TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-2909
miRNA Sequence: GUUAGGGCCAACAUCUCUUGG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr5167 21336 275 ----
NM_000016chr1------1618
NM_000020chr1282229 1836 1632 635 626 420 218 69 ------
NM_000037chr841946 1817 623 518 164 11551 --
NM_000051chr1123489 1364 12222 --12438
NM_000052chrX41230 847 528 267 22920 727 ----
NM_000055chr31424 ------
NM_000067chr81687 ------
NM_000081chr11169 11416 ----
NM_000084chrX77007 6760 6602 4484 2605 1864 1251 14745 1897 --
NM_000091chr242261 1044 610 190 22136 40 --22297 713
NM_000109chrX22633 783 1449 12080 --
NM_000112chr575582 4451 4268 1730 809 569 436 15030 13773 1858
NM_000125chr6103163 3132 2894 1241 1193 1128 1007 989 917 628 43904 3586 842 535 1400 --
NM_000138chr1531892 655 172 ------
NM_000141chr10----1982 --
NM_000163chr521476 623 11485 --11804
NM_000168chr742873 2650 2115 1295 1176 22044 1006 --
NM_000176chr563271 1283 1131 947 929 263 23159 647 1835 128
NM_000192chr1241552 1408 366 333 1550 ----
NM_000208chr1994571 4261 3611 3349 3187 1662 1541 1416 447 ------
NM_000210chr252315 1828 1691 277 44 12172 1565 --
NM_000212chr1772141 963 850 786 774 447 441 1382 ----
NM_000214chr2011425 --21316 321 1662
NM_000216chrX43466 2817 2675 485 34116 3572 319 12586 --
NM_000217chr1275230 5042 4761 4721 1698 679 127 43823 1817 1618 1339 13471 --
NM_000237chr82419 138 11524 ----
NM_000248chr342888 2399 2361 2039 --12345 1493
NM_000254chr121938 684 ----169
NM_000259chr1555006 4964 2406 2119 221 35363 2467 147 24905 4872 16313
NM_000264chr953307 3103 2118 1122 110 22917 1034 --1773
NM_000267chr1742826 2593 902 418 12801 13520 --
NM_000274chr102252 74 1551 ----
NM_000286chr171165 1312 ----
NM_000291chrX138 1139 ----
NM_000304chr171295 ----1267
NM_000314chr1023087 2662 --12497 --
NM_000315chr11277 34 1294 ----
NM_000321chr132444 164 ----1305
NM_000330chrX31707 1593 486 1403 2561 345 --
NM_000332chr616084 16535 ----
NM_000333chr32952 467 1169 ----
NM_000337chr594859 4613 4436 2431 1883 1628 1234 1153 935 25118 1131 24736 1411 --
NM_000346chr1731640 1505 755 31344 148 44 1567 1738
NM_000353chr162398 86 1980 ----
NM_000369chr1441869 1481 1368 459 1485 ----
NM_000380chr9----1496 --
NM_000390chrX42716 2648 2390 774 --11230 13220
NM_000393chr211436 21939 1772 ----
NM_000399chr102940 913 2737 173 ----
NM_000408chr212929 ------
NM_000412chr31285 ------
NM_000430chr1753199 3055 2404 1349 744 13489 ----
NM_000447chr1--1108 ----
NM_000449chr12521 99 1437 1598 --
NM_000459chr92328 181 ------
NM_000461chr383940 3438 3330 1793 1719 1478 1245 1208 21702 1193 14381 2566 355
NM_000462chr1511155 ------
NM_000480chr111252 --11605 1422
NM_000484chr211365 ------
NM_000489chrX12721 2299 111 1661 1613
NM_000493chr6149 1157 1345 --
NM_000516chr20----133 --
NM_000530chr16852 817 785 777 287 218 11113 1959 --
NM_000533chrX2705 28 11835 3636 288 42 --
NM_000540chr19142 ------
NM_000544chr6_cox_hap1103108 2592 2491 2212 1301 1251 1094 849 809 558 32291 796 77 --1893
NM_000555chrX87484 6798 5757 5751 5495 3004 1296 315 21833 1627 ----
NM_000574chr121356 1002 2864 251 ----
NM_000575chr21951 ------
NM_000586chr4------1174
NM_000601chr72431 99 1420 ----
NM_000609chr1073141 2858 2798 2708 694 557 258 22840 2038 1376 --
NM_000611chr1176561 5516 4754 4590 2408 908 509 56017 5270 4745 1822 1415 16803 25360 1903
NM_000618chr1246488 6021 5789 2053 ----25952 4090
NM_000618chr1246488 6021 5789 2053 ----25952 4090
NM_000633chr1843680 1253 783 505 33646 1420 700 21957 790 --
NM_000637chr81471 ------
NM_000639chr12731 567 ------
NM_000678chr203644 318 138 1841 --1312
NM_000719chr12116309 4750 4429 4392 2649 2638 2488 2312 2264 423 49 22510 411 12394 --
NM_000723chr1741349 648 311 179 --41616 1512 346 333 --
NM_000724chr101496 ------
NM_000726chr221434 1329 ------
NM_000793chr14104288 4281 4096 3601 1115 753 406 224 141 89 23990 3924 14159 --
NM_000794chr5--1777 ----
NM_000806chr51327 11834 11986 --
NM_000809chr489275 8442 8425 6079 3335 2529 392 345 38841 3097 369 ----
NM_000813chr535353 5053 1792 11699 --14820
NM_000814chr1563943 3126 1448 928 857 740 33385 3258 3176 ----
NM_000817chr21404 1884 ----
NM_000820chr13--1279 ----
NM_000824chr41147 1741 1187 1805
NM_000826chr431828 1815 194 ------
NM_000828chrX1173 1820 ----
NM_000829chr1111490 12103 3130 64 28 --
NM_000831chr194443 4106 3915 2178 1437 1090 727 708 326 55996 5073 4768 1506 799 45792 3909 547 438 --
NM_000833chr1641217 407 233 89 1599 ----
NM_000838chr622413 1979 11960 1158 --
NM_000842chr113305 214 124 ------
NM_000866chr33725 488 383 1252 ----
NM_000868chrX42578 2501 932 798 22040 624 ----
NM_000875chr1566420 5845 4968 852 251 225 16853 15892 --
NM_000879chr5----191 --
NM_000891chr1743140 2863 2632 1304 12281 1375 --
NM_000899chr1243160 2854 1726 1689 11708 ----
NM_000901chr411977 --131 --
NM_000902chr393181 2758 2514 2161 1140 1016 692 162 67 32465 2081 306 22143 88 --
NM_000908chr51697 ------
NM_000917chr102841 386 1212 ----
NM_000922chr11--11018 1126 1938
NM_000926chr11179449 8991 8941 8786 8317 8220 8096 7999 7353 6897 3634 2548 1738 1578 1130 727 104 16152 18396 35883 2630 1625
NM_000933chr2021446 328 ------
NM_000935chr321136 775 ----1196
NM_000944chr411871 12221 ----
NM_000945chr22589 576 ------
NM_000948chr6139 ------
NM_000949chr52854 189 3802 643 631 ----
NM_000950chrX42892 940 914 25 23380 518 --13353
NM_000958chr531001 394 367 ------
NM_001001323chr1232801 2586 652 22378 2336 11042 --
NM_001001331chr322613 761 ----1784
NM_001001342chr1011114 ------
NM_001001395chr1242664 2086 1974 1966 12541 22579 2386 --
NM_001001396chr154298 3688 1740 806 638 63651 3469 3327 1759 1202 70 13399 --
NM_001001436chr161896 ------
NM_001001481chr842501 918 536 38 33423 2350 1107 ----
NM_001001484chr1052124 832 301 276 204 --21901 980 --
NM_001001502chr51168 ------
NM_001001549chr732208 967 339 ------
NM_001001550chr732208 967 339 ------
NM_001001555chr732208 967 339 ------
NM_001001664chr223670 405 --12547 1212
NM_001001890chr2143898 2638 465 101 11116 ----
NM_001001928chr22138289 8180 7937 7922 7839 7507 7181 6855 6156 5772 5485 2737 2374 12438 18342 --
NM_001001974chr1032258 2141 950 ----1541
NM_001001995chrX2353 332 --1764 --
NM_001002006chr21603 1105 --1590
NM_001002033chr17--2793 552 ----
NM_001002243chr21880 --178 1184
NM_001002257chr273523 3324 3283 3146 1071 499 315 43249 2790 1040 1000 13039 13399
NM_001002762chr1072583 2226 2179 2156 953 408 81 22900 2862 1621 --
NM_001002860chr1444437 3129 1424 599 --13343 1788
NM_001002909chr1711755 --11670 --
NM_001003652chr1898665 6649 6328 2397 2320 2177 1953 1859 615 17274 27475 3409 17361
NM_001003674chr1866276 6213 5968 2482 2355 451 44363 2680 2278 1282 17000 11812
NM_001003675chr1866276 6213 5968 2482 2355 451 44363 2680 2278 1282 17000 11812
NM_001003681chr2231925 669 410 --11497 1283
NM_001003683chr2----140 --
NM_001003698chr621259 176 --1225 --
NM_001003699chr621259 176 --1225 --
NM_001003712chr1243987 3912 1534 743 1642 11387 --
NM_001003760chr642842 1197 945 852 3865 636 307 2961 903 --
NM_001003937chr221452 1229 11388 ----
NM_001004051chrX132 --151 --
NM_001004065chr911009 33504 2601 1238 ----
NM_001004127chr131918 ----11008
NM_001004304chr1263039 2860 2405 2084 2024 1061 1877 ----
NM_001004317chr664209 3705 3295 1454 648 151 23266 2845 --13053
NM_001004419chr1254591 4373 3980 1811 619 23600 1253 ----
NM_001004441chr521392 544 1429 ----
NM_001004720chr21416 11045 ----
NM_001005375chrY21710 1416 11401 ----
NM_001005386chr2--21707 506 1307 --
NM_001005404chr1753200 2858 1232 396 136 21602 165 1611 --
NM_001005463chr101866 ----11697
NM_001005473chr596045 5973 5542 5372 2631 2439 2168 774 495 46210 5388 4539 1508 14568 26139 4320
NM_001005474chr331058 427 83 21580 542 ----
NM_001005476chr21194 ------
NM_001005505chr32708 84 --1132 --
NM_001005526chr2--189 ----
NM_001005609chrX103577 3471 2734 2569 1456 1381 1218 977 567 70 42582 1409 1327 712 ----
NM_001005746chr221434 1329 ------
NM_001005747chr221434 1329 ------
NM_001005849chr17--1533 ----
NM_001006115chr3102276 2149 2071 1020 964 754 665 372 350 246 12465 ----
NM_001006118chrY--1246 ----
NM_001006120chrY--1246 ----
NM_001006623chr222035 200 ------
NM_001006636chr21853 ------
NM_001006641chr931366 1320 611 1124 11106 --
NM_001006642chr931366 1320 611 1124 11106 --
NM_001006643chr931366 1320 611 1124 11106 --
NM_001006933chrX3161 95 51 ------
NM_001007023chr14104288 4281 4096 3601 1115 753 406 224 141 89 23990 3924 14159 --
NM_001007024chr1741672 1652 1051 258 23056 3024 ----
NM_001007025chr1741672 1652 1051 258 23056 3024 ----
NM_001007067chr81194 ------
NM_001007068chr81194 ------
NM_001007069chr81194 ------
NM_001007070chr81194 ------
NM_001007075chr431044 1020 906 ------
NM_001007098chr14642 600 88 55 ------
NM_001007257chr12134 29 ------
NM_001007464chr6--1159 ----
NM_001007466chr674479 4125 3222 1329 426 393 67 34042 3860 3394 33605 3503 1522 --
NM_001007471chr9------146
NM_001007526chrY--1246 ----
NM_001007527chr52230 218 178 ----
NM_001007553chr13412 344 235 ------
NM_001007559chr1822073 1990 ------
NM_001007794chr1----1147 --
NM_001008220chr593713 3573 3289 3205 2574 2508 502 397 370 13875 13502 --
NM_001008222chrX41270 1121 441 245 ----1962
NM_001008239chr1812531 1507 13285 --
NM_001008392chr323194 2685 1900 13051 --
NM_001008407chr721782 230 --11609 1456
NM_001008408chr785914 4503 3896 2237 2217 1717 1162 955 --36064 5224 1903 12320
NM_001008495chr821710 1492 ------
NM_001008541chr1011499 12245 --1407
NM_001008541chr1011499 12245 --1407
NM_001008564chr1311579 ------
NM_001008660chr1131444 534 422 --11212 --
NM_001008701chr1951949 851 224 159 137 12782 ----
NM_001008707chr1421246 611 --1743 1441
NM_001008738chr522382 2164 22257 713 ----
NM_001008744chr1421252 179 21112 90 --11137
NM_001008801chr19--21961 216 ----
NM_001008860chr152705 635 ------
NM_001008892chr152705 635 ------
NM_001008894chr152705 635 ------
NM_001008895chr131530 2422 379 --11462
NM_001008925chr432948 1151 368 32930 2721 667 1873 --
NM_001008938chr111195 --1316 1401
NM_001009183chr142447 425 ------
NM_001009554chr434162 279 88 31588 1067 538 23815 3709 13272
NM_001009554chr434162 279 88 31588 1067 538 23815 3709 13272
NM_001009899chr356348 6251 5384 2306 976 35856 2295 261 ----
NM_001009909chr1122871 173 13374 --13866
NM_001009959chr252502 2127 1940 1699 82 22095 157 ----
NM_001009993chr233977 2844 861 13689 --14237
NM_001010000chr1863358 2537 2436 2365 746 274 22755 967 --23217 322
NM_001010846chr154542 3980 2983 1257 22 31286 1213 668 23651 818 --
NM_001010861chr132127 2014 920 ------
NM_001010862chrX42964 2517 2373 859 139 11276 --
NM_001010870chr6--1524 ----
NM_001010891chr565724 5448 5057 4564 2302 349 25992 111 1273 11181
NM_001010895chr921636 378 2326 169 ----
NM_001010908chr102705 262 --1559 --
NM_001010922chr174002 3925 3878 3768 3426 1661 410 43128 1446 829 296 34149 3889 3870 --
NM_001010924chr10----1313 --
NM_001010932chr72431 99 1420 ----
NM_001010971chr11866 ------
NM_001011513chr433997 2740 839 22946 2805 --2396 118
NM_001011515chr4195 ------
NM_001011516chr4195 ------
NM_001011537chr321465 955 --1614 1177
NM_001011553chr7----1213 --
NM_001011666chr755167 5126 4394 2359 1081 11701 ----
NM_001011713chr1421441 1430 1345 21474 408 --
NM_001011885chr15------11658
NM_001012393chr1152025 1948 997 614 441 1386 ----
NM_001012420chr1522618 1057 12640 --12573
NM_001012423chr1522618 1057 12640 --12573
NM_001012751chr1011813 ------
NM_001012754chr1321406 274 11471 11665 --
NM_001012979chrX195 ------
NM_001013031chr1072984 2304 1220 899 442 342 207 43352 3316 2953 910 ----
NM_001013406chr721436 1357 ------
NM_001013437chr182382 28 1394 ----
NM_001013635chr1221197 390 ------
NM_001013699chr121437 ------
NM_001013703chr151428 ------
NM_001013717chr5--11106 ----
NM_001013843chr152350 329 ------
NM_001014336chr12192 ----146
NM_001014443chr1145 ------
NM_001014445chr176791 769 721 401 313 298 ----1981
NM_001014797chr1047820 6705 2356 487 27244 3102 26021 2805 --
NM_001015045chr461763 1681 499 291 163 97 ------
NM_001015877chrX62551 2328 2194 2158 1015 825 ------
NM_001015880chr1031657 1071 252 1466 21605 528 --
NM_001015882chr9133 1160 ----
NM_001015887chr3----11373 --
NM_001015892chr5------1167
NM_001017368chr1752367 2196 857 147 29 21796 314 ----
NM_001017371chr22147 66 21249 1092 --1886
NM_001017395chr383028 2994 2556 2397 1322 1300 651 592 32783 1437 679 33400 2728 2274 --
NM_001017405chr41682 ------
NM_001017424chr141205 545 480 282 11581 ----
NM_001017425chr141205 545 480 282 11581 ----
NM_001017916chr1721847 1572 --1624 --
NM_001017917chr1721847 1572 --1624 --
NM_001017923chr1431539 1052 439 1625 ----
NM_001017926chr831242 628 492 ------
NM_001017930chrX2456 226 1191 ----
NM_001017962chr102841 386 1212 ----
NM_001018008chr152415 72 --1620 --
NM_001018009chr3--1109 1118 --
NM_001018050chr22103428 3191 3065 2755 2593 2436 1365 1259 1026 170 ----11292
NM_001018052chr22103428 3191 3065 2755 2593 2436 1365 1259 1026 170 ----11292
NM_001018064chr941528 1469 1447 784 11384 1364 --
NM_001018065chr974973 4906 4423 3728 2237 1426 653 54378 1571 690 625 608 22031 192 --
NM_001018066chr974973 4906 4423 3728 2237 1426 653 54378 1571 690 625 608 22031 192 --
NM_001018067chr135235 3832 3487 25045 1817 ----
NM_001018068chr135235 3832 3487 25045 1817 ----
NM_001018069chr135235 3832 3487 25045 1817 ----
NM_001018074chr563271 1283 1131 947 929 263 23159 647 1835 128
NM_001018075chr563271 1283 1131 947 929 263 23159 647 1835 128
NM_001018076chr563271 1283 1131 947 929 263 23159 647 1835 128
NM_001018077chr563271 1283 1131 947 929 263 23159 647 1835 128
NM_001018100chr152805 631 ------
NM_001018108chr1541771 1483 796 472 11569 1125 --
NM_001018676chr8----1176 --
NM_001018677chr8----1176 --
NM_001020818chr1941651 689 252 161 11584 1553 --
NM_001020819chr1941651 689 252 161 11584 1553 --
NM_001020820chr1941651 689 252 161 11584 1553 --
NM_001020821chr1941651 689 252 161 11584 1553 --
NM_001023567chr15--12035 --12369
NM_001024094chr563271 1283 1131 947 929 263 23159 647 1835 128
NM_001024218chr141652 ------
NM_001024401chr1692772 2679 2252 1904 1833 792 371 365 186 12885 12851 --
NM_001024647chr1267648 7286 6410 6381 5198 1081 56757 5592 4680 3006 2336 1129 --
NM_001024649chr542270 977 546 61 --12991 --
NM_001024660chr321154 334 1182 ----
NM_001024688chr872211 1912 1690 1529 748 391 316 1803 ----
NM_001024807chr192280 226 ------
NM_001024847chr31350 22295 82 ----
NM_001024912chr1951804 500 491 264 92 142 ----
NM_001024934chr61530 1211 ----
NM_001024935chr61530 1211 ----
NM_001024936chr61530 1211 ----
NM_001024948chr132319 1079 276 1544 --12171
NM_001025068chr311672 ------
NM_001025069chr311672 ------
NM_001025076chr10114832 3945 2303 2227 2173 1817 1745 1692 1546 1410 1188 31911 1901 354 ----
NM_001025077chr1076190 5303 4883 2904 2768 2546 1297 41712 1403 1338 1027 ----
NM_001025079chr343208 2956 378 312 ----12894
NM_001025108chr21634 --14080 11370
NM_001025233chr1232441 1818 628 31930 871 490 12145 --
NM_001025389chr111252 --11605 1422
NM_001025390chr111252 --11605 1422
NM_001025580chrX53789 3209 2618 1089 599 13269 ----
NM_001025595chr421585 1270 --1522 --
NM_001025596chr111400 ------
NM_001025603chr12521 99 1437 1598 --
NM_001025780chr911496 ------
NM_001029835chr7--1366 ----
NM_001029863chr642773 1197 1135 434 23062 562 ----
NM_001029871chr2081860 1693 1612 727 547 515 442 29 --11335 --
NM_001029875chr51659 ------
NM_001029896chrX2356 238 --1278 --
NM_001030006chr1762509 2401 2265 1035 555 521 21887 785 12606 --
NM_001030007chr1662824 2441 917 731 525 304 22767 140 13861 13252
NM_001030055chr1434007 2965 1433 21462 1012 14644 --
NM_001030287chr111180 167 1234 --
NM_001031679chr1253455 3225 2390 2243 153 --12518 --
NM_001031680chr172175 1734 887 831 644 410 41 ----11637
NM_001031692chr7----1257 --
NM_001031695chr2265394 5191 4848 4723 1551 1124 11772 24025 1369 --
NM_001031700chr42468 229 1897 ----
NM_001031710chr72341 165 2926 37 ----
NM_001031716chr241009 981 875 44 ------
NM_001031738chr22384 173 ------
NM_001032221chr92114 105 21733 229 --11135
NM_001032280chr6--11116 ----
NM_001032281chr2126 ------
NM_001032289chrX2793 111 ------
NM_001033057chr3--21753 540 ----
NM_001033059chr61566 11505 --1126
NM_001033087chr2073015 3009 2593 2073 682 654 130 11102 ----
NM_001033117chr3114829 4739 4406 4061 3809 1936 1925 1544 1275 879 261 --11671 --
NM_001033503chr52512 456 ------
NM_001033507chr131975 449 304 ------
NM_001033578chr821540 305 11690 ----
NM_001033581chr1157 ------
NM_001033581chr1157 ------
NM_001033582chr1157 ------
NM_001033602chr1362628 2240 751 162 92 56 1838 32205 2195 1759 --
NM_001033723chr831979 1049 48 1771 22068 33 --
NM_001034837chr53277 64 56 ------
NM_001034838chr53277 64 56 ------
NM_001034841chr1644485 3547 3530 1148 24347 38 ----
NM_001034845chr4--21269 497 ----
NM_001034915chr841221 980 340 168 11313 21457 988 1966
NM_001034954chr1053157 3039 3013 741 350 22019 498 1635 --
NM_001034955chr1053157 3039 3013 741 350 22019 498 1635 --
NM_001034956chr1053157 3039 3013 741 350 22019 498 1635 --
NM_001034957chr1053157 3039 3013 741 350 22019 498 1635 --
NM_001035chr11469 123 ----
NM_001035003chr431337 919 370 158 ----
NM_001035004chr431337 919 370 158 ----
NM_001037132chr72905 49 ----11873
NM_001037133chr72905 49 ----11873
NM_001037317chr132127 2014 920 ------
NM_001037334chr1832270 432 204 ----12442
NM_001037535chrX11083 ------
NM_001037536chrX11083 ------
NM_001037540chrX11083 ------
NM_001037553chr2195078 3651 3641 3340 1133 708 647 638 588 1317 133 --
NM_001037954chr11--23008 2574 --1283
NM_001038493chr241167 358 66 25 21255 1218 ----
NM_001038702chr531886 971 298 ------
NM_001039111chr31174 ------
NM_001039140chr201416 1524 --140
NM_001039141chr2272171 2151 2060 1040 741 538 447 2827 699 11097 --
NM_001039199chr2084236 1736 1184 1037 704 698 561 479 ------
NM_001039395chr932015 1767 964 22313 71 ----
NM_001039465chr14----1373 1415
NM_001039467chr202624 131 ------
NM_001039479chr1472372 1911 964 812 572 323 83 1351 ----
NM_001039547chr334881 3160 520 1185 47752 1195 918 615 --
NM_001039577chr154420 3156 1801 1405 95 13712 13506 1374
NM_001039585chr133967 1500 115 22742 205 ----
NM_001039590chrX94015 3695 3511 3317 3062 2477 1155 105 48 13932 ----
NM_001039591chrX94015 3695 3511 3317 3062 2477 1155 105 48 13932 ----
NM_001039618chr1175855 4446 2092 1200 1131 427 176 35295 5072 4671 ----
NM_001039690chr164954 534 462 391 31572 385 23 1739 --
NM_001039693chr263851 2698 1366 584 496 390 11153 --1559
NM_001039840chrX34777 1720 321 25261 549 ----
NM_001039888chr12227 43 1781 1716 --
NM_001039937chr1354047 3001 1104 582 520 23498 209 ----
NM_001039960chr1231067 492 110 21523 402 ----
NM_001040092chr82395 160 ------
NM_001040100chr32478 324 ------
NM_001040118chr11125 ------
NM_001040142chr211818 ------
NM_001040143chr211818 ------
NM_001040144chr164954 534 462 391 31572 385 23 1739 --
NM_001040146chr164954 534 462 391 31572 385 23 1739 --
NM_001040152chr774461 3705 3643 3526 1653 353 192 24776 1322 ----
NM_001040157chr442703 2603 2341 675 11950 ----
NM_001040158chr52540 409 ------
NM_001040202chr44960 954 930 562 2943 188 ----
NM_001040214chr6----1563 21893 537
NM_001040272chr92953 792 22348 2138 21686 626 --
NM_001040284chr1675333 5259 5180 4738 1270 1065 968 45343 5246 3926 751 15417 --
NM_001040402chr442909 2461 1124 845 ------
NM_001040429chr1332836 2305 2253 --12975 --
NM_001040441chr1--33916 3886 766 --24395 183
NM_001040450chr152515 103 2901 544 ----
NM_001040453chr152515 103 2901 544 ----
NM_001040633chr72958 359 --124 --
NM_001040653chr352575 467 345 168 116 12415 --1185
NM_001040665chr774956 4500 3299 1649 1141 867 766 --11387 13909
NM_001040666chr72658 202 ------
NM_001040708chr8--175 ----
NM_001040712chr943467 3034 2290 1129 12533 13276 --
NM_001042355chr1674760 4474 3712 3585 3443 1546 593 24453 170 25332 45 --
NM_001042388chr18------1259
NM_001042404chr11366 1393 --1545
NM_001042412chr1674760 4474 3712 3585 3443 1546 593 24453 170 25332 45 --
NM_001042413chr954063 2889 1358 1352 114 43135 2761 2582 302 ----
NM_001042425chr6--11116 ----
NM_001042481chr1452034 1777 1724 997 498 1104 ----
NM_001042492chr1742826 2593 902 418 12801 13520 --
NM_001042510chr841553 1523 545 372 1679 1635 --
NM_001042511chr841553 1523 545 372 1679 1635 --
NM_001042517chr132909 324 ----155
NM_001042555chr1264626 4570 3973 3212 3110 889 31570 1495 176 13777 --
NM_001042599chr276447 6175 5939 5794 5329 2812 555 15164 ----
NM_001042601chr33788 519 108 13300 ----
NM_001042603chr1244389 4237 3888 283 --1978 1490
NM_001042604chr334868 3515 315 ------
NM_001042635chr141121 ------
NM_001042681chr1----22346 1891 --
NM_001042682chr1----22346 1891 --
NM_001042682chr1----22346 1891 --
NM_001042723chr19142 ------
NM_001042749chrX21802 103 2709 449 21832 1411 --
NM_001042750chrX21802 103 2709 449 21832 1411 --
NM_001042751chrX21802 103 2709 449 21832 1411 --
NM_001044305chr61350 --1304 --
NM_001044385chr253442 3183 3042 1119 517 63342 1617 1558 1466 963 297 21482 1049 --
NM_001048183chr163720 3442 3330 1162 374 365 1324 21468 380 22562 409
NM_001050chr1711117 1206 ----
NM_001070chr17251 32 ------
NM_001071775chr13----1229 --
NM_001083620chr431826 1813 194 ------
NM_001083621chr154669 4401 3846 1439 531 24485 1070 13569 --
NM_001095chr1271830 1727 622 591 432 280 86 --21260 475 --
NM_001100108chr1107894 7029 6862 6795 2419 1114 796 597 578 136 11386 35152 3161 1073 13147
NM_001106chr398919 7006 3485 3142 2430 1278 1260 982 215 11208 47312 902 843 825 --
NM_001109977chr42717 578 ------
NM_001113490chrX23575 1327 1204 --1231
NM_001117chr1872437 2341 2226 2117 1566 763 491 --137 --
NM_001121chr101775 ------
NM_001122679chr5167 21336 275 ----
NM_001126chr11118 ------
NM_001128chr1662824 2441 917 731 525 304 22767 140 13861 13252
NM_001149chr101416 --11362 --
NM_001157chr101115 ----1658
NM_001160chr1232473 2187 71 1443 ----
NM_001167chrX55942 2202 1790 1200 44 34521 4500 1514 14806 --
NM_001172chr14----1104 --
NM_001173chr1434007 2965 1433 21462 1012 14644 --
NM_001189chr441117 1055 336 264 11006 2232 178 --
NM_001200chr20--2804 227 ----
NM_001201chr433773 3239 424 1913 ----
NM_001204chr265379 2787 2776 2013 1327 559 54805 2737 2123 1493 788 --26866 729
NM_001217chr19--169 135 --
NM_001225chr11134 ------
NM_001233chr7--11951 21906 650 --
NM_001237chr421071 414 1360 11022 --
NM_001237chr421071 414 1360 11022 --
NM_001241chr231708 874 743 1731 11847 --
NM_001241chr231708 874 743 1731 11847 --
NM_001256chr1742149 837 826 147 22679 532 1911 --
NM_001259chr796375 5525 5484 4851 1682 1654 1300 1028 76 --25686 4998 15620
NM_001270chr5173 ------
NM_001271chr1523174 2689 ------
NM_001273chr121475 ------
NM_001282chr1762509 2401 2265 1035 555 521 21887 785 12606 --
NM_001284chr51377 ------
NM_001298chr21105 --11285 1532
NM_001304chr1723061 2505 2189 179 11121 --
NM_001310chr1231129 420 312 12196 --1985
NM_001315chr622116 1828 ----1613
NM_001326chr111411 --1198 --
NM_001329chr1031408 413 334 ------
NM_001331chr1151802 980 749 731 511 2715 596 1134 --
NM_001332chr511369 1217 ----
NM_001343chr531344 132 51 1229 ----
NM_001351chr321683 1432 21450 1375 ----
NM_001363chrX4810 322 95 39 ------
NM_001364chr1184395 4303 3935 3609 3571 3541 1673 973 13375 13489 --
NM_001386chr842413 1994 1607 548 ----12224
NM_001387chr592972 2859 2550 2072 1280 1100 561 279 132 ------
NM_001396chr213917 837 747 1497 11753 --
NM_001399chrX103577 3471 2734 2569 1456 1381 1218 977 567 70 42582 1409 1327 712 ----
NM_001400chr11440 21126 298 ----
NM_001407chr361621 1508 1386 1276 641 128 ------
NM_001412chrX83228 3070 1438 1414 1216 969 362 46 22921 2399 ----
NM_001419chr1953853 3846 3213 1752 316 --13187 13729
NM_001426chr22526 273 1267 ----
NM_001427chr731729 595 296 ----11762
NM_001432chr433825 3108 3102 33115 3086 2700 13184 --
NM_001438chr14833 749 583 557 1685 ----
NM_001482chr152780 119 1206 1356 --
NM_001483chr71743 ------
NM_001497chr92588 574 --12120 12098
NM_001498chr6--21041 928 ----
NM_001546chr611055 ------
NM_001554chr1--1489 ----
NM_001565chr42243 198 ------
NM_001616chr222985 2721 1361 12610 --
NM_001618chr12296 159 ------
NM_001621chr722136 805 1660 ----
NM_001621chr722136 805 1660 ----
NM_001622chr31367 ------
NM_001626chr1982460 2259 2249 2239 1287 779 753 65 13138 11041 --
NM_001634chr61566 11505 --1126
NM_001642chr1121300 24 21032 223 ----
NM_001655chr1121892 1545 2683 670 --11377
NM_001659chr1272542 2224 824 191 106 70 40 ----12252
NM_001663chr1411986 12419 ----
NM_001664chr3----2902 211 --
NM_001665chr113500 377 156 1123 2475 84 --
NM_001674chr111180 167 1234 --
NM_001682chr1232515 2300 366 22092 2050 1756 --
NM_001683chr322613 761 ----1784
NM_001684chr164015 3405 1643 1457 523 355 53368 3186 3044 1476 919 13116 --
NM_001690chr31299 1983 22423 2059 --
NM_001695chr823743 339 13817 ----
NM_001699chr1971349 1218 1129 711 362 112 94 ------
NM_001709chr1122057 1150 --11994 --
NM_001726chr1------1123
NM_001731chr121256 1622 ----
NM_001743chr2------1175
NM_001746chr542270 977 546 61 --12991 --
NM_001748chr11932 ------
NM_001754chr2143898 2638 465 101 11116 ----
NM_001755chr1642017 1819 774 421 --22239 1809 1859
NM_001759chr1274735 4367 4039 3934 3816 3771 164 ------
NM_001760chr65919 899 858 364 141 ------
NM_001777chr343208 2956 378 312 ----12894
NM_001788chr7----1213 --
NM_001797chr161627 --126 --
NM_001806chr1912796 ------
NM_001825chr51136 ------
NM_001839chr11133 192 ----
NM_001843chr122239 98 ------
NM_001845chr131125 2991 74 ----
NM_001851chr61144 ------
NM_001854chr12541 460 1444 ----
NM_001859chr922612 25 11171 13888 --
NM_001873chr4--1141 ----
NM_001875chr22926 195 1424 21086 132 --
NM_001881chr10--1409 --1496
NM_001884chr52527 218 ------
NM_001904chr31786 ------
NM_001914chr181362 ------
NM_001915chr1721847 1572 --1624 --
NM_001918chr198276 7817 6487 6074 3269 3242 3087 639 56 56698 6455 3212 2635 2073 16412 1881
NM_001938chr1------1341
NM_001941chr1853673 2653 1349 678 532 21175 238 ----
NM_001942chr1871681 1478 1339 667 541 423 289 11539 ----
NM_001946chr121810 11163 ----
NM_001949chr672562 1978 1298 1272 687 403 221 127 ----
NM_001957chr41104 1676 12289 --
NM_001964chr51387 --1844 --
NM_001968chr41799 1752 ----
NM_001969chr1453472 2941 2529 1513 620 ----12501
NM_001977chr421072 95 --11373 --
NM_001981chr152224 1897 876 619 415 ------
NM_001982chr12--1448 --1941
NM_001995chr42332 175 ----2408 237
NM_002009chr1542341 985 530 307 ------
NM_002010chr13--131 ----
NM_002013chr14----122 --
NM_002025chrX78389 7957 7855 6486 6204 2853 826 21434 1267 --11344
NM_002027chr8----1176 --
NM_002028chr1431271 951 99 ------
NM_002033chr1153797 3081 2955 802 123 --22945 1431 --
NM_002035chr1832730 1274 589 53894 2432 1295 802 342 ----
NM_002041chr15197 ------
NM_002048chr921292 377 21074 188 --11254
NM_002056chr22663 572 1795 ----
NM_002061chr111642 1208 ----
NM_002063chrX11072 --11007 --
NM_002069chr721887 235 11655 ----
NM_002076chr1232508 2484 1002 13056 ----
NM_002092chr423802 856 23948 1474 ----
NM_002099chr41467 21892 822 ----
NM_002106chr4145 137 ----
NM_002107chr11444 ------
NM_002114chr6--174 ----
NM_002126chr1773854 2958 2738 1633 866 526 414 --13150 --
NM_002130chr521235 179 21136 572 ----
NM_002140chr91991 ------
NM_002146chr1721320 581 ------
NM_002158chr242665 2611 2478 1388 12577 --1209
NM_002193chr2--11787 ----
NM_002199chr41760 ------
NM_002201chr151103 ------
NM_002214chr744929 4387 1888 545 43694 3576 2132 56 15423 --
NM_002221chr1122704 2698 2442 2305 1064 836 576 413 327 309 164 71 ------
NM_002222chr3--1155 --1410
NM_002223chr1222474 583 22907 1481 ----
NM_002224chr63249 242 135 2289 205 --1764
NM_002232chr131078 384 284 ------
NM_002234chr12------1686
NM_002240chr211538 ------
NM_002242chr22531 333 21748 1234 ----
NM_002247chr1032082 1923 695 22247 1691 ----
NM_002264chr354348 1645 1218 1008 248 34802 4494 687 24947 3108 --
NM_002267chr1342419 859 728 229 22008 208 ----
NM_002270chr523908 1013 24555 2005 --11515
NM_002285chr21634 --14080 11370
NM_002293chr152487 2262 1798 975 934 22622 1714 12688 --
NM_002334chr1131312 801 133 1265 1624 21969 1300
NM_002336chr1234824 4764 3385 23270 2013 --23871 288
NM_002349chr21187 11251 ----
NM_002351chrX--11653 --1636
NM_002356chr621758 763 11996 ----
NM_002359chr17114192 4181 3990 3930 3815 3084 3056 2802 1686 662 66 13852 23263 517 --
NM_002376chr143434 227 212 ------
NM_002384chr181959 ------
NM_002397chr531373 858 62 ----11493
NM_002398chr21434 ----11104
NM_002399chr15182 ------
NM_002401chr1742375 2069 1709 595 1527 1941 --
NM_002409chr2252961 2489 711 634 54 33190 2911 1129 12901 --
NM_002429chr1271389 1301 1154 246 232 171 40 ----11041
NM_002430chr2232062 860 656 12177 12239 --
NM_002444chrX61825 1717 1233 786 328 110 ----11881
NM_002449chr52188 120 ----11045
NM_002480chr1231420 1000 351 ------
NM_002481chr1177860 7678 7614 7095 6610 6574 6286 5928 5460 1960 1926 1485 669 607 544 364 179 14851 27580 1009 --
NM_002485chr872211 1912 1690 1529 748 391 316 1803 ----
NM_002486chr932083 274 185 3853 698 473 --1168
NM_002495chr5195 ------
NM_002501chr19114016 3539 3409 3397 2521 1539 1014 951 789 763 361 --1494 --
NM_002508chr17621 524 480 370 292 261 181 ----21281 805
NM_002519chr1131460 1072 355 21038 51 ----
NM_002524chr131031 961 254 ----1382
NM_002526chr61211 21691 1386 ----
NM_002537chr1531000 726 64 ------
NM_002545chr1152025 1948 997 614 441 1386 ----
NM_002546chr81302 ------
NM_002553chr72443 100 ------
NM_002556chr1172124 1844 1663 1519 1330 833 182 1437 ----
NM_002568chr8--1440 ----
NM_002577chr353193 2873 825 524 236 ------
NM_002581chr934620 1223 857 54698 4524 3687 3629 264 14362 1933
NM_002586chr641078 444 190 134 11002 --11416
NM_002590chr132103 52 ------
NM_002594chr2052346 2340 1623 909 222 21541 236 1581 --
NM_002595chr1231309 1240 648 ------
NM_002599chr1181117 998 903 883 861 811 250 98 --1777 --
NM_002610chr232089 915 852 22236 167 ----
NM_002628chr32777 48 ------
NM_002634chr172869 157 ----1650
NM_002645chr11--21986 256 1623 12840
NM_002646chr151860 1424 599 501 100 11968 1391 1822
NM_002655chr841717 1191 1157 354 24885 627 --2708 52
NM_002657chr2083361 3187 2690 1041 635 445 164 49 12653 23151 1232 13176
NM_002687chr14----2857 94 --
NM_002707chr2185 ------
NM_002709chr243142 3085 748 726 23239 447 12584 --
NM_002713chr13848 243 131 ----11218
NM_002719chr1432435 2123 869 12113 ----
NM_002734chr1712172 1452 ----
NM_002737chr17176623 5918 5763 5520 5505 5322 5001 4903 2399 2275 1951 1356 1270 1076 586 257 68 2531 75 ----
NM_002742chr142624 491 1219 ----
NM_002744chr1157 ------
NM_002745chr2253029 1221 400 352 209 ------
NM_002747chr18--11614 1166 --
NM_002748chr152815 373 ------
NM_002753chr41645 ------
NM_002787chr72492 146 ------
NM_002790chr1--158 ----
NM_002814chrX154 ----1553
NM_002819chr1941413 1344 957 501 ----1338
NM_002822chr121664 21584 359 ----
NM_002825chr71526 ------
NM_002827chr20----11771 --
NM_002829chr931037 493 276 --2476 261 11221
NM_002833chr1521178 245 21419 42 ----
NM_002835chr73610 151 120 --1215 --
NM_002837chr1264361 3998 3738 3156 1216 75 12880 22860 489 --
NM_002839chr943467 3034 2290 1129 12533 13276 --
NM_002840chr111327 ------
NM_002843chr1122277 2271 13312 ----
NM_002852chr31582 ------
NM_002857chr142433 1855 703 587 21769 537 11931 --
NM_002858chr131068 441 348 ------
NM_002865chr81267 ------
NM_002868chr1262207 1949 777 490 321 109 ----11966
NM_002869chr11--21733 1489 --1677
NM_002871chr16750 593 567 333 293 218 1168 11945 --
NM_002873chr51389 ------
NM_002880chr32730 182 --1145 --
NM_002886chr331803 1684 247 162 ----
NM_002892chr1431475 1168 1125 162 ----
NM_002894chr181193 ------
NM_002897chr2--1192 1613 --
NM_002918chr1921028 885 --2419 219 --
NM_002941chr331250 1081 189 11242 ----
NM_002942chr32251 200 173 ----
NM_002955chr621259 176 --1225 --
NM_002957chr9103387 3019 2793 1272 1216 877 589 488 337 80 --12909 --
NM_002959chr153998 3940 3644 519 182 33494 1269 899 13664 14220
NM_002971chr31864 ------
NM_002977chr21142 21276 1207 ----
NM_002994chr41374 ------
NM_002998chr822069 1925 1433 11934 --
NM_003010chr1742290 1874 773 716 11834 ----
NM_003011chr941462 681 664 117 --11250 --
NM_003016chr172602 41 21862 1421 1627 --
NM_003017chr61237 1296 ----
NM_003028chr953496 3202 2640 2609 697 --23473 2446 13813
NM_003030chr311382 11435 ----
NM_003038chr252405 1741 782 724 638 ----12675
NM_003042chr351872 1805 819 751 174 ------
NM_003043chr393941 3762 3174 3038 2788 2705 1515 1257 698 ------
NM_003051chr111786 --2318 286 --
NM_003060chr531037 1009 365 11233 21019 235 1176
NM_003068chr81446 1320 ----
NM_003069chrX1242 2671 148 ----
NM_003070chr93860 709 552 1750 ----
NM_003071chr331906 1715 738 ------
NM_003072chr192178 63 ------
NM_003074chr371677 1610 736 643 505 439 227 1239 ----
NM_003075chr12------1254
NM_003077chr172180 29 ------
NM_003081chr20----1230 --
NM_003085chr51168 ------
NM_003088chr761007 905 724 364 319 230 11119 ----
NM_003099chr1596042 2601 1960 1872 1002 778 463 153 79 15286 --16117
NM_003104chr152212 141 ----1165
NM_003107chr621911 1855 ------
NM_003108chr247315 5366 5356 4911 --12553 --
NM_003111chr22147 66 21249 1092 --1886
NM_003112chr743017 830 824 340 11156 ----
NM_003128chr262600 2473 1859 1064 827 428 ------
NM_003131chr672248 1702 1695 1577 586 460 428 ------
NM_003137chr641935 757 365 265 ----12189
NM_003140chrY1125 ------
NM_003144chr651996 1859 1592 847 746 11847 21602 45 --
NM_003149chr331664 1504 1092 ------
NM_003150chr1742173 2137 2075 1853 --1502 --
NM_003155chr842030 1945 507 286 22454 127 ----
NM_003157chr3--1973 1267 --
NM_003161chr1733515 2202 857 ----11413
NM_003178chr321465 1398 11757 ----
NM_003187chr5------1167
NM_003188chr62766 612 ------
NM_003199chr1874780 3966 1705 1437 882 93 52 12234 24951 531 11448
NM_003201chr10--1679 ----
NM_003205chr1531626 1610 744 1698 ----
NM_003216chr2263255 2958 2760 2501 249 185 ----12270
NM_003217chr1242033 1371 776 504 1767 11279 --
NM_003220chr6--11116 ----
NM_003221chr653893 3885 1320 1299 618 44101 3723 3123 2694 ----
NM_003238chr11214 ------
NM_003242chr31350 22295 82 ----
NM_003243chr121188 797 --1356 11204
NM_003247chr64646 468 118 32 152 ----
NM_003253chr2141313 768 612 217 --149 --
NM_003262chr343635 3261 1599 1134 25285 4064 25120 977 --
NM_003274chr2142382 2030 457 250 ----12148
NM_003275chr9--11488 ----
NM_003286chr202851 179 1427 ----
NM_003288chr2041249 1207 441 406 11543 1113 --
NM_003290chr192255 238 ------
NM_003291chr132814 240 ------
NM_003300chr14--1334 ----
NM_003320chr1184193 4134 3993 3577 1500 1197 749 73 1511 --13151
NM_003336chrX--2951 166 1798 --
NM_003337chr51325 ------
NM_003338chr1021202 175 ----11812
NM_003340chr41303 --1341 11090
NM_003341chr32586 138 ------
NM_003342chr1733264 2428 779 32791 2723 489 12489 --
NM_003344chr741320 660 530 42 21764 1552 ----
NM_003360chr4----1244 --
NM_003369chr1132586 2090 704 ------
NM_003375chr10----150 --
NM_003387chr252619 952 935 508 358 22925 2424 ----
NM_003392chr333600 1607 298 21336 1184 ----
NM_003403chr141200 1866 ----
NM_003411chrY31504 1327 586 ------
NM_003413chrX21917 386 ------
NM_003416chr8----149 --
NM_003418chr31822 ------
NM_003432chr5175 ------
NM_003439chr73846 675 410 31005 759 740 13064 --
NM_003453chr131540 ------
NM_003458chr373574 3431 1351 1235 780 568 511 --1877 12894
NM_003463chr642694 2655 2638 702 13136 12684 --
NM_003468chr273355 3232 3004 1570 707 643 326 ------
NM_003469chr21320 ------
NM_003470chr1651876 1400 377 327 51 ------
NM_003477chr111202 ------
NM_003478chr1122768 126 --12104 --
NM_003483chr1211902 1173 ----
NM_003489chr2153054 2784 2157 1371 604 1931 ----
NM_003558chr91592 ------
NM_003566chr1213304 1365 ----
NM_003574chr1875692 5453 5243 4285 1956 1372 1232 25222 1594 1744 --
NM_003580chr81405 1598 ----
NM_003581chr21416 11045 ----
NM_003583chr1253946 3227 387 242 53 13381 12948 --
NM_003589chr131530 2422 379 --11462
NM_003590chr232870 945 580 23656 963 ----
NM_003603chr421580 95 11655 1232 --
NM_003607chr153917 1107 832 768 744 12824 11274 23805 376
NM_003616chr142416 394 ------
NM_003618chr21989 ------
NM_003621chr115486 398 184 153 32 ------
NM_003626chr1141087 997 497 125 --1986 --
NM_003628chr21194 ------
NM_003629chr152771 2406 2282 1200 1062 ------
NM_003633chr531747 1598 537 --1160 --
NM_003644chr17196498 6452 5929 5337 4794 4420 4201 2434 2254 1597 1458 1219 1000 943 923 416 334 236 206 ------
NM_003651chr12193 ------
NM_003654chr11177 ------
NM_003659chr2--1189 1806 --
NM_003663chr352788 1342 557 499 304 43236 3107 2284 2204 ----
NM_003671chr983497 3237 3108 2732 2422 1308 1081 99 ----22447 2437
NM_003672chr121941 485 1119 ----
NM_003681chr21126155 6119 4017 4009 3854 2456 2085 1266 1136 973 346 81 --35465 5408 3909 11517
NM_003692chr9190 ------
NM_003714chr552970 2789 2373 1229 1205 ------
NM_003716chr31987 1791 11053 --
NM_003732chr52232 196 1239 ----
NM_003749chr1332424 555 455 22164 1667 ----
NM_003754chr111121 ------
NM_003757chr11367 ------
NM_003758chr1531617 1324 1280 --1362 --
NM_003758chr1531617 1324 1280 --1362 --
NM_003759chr453930 3820 2986 1244 650 24189 323 11521 --
NM_003766chr171207 ----131
NM_003768chr131579 1464 603 --21498 117 11535
NM_003774chr1252804 2570 2282 787 205 12343 160 22595 2234
NM_003779chr1123 ------
NM_003787chr1811322 ----1561
NM_003794chr331030 438 369 ------
NM_003800chr622086 239 12112 ----
NM_003819chr1180 ------
NM_003822chr162998 2974 2895 2844 2115 521 ------
NM_003835chr17------1263
NM_003861chr1442866 827 604 41 --12236 --
NM_003862chr52102 32 1273 ----
NM_003864chr41132 1171 ----
NM_003872chr262444 2405 2380 2269 942 605 12437 12480 --
NM_003873chr1031716 1691 820 1663 12447 --
NM_003877chr122644 213 ------
NM_003887chr222258 114 --1557 --
NM_003899chr1362552 2527 2459 2441 2165 60 --11980 --
NM_003901chr1072769 2722 2688 2420 792 445 246 --11752 --
NM_003908chr20--11194 ----
NM_003913chr664269 4160 4037 3624 3535 1462 23499 2700 ----
NM_003916chrX11055 ------
NM_003922chr15--1145 ----
NM_003927chr183868 249 207 ------
NM_003930chr731896 750 86 ------
NM_003931chr61530 1211 ----
NM_003939chr1033813 3338 2950 ------
NM_003941chr72555 309 1674 ----
NM_003947chr31449 11124 --1354
NM_003953chr152574 2421 2242 1848 604 22518 1946 21905 336 --
NM_003958chr683506 3293 3262 2765 2514 2439 1129 175 11155 23371 2542 --
NM_003972chr10----1431 --
NM_003981chr152842 189 ------
NM_003986chr111106 --1237 --
NM_003994chr1243160 2854 1726 1689 11708 ----
NM_004004chr131475 31066 189 117 --1503
NM_004006chrX22633 783 1449 12080 --
NM_004007chrX22633 783 1449 12080 --
NM_004009chrX22633 783 1449 12080 --
NM_004010chrX22633 783 1449 12080 --
NM_004011chrX22633 783 1449 12080 --
NM_004012chrX22633 783 1449 12080 --
NM_004013chrX22633 783 1449 12080 --
NM_004014chrX22633 783 1449 12080 --
NM_004015chrX22633 783 1449 12080 --
NM_004016chrX22547 697 1363 11994 --
NM_004017chrX22633 783 1449 12080 --
NM_004018chrX22547 697 1363 11994 --
NM_004020chrX22633 783 1449 12080 --
NM_004021chrX22547 697 1363 11994 --
NM_004022chrX22547 697 1363 11994 --
NM_004023chrX22547 697 1363 11994 --
NM_004024chr111539 2426 97 1593 --
NM_004035chr1725209 5054 13183 11382 14758
NM_004050chr1422654 2127 1942 2954 319 11780
NM_004055chr1171970 1482 619 526 382 294 287 ------
NM_004081chrY21710 1416 11401 ----
NM_004086chr142644 269 ------
NM_004093chr1312808 ------
NM_004094chr141477 32947 1138 165 --1631
NM_004098chr1031183 962 939 1906 ----
NM_004100chr642662 1725 465 81 22158 1949 1387 1659
NM_004113chr331828 1662 1467 11637 1679 --
NM_004116chr21308 ------
NM_004124chr1423497 2355 21279 1110 --12267
NM_004145chr19----1334 --
NM_004161chr221447 993 11163 --11142
NM_004171chr11159087 9079 7397 6898 6563 6454 5944 2945 2885 1777 1544 1478 1402 978 651 88962 7464 6847 5967 1771 925 481 409 ----
NM_004172chr531801 1570 1275 1634 ----
NM_004187chrX91403 1357 1331 1261 990 467 230 135 28 ------
NM_004200chr1153265 3213 2172 1021 113 --1959 22855 493
NM_004229chrX32174 1910 707 ------
NM_004232chr1843393 1432 703 362 ------
NM_004235chr9----2756 716 --
NM_004236chr15130 2481 59 ----
NM_004249chr4181 ------
NM_004261chr1122 ------
NM_004263chr261629 1510 1434 1257 373 246 --41191 1166 493 401 --
NM_004274chr14187 23002 1225 --1947
NM_004279chr722259 313 ----11918
NM_004290chr531036 436 43 --11004 --
NM_004301chr31154 1240 ----
NM_004302chr1282696 2409 2310 2217 2155 1876 204 119 --1379 --
NM_004329chr1031364 1259 1108 --1357 --
NM_004331chr85906 614 482 318 224 --12223 --
NM_004338chr1866276 6213 5968 2482 2355 451 44363 2680 2278 1282 17000 11812
NM_004349chr8------1895
NM_004350chr172175 1734 887 831 644 410 41 ----11637
NM_004369chr23645 563 526 --1594 --
NM_004370chr642164 1897 1336 490 11780 --11951
NM_004379chr21368 1525 ----
NM_004380chr1652587 2497 2103 1849 1807 --22291 793 --
NM_004385chr51280 --149 --
NM_004389chr21334 ------
NM_004392chr1342670 2399 1052 541 12352 ----
NM_004397chr1144083 850 462 404 33708 3116 315 ----
NM_004411chr7144 1794 ----
NM_004423chr362663 2076 718 693 671 191 ------
NM_004426chr1251319 777 719 303 252 --11778 --
NM_004430chr832372 908 103 1969 ----
NM_004432chr91134 ------
NM_004433chr141728 1489 474 215 --1358 11566
NM_004434chr1421246 611 --1743 1441
NM_004437chr143532 1154 795 439 --42337 1273 855 540 --
NM_004438chr283017 2607 2457 2250 2067 650 508 346 --1732 --
NM_004440chr631899 274 157 21234 389 ----
NM_004447chr121255 ------
NM_004454chr311797 3156 97 32 21780 746 --
NM_004456chr7142 ------
NM_004463chrX3404 257 67 ------
NM_004464chr424000 3773 21157 732 ----
NM_004474chr13877 762 183 ------
NM_004482chr22927 359 1662 ----
NM_004499chr51173 ------
NM_004501chr123639 1508 23924 3852 ----
NM_004504chr223012 2326 22441 1148 --1679
NM_004514chr1752533 1159 1031 891 91 1154 32997 1958 143 12717
NM_004516chr191203 ------
NM_004521chr101261 ------
NM_004529chr91389 11067 ----
NM_004530chr165971 481 300 285 108 1254 --11001
NM_004537chr1221555 1187 ------
NM_004540chr213716 308 86 ------
NM_004574chr171110 ------
NM_004575chr411080 1485 ----
NM_004577chr71523 ------
NM_004586chrX84687 3953 3883 3456 1941 1878 1008 851 1349 14994 1610
NM_004593chr3------2675 31
NM_004598chr522889 402 11129 1572 --
NM_004612chr9----14294 --
NM_004637chr321081 1068 ------
NM_004654chrY----1222 --
NM_004656chr371265 811 505 497 483 460 123 --2788 166 --
NM_004660chrY2214 181 11634 ----
NM_004663chr152453 214 122 2524 130 --
NM_004670chr1031657 1071 252 1466 21605 528 --
NM_004681chrY1181 ------
NM_004687chr1741564 1387 835 441 --1218 --
NM_004717chr721018 970 11526 ----
NM_004719chr123667 505 426 ------
NM_004726chrX15632 25619 5146 --14742
NM_004730chr53775 174 94 1226 ----
NM_004734chr1342204 1313 132 94 12225 ----
NM_004742chr341871 1834 1818 1487 ------
NM_004745chr885429 2498 2427 1276 1119 931 514 71 35912 1914 959 15565 24946 1844
NM_004748chr1553176 3058 1430 708 284 ------
NM_004758chr172929 387 --1248 --
NM_004768chr1--21192 427 ----
NM_004770chr81247 ------
NM_004772chr511245 ------
NM_004775chr1812172 ------
NM_004781chr121510 444 31112 470 99 1710 --
NM_004781chr121510 444 31112 470 99 1710 --
NM_004788chr1121055 176 1298 12601 12184
NM_004789chr91312 ----1453
NM_004796chr141252 21497 190 ----
NM_004797chr333320 3045 691 42852 2758 2608 1159 ----
NM_004798chr202170 108 23304 477 13583 --
NM_004801chr241538 1410 627 223 21429 1167 ----
NM_004804chr252742 734 656 376 68 2946 626 ----
NM_004808chr1033013 2694 2594 --12825 --
NM_004815chr164541 4147 3588 3418 3244 314 14410 ----
NM_004820chr82352 53 145 ----
NM_004822chr1793454 3354 3114 2440 1472 836 688 351 243 ------
NM_004831chr192986 942 ------
NM_004834chr213242 13421 11132 --
NM_004844chr3--1109 1118 --
NM_004845chrX73682 3297 1351 772 738 626 250 43428 850 282 125 22669 1324 --
NM_004849chr62511 360 2604 37 ----
NM_004850chr22705 493 ------
NM_004859chr1742826 770 593 344 12664 ----
NM_004863chr1475173 4970 3465 3247 422 383 299 35349 1251 147 21155 725 15303
NM_004866chr545063 4560 3546 587 11080 ----
NM_004871chr1741672 1652 1051 258 23056 3024 ----
NM_004884chr1531722 1442 1418 11475 2387 179 --
NM_004887chr511021 ------
NM_004891chr21234 ------
NM_004893chr52540 409 ------
NM_004898chr422524 1976 ------
NM_004902chr201269 1179 ----
NM_004904chr755167 5126 4394 2359 1081 11701 ----
NM_004912chr721436 1357 ------
NM_004926chr14199 --1319 --
NM_004932chr511416 11230 1349 --
NM_004939chr2--159 ----
NM_004956chr743370 3229 1841 292 --12978 --
NM_004961chrX21187 1030 21062 307 ----
NM_004965chr212503 106 ------
NM_004973chr631474 1209 590 ----1106
NM_004979chrX2788 360 --2769 260 --
NM_004985chr1284516 3512 2762 1008 699 511 494 179 23838 137 13600 13374
NM_004992chrX118547 8257 6691 5330 5192 3171 3155 2514 2507 1173 863 28250 1545 23233 1416 --
NM_004992chrX118547 8257 6691 5330 5192 3171 3155 2514 2507 1173 863 28250 1545 23233 1416 --
NM_004995chr146562 524 394 384 211 157 1199 11042 1440
NM_004999chr644331 1664 1263 236 44474 4248 3366 1303 1596 --
NM_005004chr10377 65 30 ------
NM_005005chr8----166 --
NM_005006chr21955 1273 ----
NM_005010chr72905 49 ----11873
NM_005021chr61109 2391 119 ----
NM_005032chrX11048 2826 708 ----
NM_005036chr22138289 8180 7937 7922 7839 7507 7181 6855 6156 5772 5485 2737 2374 12438 18342 --
NM_005056chr1244633 4481 4132 527 --11222 1734
NM_005058chrY--1246 ----
NM_005063chr1032941 2374 1540 ------
NM_005065chr1434876 3854 1740 35241 900 136 24747 4232 --
NM_005066chr12804 704 ------
NM_005109chr322063 315 --1653 --
NM_005119chr111018 11289 ----
NM_005121chr1711130 33546 2849 1466 ----
NM_005126chr341926 1840 1684 200 ------
NM_005134chr18------1259
NM_005144chr841185 977 929 164 ------
NM_005151chr1832270 432 204 ----12442
NM_005153chr164767 753 522 180 ------
NM_005156chr965356 5343 1907 1058 1007 340 125 ----
NM_005160chr2266726 6370 4951 1754 1133 577 24894 4752 36140 2034 358 15293
NM_005166chr192280 226 ------
NM_005171chr12--1845 ----
NM_005188chr1177526 6079 5956 2572 876 683 325 26660 5310 --26748 1400
NM_005197chr1473833 3794 2331 1927 806 519 186 22222 635 ----
NM_005207chr2253442 2835 2425 445 46 21277 999 ----
NM_005219chr571503 1162 545 371 233 117 56 --3421 346 275 --
NM_005230chr121567 ------
NM_005233chr31590 ----1143
NM_005235chr276447 6175 5939 5794 5329 2812 555 15164 ----
NM_005238chr1122582 1048 --42906 2819 1112 627 --
NM_005239chr212496 135 ------
NM_005241chr3194 1136 ----
NM_005244chr201612 ------
NM_005254chr151322 21323 1276 ----
NM_005257chr1811101 ------
NM_005259chr2--2435 31 ----
NM_005264chr103748 742 736 1722 1806 --
NM_005295chr7------1294
NM_005311chr732208 967 339 ------
NM_005313chr1521181 1076 2847 151 ----
NM_005318chr223839 796 173 ------
NM_005336chr232109 823 792 22083 2005 22212 880 11614
NM_005349chr4------1514
NM_005359chr18105730 5467 5244 4837 4824 4070 3982 3975 2055 25 26364 671 ----
NM_005375chr61443 --11095 --
NM_005382chr8----1326 --
NM_005385chr31539 32714 2507 184 1645 22403 461
NM_005388chr9--1292 --11413
NM_005399chr193744 3584 1534 1516 1156 883 619 437 22 33458 2966 337 24083 3096 --
NM_005400chr21973 --12295 --
NM_005402chr7--11566 31709 1434 601 --
NM_005406chr181559 ------
NM_005407chr1461534 506 187 147 126 102 --184 --
NM_005409chr421079 274 ------
NM_005410chr51599 1835 ----
NM_005433chr1832169 1932 176 11745 ----
NM_005435chr72553 446 ------
NM_005436chr1063826 2580 1421 770 746 716 11452 13663 --
NM_005437chr1031108 407 392 11045 ----
NM_005442chr31547 1139 1582 --
NM_005443chr42152 127 1108 ----
NM_005445chr101270 ------
NM_005455chr12639 384 ------
NM_005458chr93574 251 192 11626 ----
NM_005460chr5------1211
NM_005465chr121711 75 ------
NM_005475chr1232997 2465 875 1783 23067 2704 --
NM_005487chr2231925 669 410 --11497 1283
NM_005497chr1721293 882 23738 2018 1920 --
NM_005502chr923030 731 --12944 --
NM_005509chr531686 762 411 ----1156
NM_005520chr51238 ------
NM_005522chr71477 --2530 239 --
NM_005529chr131011 860 130 ------
NM_005537chr13----1931 --
NM_005544chr21282 182 ----
NM_005562chr131595 1535 425 ------
NM_005563chr11805 141 ----
NM_005573chr5----1137 --
NM_005578chr374703 4173 3770 1946 1843 797 125 14717 ----
NM_005587chr15151 ------
NM_005595chr1--1893 ----
NM_005596chr974988 2196 2122 1453 775 665 276 24963 943 1431 --
NM_005598chr161578 1320 1194 1121 530 118 11529 1554 --
NM_005599chr1--21276 575 11008 --
NM_005602chr311044 --155 2187 104
NM_005604chr6186 1134 ----
NM_005613chr151926 1825 890 599 221 ------
NM_005625chr81194 ------
NM_005627chr61259 ------
NM_005630chr351844 1572 331 177 23 1345 ----
NM_005637chr1822073 1990 ------
NM_005639chr123338 173 108 ------
NM_005647chrX33481 436 70 ------
NM_005650chr223173 125 102 --21253 942 --
NM_005662chr8------173
NM_005664chr151147 1187 1387 --
NM_005665chr144657 3510 1904 721 13090 ----
NM_005668chr51205 22849 1236 --2989 176
NM_005688chr321294 918 1234 ----
NM_005715chr652506 2061 1135 309 74 --12414 12452
NM_005717chr12871 83 ----11133
NM_005722chr2--21707 506 1307 --
NM_005734chr11------1558
NM_005739chr1531839 661 155 31774 330 55 ----
NM_005746chr712782 12319 2776 527 --
NM_005754chr521064 947 ------
NM_005766chr1321361 1161 2356 299 1461 --
NM_005776chr141324 ------
NM_005780chr131703 ------
NM_005792chr161218 --1460 --
NM_005796chr161293 ------
NM_005797chr113541 286 47 21741 497 ----
NM_005808chr323194 2685 1900 13051 --
NM_005819chr183419 2884 2875 2545 2361 1276 1093 495 --12495 --
NM_005826chr12551 47 ------
NM_005828chr1764990 4083 3118 1657 1293 140 21132 790 14679 --
NM_005832chr351441 471 443 109 75 ------
NM_005840chrX127664 7295 6614 6170 5102 2709 2655 2175 1928 1361 1098 683 57035 5645 2974 2387 1791 35670 2621 1559 --
NM_005841chr42864 474 --1935 --
NM_005842chr131500 ------
NM_005843chr21297 31331 586 463 ----
NM_005857chr121383 1362 ------
NM_005873chr202624 131 ------
NM_005882chr41682 ------
NM_005885chr521566 419 1237 ----
NM_005895chr1273747 3652 2827 2621 1669 1560 1105 14160 ----
NM_005896chr2--1683 ----
NM_005898chr1152887 2650 2419 1999 1283 32661 1978 421 2537 213 --
NM_005901chr1898665 6649 6328 2397 2320 2177 1953 1859 615 17274 27475 3409 17361
NM_005906chr6--1306 ----
NM_005909chr543563 3271 3265 943 1782 ----
NM_005911chr251243 462 431 303 194 186 11400 --
NM_005923chr62245 171 1689 1432 --
NM_005924chr7157 ------
NM_005933chr11102805 2732 2676 2556 2259 1059 847 655 274 145 12726 12454 --
NM_005934chr1971908 910 859 456 192 115 103 ------
NM_005935chr463285 2132 1925 1159 845 237 1101 ----
NM_005941chr812672 12949 21586 694 --
NM_005943chr651715 1485 1285 1264 244 --41447 640 535 457 --
NM_005955chr1105545 4494 4268 3800 3767 1886 1830 1593 837 731 14094 33353 1497 680 --
NM_005962chr1011499 12245 --1407
NM_005962chr1011499 12245 --1407
NM_005964chr1721133 624 1470 ----
NM_005966chr212047 11664 176 --
NM_006009chr12------1136
NM_006011chr1564094 3483 3432 3350 1633 1217 22817 811 --11692
NM_006016chr652071 1897 682 658 272 --21979 1660 --
NM_006022chr131370 ------
NM_006030chr32708 84 --1132 --
NM_006033chr1831492 804 373 --32223 483 216 --
NM_006034chr11132339 2304 2241 2073 1935 1820 1734 839 822 800 233 101 24 31793 574 531 12021 --
NM_006036chr232299 488 385 1433 1468 --
NM_006047chr2042533 1423 1319 1293 1637 11304 13193
NM_006048chr121244 970 ------
NM_006052chr213283 193 68 ------
NM_006054chr1151349 1295 515 394 256 ------
NM_006064chrX3398 121 44 ------
NM_006080chr72190 173 22789 858 ----
NM_006090chr1----1147 --
NM_006091chr1551564 1188 1105 160 58 ------
NM_006094chr831915 1835 817 21941 593 1978 --
NM_006095chr464503 3978 3925 1745 714 39 24274 380 12869 --
NM_006106chr1132690 1362 664 ----1207
NM_006107chr171423 ------
NM_006121chr123286 92 28 ------
NM_006122chr1531102 864 417 ------
NM_006134chr2121194 271 --11439 --
NM_006135chr12341 297 --11212 --
NM_006141chr1642790 2705 2602 1023 12454 ----
NM_006162chr1851409 1234 1173 618 406 ------
NM_006166chr1232516 764 617 11969 ----
NM_006180chr941528 1469 1447 784 11384 1364 --
NM_006183chr12148 ------
NM_006194chr1421112 455 --11195 11012
NM_006195chr9123 --1324 --
NM_006203chr574401 4329 4086 2204 1621 1585 1125 34158 3970 1772 33471 1949 1202 --
NM_006206chr432589 2251 370 22556 520 12346 1993
NM_006209chr82395 160 ------
NM_006218chr3----1248 --
NM_006226chr241162 1080 551 104 ------
NM_006246chr1451229 1165 1100 978 149 ------
NM_006251chr533176 2246 429 ------
NM_006252chr137499 6999 2513 76182 6112 1872 1427 883 667 388 26900 1093 --
NM_006256chr132486 2397 330 --1352 --
NM_006264chr4142 1593 ----
NM_006275chr202805 501 --1163 --
NM_006277chr22607 219 ------
NM_006281chr841112 194 98 86 1286 ----
NM_006281chr841112 194 98 86 1286 ----
NM_006282chr2014076 14272 1803 11861
NM_006283chr884198 4079 3333 1831 741 583 170 71 2558 184 --23323 877
NM_006293chr154991 871 799 348 ------
NM_006306chrX85837 4729 1114 1048 984 462 37 24 13702 ----
NM_006307chrX------171
NM_006313chr12----1364 --
NM_006328chr113616 462 217 ------
NM_006334chr91278 ------
NM_006343chr21485 ------
NM_006352chr1----11599 --
NM_006363chr202425 243 1507 ----
NM_006364chr142375 101 ------
NM_006375chrX1619 11584 11448 1182
NM_006380chr1773801 3151 2672 1751 1697 1664 1197 33284 2772 323 1987 --
NM_006393chr1051616 1334 750 582 535 23626 326 ----
NM_006416chr6----161 --
NM_006420chr2022966 2484 13249 ----
NM_006434chr1053157 3039 3013 741 350 22019 498 1635 --
NM_006451chr511108 1685 1878 --
NM_006457chr433997 2740 839 22946 2805 --2396 118
NM_006459chr1041809 1544 647 323 11652 ----
NM_006460chr1751420 1408 1349 1187 243 1304 11264 --
NM_006469chr111507 --11082 --
NM_006478chr221212 --158 --
NM_006482chr1253946 3227 387 242 53 13381 12948 --
NM_006494chr192813 74 --2322 59 1740
NM_006504chr1052339 2081 1137 407 97 31870 1067 428 --1128
NM_006519chr62279 52 ------
NM_006527chr41143 ------
NM_006538chr233297 2827 471 13836 ----
NM_006540chr81138 11376 --1609
NM_006544chr1446013 5572 5282 785 22194 264 ----
NM_006546chr17146282 5527 5428 5393 4794 2648 2633 2442 1423 1129 869 601 401 166 14394 24735 2005 1377
NM_006547chr711674 1391 ----
NM_006549chr1242502 1895 872 83 11173 ----
NM_006557chr931642 1315 24 ------
NM_006559chr1----11114 --
NM_006560chr111400 ------
NM_006561chr10114832 3945 2303 2227 2173 1817 1745 1692 1546 1410 1188 31911 1901 354 ----
NM_006572chr1763524 3248 2687 1113 891 416 22495 354 23165 3075 13296
NM_006593chr21711 --1790 --
NM_006599chr1697377 7294 6897 6798 5869 1241 1157 1085 214 33162 2682 297 ----
NM_006601chr121263 11130 --192
NM_006603chrX21802 103 2709 449 21832 1411 --
NM_006609chr232074 622 537 22944 173 --1465
NM_006614chr322554 2321 33479 3326 2755 ----
NM_006620chr644845 1449 783 636 13162 ----
NM_006621chr121780 499 147 --1369
NM_006624chr10--11411 1746 --
NM_006626chr91616 2594 239 1967 --
NM_006628chr1574195 4157 4096 3226 1350 1009 50 11119 --23864 521
NM_006629chr1862015 1785 927 893 817 668 ------
NM_006650chr593713 3573 3289 3205 2574 2508 502 397 370 13875 13502 --
NM_006654chr1264626 4570 3973 3212 3110 889 31570 1495 176 13777 --
NM_006699chr142541 2180 1822 132 ----1996
NM_006704chr131318 ------
NM_006717chr932649 2548 316 23389 690 ----
NM_006722chr342888 2399 2361 2039 --12345 1493
NM_006729chrX95605 4798 4314 3818 2221 2035 1937 1695 424 35533 5191 4205 ----
NM_006734chr6----1100 --
NM_006746chrX11083 ------
NM_006749chr811144 ------
NM_006750chr1677944 6060 4915 2821 1354 976 570 56676 5194 3167 1025 203 ----
NM_006754chr741212 1130 857 297 --1304 --
NM_006766chr821906 298 22450 539 ----
NM_006769chr11743 --1569 --
NM_006775chr631160 355 305 ------
NM_006778chr631266 512 28 11681 ----
NM_006788chr1811539 1833 ----
NM_006805chr52682 74 ----11333
NM_006818chr14820 809 698 376 2888 367 ----
NM_006826chr21974 ------
NM_006832chr143914 908 127 ------
NM_006838chr12----11202 --
NM_006854chr721995 189 ------
NM_006856chr121806 ------
NM_006873chr243066 832 673 195 23303 2443 13144 --
NM_006874chr4----1939 --
NM_006884chr311382 11435 ----
NM_006885chr1673923 3103 2873 1118 1081 1054 305 --1236 --
NM_006888chr1422451 246 53209 3118 2311 264 197 ----
NM_006902chr13632 595 61 --11077 --
NM_006908chr71266 ----1242
NM_006920chr221832 126 21967 709 ----
NM_006922chr232362 739 664 ------
NM_006924chr1774481 4047 3476 2794 1647 272 147 1580 ----
NM_006925chr14----1373 1415
NM_006937chr17--1533 ----
NM_006941chr223821 367 58 --2886 158 --
NM_006947chr411406 1444 ----
NM_006948chr211910 2223 90 ----
NM_006950chrX1869 ----3371 179 54
NM_006956chr721722 1603 1490 --1753
NM_006981chr932923 718 101 32053 984 908 1814 12481
NM_006990chr131542 774 202 32010 596 132 21575 515 11640
NM_006997chr10----1375 --
NM_007006chr1622312 1091 3590 498 119 ----
NM_007007chr12114419 4382 4372 3528 3468 3409 3253 1228 1037 1006 176 24014 1490 11833 24788 4308
NM_007010chr172633 268 1152 ----
NM_007011chr1595344 4248 2250 2175 1910 1244 934 559 360 75852 5363 4431 2561 991 767 421 --15797
NM_007013chr81293 1222 1962 --
NM_007032chr2272171 2151 2060 1040 741 538 447 2827 699 11097 --
NM_007039chr1442283 1755 1669 237 21725 635 ----
NM_007050chr20158123 8106 8050 6380 5592 5470 5190 3233 2939 2378 2253 1530 981 543 136 46164 3157 1164 1027 ----
NM_007054chr553703 3610 684 643 414 11488 1473 11538
NM_007064chr321154 334 1182 ----
NM_007075chrX2356 238 --1278 --
NM_007084chr13----1986 --
NM_007106chr1332631 1991 699 --22324 761 --
NM_007107chr332071 639 517 --1684 --
NM_007108chr161546 ------
NM_007118chr51584 ------
NM_007146chr1762739 2612 2242 2235 1850 816 22713 2270 ----
NM_007157chrX42586 746 187 122 11828 2372 216 --
NM_007158chr13412 344 235 ------
NM_007159chr31425 11254 1642 --
NM_007166chr1131444 534 422 --11212 --
NM_007172chr2232984 2040 273 32977 711 60 ----
NM_007174chr1251507 622 355 287 212 ----11993
NM_007178chr12--1494 ----
NM_007195chr1822658 1313 23246 3028 ----
NM_007203chr911009 33504 2601 1238 ----
NM_007212chr11911 1500 ----
NM_007217chr3--1283 1257 --
NM_007222chr831242 628 492 ------
NM_007236chr1562440 2377 2051 1834 536 364 11925 ----
NM_007238chr2084778 4600 4466 4272 3772 3702 3176 1394 24840 3789 1306 --
NM_007249chr13119409 9163 9136 8834 7946 6310 5761 2038 858 740 412 22966 336 --25894 619
NM_007269chr11440 ------
NM_007271chr631495 515 289 11181 ----
NM_007282chr32797 676 ------
NM_007286chr532041 630 528 11396 ----
NM_007287chr393181 2758 2514 2161 1140 1016 692 162 67 32465 2081 306 22143 88 --
NM_007288chr393181 2758 2514 2161 1140 1016 692 162 67 32465 2081 306 22143 88 --
NM_007289chr393181 2758 2514 2161 1140 1016 692 162 67 32465 2081 306 22143 88 --
NM_007292chr1725209 5054 13183 11382 14758
NM_007294chr1741280 389 308 72 2404 173 ----
NM_007295chr1741280 389 308 72 2404 173 ----
NM_007296chr1741280 389 308 72 2404 173 ----
NM_007297chr1741280 389 308 72 2404 173 ----
NM_007298chr1741280 389 308 72 2404 173 ----
NM_007299chr1741280 389 308 72 2404 173 ----
NM_007300chr1741280 389 308 72 2404 173 ----
NM_007302chr1741280 389 308 72 2404 173 ----
NM_007303chr1741280 389 308 72 2404 173 ----
NM_007304chr1741280 389 308 72 2404 173 ----
NM_007305chr1741280 389 308 72 2404 173 ----
NM_007325chrX1173 1820 ----
NM_007345chr1842136 1948 1624 822 11928 12006 --
NM_007350chr1273805 3743 3441 3352 3259 2903 422 13035 13673 --
NM_007358chr111659 --1144 165
NM_007363chrX1237 135 --1738
NM_007372chr172231 37 --1554 --
NM_007373chr1011843 21702 1429 --1421
NM_007375chr122703 418 ------
NM_012081chr533275 607 71 12871 22480 640 1462
NM_012089chr131397 1245 1177 11072 ----
NM_012090chr121132 132 1357 ----
NM_012095chr1072928 2676 2525 2502 2198 559 496 32941 2843 324 ----
NM_012102chr1----22346 1891 --
NM_012104chr1183393 1457 1232 1137 955 940 932 670 32835 2645 1098 33533 3207 1321 1291
NM_012104chr1183393 1457 1232 1137 955 940 932 670 32835 2645 1098 33533 3207 1321 1291
NM_012105chr211262 ------
NM_012120chr642737 1873 824 201 ------
NM_012129chr721699 131 12369 ----
NM_012134chr11165 --11205 --
NM_012141chr1354047 3001 1104 582 520 23498 209 ----
NM_012153chr114969 727 526 198 --11968 --
NM_012154chr81751 1284 --1273
NM_012156chr2063300 3011 2967 2415 474 414 --11196 --
NM_012158chr13126 ------
NM_012174chr1262173 1116 761 357 303 147 12833 ----
NM_012193chr1164762 3675 2175 1843 1568 1421 --24948 4655 35303 3786 1694
NM_012214chr224351 4229 26216 704 --15920
NM_012229chr1021078 582 ------
NM_012234chr353304 3105 2746 228 176 ------
NM_012238chr10--11335 11113 11219
NM_012243chr13792 747 291 ------
NM_012249chr252590 2422 2384 1391 1181 22858 165 ----
NM_012250chr112120 94 2463 385 ----
NM_012257chr71220 11034 ----
NM_012262chr174404 4036 3653 3643 3355 1226 1220 14885 --11818
NM_012278chrX--1155 ----
NM_012288chr695332 4856 4323 3883 3516 2215 2032 1888 328 24990 3527 35489 2138 1349 --
NM_012290chr211711 ------
NM_012296chr1133525 3094 1499 1150 --22437 2424
NM_012297chr422159 628 ------
NM_012301chr7--2811 201 --1409
NM_012304chr532237 2169 2157 2450 394 12573 --
NM_012307chr18------1945
NM_012308chr1182414 1718 998 564 412 338 201 44 12602 ----
NM_012309chr1121638 1574 44216 4061 3554 3381 ----
NM_012316chr184724 4557 4487 4198 4103 1743 946 119 33951 3694 3571 1417 --
NM_012325chr2031352 1252 600 --1402 11577
NM_012330chr101167 --1557 --
NM_012333chr131445 633 520 1252 ----
NM_012334chr523618 1119 --33588 3406 301 21427 251
NM_012382chr554248 3856 3665 3590 1460 24203 3191 13282 13255
NM_012388chr153516 291 86 1847 ----
NM_012412chr71637 ------
NM_012414chr11630 ------
NM_012416chr93895 852 251 ------
NM_012417chr171165 1532 ----
NM_012419chr62595 267 ------
NM_012426chr162447 328 ------
NM_012428chr151133 ----1350
NM_012433chr2--148 ----
NM_012463chr1221454 111 ------
NM_012471chrX41983 1437 1402 659 ------
NM_012475chr1145 ------
NM_012479chr752666 2390 1932 687 274 ------
NM_012482chr11503 ------
NM_012486chr1--1108 ----
NM_013229chr1232473 2187 71 1443 ----
NM_013231chr1453625 3305 1536 708 530 ------
NM_013232chr51387 ------
NM_013233chr23972 315 25 11265 ----
NM_013255chr7108106 7827 6974 5892 5542 3515 2519 1893 1758 1387 88499 5709 3272 2066 2006 1880 761 197 --26413 3103
NM_013257chr821540 305 11690 ----
NM_013261chr432784 877 847 31418 593 68 ----
NM_013262chr62956 359 --11278 --
NM_013269chr1254518 4300 3907 1738 546 23527 1180 ----
NM_013279chr1192223 2101 2022 2011 1740 662 312 245 121 1507 41917 694 451 339 21653 777
NM_013281chr201603 11379 --11502
NM_013286chr393652 3310 2632 2578 2556 2478 792 403 382 --23544 1168 1632
NM_013293chr72614 102 ------
NM_013296chr1--168 ----
NM_013302chr16104621 4448 3755 3296 2933 1287 1073 783 732 514 23019 1703 ----
NM_013309chr1562590 2035 1821 525 95 29 12682 ----
NM_013352chr61210 1915 ----
NM_013354chr8--2454 328 1215 --
NM_013372chr1521028 30 32966 2324 549 ----
NM_013373chr22----1709 --
NM_013374chr31710 32572 2220 1023 ----
NM_013381chr1222192 1878 1219 1841 --
NM_013400chr74923 263 256 154 --1359 --
NM_013411chr152225 2023 1814 1784 609 32754 1719 884 2751 341 --
NM_013423chrX2268 203 1974 ----
NM_013427chrX2268 203 1974 ----
NM_013436chr23735 649 80 ------
NM_013438chr91602 ------
NM_013444chrX41016 922 845 416 ------
NM_013448chr143651 642 606 ------
NM_013450chr22868 117 --1331 --
NM_013943chr14796 173 58 41 22909 2185 --11309
NM_013960chr8--1743 ----
NM_013989chr14104288 4281 4096 3601 1115 753 406 224 141 89 23990 3924 14159 --
NM_013995chrX32465 2298 948 --12157 --
NM_014001chr1771537 1486 637 554 438 257 129 2357 186 290 50 --
NM_014007chr9----21219 145 --
NM_014016chr3--11274 ----
NM_014031chr52240 120 ------
NM_014043chr31137 ----1606
NM_014044chr2--1166 ----
NM_014048chr1685003 4003 3569 3359 2018 1844 1107 852 25130 382 --13896
NM_014089chr1311579 ------
NM_014106chr1532043 412 335 --12152 --
NM_014110chr13848 243 131 ----11218
NM_014112chr854629 3922 640 460 112 --24040 3466 --
NM_014117chr1642757 2135 526 291 31906 1060 419 12577 1667
NM_014141chr764965 4469 1868 1030 507 453 35237 3728 100 --24573 3695
NM_014154chr3----1272 11361
NM_014155chr1156040 5647 2210 1877 445 32684 1890 1760 --1425
NM_014169chr14253 23 ------
NM_014181chr262767 2675 1120 860 144 73 21939 701 12436 11034
NM_014182chr121508 ------
NM_014183chr20133 ------
NM_014190chr451697 1283 1223 360 78 1752 11245 --
NM_014217chr141205 545 480 282 11581 ----
NM_014232chr1731458 230 21 11270 1557 --
NM_014232chr1731458 230 21 11270 1557 --
NM_014233chr1751791 1605 1353 844 514 --11738 --
NM_014238chr1731582 1326 42 --1516 --
NM_014243chr411904 21930 1831 11911 --
NM_014246chr2282334 2161 1737 1670 1601 1474 860 697 --1250 --
NM_014250chr2231925 669 410 --11497 1283
NM_014253chrX32106 1574 363 12517 ----
NM_014267chr112266 39 ------
NM_014286chr943468 2688 2591 389 23117 886 2763 70 --
NM_014289chrX51437 1260 1004 939 222 ------
NM_014292chr2291786 1691 1531 1402 1300 1288 615 603 592 --21604 1546 1260
NM_014294chr81465 ----11100
NM_014296chr3--21016 114 --11449
NM_014305chr131260 --1454 --
NM_014309chr2265384 5181 4838 4713 1541 1114 11762 24015 1359 --
NM_014317chr101218 ------
NM_014319chr1221493 1483 ------
NM_014325chr1232057 495 76 ------
NM_014333chr1142066 1997 1015 40 ----1867
NM_014335chr1521254 1005 ----1239
NM_014345chr6--1184 ----
NM_014363chr131170 ------
NM_014368chr951861 1726 1473 1387 587 1234 ----
NM_014372chr131495 575 532 2356 118 ----
NM_014374chr74923 263 256 154 --1359 --
NM_014388chr1135654 4805 4786 4740 4560 4486 4042 3926 2399 1793 1231 523 314 45888 510 371 167 --14672
NM_014397chr94575 140 46 21 ------
NM_014400chr193498 400 46 ------
NM_014417chr192756 122 ------
NM_014423chr523995 2132 14462 --11425
NM_014445chr332309 2153 1652 11941 ----
NM_014447chr421584 1269 --1522 --
NM_014454chr6--2918 700 ----
NM_014480chr193592 325 157 1705 ----
NM_014491chr72838 693 ----2978 130
NM_014521chr2261 52 21723 1442 1728 --
NM_014554chr1262189 662 377 312 232 130 ------
NM_014572chr1311240 ------
NM_014574chr1421116 377 ------
NM_014584chr1421627 1086 21367 612 ----
NM_014591chr1071081 958 511 450 378 357 52 --146 --
NM_014592chr53277 64 56 ------
NM_014607chr26726 669 631 595 584 301 2519 230 ----
NM_014612chr9--1973 21441 966 --
NM_014613chr572928 2372 2278 2255 1072 984 633 140 ----
NM_014614chr2--11325 ----
NM_014615chr1653378 3165 2997 2881 557 13658 ----
NM_014616chr372949 2870 2848 2809 628 275 186 146 ----
NM_014636chr984181 2717 1733 1677 1084 611 599 587 11406 11092 1701
NM_014640chr21277 ------
NM_014646chr1832094 1106 676 23003 431 12446 12719
NM_014647chr1621676 253 ------
NM_014666chr52915 344 ------
NM_014667chr33964 931 879 --22460 2289 --
NM_014670chr221125 467 21475 606 ----
NM_014674chr393651 3559 2740 1511 1117 952 644 196 39 11457 ----
NM_014678chr224734 313 206 49 ----1577
NM_014679chr1121190 993 ------
NM_014694chr91643 ------
NM_014701chr1523317 382 --13438 --
NM_014717chr191547 ------
NM_014720chr10----11620 --
NM_014721chr687229 7071 7049 6995 5527 4622 1960 54 36455 5232 840 --25325 2587
NM_014729chr82290 278 1220 11962 --
NM_014730chr1285044 4983 3706 3602 2055 1995 1129 787 33544 1446 1053 24122 4100 --
NM_014730chr1285044 4983 3706 3602 2055 1995 1129 787 33544 1446 1053 24122 4100 --
NM_014732chr1655255 4776 1641 1290 1023 15518 15324 1131
NM_014742chr2031811 1648 1481 ------
NM_014746chr252791 1577 1536 615 100 ------
NM_014751chr8----11485 --
NM_014754chr81907 ------
NM_014755chr253252 2683 1200 446 58 21291 1223 13513 --
NM_014756chr111195 --1316 1401
NM_014757chr562327 2297 1875 1863 621 146 11625 ----
NM_014758chr115957 611 385 347 321 12538 --31646 1587 785
NM_014761chr161810 --1833 --
NM_014764chr1231088 500 357 1195 1254 --
NM_014766chr753360 2592 2332 2326 886 13813 ----
NM_014771chr165890 747 336 330 231 2368 198 2791 302 --
NM_014774chr132562 2177 2057 11317 --1376
NM_014795chr211002 ------
NM_014797chr642444 1155 1031 533 1790 ----
NM_014802chr1231088 813 199 11008 ----
NM_014803chr1032206 1148 374 --12896 --
NM_014810chr143169 3050 2652 453 1436 11470 --
NM_014812chr11366 1393 --1545
NM_014819chr52737 640 1614 ----
NM_014820chr331580 1300 606 164 ----
NM_014824chr1121400 242 1334 --1563
NM_014826chr153917 1107 832 768 744 12824 11274 23805 376
NM_014830chr1273781 3506 3264 2477 1404 1067 192 13545 2910 564 13178
NM_014838chr2232735 945 157 ------
NM_014839chr142237 1973 1696 885 ------
NM_014840chr1252403 2108 856 647 219 ------
NM_014847chr1----1367 --
NM_014850chr3114829 4739 4406 4061 3809 1936 1925 1544 1275 879 261 --11671 --
NM_014853chr1781436 1323 1202 1186 938 601 377 113 ------
NM_014860chr21124 180 12553 --
NM_014864chr153955 3559 3099 1559 461 --11534 22733 2716
NM_014870chr154669 4401 3846 1439 531 24485 1070 13569 --
NM_014872chr932035 1874 509 1209 12262 --
NM_014873chr164026 3259 3052 1077 884 871 33755 3556 1459 ----
NM_014877chr1735943 5004 1700 27536 5884 27513 5839 --
NM_014883chr461763 1681 499 291 163 97 ------
NM_014892chr61451 ------
NM_014893chrY21663 734 ------
NM_014897chr1742970 2761 907 542 13084 ----
NM_014899chr532362 1021 371 1253 ----
NM_014903chr1231997 709 264 1871 21953 110 1829
NM_014906chr1754020 2915 2514 1373 1339 22715 1006 ----
NM_014909chr1483510 2865 1070 759 480 419 180 69 --1718 --
NM_014912chr1032608 426 260 ------
NM_014921chr1951949 851 224 159 137 12782 ----
NM_014923chr13--22079 2035 ----
NM_014932chr31485 ------
NM_014934chr1343322 3084 2907 95 32700 1310 475 23278 1234 --
NM_014935chr1103680 2913 2727 1159 1128 932 874 361 324 218 --11224 --
NM_014936chr652422 2392 1107 924 260 11804 ----
NM_014943chr81216 --21068 266 --
NM_014945chr531939 628 609 21256 302 1267 --
NM_014946chr233114 2447 535 22639 1930 ----
NM_014947chr152557 944 231 219 30 ----1726
NM_014949chr13419 279 155 ------
NM_014961chr41221 ------
NM_014964chr1752089 845 798 585 295 --21719 382 --
NM_014969chr1--1825 ----
NM_014977chr141176 ------
NM_014978chr1031325 568 491 11297 ----
NM_014982chr1423404 167 23758 276 ----
NM_014991chr442706 2437 914 258 --13023 --
NM_014992chr141685 2833 48 ----
NM_014996chr32813 366 ----1258
NM_014997chr752180 882 289 113 102 12979 ----
NM_014999chr121154 ------
NM_015000chr122486 340 12915 ----
NM_015002chr1232178 2118 1457 1476 ----
NM_015008chr383028 2994 2556 2397 1322 1300 651 592 32783 1437 679 33400 2728 2274 --
NM_015020chr1661306 1253 1222 1015 584 405 11137 ----
NM_015023chr1101769 1743 1611 1296 688 636 557 440 198 52 ----1215
NM_015025chr232754 1728 777 22712 902 ----
NM_015026chr1274604 4545 3625 1262 959 585 55 23170 1719 14144 --
NM_015033chr983235 2586 988 820 698 397 162 80 ----12781
NM_015035chr2056306 4717 2447 2418 2237 36720 2672 426 14951 14752
NM_015044chr1663267 2912 2458 726 671 104 22476 456 --12711
NM_015059chr1593934 3544 3081 2872 2830 1190 199 126 40 11024 23342 2947 --
NM_015064chr1263276 3103 1151 1016 350 135 21325 825 1671 --
NM_015068chr743313 2557 2495 505 23628 174 ----
NM_015069chr161117 ------
NM_015071chr596377 5362 4499 4216 4124 1146 1118 949 359 56118 2296 733 577 281 ----
NM_015074chr124913 4190 ----14635
NM_015076chr634062 3085 1247 44081 3645 961 792 ----
NM_015082chr572507 2011 1922 763 685 41 21 --1390 --
NM_015087chr1372439 2029 1668 1022 393 194 34 ------
NM_015090chr175654 4622 4554 4089 3983 1337 1270 25369 2135 14476 --
NM_015091chr142311 154 ------
NM_015092chr1633988 3667 3279 23198 1379 ----
NM_015097chr332215 701 458 ------
NM_015101chr142501 2073 831 774 11965 12521 --
NM_015113chr1732247 1524 254 ------
NM_015115chr442909 2461 1124 845 ------
NM_015130chr411081 ------
NM_015132chr721953 1786 21379 542 ----
NM_015144chr1631560 847 517 41514 1253 458 186 ----
NM_015147chr223183 1068 22328 156 ----
NM_015155chr102823 282 --11323 --
NM_015156chr1412628 43636 3501 2701 580 1158 --
NM_015158chr91827 ------
NM_015172chr11508 11658 ----
NM_015173chr4----150 --
NM_015176chr12652 95 ------
NM_015185chrX73020 2549 1892 1035 947 675 598 --22709 2618 --
NM_015187chr42604 309 197 ----
NM_015191chr1192534 2505 2280 1948 804 681 521 292 104 ------
NM_015198chr71346 11075 ----
NM_015199chr3112957 2863 2744 2245 2043 1987 1833 1154 1147 798 298 --12153 --
NM_015205chr1374418 4136 4069 1924 1910 837 733 11472 41889 1461 211 173 --
NM_015206chr1553628 2944 2715 2623 2617 1490 ----
NM_015215chr122996 815 13143 ----
NM_015230chr431786 1750 1167 ------
NM_015233chr1362628 2240 751 162 92 56 1838 32205 2195 1759 --
NM_015236chr4--2116 96 ----
NM_015238chr51156 ------
NM_015242chr11125 ------
NM_015247chr1674760 4474 3712 3585 3443 1546 593 24453 170 25332 45 --
NM_015251chr16----42324 2043 2017 1977 --
NM_015254chr8103117 3098 2441 2296 2250 2056 956 570 325 54 --170 12777
NM_015267chr1232101 760 233 21712 638 ----
NM_015268chr31162 ------
NM_015271chr423088 1290 1154 13198 23863 1307
NM_015272chr1621733 403 --11461 --
NM_015275chr1221597 176 ----11469
NM_015277chr1831713 1567 286 ------
NM_015278chr642944 1369 1055 293 --1598 --
NM_015282chr262306 2015 667 643 611 323 12300 --13065
NM_015299chr14123670 3431 2830 1300 1279 1069 804 712 455 233 107 30 23212 770 21580 215 --
NM_015305chr1471785 1446 1424 1296 742 238 211 --11361 --
NM_015310chr8147396 7108 6927 6468 6369 5814 5496 3321 2494 2114 1586 1426 1032 990 21450 1237 15983 --
NM_015313chr1144096 3456 1372 1148 24385 1311 34145 1179 693 11743
NM_015314chr711959 32178 2015 177 11854 --
NM_015315chr5103153 2991 2750 2270 2202 1398 920 436 388 348 12350 ----
NM_015317chr212539 --1210 1658
NM_015326chr172700 2525 2316 2159 2096 1187 1019 1795 ----
NM_015335chr1242221 932 728 511 22163 1918 ----
NM_015336chr1221639 731 ------
NM_015346chr1421737 1698 1194 1113 --
NM_015347chr1242225 1881 511 72 22111 1859 ----
NM_015349chr672799 2696 2270 2117 2092 2023 604 12307 12324 12043
NM_015352chr2043324 2571 1395 446 13161 11055 --
NM_015354chr91322 ------
NM_015355chr17163 ------
NM_015361chr23721 314 257 ------
NM_015365chrX53789 3209 2618 1089 599 13269 ----
NM_015367chr2211597 11667 11306 41434 1401 1368 1157
NM_015375chr154049 3668 3534 3439 397 24555 1550 --23167 664
NM_015385chr1053157 3039 3013 741 350 22019 498 1635 --
NM_015387chr232085 724 700 1417 ----
NM_015393chr473215 1458 1284 600 538 435 108 ------
NM_015397chr951611 1405 1351 727 79 --11199 --
NM_015453chr311911 ----1839
NM_015455chr521358 928 12594 --12566
NM_015458chr843485 1032 974 126 14743 ----
NM_015460chr32486 209 ------
NM_015461chr182652 263 ------
NM_015463chr22297 131 ----174
NM_015464chr711021 1368 ----
NM_015465chr51285 197 1533 --
NM_015469chr9----1765 --
NM_015488chr241705 584 465 379 ------
NM_015509chr1241427 1164 398 310 ------
NM_015514chr143579 201 88 1233 ----
NM_015526chr1951240 1093 394 216 77 31226 911 514 31265 1207 67 --
NM_015534chr11169 ------
NM_015535chr282842 2808 1638 1581 1101 1034 702 158 13417 ----
NM_015548chr63762 335 127 ------
NM_015553chr684529 3537 3232 1951 1944 1810 1559 274 45024 4572 3151 82 11713 --
NM_015554chr1512247 22275 139 11896 --
NM_015564chr533524 3339 2427 22435 710 --12319
NM_015565chr2121919 443 41942 298 154 29 ----
NM_015568chr2043304 1444 288 70 11646 ----
NM_015569chr143905 3608 545 253 34406 1944 1718 --1609
NM_015575chr243717 2382 1242 747 32533 1214 1206 1579 --
NM_015576chr372969 2652 2244 1158 743 490 476 12227 ----
NM_015578chr1921482 753 11376 ----
NM_015626chr17--1914 1931 --
NM_015640chr135235 3832 3487 25045 1817 ----
NM_015642chr3--1298 1241 --
NM_015678chr1311648 ------
NM_015691chrX62909 2616 2515 1984 1861 831 11825 12970 11911
NM_015726chr171747 1545 1141 550 210 197 78 2666 542 ----
NM_015844chr181959 ------
NM_015846chr181959 ------
NM_015847chr181959 ------
NM_015866chr12134 29 ------
NM_015874chr4------1514
NM_015878chr841544 1368 238 230 ------
NM_015879chr1867566 7033 6349 2746 1726 524 32194 1039 82 38326 5536 2622 11717
NM_015888chr122666 509 157 12731 --
NM_015898chr1952466 2271 1827 1666 377 32530 948 481 ----
NM_015902chr8--1119 ----
NM_015905chr71147 ------
NM_015906chr134470 2939 1499 14614 --11719
NM_015949chr73871 635 261 --1102 --
NM_015952chr6--1159 ----
NM_015955chr21162 ------
NM_015975chrX31650 695 527 195 1239 --
NM_015990chr431044 1020 906 ------
NM_015995chr15155496 4912 4554 4270 3602 3596 3537 3460 2169 1760 1682 1402 741 474 302 33710 3452 1981 14879 1597
NM_016002chr12732 152 1164 --1776
NM_016009chr184632 4282 4265 4162 3955 3151 1515 1383 21680 62 ----
NM_016018chr832779 2103 773 --22022 452 --
NM_016021chr642327 2313 2199 915 22190 467 --1527
NM_016023chr81536 31898 670 349 12043 --
NM_016032chrX41270 1121 441 245 ----1962
NM_016037chr121087 765 ------
NM_016038chr7--2209 26 ----
NM_016045chr202393 294 1171 11628 --
NM_016057chr121967 1121 2493 292 --
NM_016061chr211638 ------
NM_016071chr71241 199 ----
NM_016072chr1221763 722 --12258 --
NM_016073chr152759 242 2858 452 ----
NM_016076chr121166 865 --32128 1293 557 --
NM_016083chr673260 3154 3021 2908 1281 743 603 13295 12817 --
NM_016096chr841553 1523 545 372 1679 1635 --
NM_016097chr18--1410 --1781
NM_016098chr62174 87 ------
NM_016100chr20180 ------
NM_016103chr52512 456 ------
NM_016104chr6--1159 ----
NM_016131chr241882 1581 1486 515 189 --11777
NM_016132chr1512267 ------
NM_016133chr211465 --1524 --
NM_016141chr3----1749 --
NM_016185chr17--2793 552 ----
NM_016203chr72958 359 --124 --
NM_016205chr4188 1409 ----
NM_016206chr346840 6111 547 385 48847 3301 3162 2330 18145 23440 2905
NM_016210chr34230 170 132 70 11504 3993 499 183 --
NM_016221chr532360 1574 1525 11468 ----
NM_016231chr171559 1425 ----
NM_016235chr1611371 ------
NM_016250chr141149 1227 1200 --
NM_016252chr21124 ------
NM_016258chr1149 --1592 --
NM_016260chr236067 744 526 35680 4934 2431 12918 36550 6498 1753
NM_016261chr172777 29 1569 ----
NM_016262chr62541 196 ------
NM_016269chr441128 900 842 154 ------
NM_016270chr19----1331 --
NM_016272chr2272567 1933 1761 742 692 535 162 11818 ----
NM_016277chr641574 1127 194 104 21137 461 ----
NM_016281chr123991 451 443 ------
NM_016287chr11668 2237 137 ----
NM_016289chr222335 2295 12238 ----
NM_016297chr223076 991 --11001 --
NM_016308chr121614 401 11729 ----
NM_016312chr121475 1134 ----
NM_016315chr221488 1426 2653 372 ----
NM_016322chr931963 1053 391 12898 ----
NM_016338chr521030 391 ------
NM_016352chr721309 1169 --11067 11135
NM_016357chr12--1904 --127
NM_016376chr1764225 2673 1159 1128 1082 1042 33426 3180 2965 1621 23453 509
NM_016396chr1522498 1198 --22895 380 --
NM_016424chr1721928 1264 ------
NM_016441chr21911 1638 --157
NM_016472chr142452 266 ------
NM_016485chr611984 21515 242 11952 --
NM_016526chr1152387 2339 2321 1650 641 --12315 11729
NM_016529chr1321134 127 ------
NM_016530chr1533901 3813 1428 ------
NM_016531chr43917 420 175 ------
NM_016544chr233805 3721 2406 155 1640 --
NM_016545chr11720 ------
NM_016557chr311022 2947 808 ----
NM_016577chr373923 3502 3166 2736 654 527 72 23339 713 24540 1413 --
NM_016589chr3--1202 ----
NM_016605chr542193 978 490 465 --22015 246 --
NM_016613chr42468 229 1897 ----
NM_016631chr21--1141 ----
NM_016649chr20--143 ----
NM_016654chr151322 21323 1276 ----
NM_016655chr15197 ------
NM_016656chrX3398 121 44 ------
NM_016824chr101775 ------
NM_016831chr131878 1810 923 1262 ----
NM_016836chr2--1192 1613 --
NM_016839chr2--1192 1613 --
NM_016929chr664339 3867 3258 1367 689 53 11382 14499 --
NM_016946chr173228 2938 2708 559 94 68 39 ----1683
NM_016952chr1124050 87 44044 3616 3507 3386 13935 23667 185
NM_016953chr275944 5377 4281 952 934 466 233 35208 597 431 ----
NM_016954chrX1148 1639 ----
NM_017409chr122787 91 --1542 --
NM_017415chr594168 3590 3477 2884 1331 937 467 350 192 31796 1490 1473 23948 214 11779
NM_017420chr1433610 3258 2832 23186 2843 ----
NM_017423chr4--1211 ----
NM_017437chr1441727 893 333 215 ------
NM_017440chr12193 ------
NM_017447chr2131680 1117 28 ----33215 1403 1280
NM_017455chr151133 ----1350
NM_017514chrX7858 817 793 614 251 185 98 ----1685
NM_017548chr36549 542 522 436 166 130 11868 ----
NM_017551chr1072422 2213 2178 2108 1847 1750 580 11839 --12115
NM_017580chr1032008 1973 1965 3732 450 54 1926 12101
NM_017593chr4--1199 ----
NM_017594chr951311 1020 582 141 131 ------
NM_017599chr1241691 829 613 324 ------
NM_017610chr153750 548 486 1295 ----
NM_017628chr454820 4424 3809 1497 1198 2507 437 13956 --
NM_017629chr111950 ----11408
NM_017632chr4------1298
NM_017633chr642630 2518 1485 946 ------
NM_017634chr831917 1473 551 ------
NM_017637chr9119181 8489 7871 7513 7450 6571 6512 6306 6195 6052 655 59213 8274 7520 5753 876 26962 1318 16060
NM_017643chr1722218 693 ------
NM_017644chr354359 4081 977 782 699 11757 24950 4488 --
NM_017646chr1--1263 ----
NM_017650chr754910 4676 264 115 62 45546 5467 2348 1388 1677 --
NM_017657chr21880 --178 1184
NM_017658chr1444350 3464 642 364 ----14300
NM_017660chr1932590 604 597 33307 3221 1107 22323 868 --
NM_017662chr931511 1282 36 ------
NM_017667chr71423 ------
NM_017680chr92981 806 ------
NM_017686chr14986 975 856 349 ------
NM_017694chr241909 1901 1406 407 12070 ----
NM_017697chr82340 168 ------
NM_017709chr183776 3619 3506 3371 2925 2620 1654 909 13251 ----
NM_017719chr342222 2020 1632 396 1551 --12202
NM_017724chr3142 1667 ----
NM_017730chr31240 ----1614
NM_017736chr1653213 2280 2052 151 44 22306 72 12039 --
NM_017737chr11198 ----1880
NM_017747chr51368 ------
NM_017748chr17160 1876 ----
NM_017752chrX11732 1678 ----
NM_017754chr694885 4516 4502 3461 3217 3141 1193 1121 225 13177 ----
NM_017769chr1422752 2081 ------
NM_017772chr61404 ------
NM_017776chrX2324 81 11149 ----
NM_017778chr821495 1230 ------
NM_017780chr82207 53 ----1801
NM_017787chr1062603 2511 2210 2175 449 252 22518 729 32893 923 352 --
NM_017791chr1421321 601 11239 1404 --
NM_017798chr2011088 1268 11258 --
NM_017799chr1411713 21863 1378 ----
NM_017801chr32520 61 ----1561
NM_017811chr942453 2233 572 31 ----12126
NM_017842chr121678 --156 --
NM_017845chr42164 25 1569 ----
NM_017848chrX54333 350 337 236 128 43688 1534 1248 99 ----
NM_017849chr252745 2654 2502 552 394 22954 2798 --11219
NM_017857chr112663 28 --1196 --
NM_017887chr1254 27 1553 ----
NM_017896chr2052675 1343 851 498 37 1743 ----
NM_017913chr91383 ------
NM_017919chr994981 4790 4678 4589 3935 1401 730 371 199 55684 4935 4087 1920 358 13944 --
NM_017933chr21364 11331 --11388
NM_017938chrX42063 434 404 219 2623 422 ----
NM_017943chr14185 3872 270 152 ----
NM_017958chr232890 1207 616 13069 ----
NM_017964chr2--198 ----
NM_017966chr1161445 981 613 606 557 30 --11005 --
NM_017969chr2134 ------
NM_017987chr104856 533 264 88 ----1282
NM_017994chr752032 1994 863 550 209 ------
NM_018004chr32308 109 ------
NM_018013chr652473 2411 2178 1886 937 1809 ----
NM_018014chr221067 281 1865 ----
NM_018015chrX2991 341 1441 --1116
NM_018028chr1921124 991 --1879 --
NM_018036chr1454356 4346 4062 3370 1643 34091 1354 230 23324 917 --
NM_018048chr1252061 1834 1804 1392 307 --1243 1558
NM_018056chr11175 ------
NM_018063chr101162 ------
NM_018078chr41215 1328 --1821
NM_018084chr232399 2141 533 22335 2047 --12965
NM_018085chr188159 7455 7251 7178 6995 6432 1102 467 36536 836 218 37378 3064 2527 12431
NM_018086chr21580 ------
NM_018096chr176791 769 721 401 313 298 ----1981
NM_018099chr121234 149 ----
NM_018107chr141146 ------
NM_018121chr1043173 1232 689 655 12037 ----
NM_018133chr321951 1835 12199 ----
NM_018155chr363072 2823 2320 1120 462 327 ------
NM_018157chr1251069 822 685 323 287 32969 578 78 --12816
NM_018171chr124851 733 650 52 ------
NM_018178chr141837 1804 1353 613 11768 ----
NM_018179chr121606 ----1637
NM_018181chr1811948 21932 1288 21739 530 --
NM_018182chr1752156 1514 767 387 215 11845 21586 357 --
NM_018184chr321823 159 195 --11499
NM_018195chr1161964 1935 1757 1570 1436 1428 ----11681
NM_018199chr1421190 385 11229 ----
NM_018206chr161171 2524 488 ----
NM_018207chr151662 1437 499 431 56 21319 173 1340 --
NM_018211chr141827 505 360 28 1412 167 --
NM_018221chr22424 186 ------
NM_018225chr945323 3821 1683 1548 35312 5236 829 ----
NM_018227chr422902 550 1802 2816 117 --
NM_018243chr443544 3130 2886 1503 1448 1478 13784
NM_018247chr672910 2464 2027 1130 1094 992 50 ------
NM_018254chr12696 402 11772 11497 21716 1560
NM_018263chr242283 2117 2109 719 12479 2737 626 12408
NM_018290chr4----1297 --
NM_018293chr33968 328 89 --198 --
NM_018299chr842501 918 536 38 33423 2350 1107 ----
NM_018302chr442198 649 343 111 22089 1897 ----
NM_018312chr1131566 1485 491 ------
NM_018313chr341891 798 623 464 22041 1925 12083 --
NM_018319chr1421252 179 21112 90 --11137
NM_018323chr4--1510 21398 467 1738
NM_018340chr1674058 3790 3465 3190 3162 273 155 34733 1171 395 1943 1712
NM_018348chr16170 1237 ----
NM_018351chr12114358 4240 3826 3806 3752 1827 1673 1656 1436 1216 1039 11641 23938 3329 --
NM_018358chr31113 ------
NM_018362chr1122450 227 ------
NM_018364chr143927 3075 2764 333 43744 2956 1446 824 11148 --
NM_018367chr1111021 172 11643 --
NM_018368chr61259 ------
NM_018370chr1251723 612 192 146 90 --12159 --
NM_018373chr1476274 5944 5116 4025 2201 1050 679 11125 11023 --
NM_018374chr794857 3632 3467 1625 1530 1422 1062 643 76 44436 4400 4283 90 ----
NM_018383chr262022 1909 1338 737 193 22 --1433 1104
NM_018403chr353821 3558 855 819 627 23929 3576 13284 1573
NM_018424chr931911 1353 404 21218 505 ----
NM_018429chr522024 1847 12513 1971 --
NM_018433chr2--1206 ----
NM_018440chr877289 6897 6683 2329 1943 1021 132 57135 6963 6919 2367 1321 25941 877 --
NM_018444chr842240 1970 1782 619 ------
NM_018445chr154583 122 66 46 ------
NM_018448chr12--11255 ----
NM_018462chr31605 2354 95 ----
NM_018465chr9------1189
NM_018482chr842159 670 368 210 ------
NM_018489chr122392 234 2864 475 ----
NM_018490chr1121745 439 11480 ----
NM_018534chr23626 233 134 ------
NM_018557chr221065 542 ------
NM_018566chr144834 1257 1090 728 53831 3446 3256 1345 84 23713 3333 23886 1817
NM_018571chr2125 1628 ----
NM_018640chr1242664 2086 1974 1966 12541 22579 2386 --
NM_018650chr121607 121 ------
NM_018657chr3----1269 --
NM_018660chr8135 1216 12630 --
NM_018667chr1642557 2172 1994 1809 22763 2004 12475 --
NM_018684chrX31234 509 420 ------
NM_018686chr121136 ------
NM_018698chrX2203 172 1672 ----
NM_018710chr82342 86 ------
NM_018715chr162035 1943 1570 1541 212 135 ------
NM_018718chr772138 1805 735 568 490 225 54 ------
NM_018841chr143828 3348 2636 902 2634 383 ----
NM_018845chr11524 ----1549
NM_018846chr72341 165 2926 37 ----
NM_018847chr911823 ----1350
NM_018890chr71266 ----1242
NM_018896chr17150 ------
NM_018898chr51320 21902 645 ----
NM_018899chr51320 21902 645 ----
NM_018900chr51320 21902 645 ----
NM_018901chr51320 21902 645 ----
NM_018902chr51320 21902 645 ----
NM_018903chr51320 21902 645 ----
NM_018904chr51320 21902 645 ----
NM_018905chr51320 21902 645 ----
NM_018906chr51320 21902 645 ----
NM_018907chr51320 21902 645 ----
NM_018908chr51320 21902 645 ----
NM_018909chr51320 21902 645 ----
NM_018910chr51320 21902 645 ----
NM_018911chr51320 21902 645 ----
NM_018945chr633337 1481 350 --1966 --
NM_018951chr721192 100 --1266 --
NM_018958chr1544046 3724 2985 696 13362 12561 12862
NM_018963chr2111525 ----183
NM_018970chr711100 --1236 1824
NM_018999chr1084791 3216 3099 3057 3050 1065 687 192 1709 ----
NM_019001chr334868 3515 315 ------
NM_019004chr72364 288 ----123
NM_019008chr2263674 3558 1062 1041 934 41 12981 13700 --
NM_019027chr432040 736 641 12306 --1744
NM_019040chr112206 45 ------
NM_019041chr662108 863 737 616 345 280 21028 418 21743 352 --
NM_019050chr41666 ------
NM_019055chr112526 432 ------
NM_019067chrX64799 4249 1952 1812 1800 1561 23430 86 ----
NM_019071chr7--1769 ----
NM_019072chr532832 783 378 --21439 906 --
NM_019084chr101674 11672 ----
NM_019087chr521678 1488 11091 ----
NM_019091chr23946 201 28 1832 ----
NM_019094chr1233530 1459 663 13493 22439 227 --
NM_019106chr2252843 2541 2459 2432 1374 12600 11013 --
NM_019114chr952550 1863 895 863 182 21661 883 ----
NM_019555chr31152 21208 657 --11809
NM_019557chr12661 180 --1654 1315
NM_019595chr22607 219 ------
NM_019596chr2132651 1955 370 1255 1326 --
NM_019600chr152706 303 --1190 --
NM_019605chr11682 ------
NM_019610chr121358 744 41929 1903 821 285 ----
NM_019613chr1741056 926 476 151 ------
NM_019891chr111026 ----11169
NM_019903chr101775 ------
NM_020039chr1271830 1727 622 591 432 280 86 --21260 475 --
NM_020122chr295847 5699 4605 1902 637 616 363 300 259 15395 --1748
NM_020132chr2195078 3651 3641 3340 1133 708 647 638 588 1317 133 --
NM_020144chr711630 31369 673 477 ----
NM_020150chr1042246 2193 551 379 --11769 --
NM_020154chr151238 ------
NM_020156chr7--1593 --1384
NM_020159chr431686 1330 395 ------
NM_020177chr542930 2447 753 484 --1428 --
NM_020198chr17--41536 1003 423 91 ----
NM_020205chr183432 2910 2810 2489 2361 1362 1167 1109 22462 2321 ----
NM_020228chr1141978 1759 1639 298 11997 ----
NM_020232chr181205 ------
NM_020240chr531886 971 298 ------
NM_020337chr462456 2355 788 732 277 136 32574 2034 908 11993 --
NM_020338chr1073592 3223 2911 2648 1080 754 610 --12923 --
NM_020340chr63863 394 133 1591 ----
NM_020341chr201657 --11525 11775
NM_020346chr1131744 1617 1557 ----11450
NM_020354chr10----1769 --
NM_020357chr331392 634 412 ------
NM_020362chr12836 732 ------
NM_020382chr1241224 1117 473 204 ------
NM_020390chr344857 3398 1675 1667 64344 3914 1717 1332 1288 484 ----
NM_020404chr111206 ------
NM_020420chrY21710 1416 11401 ----
NM_020423chr12384 185 1597 ----
NM_020432chr71364 11447 ----
NM_020440chr162896 2639 1261 1092 690 111 13190 1744 --
NM_020443chr1116225 4943 4575 4489 2421 2228 1989 1636 782 386 246 34831 364 224 12308 --
NM_020449chrX--1119 ----
NM_020457chr162197 185 ------
NM_020466chr644497 1408 1224 601 34964 3335 577 1154 --
NM_020474chr18--22034 1303 ----
NM_020475chr841883 1754 560 455 ------
NM_020476chr841883 1754 560 455 ------
NM_020477chr841883 1754 560 455 ------
NM_020478chr841946 1817 623 518 164 11551 --
NM_020480chr841883 1754 560 455 ------
NM_020546chr562716 2401 2261 2010 207 107 32867 2581 2325 ----
NM_020640chr321491 726 ----1215
NM_020644chr111775 1709 ----
NM_020647chr83871 416 340 11506 12326 --
NM_020654chr3135 11604 ----
NM_020661chr1241593 788 723 503 2337 280 ----
NM_020673chr2057263 7240 6302 6255 1804 46489 5506 1960 543 ----
NM_020690chr52257 221 1264 ----
NM_020699chr1115070 4772 4253 3884 3804 3422 3347 2040 1861 989 169 25144 1517 23590 698 --
NM_020711chr252502 2127 1940 1699 82 22095 157 ----
NM_020714chr1944534 4308 3324 1044 --23286 120 --
NM_020718chr1684991 4332 1870 996 766 473 313 187 14544 --1459
NM_020724chr452625 2519 1779 1071 770 2578 277 --1672
NM_020734chr1233271 2605 835 11266 ----
NM_020739chr1553176 3058 1430 708 284 ------
NM_020742chrX32599 449 35 --12687 --
NM_020747chr5----195 1941
NM_020748chr1721820 1614 176 21893 367 --
NM_020752chr102906 316 12838 1282 --
NM_020755chr62328 264 11675 ----
NM_020766chrX63521 3217 3078 2898 2892 1460 22849 121 13728 1955
NM_020768chr542688 2350 2024 163 52962 2730 2193 926 58 ----
NM_020771chr61360 ----11310
NM_020772chr17117038 5867 5263 2717 2271 1947 1719 1563 1265 1104 526 23285 1571 --38148 6130 5927
NM_020773chr472285 2061 1972 966 946 743 120 11931 1189 1139
NM_020774chr1846181 1975 1052 901 32034 1986 1416 ----
NM_020786chr161530 31455 618 66 1791 --
NM_020794chr11585 1152 ----
NM_020796chr532932 1034 728 22714 2439 ----
NM_020805chr1811416 11612 ----
NM_020806chr141652 ------
NM_020808chr11456 1923 ----
NM_020809chr1131724 1606 1543 1509 ----
NM_020810chr1443239 2452 1235 116 13473 ----
NM_020830chr263213 2693 2647 2350 2074 1099 22877 218 ----
NM_020841chr1243987 3912 1534 743 1642 11387 --
NM_020850chr16113261 3041 2936 2738 2671 2620 2407 1194 738 730 60 1950 11245 --
NM_020854chr181124 21061 1006 ----
NM_020858chr1511516 177 ----
NM_020859chr463325 3154 3079 1206 1044 593 --13660 1432
NM_020860chr41847 ------
NM_020871chrX31688 116 104 1771 ----
NM_020872chr311679 --1184 --
NM_020886chr1111030 11126 ----
NM_020888chr141684 1644 1318 246 --2306 124 12016
NM_020899chr1752460 2021 750 418 352 21665 46 ----
NM_020914chr1752550 2453 2390 2185 2108 1442 21686 557 --
NM_020921chr1433670 3020 950 12332 ----
NM_020925chr11362 ----1504
NM_020927chr1621499 375 ----12253
NM_020935chr264355 3817 1749 1060 878 767 23099 1141 11733 1336
NM_020943chr22171 33 ------
NM_020947chr1631968 955 316 --11542 12301
NM_020952chr9------146
NM_020962chr156953 835 663 554 364 123 11651 12303 11940
NM_020987chr101416 --11362 --
NM_021007chr211818 ------
NM_021012chr1793092 2993 2154 2104 2098 2080 1246 1027 99 --12815 --
NM_021032chr331828 1662 1467 11637 1679 --
NM_021033chr1322383 832 --33384 2598 1216 12646
NM_021035chr203929 862 60 ----11053
NM_021038chr322267 1305 11142 13392 --
NM_021069chr421580 95 11655 1232 --
NM_021072chr511633 11805 ----
NM_021090chr2244151 1518 1481 518 33225 1944 905 43815 3535 3314 860 11278
NM_021097chr21269 ------
NM_021116chr7178978 8314 7464 7450 7251 7000 3440 2710 2533 2348 2323 2158 1710 1402 720 486 439 67528 5586 5539 5486 3508 810 26969 5818 --
NM_021136chr141685 1134 ----
NM_021145chr71123 1345 ----
NM_021159chr43276 150 35 11496 ----
NM_021183chrX--1193 11565 1426
NM_021190chr1------1309
NM_021202chr2072874 2404 1046 947 489 360 164 12799 --22463 872
NM_021205chr122820 301 ------
NM_021224chr91419 ------
NM_021239chr1441458 566 157 142 1589 ----
NM_021253chr631013 904 205 1250 --1912
NM_021622chr1032258 2141 950 ----1541
NM_021627chr3--2842 759 --1422
NM_021629chr344740 3931 3894 3578 31516 1215 781 --14986
NM_021638chr474055 3944 3445 3159 3040 834 334 45001 4127 3531 1343 ----
NM_021647chr434162 279 88 31588 1067 538 23815 3709 13272
NM_021648chr662658 2499 2188 2114 1737 954 --22631 1949 --
NM_021728chr142899 157 ------
NM_021785chrX1136 ------
NM_021813chr675339 5328 5089 4394 1512 1157 1099 21362 516 15096 --
NM_021814chr61271 1152 --1420
NM_021911chr535353 5053 1792 11699 --14820
NM_021912chr1563943 3126 1448 928 857 740 33385 3258 3176 ----
NM_021913chr1971349 1218 1129 711 362 112 94 ------
NM_021914chr1412071 21680 536 --1777
NM_021931chr201315 ----1806
NM_021940chr61350 --1304 --
NM_021942chr42845 191 ------
NM_021943chr631710 1410 55 --21674 318 --
NM_021946chrX2342 128 ------
NM_021954chr1363719 3410 2667 1177 448 386 23346 2925 1910 --
NM_021958chr1------1322
NM_021959chr61307 --1405 143
NM_021960chr152773 2215 2111 494 105 11888 ----
NM_021961chr11156282 6274 5292 4708 4661 2784 2200 2124 1996 1818 1552 747 689 324 119 27355 5843 2641 616 --
NM_021964chr3106483 6469 6362 5302 4048 1767 1644 485 306 190 25220 2061 ----
NM_021965chr941394 542 390 182 ------
NM_021967chr541267 1255 997 42 ------
NM_021973chr41676 1590 ----
NM_021984chrX21187 1030 21062 307 ----
NM_021987chrX21187 1030 21062 307 ----
NM_021990chrX21187 1030 21062 307 ----
NM_021999chr13--1163 ----
NM_022048chr1564771 4363 2274 1609 1412 30 13881 45665 4243 4028 1634 --
NM_022051chr11274 ----1492
NM_022064chr3162 --1163 --
NM_022068chr181605 ------
NM_022085chr631145 1103 196 --11215 11424
NM_022114chr1124678 4132 4081 3665 3488 3470 3324 1465 1404 1389 1109 776 1177 ----
NM_022118chr131430 ------
NM_022130chr531436 1142 1065 ------
NM_022132chr5--1137 --163
NM_022138chr631309 343 309 11472 ----
NM_022140chr522209 1538 --11587 --
NM_022143chr7--2627 334 ----
NM_022166chr16116187 5797 5227 5102 5016 4157 2140 667 568 298 259 11359 25131 1490 --
NM_022371chr11159 ----1277
NM_022373chr72901 209 ------
NM_022444chr7------176
NM_022455chr5--185 ----
NM_022456chr1267648 7286 6410 6381 5198 1081 56757 5592 4680 3006 2336 1129 --
NM_022458chr71642 32725 2669 545 11948 --
NM_022459chr1346156 4489 1314 80 21840 1113 1896 14977
NM_022465chr1282235 1176 803 711 690 681 499 135 --143 --
NM_022473chr1574141 4110 3456 328 305 153 133 14182 --14280
NM_022474chr141680 22299 510 12724 12246
NM_022482chr2042153 1958 753 396 ------
NM_022483chr541628 1252 1211 345 ------
NM_022484chr731435 1112 335 ----11444
NM_022488chr32160 26 ------
NM_022491chr1252647 2332 1080 499 75 23496 2667 11000 --
NM_022496chr12----192 --
NM_022497chr382664 2474 943 793 744 386 255 228 23826 1305 --11443
NM_022572chr241705 584 465 379 ------
NM_022574chr731974 1455 151 31677 1657 278 11896 --
NM_022640chr17151 --1222 1188
NM_022648chr2123838 3304 1834 1522 1411 1174 1101 1049 1037 874 393 307 32874 1852 1578 ----
NM_022652chr121810 11163 ----
NM_022716chr12476 439 --1921 --
NM_022726chr62127 120 ------
NM_022739chr17144 11021 --11083
NM_022745chr152758 2310 1835 156 120 1774 ----
NM_022748chr792657 2598 2525 2256 1949 1884 1007 270 46 12879 ----
NM_022753chr142518 1821 1126 1094 --12713 22441 1994
NM_022755chr971834 1671 964 367 324 310 253 --11913 --
NM_022763chr322352 1022 --12936 1516
NM_022768chr1--122 187 --
NM_022771chr121863 ------
NM_022776chr321317 1296 2284 52 ----
NM_022781chr912835 12672 1756 --
NM_022784chr151945 1127 ----
NM_022802chr1031408 413 334 ------
NM_022821chr11153 ------
NM_022826chr211087 --1451 --
NM_022828chr531694 1581 686 ----11225
NM_022831chr161533 1516 1495 1254 618 549 21703 1558 ----
NM_022842chr372910 2547 1036 751 743 310 70 42260 990 853 84 12487 --
NM_022845chr1641971 1773 728 375 --22193 1763 1813
NM_022893chr242978 1057 889 403 1621 ----
NM_022894chr2----1279 --
NM_022897chr531113 982 257 --1133 --
NM_022898chr1494747 4445 4326 3996 3624 3122 3108 903 161 --24372 1142 --
NM_022912chr232886 2256 1168 ----1114
NM_022970chr10----1982 --
NM_022978chr541267 1255 997 42 ------
NM_023000chr1431475 1168 1125 162 ----
NM_023001chr1431475 1168 1125 162 ----
NM_023010chrX------1571
NM_023074chr192981 535 --1974 --
NM_023076chr1652512 2259 859 279 208 22407 245 1427 --
NM_023079chr1751748 1494 1401 1234 556 --11797 --
NM_023923chr163720 3442 3330 1162 374 365 1324 21468 380 22562 409
NM_023929chr83916 292 144 1309 1796 --
NM_023943chr3--145 ----
NM_024007chr552963 2608 2256 1926 336 23009 2854 12103 2979 542
NM_024017chr1761266 544 321 300 244 30 --11682 --
NM_024019chr42100 33 ------
NM_024046chr37922 820 497 438 365 355 294 --1413 1393
NM_024052chr1742509 2162 2060 605 1255 --1393
NM_024071chr142451 426 ------
NM_024082chrX2126 98 ------
NM_024090chr41373 ------
NM_024292chr19190 ------
NM_024329chr171438 1370 1079 1064 1045 270 24 --1320 --
NM_024348chr9------1263
NM_024408chr173635 2337 1430 792 505 404 342 --12957 --
NM_024411chr203590 505 40 21203 249 ----
NM_024421chr181881 --1930 --
NM_024429chr72958 359 --124 --
NM_024509chr191156 ------
NM_024524chr323044 211 1150 1178 --
NM_024529chr12783 359 31179 1151 911 ----
NM_024539chrX----11018 --
NM_024548chr3196 21264 350 ----
NM_024551chr1262318 2043 1824 917 835 697 133 22380 720 --
NM_024551chr1262318 2043 1824 917 835 697 133 22380 720 --
NM_024556chr112445 47 ------
NM_024567chr8172 ------
NM_024569chr152651 2498 2319 1925 681 22595 2023 21982 413 --
NM_024582chr41869 ------
NM_024595chr11221 1816 ----
NM_024612chr17----1285 --
NM_024613chr81493 ------
NM_024639chr652929 2189 2090 1971 566 12103 22176 165 --
NM_024646chr153825 3804 1178 162 78 13091 ----
NM_024659chr21853 ------
NM_024665chr323132 64 33377 241 168 ----
NM_024674chr152767 2593 2058 716 567 12787 ----
NM_024680chr11--1386 ----
NM_024686chr11150 1439 ----
NM_024702chr171236 ------
NM_024704chr201332 2884 386 1205 --
NM_024713chr1531508 1265 1095 148 1554 11195
NM_024721chr852417 1984 1004 649 91 ------
NM_024725chr111171 ------
NM_024735chr1611876 11504 11862 --
NM_024740chr1143321 1600 1591 658 13185 --23312 242
NM_024742chr16101750 1629 1586 1331 1211 587 458 328 145 74 --4739 711 536 89 --
NM_024744chr222462 174 1451 ----
NM_024749chr132095 796 380 22303 1597 ----
NM_024755chr152350 329 ------
NM_024770chr256769 6513 6324 5764 5111 35739 1344 575 ----
NM_024814chr71159 ------
NM_024828chr911019 ----1133
NM_024834chr1011539 21471 1376 11921 --
NM_024884chr1484200 4112 4064 4007 3964 1230 914 818 44467 3406 3349 1330 --24475 1223
NM_024887chr181760 1710 1413 1348 778 423 367 30 ------
NM_024893chr202907 119 ------
NM_024920chr41243 21620 1005 ----
NM_024930chr542252 2058 484 437 1971 22692 2024 --
NM_024948chr102693 553 ----1168
NM_024953chr1242768 2449 1958 998 ------
NM_024960chr201154 ------
NM_024969chr21854 1709 ----
NM_024971chr9------146
NM_024989chr256954 6801 5667 2892 1232 37622 7591 1984 --12559
NM_024991chr1053157 3039 3013 741 350 22019 498 1635 --
NM_024993chr231482 593 75 21617 1588 11424 164
NM_025027chr19--21215 235 ----
NM_025054chr854248 3538 1468 1009 687 33153 1620 1092 ----
NM_025073chr164188 4166 3851 3597 1847 1583 24567 3653 --11367
NM_025090chr1731109 1035 191 ------
NM_025126chr121576 ------
NM_025134chr1632062 1936 487 ------
NM_025138chr132408 253 ----1338
NM_025146chr342300 2180 1984 398 42000 905 868 467 --1278
NM_025154chr711111 ------
NM_025160chr153753 3129 2611 1182 486 13516 ----
NM_025176chr202158 66 ------
NM_025179chr1114212 3783 3627 3555 3442 3255 1919 1882 983 413 113 44989 4222 924 871 ----
NM_025181chr22319 260 1133 ----
NM_025187chr1621173 418 ------
NM_025191chr152294 1365 916 485 71 12224 ----
NM_025208chr1152297 2094 1983 1582 777 21843 1776 ----
NM_025221chr431337 919 370 158 ----
NM_025224chr20101926 1768 1627 1489 906 688 655 552 460 153 22181 127 1262 --
NM_025235chr1011703 --1731 --
NM_025238chr15------11455
NM_030594chr151857 ------
NM_030621chr1433205 2606 390 --32836 2690 1000 1667
NM_030623chr231194 1082 353 ----178
NM_030625chr1032542 2007 1836 21632 871 ----
NM_030627chr533801 1507 947 12556 11457 --
NM_030647chr765398 4597 4432 4245 2373 1313 34405 4259 224 ----
NM_030648chr475377 4867 3420 2206 862 569 209 1456 22190 685 --
NM_030650chr253153 2933 2885 368 94 13215 ----
NM_030652chr62231 29 ------
NM_030664chr1052124 832 301 276 204 --21901 980 --
NM_030674chr1245287 3852 3684 1489 64691 4067 3714 2345 1393 1120 ----
NM_030751chr101291 --1650 --
NM_030751chr101291 --1650 --
NM_030758chr2231333 933 251 1960 --11237
NM_030761chr131088 928 382 22301 657 32592 1722 514 --
NM_030762chr123500 96 58 ------
NM_030766chr121122 --1157 --
NM_030786chr111798 21329 579 ----
NM_030791chr1421836 488 ------
NM_030797chr22299 191 ------
NM_030806chr1128606 8464 8338 8286 7882 7404 6343 6319 6252 5946 5738 2849 69097 9080 7352 5765 2982 300 28990 6452 12254
NM_030810chr631145 1103 196 --11215 11424
NM_030816chr142747 885 251 156 155 12513 --
NM_030820chr61867 ------
NM_030885chr331969 754 53 ------
NM_030913chr11518 1582 1287 --
NM_030918chr175277 4450 4347 3854 3519 540 88 35405 5020 3590 --2945 615
NM_030920chr152011 1778 230 145 25 12075 ----
NM_030922chr152705 635 ------
NM_030927chr1031481 1291 69 ------
NM_030938chr172395 336 ----152
NM_030952chr131066 476 205 --1138 11077
NM_030964chr573641 3311 2482 2341 1351 564 535 ------
NM_031216chr1822187 1833 12199 ----
NM_031262chr91934 ------
NM_031263chr91991 ------
NM_031266chr51173 ------
NM_031365chr242323 1106 672 252 22198 102 --22359 775
NM_031366chr242323 1106 672 252 22198 102 --22359 775
NM_031411chr51320 21902 645 ----
NM_031419chr331058 427 83 21580 542 ----
NM_031426chr942364 2145 1850 694 ----1164
NM_031427chr141872 23855 1507 24953 768 --
NM_031435chr1243299 2537 825 195 32276 1191 408 ----
NM_031442chrX62908 2366 2180 1010 856 666 1998 ----
NM_031443chr7--1366 ----
NM_031444chr2261902 1590 851 624 609 72 11827 21928 759 --
NM_031445chr242882 2384 2161 206 23317 354 ----
NM_031469chr653480 1471 1036 876 823 24121 3670 1335 --
NM_031483chr2032726 2256 2215 23138 1310 12263 --
NM_031844chr123639 1508 23924 3852 ----
NM_031849chr51320 21902 645 ----
NM_031857chr51320 21902 645 ----
NM_031860chr51320 21902 645 ----
NM_031890chr2282831 2694 2393 2342 2209 739 551 293 22910 2659 ----
NM_031911chr421963 319 --2999 286 --
NM_031934chr171332 --137 --
NM_031935chr11909 ------
NM_031990chr1941413 1344 957 501 ----1338
NM_031991chr1941413 1344 957 501 ----1338
NM_032012chr974766 4686 4409 3592 1815 1291 134 43602 1803 935 353 13562 --
NM_032021chr1141160 857 261 148 ------
NM_032042chr562186 477 393 351 269 32 --1294 1304
NM_032048chr182225 155 2607 51 ----
NM_032052chr2251088 968 924 245 177 --1171 1148
NM_032102chr1111150 1423 ----
NM_032121chrX1362 --32702 2459 163 --
NM_032128chr41942 1103 --1666
NM_032132chr12158 77 ------
NM_032139chr191255 ------
NM_032144chr211127 21589 1346 --1529
NM_032145chr641912 1392 1327 514 --1180 --
NM_032148chr121369 --2144 125 --
NM_032182chr1021448 106 --1226 --
NM_032199chr1043425 2756 1023 720 ------
NM_032217chr421372 453 ------
NM_032221chr2022016 284 21976 1856 --11968
NM_032228chr1113478 13487 43224 2850 2450 348 1250
NM_032229chr13174 ------
NM_032236chr11157 --1954 --
NM_032242chr3113048 2713 2650 2607 2294 2063 1242 909 896 848 834 ------
NM_032246chr151271 ------
NM_032266chr21171 --133 --
NM_032268chr1683070 2753 2455 2414 2095 1210 582 162 ----12253
NM_032287chr2284187 3162 3086 1251 1155 1029 527 169 12581 --12833
NM_032288chr321465 955 --1614 1177
NM_032289chr531861 1307 275 1678 ----
NM_032315chr1122 ------
NM_032320chr112672 665 ------
NM_032321chr232907 2797 277 22775 2111 1583 --
NM_032324chr1165 --1172 --
NM_032352chr14--1138 ----
NM_032370chr19141 --1134 --
NM_032373chr1031888 902 791 55769 4345 3875 1281 140 12312 --
NM_032408chr7----1511 --
NM_032427chr11----1414 --
NM_032440chr101796 12667 --12334
NM_032445chr1562188 2171 1732 628 224 33 --1832 --
NM_032446chr523070 385 2993 583 13645 --
NM_032449chr172180 2131 2084 847 815 597 481 12164 11073 12252
NM_032457chr443497 3344 1375 377 1532 --1649
NM_032458chrX62881 2658 2524 2488 1345 1155 ------
NM_032471chr61842 --1111 --
NM_032482chr1952495 2216 782 564 309 22429 1017 1577 --
NM_032486chr161603 --2159 38 --
NM_032490chr142611 256 2791 526 2680 82 --
NM_032491chr122136 120 ------
NM_032505chr332365 2287 432 ------
NM_032509chr811697 42546 1961 1898 653 --12238
NM_032511chr62341 143 ------
NM_032523chr21171 1216 1556 --
NM_032558chr911478 --1972 --
NM_032575chr1671565 1493 1401 826 765 487 95 --41736 1701 1606 1307 --
NM_032582chr1711236 ----1122
NM_032595chr1741078 620 614 182 11370 11228 --
NM_032622chr411058 1590 --1267
NM_032632chr14--1565 ----
NM_032682chr323306 2578 23093 811 --11284
NM_032711chr17114192 4181 3990 3930 3815 3084 3056 2802 1686 662 66 13852 23263 517 --
NM_032717chr4----1941 1783
NM_032777chr821456 588 ------
NM_032784chr6170 ------
NM_032788chr22472 306 21464 83 11104 --
NM_032800chr132542 2057 1878 134 1979 --
NM_032801chr1162273 1868 469 338 257 160 12298 ----
NM_032804chr10275 42 2842 281 ----
NM_032810chr101264 11310 11075 --
NM_032812chr10----1107 --
NM_032842chr71295 ------
NM_032859chr1311519 22600 431 ----
NM_032867chr11----2653 605 --
NM_032869chr8--21834 1653 11442 --
NM_032873chr1143949 3583 652 89 31546 871 247 1345 1498
NM_032900chr1063786 3779 3465 3351 212 154 13374 1505 --
NM_032905chr1021091 494 142 ----
NM_032918chr122220 137 ------
NM_032924chr74856 170 56 35 1807 ----
NM_032926chrX3161 95 51 ------
NM_032949chr132103 52 ------
NM_032973chrY23507 2644 --1734 13800
NM_033020chr134470 2939 1499 14614 --11719
NM_033030chr221223 1174 11107 ----
NM_033044chr121132 132 1357 ----
NM_033055chr11326 2948 909 --1893
NM_033083chr342857 2318 1117 295 22388 815 13208 --
NM_033103chr192488 387 ----258 31
NM_033117chr9----1245 --
NM_033121chr1221741 664 11835 176 1672
NM_033122chr4----157 --
NM_033129chr2071981 1773 1619 823 633 611 492 --1501 --
NM_033132chr135916 740 513 127 60 11956 ----
NM_033133chr1763215 3117 1300 982 297 183 129 22708 707 --
NM_033135chr1152297 2094 1983 1582 777 21843 1776 ----
NM_033136chr531622 1254 612 11354 --11291
NM_033137chr531622 1254 612 11354 --11291
NM_033143chr434331 4104 251 21488 1063 --1102
NM_033181chr673260 3154 3021 2908 1281 743 603 13295 12817 --
NM_033211chr532091 1922 1482 ------
NM_033215chrX1416 ------
NM_033221chr942431 2167 2009 763 3781 395 375 --22419 1868
NM_033224chr766166 5719 5446 5022 2894 914 66233 5760 4907 2230 2073 922 ----
NM_033253chr21603 1105 --1590
NM_033260chr61636 ----1132
NM_033274chr573195 2928 2905 2491 1055 827 520 33120 2878 75 ----
NM_033290chrX1698 22993 2825 33751 2607 1040 --
NM_033306chr11134 ------
NM_033331chr983497 3237 3108 2732 2422 1308 1081 99 ----22447 2437
NM_033360chr1284637 3633 2883 1129 820 632 615 300 23959 258 13721 13495
NM_033364chr321359 219 1137 11323 --
NM_033389chr1774755 4333 4313 4227 4129 3722 1655 21424 1162 --14446
NM_033407chr11664 ------
NM_033425chr11--23008 2574 --1283
NM_033428chr911697 21847 1485 ----
NM_033495chrX175 ------
NM_033505chr296442 5723 4648 2530 1990 1057 796 252 175 45533 5440 631 525 ----
NM_033512chr822674 2066 ------
NM_033515chr611256 1343 --1140
NM_033542chr2061968 1857 1452 808 589 43 ------
NM_033551chr5103153 2991 2750 2270 2202 1398 920 436 388 348 12350 ----
NM_033624chr1232178 2118 1457 1476 ----
NM_033631chr153512 2375 1479 846 484 1564 ----
NM_033637chr1033813 3338 2950 ------
NM_033656chr2195035 4529 4273 4150 2388 2353 1274 1081 879 45488 5395 5211 4432 21491 1376 --
NM_052832chr812778 12523 1721 --
NM_052845chr1273213 3035 2824 2581 2366 2265 198 --12775 --
NM_052867chr1321005 932 --1320 --
NM_052876chr1962338 2304 2011 1912 270 144 11981 22406 351 1683
NM_052879chr1223523 173 23785 3105 13298 --
NM_052885chr1263120 1733 1115 921 313 77 13224 14605 21782 1577
NM_052886chr832166 348 131 1375 ----
NM_052900chr811480 ------
NM_052901chr931366 1320 611 1124 11106 --
NM_052906chr2274866 4536 4495 4046 3995 3293 650 1228 14359 --
NM_052913chr621064 312 ------
NM_052917chr283384 3358 3329 2611 2572 1273 739 360 13175 --13102
NM_052918chr1073183 2503 1419 1098 641 541 406 43551 3515 3152 1109 ----
NM_052932chr113617 257 45 --21825 1534 --
NM_052936chrX--1658 ----
NM_052978chr141280 ------
NM_052996chr1651526 1325 410 327 134 11695 ----
NM_053016chr957428 6170 5497 545 471 45306 2361 1951 222 25060 311 --
NM_053024chr321099 370 ------
NM_053025chr331353 429 207 156 ----
NM_053026chr331353 429 207 156 ----
NM_053027chr331353 429 207 156 ----
NM_053028chr331353 429 207 156 ----
NM_053031chr331353 429 207 156 ----
NM_053032chr331353 429 207 156 ----
NM_053035chr71241 199 ----
NM_053043chr785914 4503 3896 2237 2217 1717 1162 955 --36064 5224 1903 12320
NM_053064chr1432886 910 673 21102 824 12500 --
NM_054111chr62806 107 --1209 --
NM_057164chr23645 563 526 --1594 --
NM_057165chr23645 563 526 --1594 --
NM_057166chr23645 563 526 --1594 --
NM_057167chr23645 563 526 --1594 --
NM_057175chr452452 2153 1940 1838 1035 22292 1674 184 --
NM_057178chr1752367 2196 857 147 29 21796 314 ----
NM_057749chr81852 1372 1107 --
NM_058170chr131568 1392 297 11042 11115 --
NM_058172chr441720 556 541 503 ------
NM_058179chr91192 ----1999
NM_058191chr212796 683 130 --1698
NM_058240chr1471417 1131 1124 283 148 95 47 ------
NM_058241chr231608 774 643 1631 11747 --
NM_058241chr231608 774 643 1631 11747 --
NM_058243chr192280 180 ------
NM_078483chr553548 3067 1326 1123 590 12930 ----
NM_078485chr61144 ------
NM_080391chr11134 --1577 --
NM_080392chr11183 --1626 --
NM_080415chr175933 839 642 603 65 ----1247
NM_080416chr171110 ------
NM_080425chr20----133 --
NM_080426chr20----133 --
NM_080491chr1133525 3094 1499 1150 --22437 2424
NM_080604chr61623 ------
NM_080617chr202746 210 1370 1966 --
NM_080629chr12541 460 1444 ----
NM_080630chr12541 460 1444 ----
NM_080632chrX------1571
NM_080645chr642164 1897 1336 490 11780 --11951
NM_080664chr1462029 1914 1859 1613 205 76 ------
NM_080669chr17114852 3893 3618 3444 3259 1577 1557 1217 1107 1003 437 --1728 --
NM_080676chr2073015 3009 2593 2073 682 654 130 11102 ----
NM_080678chr23479 242 50 ----1142
NM_080683chr4142 1593 ----
NM_080684chr4142 1593 ----
NM_080685chr4142 1593 ----
NM_080717chr1241552 1408 366 333 1550 ----
NM_080738chr13656 266 252 ------
NM_080743chr621582 561 11044 ----
NM_080759chr1342670 2399 1052 541 12352 ----
NM_080760chr1342670 2399 1052 541 12352 ----
NM_080832chrX2721 31 ------
NM_080867chr1445032 3348 291 266 21918 620 --24402 125
NM_080868chr1127 ------
NM_080872chr853164 2880 2788 1262 209 21219 1165 --11114
NM_080927chr332912 1203 740 13009 ----
NM_130385chr1152895 439 279 205 27 23036 2543 12969 --
NM_130387chr321238 103 11248 ----
NM_130391chr943467 3034 2290 1129 12533 13276 --
NM_130392chr943467 3034 2290 1129 12533 13276 --
NM_130393chr943467 3034 2290 1129 12533 13276 --
NM_130435chr1052339 2081 1137 407 97 31870 1067 428 --1128
NM_130436chr213917 837 747 1497 11753 --
NM_130438chr2111324 11074 12330 --
NM_130439chr1011499 12245 --1407
NM_130439chr1011499 12245 --1407
NM_130440chr111327 ------
NM_130466chr1231621 1405 710 1113 --11837
NM_130809chr522355 2203 22670 77 1944 --
NM_130811chr20----1230 --
NM_130838chr1511155 ------
NM_130839chr1511155 ------
NM_130847chr1144949 4650 2087 662 45910 4694 4283 1680 15840 --
NM_133170chr20158123 8106 8050 6380 5592 5470 5190 3233 2939 2378 2253 1530 981 543 136 46164 3157 1164 1027 ----
NM_133264chr1793778 3622 3335 3289 3093 3058 2694 247 97 177 1922 31347 966 127
NM_133265chrX23575 1327 1204 --1231
NM_133326chr1--1326 ----
NM_133338chr51389 ------
NM_133339chr51389 ------
NM_133340chr51389 ------
NM_133341chr51389 ------
NM_133342chr51389 ------
NM_133343chr51389 ------
NM_133344chr51389 ------
NM_133369chr53928 754 137 ------
NM_133372chr522382 2164 22257 713 ----
NM_133443chr161874 31809 1588 768 11760 --
NM_133445chr973318 2476 2423 2375 1143 1050 869 ------
NM_133468chr721984 235 --21911 529 --
NM_133625chr321317 291 11255 1456 --
NM_133631chr331250 1081 189 11242 ----
NM_133645chr61586 ------
NM_133646chr275391 5010 4160 3610 2117 867 399 24281 2180 ----
NM_134265chr17--1914 1931 --
NM_134325chr151418 1395 1260 676 550 ------
NM_134442chr21368 1525 ----
NM_138270chrX12721 2299 111 1661 1613
NM_138292chr1123489 1364 12222 --12438
NM_138328chr1753033 1139 1109 628 382 --22068 839 13257
NM_138333chr931986 1757 306 31864 765 131 11997 --
NM_138338chr22103428 3191 3065 2755 2593 2436 1365 1259 1026 170 ----11292
NM_138340chr182434 229 1246 ----
NM_138373chr1941651 689 252 161 11584 1553 --
NM_138423chr1532000 1936 401 11532 12240 12274
NM_138426chr731948 364 312 ------
NM_138437chrX132 --151 --
NM_138468chr276223 6072 5447 4856 4258 876 647 1744 ----
NM_138473chr12155032 4766 4384 4211 4155 3992 3623 3585 1973 1800 1395 1363 709 530 44 1345 34378 4110 1171 --
NM_138479chr11261 52020 1953 838 721 629 ----
NM_138558chr13848 243 131 ----11218
NM_138559chr221057 271 1855 ----
NM_138576chr1494747 4445 4326 3996 3624 3122 3108 903 161 --24372 1142 --
NM_138609chr52540 409 ------
NM_138610chr52540 409 ------
NM_138619chr1771537 1486 637 554 438 257 129 2357 186 290 50 --
NM_138621chr233297 2827 471 13836 ----
NM_138638chr1412071 21680 536 --1777
NM_138713chr1697377 7294 6897 6798 5869 1241 1157 1085 214 33162 2682 297 ----
NM_138714chr1697377 7294 6897 6798 5869 1241 1157 1085 214 33162 2682 297 ----
NM_138731chr1442975 2709 1607 1507 12610 186 11517
NM_138735chr241520 1392 627 223 21411 1167 ----
NM_138771chr741243 1160 150 111 1225 ----
NM_138774chr19----1583 --
NM_138775chr111601 ------
NM_138782chr512272 ------
NM_138795chr171457 1113 1019 270 250 206 86 ------
NM_138799chr241708 1402 276 202 2417 403 --21483 387
NM_138927chr21--11008 140 --
NM_138959chr1126067 5258 5125 2546 1364 1309 1025 737 683 629 526 306 25380 186 12494 --
NM_138967chr1582510 2220 2171 2127 1656 789 782 602 ------
NM_138970chr141252 21497 190 ----
NM_138971chr1183393 1457 1232 1137 955 940 932 670 32835 2645 1098 33533 3207 1321 1291
NM_138971chr1183393 1457 1232 1137 955 940 932 670 32835 2645 1098 33533 3207 1321 1291
NM_138972chr1183393 1457 1232 1137 955 940 932 670 32835 2645 1098 33533 3207 1321 1291
NM_138972chr1183393 1457 1232 1137 955 940 932 670 32835 2645 1098 33533 3207 1321 1291
NM_138973chr1183393 1457 1232 1137 955 940 932 670 32835 2645 1098 33533 3207 1321 1291
NM_138973chr1183393 1457 1232 1137 955 940 932 670 32835 2645 1098 33533 3207 1321 1291
NM_138980chr41514 ------
NM_138981chr41645 ------
NM_138982chr41514 ------
NM_138991chr211262 ------
NM_138992chr213459 151 58 ------
NM_139012chr622116 1828 ----1613
NM_139014chr622196 1908 11464 --1693
NM_139035chrX1242 2671 148 ----
NM_139045chr93860 709 552 1750 ----
NM_139048chr331069 878 379 ------
NM_139067chr12------1254
NM_139168chr511524 1334 ----
NM_139175chr7----153 --
NM_139181chr11125 ------
NM_139182chr431786 1750 1167 ------
NM_139207chr1232229 1861 76 ------
NM_139245chr32711 26 1311 ----
NM_139246chr951847 881 593 436 385 1401 --1925
NM_139276chr1742173 2137 2075 1853 --1502 --
NM_139280chr1711043 11419 1969 --
NM_139283chr1222084 1794 21724 866 11785 1549
NM_144507chr191156 ------
NM_144563chr2----184 --
NM_144563chr2----184 --
NM_144567chr11720 22757 2276 12105 1211
NM_144568chr141575 1256 --1269
NM_144570chr1652668 2220 2113 1997 934 12894 42657 2266 767 615 --
NM_144571chr466877 5241 4837 4301 1963 93 26339 5333 ----
NM_144574chr14----1579 --
NM_144578chr1495438 4577 3767 3478 1982 1370 1048 985 840 13865 21567 1260 12213
NM_144582chr282059 1769 1676 971 955 627 503 106 12163 1495 --
NM_144590chr1042392 1909 1884 402 11976 22419 521 --
NM_144642chr32471 452 11103 ----
NM_144643chr41431 ------
NM_144664chr11--171 22181 1827 --
NM_144667chr1211142 1800 ----
NM_144709chr21275 ------
NM_144710chr241189 972 481 210 ------
NM_144721chr452493 2410 1918 1074 806 ------
NM_144778chr132308 151 --1460 --
NM_144973chr1284283 3922 3857 3792 3448 1344 920 258 ----13879
NM_145000chr52508 71 ------
NM_145036chr17--1118 ----
NM_145040chr111135 --180 --
NM_145055chr1812531 1507 13285 --
NM_145117chr1152618 2168 1052 267 108 22509 72 ----
NM_145176chr641362 1312 817 312 23390 2814 2337 204 --
NM_145234chrX2810 256 ----193
NM_145259chr255690 5635 5392 2567 288 31377 624 156 --36352 5533 493
NM_145284chrX21846 999 --1753 11997
NM_145303chr62375 109 ------
NM_145307chr1063053 2992 2972 2906 1271 242 41623 1226 1079 794 1298 1636
NM_145313chr1081594 1484 1296 1068 1061 417 364 209 ------
NM_145330chr21160 ------
NM_145331chr62766 612 ------
NM_145332chr62914 760 ------
NM_145333chr62914 760 ------
NM_145686chr213242 13421 11132 --
NM_145687chr213242 13421 11132 --
NM_145725chr14--1334 ----
NM_145726chr14--1334 ----
NM_145733chr223330 248 221 1389 ----
NM_145739chr21171 1216 1556 --
NM_145793chr103748 742 736 1722 1806 --
NM_145800chrX----1280 --
NM_145808chr732046 453 321 22057 599 2467 389 11219
NM_145858chr211408 ------
NM_145859chr3--1283 1257 --
NM_145860chr3--1283 1257 --
NM_145861chr13656 266 252 ------
NM_145868chr101115 ----1658
NM_145869chr101115 ----1658
NM_145912chr22134594 4031 3705 3661 3616 3597 1575 1315 1212 1017 825 319 32 --11153 --
NM_145913chr122798 761 128 ----
NM_146388chr1911008 1106 ----
NM_147150chr911009 33504 2601 1238 ----
NM_147156chr1031215 1202 87 ------
NM_147181chr431337 919 370 158 ----
NM_147182chr431337 919 370 158 ----
NM_147183chr431337 919 370 158 ----
NM_147189chr842132 2019 1604 746 31646 1578 777 ----
NM_147202chr932541 932 668 --32584 2354 706 --
NM_148174chr841544 1368 238 230 ------
NM_148898chr72838 693 ----2978 130
NM_148899chr72838 693 ----2978 130
NM_148921chr1752089 845 798 585 295 --21719 382 --
NM_148955chr1596042 2601 1960 1872 1002 778 463 153 79 15286 --16117
NM_152236chr221212 --158 --
NM_152237chr2281706 1452 1276 1085 354 292 187 54 --11552 --
NM_152253chr2294108 3909 3778 2969 2903 2686 1558 965 828 1389 13340 11726
NM_152261chr122601 372 1632 ----
NM_152265chr11621 --11094 --
NM_152271chr831188 1000 35 1262 --11058
NM_152280chr153324 3076 2719 2470 21 22312 1105 12623 --
NM_152300chr172633 268 1152 ----
NM_152310chr102230 93 --1260 --
NM_152330chr1452034 1777 1724 997 498 1104 ----
NM_152332chr1432510 775 537 22732 2188 --11818
NM_152344chr1711502 21166 612 ----
NM_152350chr171156 ------
NM_152375chr182462 2406 2327 2222 1910 794 560 146 21703 439 ----
NM_152387chr21374 ------
NM_152388chr253442 3183 3042 1119 517 63342 1617 1558 1466 963 297 21482 1049 --
NM_152390chr21527 ------
NM_152409chr513193 ------
NM_152414chr811446 1315 ----
NM_152417chr82242 88 --1347 --
NM_152418chr82632 392 ------
NM_152420chr93626 620 125 ------
NM_152423chrX2637 255 1435 ----
NM_152424chrX74613 4288 4214 3228 3139 1756 1225 1975 ----
NM_152440chr1221085 822 --155 --
NM_152450chr151246 2419 223 --124
NM_152451chr152805 631 ------
NM_152470chr1884097 3811 3603 3294 2732 2659 1263 462 23591 2965 ----
NM_152475chr1932562 1033 81 62393 2197 2079 2032 1768 1718 ----
NM_152487chr131179 1020 510 ------
NM_152519chr241648 769 410 60 ------
NM_152538chr3----11373 --
NM_152553chr61450 1232 ----
NM_152556chr722335 660 139 ----
NM_152581chrX1588 41522 1235 1227 111 ----
NM_152588chr121720 1353 1468 --
NM_152594chr151761 21945 751 ----
NM_152608chr151970 1741 913 902 431 --11952 1183
NM_152622chr513230 ----11224
NM_152624chr545077 1998 521 74 --17299 15127
NM_152629chr954063 2889 1358 1352 114 43135 2761 2582 302 ----
NM_152636chr1122268 520 21926 545 --1840
NM_152641chr1232102 998 685 12435 ----
NM_152663chr1------1260
NM_152665chr12847 372 11250 ----
NM_152671chr22518 319 ------
NM_152678chr342603 2007 479 434 11860 ----
NM_152682chr4----1200 --
NM_152716chr1131202 247 180 2515 155 --21218 286
NM_152735chr6------21015 774
NM_152739chr71100 1736 --1132
NM_152744chr732697 2597 311 13483 11168 --
NM_152748chr72162 49 1490 ----
NM_152754chr722726 716 1230 13710 12612
NM_152756chr544040 2866 449 167 33955 973 62 11025 12796
NM_152758chr852619 1889 831 549 543 1990 ----
NM_152765chr82841 24 11613 --1355
NM_152772chr121340 1406 ----
NM_152774chr712067 1133 ----
NM_152787chrX21039 709 43296 3146 2836 1501 ----
NM_152792chr23516 401 344 2451 28 1154 --
NM_152826chr1596042 2601 1960 1872 1002 778 463 153 79 15286 --16117
NM_152835chr142006 732 581 106 --11028 --
NM_152838chr2042533 1423 1319 1293 1637 11304 13193
NM_152857chr62682 33 --1703 --
NM_152858chr62682 33 --1703 --
NM_152896chr93852 675 247 2841 816 ----
NM_152902chr121819 1656 21811 788 --1121
NM_152903chr1332665 2214 1934 31922 1066 98 12532 --
NM_152924chr1595344 4248 2250 2175 1910 1244 934 559 360 75852 5363 4431 2561 991 767 421 --15797
NM_152998chr7142 ------
NM_152999chr774956 4500 3299 1649 1141 867 766 --11387 13909
NM_153013chr542381 1990 1630 362 ----11952
NM_153020chr6--11141 11087 --
NM_153029chr1633458 3135 1514 21090 318 33611 3419 944 --
NM_153035chr141131 475 421 22 21998 319 1158 --
NM_153042chr6--1161 1454 --
NM_153050chr2244151 1518 1481 518 33225 1944 905 43815 3535 3314 860 11278
NM_153051chr2244151 1518 1481 518 33225 1944 905 43815 3535 3314 860 11278
NM_153184chr32778 522 --1267 --
NM_153186chr91827 ------
NM_153188chr523908 1013 24555 2005 --11515
NM_153207chr1243574 2678 1309 829 ------
NM_153223chr531420 389 32 ------
NM_153234chr552872 2443 2072 509 117 --12581 --
NM_153235chr632287 677 589 ------
NM_153240chr331225 831 36 ------
NM_153261chr1611525 21270 1008 ----
NM_153262chr153097 2915 2490 2271 2094 22979 1020 ----
NM_153273chr3102276 2149 2071 1020 964 754 665 372 350 246 12465 ----
NM_153321chr171295 ----1267
NM_153322chr171295 ----1267
NM_153332chr8--23287 103 1755 --
NM_153342chr22384 173 ------
NM_153343chr462175 1805 912 791 474 409 12112 ----
NM_153348chr1262173 1116 761 357 303 147 12833 ----
NM_153354chr51735 163 ----
NM_153362chr63352 346 324 1990 ----
NM_153365chr411800 2560 521 --12783
NM_153367chr10103940 1275 1260 1191 891 729 554 441 294 91 23674 3618 ----
NM_153374chr15123 ------
NM_153442chr10105974 5910 5277 4867 4754 4412 1464 1384 1071 734 45167 2413 1947 673 24351 796 --
NM_153449chr121447 ------
NM_153456chr1375225 4236 2265 2015 1951 717 647 34948 1778 1488 14810 --
NM_153498chr101286 --1255 --
NM_153499chr1242600 1993 970 181 ------
NM_153500chr1242600 1993 970 181 ------
NM_153607chr52835 657 23067 625 ----
NM_153616chr1511516 177 ----
NM_153617chr1511516 177 ----
NM_153618chr1511516 177 ----
NM_153619chr1552754 2536 2463 787 189 31315 1162 224 ----
NM_153620chr71339 --1630 --
NM_153634chr12--2243 159 --11204
NM_153640chr201154 ------
NM_153645chr2232984 2040 273 32977 711 60 ----
NM_153686chr442299 2141 1660 276 11875 1252 --
NM_153689chr222317 1465 41675 763 271 135 ----
NM_153694chr121246 1191 ----
NM_153712chr243422 2591 910 343 --2614 336 1662
NM_153715chr721192 100 --1266 --
NM_153810chr1043144 1908 958 704 25103 4017 11110 --
NM_170606chr751755 484 461 383 40 ------
NM_170609chr631038 925 253 1852 --1339
NM_170665chr1254283 3276 2999 1449 1442 13847 23148 1277 --
NM_170674chr15182 ------
NM_170677chr15182 ------
NM_170707chr14733 367 239 75 ----1292
NM_170708chr14733 367 239 75 ----1292
NM_170709chr821540 305 11690 ----
NM_170710chr422453 69 ------
NM_170719chr132408 253 ----1338
NM_170721chr1741289 1210 859 498 ------
NM_170724chr62940 809 1993 ----
NM_170731chr1122057 1150 --11994 --
NM_170732chr1122057 1150 --11994 --
NM_170733chr1122057 1150 --11994 --
NM_170734chr1122057 1150 --11994 --
NM_170735chr1122057 1150 --11994 --
NM_170750chrX2561 200 ----1699
NM_170768chr11133 ------
NM_171999chr182251 24 1528 ----
NM_172016chr631013 904 205 1250 --1912
NM_172070chr212286 1722 11893 --
NM_172071chr1117349 6577 5898 5738 5649 5357 4776 2817 1676 1456 36 55524 5513 5500 4849 2429 --16827
NM_172103chr642662 1725 465 81 22158 1949 1387 1659
NM_172105chr642662 1725 465 81 22158 1949 1387 1659
NM_172110chr201612 ------
NM_172111chr201612 ------
NM_172112chr201612 ------
NM_172113chr201612 ------
NM_172127chr421410 161 11479 ----
NM_172128chr421366 117 11435 ----
NM_172216chr1242502 1895 872 83 11173 ----
NM_172226chr1242600 1993 970 181 ------
NM_172315chr15182 ------
NM_172316chr15182 ------
NM_172337chr142899 157 ------
NM_172349chr5--185 ----
NM_172387chr1851362 1187 1126 571 359 ------
NM_172388chr1851409 1234 1173 618 406 ------
NM_172389chr1851409 1234 1173 618 406 ------
NM_173065chr153644 3490 1183 977 162 23623 3283 22306 576 --
NM_173075chr461851 1540 580 421 406 125 ------
NM_173083chr11499 ------
NM_173156chr112075 ----11952
NM_173191chr1071081 958 511 450 378 357 52 --146 --
NM_173192chr1071081 958 511 450 378 357 52 --146 --
NM_173193chr1071081 958 511 450 378 357 52 --146 --
NM_173194chr1071081 958 511 450 378 357 52 --146 --
NM_173195chr1071081 958 511 450 378 357 52 --146 --
NM_173198chr932923 718 101 32053 984 908 1814 12481
NM_173199chr92141 107 1120 1128 --
NM_173200chr932923 718 101 32053 984 908 1814 12481
NM_173214chr1697377 7294 6897 6798 5869 1241 1157 1085 214 33162 2682 297 ----
NM_173359chr311813 11595 1709 --
NM_173468chr464791 4668 4011 2059 655 100 35409 1840 1268 ----
NM_173469chr1521402 1024 ------
NM_173478chr171690 1386 ----
NM_173485chr20121 ------
NM_173495chrX3991 517 339 1736 ----
NM_173496chr1052499 2083 1051 260 157 11922 1969 12423
NM_173510chr2212476 12571 12465 11968
NM_173511chr252737 2529 1319 1221 349 1372 11182 13733
NM_173563chr6143 ------
NM_173567chr1--144 --1227
NM_173576chr1021457 64 11703 ----
NM_173582chr1134521 4137 1803 45757 4799 4634 1954 ----
NM_173595chr12114956 4781 3793 3682 3672 1607 1564 1363 821 748 131 53947 1888 1688 1341 597 2932 464 --
NM_173602chr1243424 3317 3277 2511 ----13616
NM_173607chr14--21951 1349 22105 274 --
NM_173631chr1921222 1104 ------
NM_173642chr1127223 7025 6879 6614 5888 5588 3027 2321 1959 1169 703 48 22690 1564 16488 19106
NM_173653chr321460 429 ----11285
NM_173683chr841608 1564 467 34 ----11133
NM_173694chrX138 1470 ----
NM_173797chr531321 1236 168 --1528 --
NM_173808chr143037 1497 1030 732 44181 3918 3836 1257 23569 1723 --
NM_173809chr1011114 ------
NM_173830chr6125 1373 ----
NM_173833chr8185 11539 41547 1502 1132 251 --
NM_173834chrX1411 ------
NM_173851chr8------13678
NM_173854chr122032 851 12326 22178 348 11774
NM_174890chr10--2331 92 ----
NM_174921chr41761 ----1261
NM_174937chr102625 232 ------
NM_175038chr122239 98 ------
NM_175061chr72463 247 31647 1362 827 ----
NM_175623chr1267648 7286 6410 6381 5198 1081 56757 5592 4680 3006 2336 1129 --
NM_175624chr1267743 7381 6505 6476 5293 1176 56852 5687 4775 3101 2431 1224 --
NM_175625chr1267743 7381 6505 6476 5293 1176 56852 5687 4775 3101 2431 1224 --
NM_175630chr23771 348 332 ------
NM_175634chr8------1895
NM_175635chr8------1895
NM_175636chr8------1895
NM_175736chr12137851 7132 6739 6599 6576 6429 5602 5152 2595 1044 425 281 42 25238 2956 36034 3050 502 --
NM_175767chr521804 128 1472 --1451
NM_175847chr1941413 1344 957 501 ----1338
NM_175854chr1332398 2196 42 22697 2173 --1453
NM_175861chr12115468 3801 2085 1908 1873 1007 876 752 681 652 579 15559 --24286 1109
NM_175902chr171283 ------
NM_175907chr1842506 2187 920 872 ------
NM_176801chr451697 1283 1223 360 78 1752 11245 --
NM_176823chr143195 2465 976 72 21381 269 33820 757 549 1686
NM_177398chr131975 449 304 ------
NM_177399chr131975 449 304 ------
NM_177438chr1433205 2606 390 --32836 2690 1000 1667
NM_177972chr1184193 4134 3993 3577 1500 1197 749 73 1511 --13151
NM_177974chr1532000 1936 401 11532 12240 12274
NM_177983chr2185 ------
NM_177989chr31154 1240 ----
NM_177990chr201657 --11525 11775
NM_177996chr2063300 3011 2967 2415 474 414 --11196 --
NM_178011chr1021273 1017 3512 239 87 12495 --
NM_178037chr1263276 3103 1151 1016 350 135 21325 825 1671 --
NM_178038chr1263276 3103 1151 1016 350 135 21325 825 1671 --
NM_178039chr1242911 2738 786 651 2960 460 1306 --
NM_178040chr1242911 2738 786 651 2960 460 1306 --
NM_178042chr31154 1240 ----
NM_178140chr542656 2410 2298 2069 1522 ----
NM_178151chrX87484 6798 5757 5751 5495 3004 1296 315 21833 1627 ----
NM_178152chrX87484 6798 5757 5751 5495 3004 1296 315 21833 1627 ----
NM_178153chrX87484 6798 5757 5751 5495 3004 1296 315 21833 1627 ----
NM_178270chrX--1658 ----
NM_178313chr2----11582 21517 181
NM_178423chr7--1196 ----
NM_178425chr7--1196 ----
NM_178439chr22145 102 ------
NM_178445chr311022 2947 808 ----
NM_178509chr1743252 1076 680 210 23853 3800 ----
NM_178548chr12612 24 ----143
NM_178566chr911895 ------
NM_178584chr241189 972 481 210 ------
NM_178585chr442706 2437 914 258 --13023 --
NM_178586chr1432435 2123 869 12113 ----
NM_178812chr841512 1492 309 288 ------
NM_178815chr1031927 328 27 ------
NM_178831chr782843 2794 2694 2490 2117 513 343 163 32824 2272 2214 --12925
NM_181265chr422453 69 ------
NM_181291chr14--1261 ----
NM_181302chr14----1579 --
NM_181308chr14----1579 --
NM_181332chrX32599 449 35 --12687 --
NM_181358chr163215 1708 1677 1632 210 49 --13225 --
NM_181361chr351441 471 443 109 75 ------
NM_181427chr15197 ------
NM_181481chr1866276 6213 5968 2482 2355 451 44363 2680 2278 1282 17000 11812
NM_181482chr1866276 6213 5968 2482 2355 451 44363 2680 2278 1282 17000 11812
NM_181483chr1866276 6213 5968 2482 2355 451 44363 2680 2278 1282 17000 11812
NM_181486chr1241552 1408 366 333 1550 ----
NM_181492chr223111 63 40 --21191 880 --
NM_181504chr553423 2564 1461 203 44 12867 12762 --
NM_181523chr553423 2564 1461 203 44 12867 12762 --
NM_181524chr553423 2564 1461 203 44 12867 12762 --
NM_181527chr20180 ------
NM_181528chr201135 ------
NM_181571chr101293 1132 ----
NM_181581chr71322 178 ----
NM_181643chr131079 589 337 21574 1158 ----
NM_181672chrX22076 670 1692 ----
NM_181673chrX22076 670 1692 ----
NM_181714chr6----1509 --
NM_181747chr7----175 --
NM_181762chrX--2951 166 1798 --
NM_181777chrX--2951 166 1798 --
NM_181782chr622026 1907 159 1652 --
NM_181787chr822986 1138 11292 ----
NM_181794chr61842 --1111 --
NM_181795chr61842 --1111 --
NM_181836chr552575 2178 2167 448 53 11037 --1674
NM_181861chr1232473 2187 71 1443 ----
NM_181868chr1232473 2187 71 1443 ----
NM_181869chr1242558 2272 156 21 1528 ----
NM_181886chr41303 --1341 11090
NM_181887chr41303 --1341 11090
NM_181888chr41303 --1341 11090
NM_181889chr41303 --1341 11090
NM_181890chr41303 --1341 11090
NM_181891chr41303 --1341 11090
NM_181892chr41350 159 1388 11137
NM_181893chr41303 --1341 11090
NM_182314chrX1619 11584 11448 1182
NM_182485chr423500 1280 12706 ----
NM_182503chr6104940 4779 4167 4152 3804 3514 2251 2126 1106 382 1481 14542 12016
NM_182509chr1441629 364 99 21 --11373 11651
NM_182511chr181206 21023 71 1474 --
NM_182526chr14142947 2859 2689 2642 2520 2241 1254 989 768 582 320 141 119 97 12072 1801 --
NM_182540chrX----1178 --
NM_182551chr273523 3324 3283 3146 1071 499 315 43249 2790 1040 1000 13039 13399
NM_182557chr1171917 1900 1807 1662 773 734 53 1833 21986 874 --
NM_182580chr152063 1000 755 524 507 --11915 --
NM_182643chr831915 1835 817 21941 593 1978 --
NM_182646chr423500 1280 12706 ----
NM_182648chr143651 642 606 ------
NM_182664chr172011 1922 1871 1787 789 777 771 21550 609 1104 --
NM_182666chr32586 138 ------
NM_182691chr71248 11173 ----
NM_182692chr71248 11173 ----
NM_182697chr741320 660 530 42 21764 1552 ----
NM_182715chr741212 1130 857 297 --1304 --
NM_182717chr103102 57 31 1537 ----
NM_182718chr101293 1132 ----
NM_182719chr101293 1132 ----
NM_182720chr103102 57 31 1537 ----
NM_182721chr103102 57 31 1537 ----
NM_182722chr103102 57 31 1537 ----
NM_182723chr103102 57 31 1537 ----
NM_182724chr101293 1132 ----
NM_182725chr101293 1132 ----
NM_182763chr152762 2204 2100 483 94 11877 ----
NM_182769chr101293 1132 ----
NM_182770chr101293 1132 ----
NM_182771chr101293 1132 ----
NM_182772chr101293 1132 ----
NM_182789chr511108 1685 1878 --
NM_182797chr2021466 348 ------
NM_182830chr1421988 1952 11546 ----
NM_182850chr101293 1132 ----
NM_182853chr103102 57 31 1537 ----
NM_182854chr161308 1322 1426 --
NM_182898chr755167 5126 4394 2359 1081 11701 ----
NM_182899chr755167 5126 4394 2359 1081 11701 ----
NM_182920chr331369 212 68 1907 ----
NM_182936chr1471417 1131 1124 283 148 95 47 ------
NM_182943chr321136 775 ----1196
NM_182964chr1152618 2168 1052 267 108 22509 72 ----
NM_182972chr132445 400 38 2875 532 ----
NM_182975chr11843 1124 ----
NM_183002chr1471417 1131 1124 283 148 95 47 ------
NM_183004chr1453472 2941 2529 1513 620 ----12501
NM_183011chr103102 57 31 1537 ----
NM_183012chr103102 57 31 1537 ----
NM_183013chr103102 57 31 1537 ----
NM_183060chr101293 1132 ----
NM_183078chr683412 3199 3168 2671 2420 2345 1035 81 11061 23277 2448 --
NM_183227chr641574 1127 194 104 21137 461 ----
NM_183323chr511108 1685 1878 --
NM_183380chr63762 335 127 ------
NM_183381chr32797 676 ------
NM_183383chr32797 676 ------
NM_183384chr32797 676 ------
NM_183393chr31987 1791 11053 --
NM_183394chr31987 1791 11053 --
NM_183397chr2085002 4824 4690 4496 3996 3926 3400 1618 35064 4013 35 2530 235 --
NM_183398chr531036 436 43 --11004 --
NM_183399chr531036 436 43 --11004 --
NM_183400chr531036 436 43 --11004 --
NM_183401chr531036 436 43 --11004 --
NM_183415chr1231621 1405 710 1113 --11837
NM_183416chr121465 1280 31959 1884 1524 --11371
NM_183422chr131370 ------
NM_184234chr201269 1179 ----
NM_194071chr785327 4876 4192 3967 1848 1069 843 33 24319 3303 25204 4010 14183
NM_194247chr273792 2885 1516 1399 1142 811 331 --21642 1504 14129
NM_194250chr22297 172 ------
NM_194271chr121576 ------
NM_194282chr423023 2253 ------
NM_194285chr1152649 2452 1181 401 279 --1480 --
NM_194286chr12105617 5562 5283 3856 1779 1019 964 786 565 328 44830 2330 2237 1374 25326 2338 --
NM_194298chr101658 --1519 --
NM_194314chr165556 4647 4296 1976 1427 448 44930 4713 3694 3660 12172 --
NM_194317chr222024 916 --11728 --
NM_194328chr912835 12672 1756 --
NM_194329chr912835 12672 1756 --
NM_194330chr912835 12672 1756 --
NM_194332chr912835 12672 1756 --
NM_194434chr1875692 5453 5243 4285 1956 1372 1232 25222 1594 1744 --
NM_194454chr721436 1357 ------
NM_194455chr721436 1357 ------
NM_194456chr721436 1357 ------
NM_194463chrX----11018 --
NM_197941chr582966 2955 2728 2699 2547 2094 1901 888 12555 1138 --
NM_197968chr131540 ------
NM_197970chr221223 1174 11107 ----
NM_198074chr1----21202 1095 --
NM_198081chr64856 412 279 62 ------
NM_198123chr811480 ------
NM_198124chr811480 ------
NM_198158chr342888 2399 2361 2039 --12345 1493
NM_198159chr342888 2399 2361 2039 --12345 1493
NM_198177chr342888 2399 2361 2039 --12345 1493
NM_198178chr342888 2399 2361 2039 --12345 1493
NM_198181chr1551794 1076 1004 765 527 12406 ----
NM_198196chr321774 426 1701 12435 --
NM_198212chr7--11913 21868 612 --
NM_198217chr13----1931 --
NM_198218chr13----1931 --
NM_198219chr13----1931 --
NM_198256chr231977 556 373 ------
NM_198268chr163215 1708 1677 1632 210 49 --13225 --
NM_198269chr163215 1708 1677 1632 210 49 --13225 --
NM_198270chrX12787 22657 1051 --1888
NM_198273chr521124 890 --1873 --
NM_198317chr11327 --142 --
NM_198353chr4----175 --
NM_198376chr17150 ------
NM_198377chr17150 ------
NM_198378chr17150 ------
NM_198379chr17150 ------
NM_198380chr17150 ------
NM_198382chr17150 ------
NM_198383chr17150 ------
NM_198384chr17150 ------
NM_198385chr17150 ------
NM_198386chr17150 ------
NM_198387chr17150 ------
NM_198388chr17150 ------
NM_198391chr201603 11379 --11502
NM_198395chr521064 947 ------
NM_198396chr17150 ------
NM_198399chr311672 ------
NM_198427chr1----1420 --
NM_198465chrX32424 808 195 ------
NM_198468chr631264 999 64 23302 3011 13091 --
NM_198485chr332540 2168 295 42519 619 594 319 ----
NM_198503chr11568 21685 750 --11767
NM_198513chr831672 632 55 --1727 --
NM_198530chr172197 138 127 ----
NM_198560chr3113141 3126 2861 2492 1537 1436 1095 898 616 582 96 --22928 642 --
NM_198576chr11450 ----1961
NM_198580chr1911526 --1255 21060 955
NM_198581chr226680 5884 36957 1091 153 15795 --
NM_198595chr474055 3944 3445 3159 3040 834 334 45001 4127 3531 1343 ----
NM_198700chr111400 ------
NM_198715chr156299 4686 1667 997 556 ------
NM_198793chr343204 2952 374 308 ----12890
NM_198829chr71266 ----1242
NM_198841chr93692 81 53 11052 1220 --
NM_198859chr355111 4810 1573 1033 715 14898 ----
NM_198880chr31240 ----1614
NM_198889chr421372 453 ------
NM_198896chr11--21733 1489 --1677
NM_198900chr12137851 7132 6739 6599 6576 6429 5602 5152 2595 1044 425 281 42 25238 2956 36034 3050 502 --
NM_198904chr511578 1827 1302 --
NM_198935chr2072972 2952 2914 2721 2431 1999 724 ------
NM_198965chr121134 ------
NM_198966chr121134 ------
NM_198968chr1343322 3084 2907 95 32700 1310 475 23278 1234 --
NM_199000chr741964 1930 889 316 ------
NM_199039chr431044 1020 906 ------
NM_199040chr1233530 1459 663 13493 22439 227 --
NM_199053chr42867 213 ------
NM_199054chr1931462 497 296 31732 1359 723 ----
NM_199072chr712344 32189 1177 713 ----
NM_199129chr203441 229 39 --1801 --
NM_199132chr19--21961 216 ----
NM_199136chr71137 ------
NM_199160chr951802 1667 1414 1328 528 1175 ----
NM_199168chr1021511 227 --198 --
NM_199188chr1223523 173 23785 3105 13298 --
NM_199190chr1223523 173 23785 3105 13298 --
NM_199192chr2192 ------
NM_199193chr2192 ------
NM_199262chr1762110 1452 885 827 493 449 22276 1816 ----
NM_199320chr432151 986 795 ------
NM_199320chr432151 986 795 ------
NM_199324chr453720 3476 3208 2388 478 --13671 --
NM_199327chr42864 474 --1935 --
NM_199359chr2041249 1207 441 406 11543 1113 --
NM_199360chr2041249 1207 441 406 11543 1113 --
NM_199361chr2041249 1207 441 406 11543 1113 --
NM_199362chr2041249 1207 441 406 11543 1113 --
NM_199363chr2041249 1207 441 406 11543 1113 --
NM_199413chr152842 189 ------
NM_199414chr152885 232 --153 --
NM_199421chr1445032 3348 291 266 21918 620 --24402 125
NM_199436chr233114 2447 535 22639 1930 ----
NM_199437chr1141978 1759 1639 298 11997 ----
NM_199438chr1141978 1759 1639 298 11997 ----
NM_199439chr1141978 1759 1639 298 11997 ----
NM_199454chr1124678 4132 4081 3665 3488 3470 3324 1465 1404 1389 1109 776 1177 ----
NM_199462chr154049 3668 3534 3439 397 24555 1550 --23167 664
NM_199478chrX2705 28 11835 3636 288 42 --
NM_199482chr232085 724 700 1417 ----
NM_201263chr132029 1718 64 31661 1373 523 ----
NM_201266chr262444 2405 2380 2269 942 605 12437 12480 --
NM_201267chr23626 233 134 ------
NM_201279chr262444 2405 2380 2269 942 605 12437 12480 --
NM_201286chrX1200 ------
NM_201413chr211365 ------
NM_201414chr211365 ------
NM_201428chr1151349 1295 515 394 256 ------
NM_201429chr1151349 1295 515 394 256 ------
NM_201430chr1151275 1221 441 320 182 ------
NM_201432chr17196498 6452 5929 5337 4794 4420 4201 2434 2254 1597 1458 1219 1000 943 923 416 334 236 206 ------
NM_201433chr17196498 6452 5929 5337 4794 4420 4201 2434 2254 1597 1458 1219 1000 943 923 416 334 236 206 ------
NM_201436chr71637 ------
NM_201439chr122423 75 ------
NM_201440chr122423 75 ------
NM_201515chr122423 75 ------
NM_201516chr71693 ------
NM_201517chr71637 ------
NM_201535chr141149 1227 1200 --
NM_201536chr141149 1227 1200 --
NM_201537chr141149 1227 1200 --
NM_201538chr141149 1227 1200 --
NM_201539chr141149 1227 1200 --
NM_201540chr141149 1227 1200 --
NM_201541chr141149 1227 1200 --
NM_201568chr112075 ----11952
NM_201569chr112075 ----11952
NM_201570chr101496 ------
NM_201571chr101496 ------
NM_201572chr101496 ------
NM_201590chr101496 ------
NM_201593chr101496 ------
NM_201596chr101496 ------
NM_201597chr101496 ------
NM_201999chr4----1939 --
NM_203283chr4------1514
NM_203284chr4------1514
NM_203290chr61183 ------
NM_203291chr181193 ------
NM_203292chr181186 ------
NM_203301chr1431386 235 50 ------
NM_203329chr1176561 5516 4754 4590 2408 908 509 56017 5270 4745 1822 1415 16803 25360 1903
NM_203330chr1176561 5516 4754 4590 2408 908 509 56017 5270 4745 1822 1415 16803 25360 1903
NM_203331chr1176561 5516 4754 4590 2408 908 509 56017 5270 4745 1822 1415 16803 25360 1903
NM_203342chr143532 1154 795 439 --42337 1273 855 540 --
NM_203343chr143532 1154 795 439 --42337 1273 855 540 --
NM_203346chr232109 823 792 22083 2005 22212 880 11614
NM_203349chr1521707 488 11848 ----
NM_203350chr12534 279 ------
NM_203351chr1742375 2069 1709 595 1527 1941 --
NM_203364chr11------1264
NM_203382chr551647 507 498 391 224 11329 ----
NM_203394chr1272631 2374 2324 1943 849 709 595 11759 2373 41 --
NM_203399chr11805 141 ----
NM_203401chr11805 141 ----
NM_203403chr92977 154 2906 393 ----
NM_203406chr542901 2630 2094 243 ----12042
NM_203437chr21880 --178 1184
NM_203499chr172231 37 --1554 --
NM_203504chr422159 628 ------
NM_203505chr422159 628 ------
NM_205768chr1----11599 --
NM_205836chr51484 1193 ----
NM_205842chr23735 649 80 ------
NM_205848chr142341 1869 1789 561 ------
NM_205860chr162998 2974 2895 2844 2115 521 ------
NM_205861chr181760 1710 1413 1348 778 423 367 30 ------
NM_206594chr14833 749 583 557 1685 ----
NM_206595chr14833 749 583 557 1685 ----
NM_206852chr141685 1134 ----
NM_206853chr623861 3465 --1625 --
NM_206854chr635122 4726 690 --11886 --
NM_206855chr646087 5691 1655 733 1161 ----
NM_206857chr141685 1134 ----
NM_206860chr10----1375 --
NM_206861chr10----1375 --
NM_206862chr10----1375 --
NM_206876chr243142 3085 748 726 23239 447 12584 --
NM_206907chr533176 2246 429 ------
NM_206909chr8147396 7108 6927 6468 6369 5814 5496 3321 2494 2114 1586 1426 1032 990 21450 1237 15983 --
NM_206944chr9------146
NM_206945chr9------146
NM_206946chr9------146
NM_206947chr9------146
NM_207012chr1072928 2676 2525 2502 2198 559 496 32941 2843 324 ----
NM_207015chr331916 707 673 32168 1594 828 156 --
NM_207036chr1531626 1610 744 1698 ----
NM_207037chr1531626 1610 744 1698 ----
NM_207038chr1531626 1610 744 1698 ----
NM_207040chr1531626 1610 744 1698 ----
NM_207043chr1--21900 499 1165 --
NM_207044chr1--21900 499 1165 --
NM_207047chr1--21900 499 1165 --
NM_207111chr7112523 2496 2274 2170 2042 2034 2010 1069 1028 778 100 11923 --22582 2112
NM_207113chr721072 318 11106 170 1630
NM_207116chr7112523 2496 2274 2170 2042 2034 2010 1069 1028 778 100 11923 --22582 2112
NM_207189chr1------1123
NM_207292chr322267 1305 11142 13392 --
NM_207293chr322267 1305 11142 13392 --
NM_207294chr322267 1305 11142 13392 --
NM_207295chr322267 1305 11142 13392 --
NM_207296chr322267 1305 11142 13392 --
NM_207297chr322292 1330 11167 13417 --
NM_207304chr132195 38 11062 1347 --
NM_207306chr134370 3939 49 34609 1557 113 14110 1245
NM_207313chr171806 ------
NM_207325chr1931681 1675 1534 2712 489 ----
NM_207343chr111388 --1342 --
NM_207361chr1324268 870 25112 65 14692 --
NM_207372chr1052293 2253 1872 1826 1601 22223 347 ----
NM_207406chr454460 4141 2105 1935 1489 --11952 1763
NM_207429chr1152453 1966 499 385 160 ----12334
NM_207481chr21507 21085 48 ----
NM_207647chr931993 764 327 12366 ----
NM_212467chr1542452 1963 1708 895 1115 ----
NM_212471chr1712172 1452 ----
NM_212472chr1712172 1452 ----
NM_212551chr121130 304 ------
NM_213589chr265594 5345 3959 2121 1097 258 11520 11392 12241
NM_213594chr122136 120 ------
NM_213609chr321090 885 ------
NM_213654chr3----1272 11361
NM_213662chr1742267 2231 2169 1947 --1596 --