NM_030625chr1042451 1690 1626 436 12562 ----
NM_030627chr524013 2627 --13985 --
NM_030634chr131987 609 82 ------
NM_030647chr786005 4657 2387 2287 1177 957 866 637 14225 ----
NM_030648chr454306 4299 3718 3379 805 11789 25179 1508 --
NM_030650chr233726 3628 1353 --33696 2889 363 --
NM_030651chr63635 167 49 ------
NM_030660chr1431404 1377 384 ------
NM_030661chr721047 567 11491 ----
NM_030664chr1022277 2039 ------
NM_030674chr1295847 5529 4843 4792 4724 4517 4248 3795 1560 24892 4813 --11626
NM_030751chr1021835 405 --11863 --
NM_030751chr1021835 405 --11863 --
NM_030759chr10----1669 --
NM_030777chr2042361 1514 944 87 ----1675
NM_030791chr142184 90 --1657 11529
NM_030799chr511722 21423 885 ----
NM_030806chr158290 7625 3780 2751 497 37861 7651 2881 1661 --
NM_030808chr171388 --1425 --
NM_030809chr1242433 1959 967 577 21864 398 21792 250 12055
NM_030817chr1272930 2837 2809 2398 1455 1381 1145 13151 ----
NM_030820chr62721 175 ------
NM_030881chr2231603 530 318 ------
NM_030885chr352273 1766 1652 600 515 ------
NM_030917chr41167 ------
NM_030920chr141697 1494 1420 413 1267 12057 --
NM_030925chr1322026 1997 22065 305 ----
NM_030938chr173366 358 332 --1783 --
NM_030939chr621087 997 ------
NM_030940chr931143 50 40 ------
NM_030949chr631456 452 392 ------
NM_031157chr121654 1529 ----
NM_031216chr1842125 1477 700 71 ------
NM_031217chr112217 116 ------
NM_031243chr72551 343 --1921 1818
NM_031262chr911089 ------
NM_031263chr911146 ------
NM_031267chr71346 ------
NM_031296chr432413 266 157 22765 1949 1481 --
NM_031305chr441249 604 367 343 ------
NM_031314chr1411855 ----21735 354
NM_031372chr441570 1345 1215 578 ----21618 1560
NM_031411chr52180 133 --11516 --
NM_031412chr1221216 262 1952 ----
NM_031417chr1942084 1715 850 269 22226 2124 ----
NM_031419chr321389 101 ----11040
NM_031422chr18------150
NM_031426chr911094 2373 367 22330 1013 12042
NM_031427chr1485929 5644 5571 2054 1464 982 976 520 --11994 --
NM_031442chrX41002 847 800 374 12266 --12721
NM_031445chr241020 971 730 574 11307 1888 --
NM_031453chr1052411 2202 2181 1046 220 --11965 --
NM_031480chr63228 163 64 --1170 --
NM_031483chr2043525 3128 1395 1353 1436 ----
NM_031492chr112424 164 ------
NM_031844chr1104063 3959 3695 3650 2794 1650 906 521 131 75 1689 --13414
NM_031845chr242310 614 522 473 13424 22623 46 --
NM_031847chr242310 614 522 473 13424 22623 46 --
NM_031849chr52180 133 --11516 --
NM_031850chr32165 152 ------
NM_031850chr32165 152 ------
NM_031857chr52180 133 --11516 --
NM_031860chr52180 133 --11516 --
NM_031885chr16127 ------
NM_031892chrX2770 364 ------
NM_031898chr17136 ------
NM_031966chr53497 472 96 ------
NM_032012chr974769 4738 3479 1595 861 716 623 137 ----
NM_032017chr131424 512 393 --1666 --
NM_032028chr5153 134 1634 --
NM_032042chr582862 2289 2255 2053 973 905 523 291 ------
NM_032047chr341980 1735 850 791 31794 479 257 --1191
NM_032048chr182592 55 ------
NM_032049chr32165 152 ------
NM_032049chr32165 152 ------
NM_032102chr1172992 2525 1918 1156 918 652 149 12092 ----
NM_032105chr186957 6623 6028 5977 3011 2671 1757 136 25384 415 25649 142 12637
NM_032128chr41874 ------
NM_032132chr11128 ------
NM_032138chr131500 ----1621
NM_032139chr193417 140 130 ------
NM_032144chr241419 1223 692 389 ------
NM_032145chr611887 11415 ----
NM_032147chr121973 1302 ----
NM_032153chr351863 1711 870 522 130 2935 913 1596 --
NM_032175chr541609 1445 639 581 ------
NM_032189chr1384489 3584 3498 3459 3263 3211 1989 1976 11463 33535 3408 3152 --
NM_032199chr1023120 1009 32551 2383 1226 --13129
NM_032208chr223032 930 22462 2298 13430 --
NM_032221chr204725 407 393 39 ----11311
NM_032228chr1153209 2536 2470 1354 526 ------
NM_032229chr1321021 855 ------
NM_032233chr142369 148 ------
NM_032239chr431386 1300 505 ------
NM_032246chr1531297 1143 335 ------
NM_032268chr1662412 2123 1205 958 945 91 22570 66 ----
NM_032281chr1932689 2627 2240 13191 ----
NM_032289chr571989 1781 1708 1676 1560 343 91 ------
NM_032291chr121453 645 ------
NM_032303chr921812 1246 154 1189 --
NM_032320chr112201 133 ------
NM_032321chr233219 3085 2238 --1818 --
NM_032364chr121922 --1786 1346
NM_032373chr1024290 895 44776 3639 2252 527 35541 4474 507 13699
NM_032408chr72889 324 ------
NM_032421chr762072 1312 828 693 569 425 ------
NM_032438chr651586 1386 451 232 179 145 11419 --
NM_032440chr1052792 2726 2582 815 342 22340 1184 --12130
NM_032445chr152950 829 1747 ----
NM_032446chr533686 2920 1077 ------
NM_032449chr132367 2168 1939 ------
NM_032457chr462515 1542 590 380 117 26 ------
NM_032458chrX92955 2132 1334 940 871 668 646 622 150 --1948 --
NM_032499chr1521115 551 ------
NM_032505chr342152 1928 1123 612 ------
NM_032510chr1872302 2221 1950 870 713 375 328 ------
NM_032521chr2053049 2882 2409 1237 952 1127 12114 --
NM_032558chr9----21473 1059 --
NM_032562chr10----1403 --
NM_032569chr1681823 1759 1732 799 574 307 229 222 ------
NM_032632chr1461571 1553 1277 797 742 731 ------
NM_032663chr1281985 1541 1532 1399 1269 761 173 134 1614 ----
NM_032682chr342426 2334 1166 390 23507 1130 22389 640 --
NM_032765chr5--1736 ----
NM_032778chr333230 2954 2033 --12555 --
NM_032801chr1182559 2167 1616 873 683 552 514 119 1856 ----
NM_032810chr103587 277 138 1105 ----
NM_032812chr103354 110 104 ------
NM_032817chr1043368 1223 814 710 22785 2044 ----
NM_032832chr631110 424 242 1486 166 --
NM_032837chr1741752 865 459 436 12017 ----
NM_032859chr1353794 3039 2460 2452 1403 13118 ----
NM_032869chr841814 773 493 87 ------
NM_032873chr1164478 3878 3451 2958 2935 138 1952 ----
NM_032883chr202594 28 ------
NM_032900chr1063789 2913 958 539 508 81 ------
NM_032918chr123945 427 276 11025 ----
NM_032949chr13155 1503 ----
NM_032961chr421226 971 --11366 --
NM_032973chrY21002 394 ------
NM_032978chr181261 1792 ----
NM_032979chr181261 1792 ----
NM_032981chr181261 1792 ----
NM_033012chr131717 ------
NM_033020chr144154 4104 3104 1037 ------
NM_033036chr1161707 1663 1459 465 416 205 1368 ----
NM_033044chr121130 153 ------
NM_033071chr61277 ------
NM_033081chr2011179 ------
NM_033132chr13------11745
NM_033133chr1763642 3497 2406 2319 1182 914 ------
NM_033136chr521783 633 ------
NM_033137chr521783 633 ------
NM_033138chr732052 1955 1825 31999 45 27 ----
NM_033139chr732052 1955 1825 31999 45 27 ----
NM_033140chr732052 1955 1825 31999 45 27 ----
NM_033157chr732052 1955 1825 31999 45 27 ----
NM_033181chr623708 2757 ----151
NM_033207chr101993 ----12043
NM_033211chr521569 772 ------
NM_033222chr9------11414
NM_033224chr7137912 7092 6579 2792 2589 2319 2287 2032 1887 1726 1094 197 85 27845 7640 13184 --
NM_033225chr842230 2143 555 477 1510 ----
NM_033272chr21147 ------
NM_033274chr532771 1338 1058 22739 2512 2102 35 --
NM_033281chr5--1190 ----
NM_033300chr111062 11004 ----
NM_033305chr921307 503 ------
NM_033326chr1142141 1843 346 150 ------
NM_033360chr1233756 1145 463 23774 1804 13631 --
NM_033380chrX21011 873 ----1441
NM_033381chrX21011 873 ----1441
NM_033393chr472936 2703 2416 2355 2243 2106 955 --12806 --
NM_033394chr231514 1399 1173 --21054 485 --
NM_033425chr1172922 2893 2515 1383 1019 801 122 12196 ----
NM_033426chr1432041 905 813 21181 79 ----
NM_033427chr71630 ------
NM_033429chr1542589 989 751 400 22236 779 12897 12782
NM_033480chr63266 255 69 32188 900 464 12894 --
NM_033481chr63266 255 69 32188 900 464 12894 --
NM_033505chr252546 2457 1817 1797 998 --24916 761 --
NM_033512chr843063 2659 751 362 --11880 --
NM_033516chr92621 369 11211 1518 --
NM_033624chr1242131 2063 1678 147 ------
NM_033631chr143917 3200 1361 849 ------
NM_033632chr41540 21024 494 ----
NM_033642chrX1193 188 ----
NM_033644chr512071 --11906 --
NM_033645chr512071 --11906 --
NM_033656chr2195407 5318 5001 4408 4271 4048 2071 1361 934 ------
NM_052832chr862590 1053 768 750 655 320 --11210 --
NM_052845chr1262992 2646 2263 2197 1037 216 3600 109 95 11132 --
NM_052860chr52859 211 2768 385 177 --
NM_052864chr452071 656 473 408 43 ------
NM_052879chr1243597 3573 3383 2578 12818 ----
NM_052885chr1264887 4602 4193 3319 3212 730 44903 4157 3840 1725 1511 14330
NM_052888chr171150 ------
NM_052896chr122076 1933 11593 179 --
NM_052897chr121317 1184 ----
NM_052898chr841337 457 405 106 2754 432 ----
NM_052900chr851245 724 547 432 30 1668 ----
NM_052905chr221241 284 11725 1154 --
NM_052910chr1321940 712 --2617 143 --
NM_052917chr232940 2902 1231 12088 ----
NM_052918chr1053244 2612 1034 688 644 12321 ----
NM_052925chr1921054 842 1260 ----
NM_052927chr541528 1400 760 325 11427 22106 1860 --
NM_052944chr16180 ------
NM_052953chr31225 1306 ----
NM_052954chr2141465 893 650 579 11496 ----
NM_052978chr1441745 631 290 208 11916 1278 --
NM_053016chr987660 7073 6282 6129 5163 2942 1479 1242 46658 2555 2203 1962 32313 1889 554 --
NM_053024chr31622 ----164
NM_053043chr7105959 5403 5134 4212 4141 1467 1224 484 366 29 1451 11900 --
NM_053281chrX1104 ------
NM_057159chr92522 241 ------
NM_057161chr61500 1521 ----
NM_057169chr12113166 2932 2380 2200 1239 1152 733 665 629 472 36 --12722 12075
NM_057170chr12113166 2932 2380 2200 1239 1152 733 665 629 472 36 --12722 12075
NM_057175chr422536 1912 ------
NM_057178chr1742817 2666 1024 711 ------
NM_058172chr4197 11353 --11530
NM_078474chr151481 ----1461
NM_078483chr552960 1621 1175 810 88 --24088 2793 --
NM_078487chr9----23284 2443 --
NM_079421chr191475 ------
NM_080425chr201228 ------
NM_080426chr201228 ------
NM_080546chr921634 828 21755 1672 ----
NM_080552chr201107 ------
NM_080597chr182834 691 ------
NM_080629chr141047 1028 198 175 ------
NM_080630chr141047 1028 198 175 ------
NM_080645chr61260 --1463 --
NM_080671chr242041 2021 864 499 ----1158
NM_080672chr20--181 --1448
NM_080683chr4--198 1399 --
NM_080684chr4--198 1399 --
NM_080685chr4--198 1399 --
NM_080738chr141823 1783 662 548 11437 ----
NM_080743chr672450 2271 2158 710 606 416 41 ----1566
NM_080759chr1331953 672 238 172 --11699
NM_080760chr1331953 672 238 172 --11699
NM_080836chr2044205 1415 707 155 11754 14692 --
NM_080840chr204525 365 356 122 ------
NM_080841chr204525 365 356 122 ------
NM_080862chr31941 ------
NM_080867chr1465035 3184 1377 1023 931 807 41889 1754 1078 1062 24815 4667 15062
NM_080868chr1----122 --
NM_080872chr873704 3432 3158 2928 2744 304 187 ------
NM_080927chr332490 823 263 12897 --12704
NM_130387chr32926 131 ------
NM_130391chr933584 2774 654 11218 ----
NM_130392chr933584 2774 654 11218 ----
NM_130393chr933584 2774 654 11218 ----
NM_130434chr1511146 ------
NM_130435chr1022754 495 32377 876 353 11847 --
NM_130439chr1041523 809 479 394 1565 12092 --
NM_130439chr1041523 809 479 394 1565 12092 --
NM_130795chr91746 ------
NM_130798chr153518 496 80 ------
NM_130846chr124974 929 357 105 ------
NM_130847chr1154918 4020 1959 1765 917 31982 1486 1156 14854 --
NM_133170chr2097536 6940 6766 5352 1841 1032 443 368 90 36459 6227 5402 15625 --
NM_133264chr1793771 3642 3591 3531 3133 2808 779 387 93 23324 1107 ----
NM_133265chrX53608 2971 2902 2420 514 1236 ----
NM_133329chr231847 632 360 ----11675
NM_133334chr445839 5780 4763 1275 35792 2206 1305 ----
NM_133338chr51482 ------
NM_133339chr51482 ------
NM_133340chr51482 ------
NM_133341chr51482 ------
NM_133342chr51482 ------
NM_133343chr51482 ------
NM_133344chr51482 ------
NM_133370chr463501 2845 2373 2332 2313 1162 2942 110 ----
NM_133372chr522845 2450 --12266 --
NM_133378chr21276 1134 ----
NM_133432chr21276 1134 ----
NM_133437chr21276 1134 ----
NM_133445chr922966 741 22840 176 32427 1027 237 11379
NM_133446chr10--1299 ----
NM_133493chr634549 4464 4001 14668 ----
NM_133503chr124632 305 234 213 1550 --1709
NM_133504chr124632 305 234 213 1550 --1709
NM_133505chr124632 305 234 213 1550 --1709
NM_133506chr124632 305 234 213 1550 --1709
NM_133507chr121810 1728 --1887
NM_133631chr321509 1203 ------
NM_133646chr275302 4143 4012 2075 1656 1338 1160 ------
NM_133647chr1543610 1058 166 137 ------
NM_133650chr61277 ------
NM_134265chr173260 148 62 ------
NM_134268chr171781 ------
NM_134427chr91746 ------
NM_134428chr92363 59 ------
NM_138270chrX43025 2998 2103 896 12156 ----
NM_138286chr1944209 2740 2675 997 23804 3178 ----
NM_138288chr1441716 872 302 197 --1529 --
NM_138319chr1531222 1025 305 ------
NM_138323chr152735 360 1152 ----
NM_138328chr1783041 3028 2434 2210 2115 1328 699 399 11155 1626 --
NM_138333chr92812 304 --32001 824 330 --
NM_138335chr42929 710 ------
NM_138346chr1----1219 --
NM_138348chr5106268 6175 5345 4840 4719 4354 2294 2167 1434 876 --25042 2644 12538
NM_138357chr1021761 1632 ----1195
NM_138385chr411387 11034 ----
NM_138395chr231196 1178 118 ------
NM_138409chr671376 1153 1013 361 249 168 159 ------
NM_138423chr1531968 1476 923 ------
NM_138426chr712503 22291 833 22036 310 12330
NM_138437chrX3331 268 239 ------
NM_138468chr2176008 5956 5196 5090 4867 4625 4471 3945 2079 1880 1841 1673 1583 1198 1036 356 330 15879 ----
NM_138473chr1235039 1174 569 ----14115
NM_138554chr922107 672 12723 ----
NM_138559chr211087 21237 1026 ----
NM_138576chr1484537 4472 3833 3242 2999 1389 938 455 ------
NM_138615chr3157 ------
NM_138633chr63714 417 92 --11506 --
NM_138638chr1441789 554 524 331 ----12175
NM_138701chr7262 26 ------
NM_138713chr1676958 6751 2982 2828 2757 1245 833 23233 437 17864 --
NM_138714chr1676958 6751 2982 2828 2757 1245 833 23233 437 17864 --
NM_138717chr62715 509 ------
NM_138727chr172473 2253 1698 1630 833 775 139 1674 ----
NM_138728chr172473 2253 1698 1630 833 775 139 1674 ----
NM_138731chr1473981 3795 3663 3102 1356 1231 753 --23606 397 --
NM_138735chr211092 ------
NM_138766chr52151 77 1189 ----
NM_138768chr113854 744 652 3727 343 123 1140 --
NM_138779chr131254 ------
NM_138782chr541831 492 452 412 --21627 640 --
NM_138799chr212055 ----1743
NM_138821chr52151 77 1189 ----
NM_138822chr52151 77 1189 ----
NM_138927chr21--11027 ----
NM_138931chr31307 ------
NM_138959chr1126070 6033 5736 5649 5087 4604 4170 2461 2082 1865 1378 869 26350 1010 25510 998 --
NM_138970chr1442308 2261 1905 418 1195 ----
NM_138980chr41610 --1688 1195
NM_138981chr41741 --1819 1326
NM_138982chr41610 --1688 1195
NM_138995chr22930 204 ------
NM_139045chr92570 249 ------
NM_139057chr1542218 2115 916 731 21954 30 1837 --
NM_139071chr1261675 1340 1220 1087 431 219 11515 11687 --
NM_139072chr2--175 ----
NM_139076chr461514 1371 1248 1029 227 82 --11451 198
NM_139135chr141155 1137 516 263 ------
NM_139136chr1221119 888 1201 ----
NM_139160chr11287 24 ------
NM_139168chr52359 50 1778 --11333
NM_139276chr1732265 2118 1914 12067 --11954
NM_139283chr1222543 588 ------
NM_139321chr2073496 3185 1578 1012 841 246 153 13990 --12907
NM_139323chr201783 2665 564 ----
NM_144488chr91746 ------
NM_144489chr91746 ------
NM_144498chr2042038 1606 601 207 --11682 --
NM_144567chr172835 2467 2446 955 538 344 64 1646 1207 --
NM_144571chr4106199 5239 4877 4659 4574 4428 2716 2421 1369 96 12304 ----
NM_144578chr14135151 4822 4669 4148 3765 1996 1708 1521 1302 1125 785 590 463 14249 ----
NM_144594chr121192 ------
NM_144599chr1565489 4828 3772 1829 1446 269 25147 3393 ----
NM_144600chr1611039 ------
NM_144628chr2032996 840 291 1636 ----
NM_144632chr241897 1784 1766 1585 ------
NM_144642chr32474 121 ------
NM_144643chr41427 ------
NM_144664chr1132500 972 162 ------
NM_144693chr19187 170 2498 413 --
NM_144710chr241485 960 555 236 ------
NM_144728chr12293 109 ------
NM_144729chr12293 109 ------
NM_144732chr192956 743 ------
NM_144777chr13190 1223 ----
NM_144778chr132996 717 ------
NM_144949chr262131 2082 1614 761 447 91 12177 --1114
NM_144963chr82647 273 11819 ----
NM_144982chr123816 130 74 ------
NM_145000chr5--1226 --1521
NM_145005chr92329 307 ----1835
NM_145010chr102890 460 22268 714 1105 --
NM_145014chr112336 91 ------
NM_145055chr1843216 3119 2810 1095 171 ----
NM_145113chr142426 254 ------
NM_145117chr1142781 2721 388 359 ------
NM_145203chr13--1817 ----
NM_145206chr1052807 2625 2072 1338 399 ----11210
NM_145207chr495241 4423 3885 1550 1416 1204 739 667 193 23588 1814 --24795 1194
NM_145251chr1441601 1342 1183 1014 ------
NM_145259chr296957 6567 6156 5461 4711 4612 4582 459 312 16278 25024 286 --
NM_145284chrX32226 2183 1837 1161 12025 --
NM_145303chr62444 185 ------
NM_145305chrX21068 407 ------
NM_145307chr1053177 1803 1664 1655 123 150 ----
NM_145315chr61164 ------
NM_145320chr753580 2596 1114 429 290 ----12209
NM_145321chr753580 2596 1114 429 290 ----12209
NM_145322chr753580 2596 1114 429 290 ----12209
NM_145332chr63962 902 49 ------
NM_145333chr63962 902 49 ------
NM_145341chr103394 371 248 11382 ----
NM_145686chr252658 2442 2246 2177 79 ----12556
NM_145687chr252658 2442 2246 2177 79 ----12556
NM_145690chr821778 1369 11792 11885 --
NM_145716chr11405 ------
NM_145798chr172900 25 ----1742
NM_145799chrX53144 2186 1127 927 914 ------
NM_145805chr153564 511 88 ------
NM_145808chr763123 2807 2588 2412 1097 698 1570 1556 --
NM_145861chr141823 1783 662 548 11437 ----
NM_145891chr1651580 1442 556 347 46 ------
NM_145892chr1651580 1442 556 347 46 ------
NM_145893chr1651702 1564 678 469 168 ------
NM_145912chr2263980 3272 3209 1793 786 398 33162 1686 1113 11870 --
NM_147150chr933768 3251 1481 12685 13103 --
NM_147156chr1021205 239 --2321 306 --
NM_147175chrX42213 1966 1700 289 ------
NM_147189chr862371 1550 1525 938 366 85 ------
NM_147223chr241594 1572 551 532 12087 ----
NM_147233chr241411 1389 368 349 11904 ----
NM_148174chr822057 678 2755 378 145 --
NM_148894chr45837 217 131 76 24 ------
NM_148957chr1362390 845 298 257 182 65 ------
NM_152233chr1411395 1258 ----
NM_152237chr221109 ------
NM_152253chr2234058 3937 3855 23864 1654 24286 3390 --
NM_152261chr1232166 1663 489 --2927 199 --
NM_152263chr165764 5639 4386 4234 2178 182 --1287 16024
NM_152265chr121519 1271 11317 ----
NM_152271chr8----1943 --
NM_152275chr252246 1835 899 674 185 1770 ----
NM_152283chr51170 1350 ----
NM_152284chr8136 172 1700 --
NM_152330chr1442535 1819 1711 680 2944 231 166 --
NM_152332chr1442741 2260 795 588 --22532 337 --
NM_152335chr152167 50 ------
NM_152365chr1--1384 ----
NM_152375chr132569 1958 1947 21729 325 ----
NM_152380chr111410 ------
NM_152381chr2141 21165 398 ----
NM_152387chr23179 141 44 1101 --11022
NM_152388chr294059 3986 3822 3418 3197 2858 1449 1305 741 32601 968 714 ----
NM_152407chr5103175 3013 2839 2563 2066 1218 1178 965 545 419 ----22204 1271
NM_152414chr841401 1284 1029 330 ------
NM_152415chr81355 ------
NM_152417chr85881 398 373 350 274 ------
NM_152422chr941201 463 183 69 ------
NM_152423chrX31174 211 100 1173 ----
NM_152424chrX34594 1053 657 24106 1530 2922 886 --
NM_152442chr12--11427 ----
NM_152447chr141274 ------
NM_152455chr1522803 2113 132 ----
NM_152470chr1853470 3364 3284 1039 855 ------
NM_152493chr14472 320 134 102 ------
NM_152519chr252014 1646 1575 1502 551 ------
NM_152522chr23745 729 407 ------
NM_152527chr262167 2081 1525 1497 513 353 1415 ----
NM_152542chr431417 829 362 --11844 --
NM_152546chr521058 217 ------
NM_152549chr53240 144 48 ------
NM_152556chr72773 34 2593 182 ----
NM_152557chr7179 ------
NM_152594chr1532062 72 24 11541 11605 --
NM_152608chr162520 2334 2208 1949 621 559 ----12078
NM_152609chr14823 781 485 408 ------
NM_152622chr543226 1264 1138 967 13013 31072 1059 245 --
NM_152624chr5117313 6601 6410 6061 4969 2953 2253 1677 670 516 231 ------
NM_152636chr1163064 1233 956 476 363 111 1453 --1138
NM_152638chr1241093 973 373 192 --21276 815 --
NM_152641chr1232648 433 142 22825 1036 22562 2410 --
NM_152653chr31535 ------
NM_152660chr12211 90 ------
NM_152665chr141013 809 345 128 ------
NM_152667chr2021465 165 ----11020
NM_152672chr31196 ------
NM_152673chr342919 2846 1606 607 1720 --11346
NM_152678chr342280 1001 774 514 ------
NM_152680chr412331 1766 1574 --
NM_152682chr441237 422 251 145 1154 ----
NM_152688chr61636 --1649 --
NM_152694chrX4878 662 311 139 1286 ----
NM_152699chr333566 2965 865 1304 ----
NM_152704chr132271 74 1725 ----
NM_152716chr1121434 1009 ------
NM_152723chr115966 954 860 413 272 ------
NM_152729chr62404 113 11586 ----
NM_152733chr686334 6154 5952 1815 1713 1614 1204 1058 --1794 --
NM_152739chr73838 379 35 --1217 --
NM_152745chr72939 827 --1780 --
NM_152749chr75767 469 402 245 118 1358 ----
NM_152754chr733194 943 303 12908 1714 --
NM_152756chr593650 3464 2935 1681 1559 1152 992 922 607 ------
NM_152758chr872834 2799 2709 2451 2207 235 88 --1547 --
NM_152787chrX63904 2435 766 707 439 282 ----1928
NM_152789chr721225 957 ----11005
NM_152793chr753598 1868 1776 291 172 11920 ----
NM_152838chr2042610 1421 1301 449 1282 ----
NM_152860chr12--1366 ----
NM_152888chr81794 ----1654
NM_152890chr121235 439 1894 --11148
NM_152903chr132468 50 12784 --1915
NM_152904chr172285 255 ------
NM_152924chr1554717 2497 2490 2145 172 21045 430 --11026
NM_152989chr121232 1749 ----
NM_152990chr621108 30 ------
NM_152994chr2--1615 ----
NM_152995chr42629 48 ------
NM_152996chr142020 2010 1837 120 11744 ----
NM_152999chr794735 4301 4181 3536 3043 2011 1474 1147 35 --33297 1139 354 --
NM_153005chr63228 163 64 --1170 --
NM_153020chr611121 ------
NM_153029chr1663765 3474 1467 1176 778 22 23752 56 14079 --
NM_153035chr152911 2719 2668 2623 828 1529 12126 --
NM_153042chr651552 551 480 310 267 ------
NM_153050chr2284989 4679 4295 4076 3427 3235 3220 1251 24580 4236 11473 --
NM_153051chr2284989 4679 4295 4076 3427 3235 3220 1251 24580 4236 11473 --
NM_153182chr333230 2954 2033 --12555 --
NM_153186chr92145 42 --1867 1101
NM_153188chr5135552 5387 5149 4597 4443 3982 2259 2044 1648 1449 1025 487 449 --11405 --
NM_153207chr121319 12714 13821 --
NM_153211chr182138 74 ------
NM_153223chr531583 1074 293 ------
NM_153234chr562434 2188 1000 489 111 83 --22757 481 --
NM_153235chr652416 2315 1817 715 398 32211 2107 875 ----
NM_153240chr32986 157 ------
NM_153260chr152383 177 11516 ----
NM_153261chr1621425 279 ------
NM_153262chr163111 3017 2918 1208 1171 912 32793 2710 656 1136 --
NM_153266chr111282 ------
NM_153267chr91104 1717 ----
NM_153273chr32694 205 1929 1989 --
NM_153340chr11119 ------
NM_153354chr531004 907 755 ------
NM_153365chr431782 709 218 12298 12189 --
NM_153369chr631887 1385 1173 ------
NM_153371chr1342188 747 546 170 1282 ----
NM_153456chr13116332 5850 4803 4700 2180 2122 1961 1906 1877 1540 1009 ----12229
NM_153607chr572591 2576 2560 2227 1955 1226 1154 1505 --22214 2184
NM_153619chr151575 ------
NM_153631chr721047 567 11491 ----
NM_153632chr721047 567 11491 ----
NM_153633chr121527 ------
NM_153682chr21147 ------
NM_153686chr492460 2336 1984 1772 1540 900 670 541 255 --21946 1834 --
NM_153688chr1651468 1163 735 599 247 --11457 11295
NM_153748chr1221119 888 1201 ----
NM_153757chr411036 189 --11243
NM_153810chr1094446 3875 1709 1683 1293 1115 919 607 100 34202 4028 1198 --24942 2034
NM_153812chr142104 1891 1734 1633 --1426 --
NM_153828chr23894 661 206 1956 ----
NM_153831chr82770 157 --1274 --
NM_170606chr71124 ------
NM_170672chr251787 1625 727 311 75 1554 ----
NM_170674chr1521141 1061 --11364 --
NM_170675chr153817 737 272 --11040 --
NM_170676chr153817 737 272 --11040 --
NM_170677chr1521141 1061 --11364 --
NM_170679chr52871 851 11249 ----
NM_170706chr144193 3562 1486 915 13842 ----
NM_170709chr852319 2249 2231 1964 308 ----21924 218
NM_170710chr43657 648 540 ------
NM_170720chr1921084 1044 ------
NM_170731chr1132842 1991 813 ----11095
NM_170732chr1132842 1991 813 ----11095
NM_170733chr1132842 1991 813 ----11095
NM_170734chr1132842 1991 813 ----11095
NM_170735chr1132842 1991 813 ----11095
NM_170750chrX2841 682 2578 315 ----
NM_170751chr651204 1196 976 286 201 1100 ----
NM_170752chr651204 1196 976 286 201 1100 ----
NM_170754chr121178 ------
NM_170774chr2073841 3233 3153 1435 1329 1183 349 11651 ----
NM_171998chrX22344 2208 --22227 448 1357
NM_171999chr182640 536 1268 1216 --
NM_172020chr781844 1794 1542 1479 1418 1390 734 437 11503 ----
NM_172070chr21576 --166 11643
NM_172071chr147365 2514 1386 646 15752 11492 16407
NM_172103chr651840 1086 859 782 619 ------
NM_172105chr651840 1086 859 782 619 ------
NM_172127chr411690 ------
NM_172128chr411646 ------
NM_172193chr1421268 1080 ------
NM_172315chr1521141 1061 --11364 --
NM_172316chr1521141 1061 --11364 --
NM_172337chr143763 318 124 ------
NM_172344chr231847 632 360 ----11675
NM_172373chr131398 ------
NM_172375chr14194 1107 ----
NM_173054chr7----1719 --
NM_173065chr183642 3267 2952 901 700 454 273 203 ------
NM_173075chr42587 214 11632 ----
NM_173078chrX1398 ------
NM_173083chr1268 50 ------
NM_173087chr151491 ------
NM_173088chr151491 ------
NM_173089chr151491 ------
NM_173090chr151491 ------
NM_173164chr16189 ------
NM_173198chr952806 2723 2576 2270 24 ------
NM_173200chr952806 2723 2576 2270 24 ------
NM_173214chr1676958 6751 2982 2828 2757 1245 833 23233 437 17864 --
NM_173353chr121620 ------
NM_173354chr211759 ------
NM_173355chr22769 209 ----1292
NM_173468chr465835 5059 4797 4297 958 653 45652 3842 1802 396 --14535
NM_173469chr1541397 1337 158 72 11159 ----
NM_173470chrX42634 2574 1150 180 21170 675 12389 --
NM_173471chr33820 261 155 ------
NM_173478chr17--1784 ----
NM_173495chrX32214 544 83 1316 12122 --
NM_173511chr2----23694 2777 --
NM_173519chr821875 656 ------
NM_173531chr1953119 2887 2741 2657 301 --1525 --
NM_173552chr362421 1979 1747 1589 286 225 ------
NM_173576chr1031826 1652 746 1851 1277 --
NM_173582chr1186060 5054 3975 3963 1668 1587 974 172 1889 --24191 2002
NM_173595chr1232094 1256 1180 1602 ----
NM_173607chr1472108 1516 1469 577 338 35 21 ------
NM_173642chr188936 7882 6774 5846 3098 1769 1470 761 28144 7363 ----
NM_173647chr21966 --1717 --
NM_173653chr33468 432 404 11241 11162 --
NM_173670chr51941 11032 ----
NM_173683chr8137 --1186 --
NM_173694chrX42224 1703 1633 242 ------
NM_173791chr10----121 --
NM_173794chrX3505 473 161 ------
NM_173797chr5--1998 --11326
NM_173808chr174398 3932 3612 3218 2722 1093 234 --13053 1601
NM_173809chr10--1273 --11287
NM_173822chr252125 1544 1474 1342 293 ------
NM_173829chr585377 4926 4414 3807 2027 1827 1621 908 15087 14008 1306
NM_173832chr882409 1082 936 774 496 372 273 244 ----1638
NM_173848chr82618 181 ------
NM_174887chr171360 ------
NM_174890chr101517 ------
NM_174909chr51333 1557 1667 --
NM_174911chr873964 3840 3041 1176 718 489 355 ------
NM_174921chr43875 837 137 ------
NM_174934chr1143134 2942 2775 2416 --12782 --
NM_174938chr93345 170 137 ------
NM_175061chr71245 --11592 --
NM_175607chr311110 1679 ----
NM_175612chr311110 1679 ----
NM_175623chr1265776 5497 2154 2041 1602 1016 15620 ----
NM_175733chr1162106 1962 1588 1517 1480 478 11402 ----
NM_175767chr531836 1241 479 ------
NM_175852chr152819 1956 484 274 68 42524 1023 392 366 --12677
NM_175854chr131533 2829 492 12309 --
NM_175861chr1284453 4048 1347 1027 1005 620 560 361 24780 1569 --15454
NM_175863chr61487 ------
NM_175866chr13921 582 435 ------
NM_175876chr162505 2387 836 754 160 71 12796 ----
NM_175910chr1982332 2066 894 731 479 395 311 59 ------
NM_176081chr10116010 5893 5651 4558 4449 4423 4279 4208 3823 1536 705 15225 ----
NM_176083chr10116010 5893 5651 4558 4449 4423 4279 4208 3823 1536 705 15225 ----
NM_176801chr431460 1137 304 ------
NM_176812chr201281 --1659 --
NM_177414chr131777 53 21 ------
NM_177424chr141440 1390 582 28 ------
NM_177524chr741026 872 467 170 ------
NM_177525chr741026 872 467 170 ------
NM_177947chrX2540 511 --1292 --
NM_177948chrX2540 511 --1292 --
NM_177952chr141855 ------
NM_177964chr21533 ------
NM_177967chr132661 180 ------
NM_177968chr222122 1493 1896 ----
NM_177974chr1531968 1476 923 ------
NM_177985chr22649 207 1485 11754 --
NM_177995chr941201 463 183 69 ------
NM_178010chr121232 1749 ----
NM_178011chr1022498 200 12936 13019 --
NM_178120chr231376 1045 362 11174 ----
NM_178123chr21256 --1300 --
NM_178140chr562539 2464 781 761 569 126 1663 --1576
NM_178151chrX107824 6526 6216 4949 2887 2627 2215 1840 1638 996 22031 291 26683 2570 --
NM_178152chrX107824 6526 6216 4949 2887 2627 2215 1840 1638 996 22031 291 26683 2570 --
NM_178153chrX107824 6526 6216 4949 2887 2627 2215 1840 1638 996 22031 291 26683 2570 --
NM_178169chr121196 1371 --1340
NM_178313chr251579 1469 808 667 217 ------
NM_178326chr211637 ------
NM_178424chr51206 --1514 --
NM_178426chr11189 --32124 1961 574 --
NM_178427chr12906 89 --32024 1861 474 --
NM_178438chr11275 ------
NM_178439chr21492 ------
NM_178450chr53696 648 225 ----1637
NM_178470chrX41147 686 545 429 11053 11487 --
NM_178496chr34970 428 155 127 --11066 --
NM_178507chr111790 ------
NM_178539chr1231404 799 698 1527 --11715
NM_178566chr91195 11749 11589 --
NM_178584chr241485 960 555 236 ------
NM_178585chr422784 674 1613 ----
NM_178586chr1432254 842 102 22456 1973 ----
NM_178812chr81584 ------
NM_178818chr1652298 1653 731 608 53 --11737 --
NM_181077chr1531653 783 144 --2454 346 --
NM_181265chr43657 648 540 ------
NM_181349chr752686 2642 2377 2242 586 2476 316 1329 --
NM_181351chr1142685 2156 1100 512 22569 344 ----
NM_181354chr831552 1343 1175 171 ----
NM_181358chr144047 1711 1670 947 --13575 --
NM_181361chr32299 78 137 ----
NM_181442chr202793 231 ------
NM_181453chr261287 1240 700 635 466 368 ------
NM_181481chr18106812 6463 5001 2659 1772 1195 907 816 633 549 16442 1860 --
NM_181482chr18106812 6463 5001 2659 1772 1195 907 816 633 549 16442 1860 --
NM_181483chr18106812 6463 5001 2659 1772 1195 907 816 633 549 16442 1860 --
NM_181491chr972128 2017 989 754 696 543 130 22470 2429 ----
NM_181504chr584164 3588 3353 2888 831 358 206 95 33232 1066 34 21114 868 --
NM_181507chr1131064 823 378 ------
NM_181508chr1131064 823 378 ------
NM_181521chr1687079 6434 5512 5389 4834 2405 2266 1907 34790 1863 123 16518 11553
NM_181523chr584164 3588 3353 2888 831 358 206 95 33232 1066 34 21114 868 --
NM_181524chr584164 3588 3353 2888 831 358 206 95 33232 1066 34 21114 868 --
NM_181659chr2063398 3004 2466 2291 1092 555 12140 1119 --
NM_181659chr2063398 3004 2466 2291 1092 555 12140 1119 --
NM_181670chr121160 11318 ----
NM_181672chrX21898 460 ------
NM_181673chrX21898 460 ------
NM_181674chr51371 ------
NM_181675chr51371 ------
NM_181676chr51371 ------
NM_181677chr51371 ------
NM_181678chr51371 ------
NM_181701chr922020 33 ------
NM_181706chr116963 924 614 564 363 63 ------
NM_181712chr12838 723 11765 ----
NM_181726chr41203 --161 --
NM_181780chr331629 1533 529 11392 12091 --
NM_181784chr241799 991 622 553 11704 ----
NM_181787chr833069 2989 1189 ------
NM_181807chr11--1135 ----
NM_181838chr551244 1168 544 359 274 --11250 11078
NM_181861chr1242045 1081 1043 92 ------
NM_181868chr1242045 1081 1043 92 ------
NM_181869chr1242130 1166 1128 177 ------
NM_181886chr421039 945 --1174 --
NM_181887chr421039 945 --1174 --
NM_181888chr421039 945 --1174 --
NM_181889chr421039 945 --1174 --
NM_181890chr421039 945 --1174 --
NM_181891chr421039 945 --1174 --
NM_181892chr421086 992 --1221 --
NM_181893chr421039 945 --1174 --
NM_182485chr433764 2686 821 12484 ----
NM_182487chr984399 3950 3717 3415 854 847 552 145 44266 3083 1457 291 ----
NM_182488chr131774 1105 ----
NM_182493chr1684057 3967 3525 1544 1529 1114 426 176 ----11926
NM_182503chr674627 4511 4413 4398 4133 4059 494 11093 13427 14732
NM_182509chr1431655 350 337 ------
NM_182515chr1945107 2471 1019 788 15760 --14613
NM_182529chr7192 --139 --
NM_182551chr253299 2746 2291 663 452 --23378 721 22595 68
NM_182569chr171241 ------
NM_182646chr433764 2686 821 12484 ----
NM_182648chr142726 203 ------
NM_182715chr72390 268 21111 209 ----
NM_182717chr1021531 1071 1352 ----
NM_182720chr1021531 1071 1352 ----
NM_182721chr1021531 1071 1352 ----
NM_182722chr1021531 1071 1352 ----
NM_182723chr1021531 1071 1352 ----
NM_182756chr24562 495 208 143 ------
NM_182758chr1532828 791 110 23324 1238 ----
NM_182762chr745595 4245 1655 300 11218 ----
NM_182763chr132008 1929 470 2616 206 ----
NM_182765chr1021979 126 2816 105 ----
NM_182767chr123468 376 78 --11677 --
NM_182789chr5--11090 ----
NM_182797chr202512 316 ------
NM_182830chr1441735 1444 862 639 ------
NM_182853chr1021531 1071 1352 ----
NM_182898chr755719 5684 5025 4792 4549 --66439 6281 6081 6009 4347 634 15846
NM_182899chr755719 5684 5025 4792 4549 --66439 6281 6081 6009 4347 634 15846
NM_182907chr62100 35 ------
NM_182910chr141747 ------
NM_182911chr2--1296 ----
NM_182913chr141747 ------
NM_182914chr141747 ------
NM_182917chr3------1450
NM_182918chr211107 --11354 --
NM_182931chr7186 ------
NM_182948chr122261 820 ----127
NM_182961chr61277 ------
NM_182964chr1142781 2721 388 359 ------
NM_182972chr142676 2500 2313 275 1592 ----
NM_182975chr121124 347 ------
NM_182976chr11768 ----1247
NM_182977chr521131 104 ------
NM_183004chr1423735 335 13177 13804 --
NM_183011chr1021531 1071 1352 ----
NM_183012chr1021531 1071 1352 ----
NM_183013chr1021531 1071 1352 ----
NM_183043chr131365 --1403 1931
NM_183044chr131365 --1403 1931
NM_183244chr20--181 --1448
NM_183246chr20--181 --1448
NM_183323chr5--11090 ----
NM_183353chrX1395 ------
NM_183376chr1552535 2521 1024 669 153 ------
NM_183380chr6149 ------
NM_183416chr141932 1688 1535 308 1749 ----
NM_183419chr82418 78 1530 ----
NM_194071chr775395 5224 5207 4834 1905 1030 936 24303 1794 24826 847 1974
NM_194247chr264182 4076 3447 3347 3081 1806 ------
NM_194250chr21175 ------
NM_194271chr123774 500 204 ------
NM_194278chr1433786 3212 1028 21349 861 --12951
NM_194285chr1152270 1124 861 692 268 12242 11340 --
NM_194286chr1256234 5754 3866 2335 1292 15727 --15765
NM_194298chr1041980 1811 1669 1259 --11291 --
NM_194301chr143981 894 178 ------
NM_194314chr125666 1986 1605 13792 1792
NM_194317chr252657 1856 1746 990 228 11932 ----
NM_194328chr932345 1148 962 23079 159 ----
NM_194329chr932345 1148 962 23079 159 ----
NM_194330chr932345 1148 962 23079 159 ----
NM_194332chr932345 1148 962 23079 159 ----
NM_194358chr1221667 1562 21830 1789 21358 622 --
NM_194359chr1221667 1562 21830 1789 21358 622 --
NM_194434chr18105733 4635 4572 4398 4298 3965 2198 1784 1589 131 --21861 925 --
NM_194454chr721276 500 --1574 11328
NM_194455chr721276 500 --1574 11328
NM_194456chr721276 500 --1574 11328
NM_194463chrX31035 505 495 ------
NM_198057chrX11157 ------
NM_198074chr131092 457 430 --1899 1108
NM_198077chr12510 65 ------
NM_198123chr851245 724 547 432 30 1668 ----
NM_198124chr851245 724 547 432 30 1668 ----
NM_198128chr184782 723 602 176 ------
NM_198181chr1551910 1074 855 793 431 --1540 1771
NM_198217chr131797 11070 ----
NM_198218chr131797 11070 ----
NM_198219chr131797 11070 ----
NM_198243chr151255 ------
NM_198261chr121490 ------
NM_198262chr121490 ------
NM_198268chr144047 1711 1670 947 --13575 --
NM_198269chr144047 1711 1670 947 --13575 --
NM_198270chrX32782 1161 998 ------
NM_198273chr522271 973 ------
NM_198279chrX21056 494 ------
NM_198316chr121178 ------
NM_198320chr1254475 4268 3655 1047 1007 11358 12062 --
NM_198329chr311116 11238 ----
NM_198336chr711820 11284 11397 --
NM_198381chr1111190 122 ----
NM_198392chr651995 1811 915 352 112 1872 ----
NM_198395chr51115 ------
NM_198399chr341675 341 324 90 11283 ----
NM_198400chr1542952 2385 1980 976 ------
NM_198402chr31238 ------
NM_198404chr134283 259 137 47 1574 ----
NM_198465chrX62738 2451 1921 938 629 193 ----21911 1063
NM_198467chr7----1632 --
NM_198468chr664086 3178 3094 1666 1053 991 33459 3436 1579 ----
NM_198490chr362533 1021 830 163 129 121 22375 846 13029 --
NM_198503chr122082 1958 ----1441
NM_198507chr52515 108 ------
NM_198512chrX2580 398 ------
NM_198513chr851956 1895 1597 355 53 --1257 --
NM_198530chr174914 247 99 56 2453 272 1136 --
NM_198549chr152582 1194 790 329 166 ------
NM_198560chr363712 3635 674 516 133 80 --13801 --
NM_198581chr265869 4667 2878 2774 2408 674 26275 1549 --26067 2483
NM_198715chr1105885 5787 3967 3822 2397 2181 1278 1175 1102 574 25915 2421 36116 1671 1065 25673 4794
NM_198793chr394069 3984 3878 3115 3083 2802 2748 1385 158 13069 24149 3530 --
NM_198830chr171188 ------
NM_198859chr374701 3836 3814 2007 1351 1276 395 ----14493
NM_198896chr1151562 1362 840 649 540 136 ----
NM_199000chr72852 392 2834 815 ----
NM_199005chr92901 730 195 --1240
NM_199039chr431023 1000 690 ----1400
NM_199076chr103990 393 87 ----1866
NM_199136chr71376 ------
NM_199138chr132271 74 1725 ----
NM_199144chr202195 123 ------
NM_199160chr9--21725 1347 ----
NM_199169chr2063459 3241 2901 2401 298 237 23337 2668 23485 2748 --
NM_199170chr2063459 3241 2901 2401 298 237 23337 2668 23485 2748 --
NM_199171chr2063459 3241 2901 2401 298 237 23337 2668 23485 2748 --
NM_199188chr1243597 3573 3383 2578 12818 ----
NM_199189chr52257 187 ------
NM_199190chr1243597 3573 3383 2578 12818 ----
NM_199192chr2190 --1445 --
NM_199193chr2190 --1445 --
NM_199203chr202195 123 ------
NM_199229chr241588 1460 1149 451 ------
NM_199244chr92282 31 --1828 --
NM_199246chr53869 431 90 ----1820
NM_199262chr1742240 2175 1543 608 1854 ----
NM_199320chr462555 2185 1097 526 100 61 1886 22483 1108 --
NM_199320chr462555 2185 1097 526 100 61 1886 22483 1108 --
NM_199324chr462963 2419 2351 343 335 260 12591 --12792
NM_199330chr151520 ------
NM_199331chr151520 ------
NM_199332chr151520 ------
NM_199355chr1641795 542 162 109 ------
NM_199421chr1465035 3184 1377 1023 931 807 41889 1754 1078 1062 24815 4667 15062
NM_199423chr1621548 425 1381 ----
NM_199436chr262466 2110 1109 480 245 94 12790 12618 12137
NM_199437chr1161936 1876 771 271 78 63 2674 371 ----
NM_199438chr1161936 1876 771 271 78 63 2674 371 ----
NM_199439chr1161936 1876 771 271 78 63 2674 371 ----
NM_199462chr154138 3802 1392 1172 436 ------
NM_199478chrX2285 39 --21703 1437 --
NM_199482chr251710 1508 757 172 161 ------
NM_201266chr232648 2408 2306 1264 ----
NM_201267chr21614 ------
NM_201278chr1142397 2022 2015 1664 1107 21545 1494 --
NM_201279chr232648 2408 2306 1264 ----
NM_201280chr651616 1390 1306 652 572 197 ----
NM_201281chr1142397 2022 2015 1664 1107 21545 1494 --
NM_201428chr111116 ------
NM_201429chr111116 ------
NM_201432chr17115357 5061 4658 4497 4427 2346 1312 977 817 807 349 ------
NM_201433chr17115357 5061 4658 4497 4427 2346 1312 977 817 807 349 ------
NM_201535chr14----1689 --
NM_201536chr14----1689 --
NM_201537chr14----1689 --
NM_201538chr14----1689 --
NM_201539chr14----1689 --
NM_201540chr14----1689 --
NM_201541chr14----1689 --
NM_201567chr331742 617 34 ------
NM_201591chr421507 212 ------
NM_201592chr421507 212 ------
NM_201629chr91538 ------
NM_201632chr541314 760 717 638 1683 ----
NM_201999chr4--2912 906 ----
NM_203282chr1941523 1247 1137 254 ------
NM_203301chr1421143 1122 2343 182 11396 --
NM_203327chr2064603 3837 3509 1426 1058 258 ------
NM_203329chr11106632 6433 6411 4805 2623 2280 2258 1867 1188 1049 22665 1579 14842 26490 2337
NM_203330chr11106632 6433 6411 4805 2623 2280 2258 1867 1188 1049 22665 1579 14842 26490 2337
NM_203331chr11106632 6433 6411 4805 2623 2280 2258 1867 1188 1049 22665 1579 14842 26490 2337
NM_203349chr1521650 450 --11346 --
NM_203350chr151671 1425 1400 1078 345 ------
NM_203354chr141804 1103 1861 --
NM_203355chr141804 1103 1861 --
NM_203356chr141804 1103 1861 --
NM_203364chr1111145 --11170 --
NM_203365chr2--2600 101 ----
NM_203379chr101756 1327 ----
NM_203380chr101756 1327 ----
NM_203390chr81599 1557 --11485
NM_203394chr123436 397 287 --12732 --
NM_203406chr532607 2161 616 ----1205
NM_203434chr92965 113 --1927 --
NM_203437chr21798 1110 ----
NM_203446chr2131932 263 202 2618 104 ----
NM_203459chr142309 917 848 707 --1121 --
NM_203463chr254389 1599 1296 690 63 1799 ----
NM_203488chr142313 26 ------
NM_203506chr1712162 1564 ----
NM_205848chr162658 2594 1793 622 503 89 ------
NM_206594chr123678 2701 --21202 906 --
NM_206595chr123678 2701 --21202 906 --
NM_206853chr653529 1523 1166 770 314 3488 462 88 ----
NM_206854chr664790 2031 1575 1050 818 514 31749 1723 1349 ----
NM_206855chr675755 3943 2540 2015 1783 1479 601 12314 ----
NM_206860chr101310 ------
NM_206861chr101310 ------
NM_206862chr101310 ------
NM_206866chr2133275 846 584 ------
NM_206876chr273569 3511 3196 2841 1427 1221 385 22791 782 13561 --
NM_206909chr8158283 8092 7923 7693 7582 7046 6779 6761 6349 5508 2363 2326 2084 1869 1310 37078 6165 1339 26894 6466 --
NM_207012chr1033223 2280 175 2899 643 ----
NM_207015chr331809 308 53 ------
NM_207112chr161538 1142 ----
NM_207171chr121489 1383 11793 ----
NM_207304chr132883 604 ------
NM_207337chr123364 351 125 136 ----
NM_207361chr1346160 1540 1335 752 24112 596 ----
NM_207372chr1042394 2047 1670 289 --11657 --
NM_207387chr1751748 1700 1307 703 25 ------
NM_207391chr1911110 ------
NM_207404chr342223 2111 1503 353 ------
NM_207406chr466363 6033 1955 991 432 343 --1279 26384 5956
NM_207411chr862944 2881 2731 2471 1323 346 270 64 12549 12346
NM_207429chr1142287 2230 962 730 22631 298 ----
NM_207435chr122234 22 1756 ----
NM_207520chr23894 661 206 1956 ----
NM_207521chr23894 661 206 1956 ----
NM_207577chr1152588 2516 2507 1839 139 2839 451 ----
NM_207578chr12743 235 ------
NM_207645chr1111048 --1491 --
NM_207647chr952426 2041 532 428 346 --12571 12251
NM_207660chr1431403 585 170 31304 1248 1151 ----
NM_207661chr1431403 585 170 31304 1248 1151 ----
NM_207662chr1431403 585 170 31304 1248 1151 ----
NM_212460chr792012 1958 1854 1714 1677 1268 596 519 116 ------
NM_212465chr151491 ------
NM_212467chr1562632 2456 2041 971 472 348 32103 1812 620 1329 11695
NM_212471chr1732045 1798 705 11792 ----
NM_212472chr1732045 1798 705 11792 ----
NM_212535chr161118 ------
NM_212554chr1021608 1206 21036 38 ----
NM_213589chr245467 5123 4654 847 35107 4700 1193 1774 --
NM_213648chr541314 760 717 638 1683 ----
NM_213654chr331357 1114 251 --1590 --
NM_213662chr1732359 2212 2008 12161 --22048 1535