TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-296-3p
miRNA Sequence: GAGGGUUGGGUGGAGGCUCUCC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000037chr862217 1744 1598 557 435 59 --1232 --
NM_000074chrX3681 601 234 1103 1835 --
NM_000084chrX96510 6019 5192 4697 4483 4404 2546 1776 1495 --26914 1813 --
NM_000088chr1761201 1183 1098 502 74 55 ----1223
NM_000089chr7193 --1260 --
NM_000092chr244338 3548 2837 1642 11439 24205 745 --
NM_000168chr773275 3140 2811 2801 2194 2060 1029 23293 174 12072 --
NM_000217chr12104946 4675 4503 4413 4381 4058 3676 1821 916 790 24760 820 11599 --
NM_000237chr821846 1653 --11438 1138
NM_000248chr382720 2689 2365 2357 2033 1952 1022 449 ----12888
NM_000259chr15105379 5295 5224 5015 4875 2075 1701 1657 1149 327 16150 54141 2518 2405 1944 997 --
NM_000264chr962912 2888 1081 801 788 564 13275 1469 --
NM_000267chr171469 --33332 2858 155 --
NM_000291chrX4706 135 86 34 --1757 --
NM_000314chr1023034 735 --13247 --
NM_000330chrX72016 1997 1969 1642 1454 718 485 --1343 --
NM_000334chr1772202 1994 1638 506 489 446 440 --21841 1779 --
NM_000335chr362006 1961 1740 1728 414 127 11842 12083 11426
NM_000337chr585465 5426 5348 5232 5219 1076 906 250 24435 2430 26255 4776 --
NM_000368chr984723 4324 4029 3835 3197 1882 911 214 13345 14353 14705
NM_000391chr1171209 1143 1121 1079 131 92 82 11366 --1167
NM_000393chr2----1187 --
NM_000408chr253484 2189 1194 654 518 12929 12906 13453
NM_000430chr1783526 2547 2447 2403 1377 1259 1167 683 12789 ----
NM_000448chr1142259 2002 1086 670 23083 2350 12219 --
NM_000462chr1541484 708 448 228 --1663 --
NM_000489chrX53146 2961 2902 1365 280 --13215 --
NM_000533chrX181 1635 21827 787 1650
NM_000555chrX137618 7055 6783 6458 6177 5796 5143 3128 2740 2608 2368 988 472 23003 1295 35750 4986 1278 --
NM_000609chr1052905 2661 1987 427 25 12036 33070 1195 602 32623 825 375
NM_000610chr1162652 2494 2371 2303 810 591 --1331 --
NM_000615chr1142730 2607 2363 491 12775 22323 2003 --
NM_000618chr12136161 5991 5371 5176 4896 2463 1438 886 788 750 576 508 441 15239 45842 5182 2437 388 16487
NM_000633chr18104771 4153 3865 3560 3297 1955 1708 868 831 788 23679 1418 24338 1209 --
NM_000639chr12221 164 ----1730
NM_000689chr9----1531 --
NM_000719chr12116520 6145 5967 5769 4998 4696 4464 2310 2083 1370 472 1333 36603 2332 2046 --
NM_000721chr182096 2027 1854 1821 1064 932 659 509 --11931 --
NM_000723chr172646 315 --11090 --
NM_000814chr1573952 3638 3203 3125 2760 1332 1299 ----11447
NM_000827chr5122495 2379 2110 2007 1958 1883 1867 686 448 265 62 49 --2836 530 --
NM_000829chr111749 --31752 102 62 --
NM_000834chr12----3981 793 167 --
NM_000840chr72509 353 ----198
NM_000844chr33221 61 39 --11039 --
NM_000868chrX42265 2025 1618 846 --22036 137 --
NM_000875chr15146860 6454 5964 1850 1513 1320 1022 963 876 864 598 388 222 82 26307 250 ----
NM_000891chr1732696 1228 1184 13100 23496 3296 13567
NM_000899chr1233207 1736 1619 --24344 3226 --
NM_000933chr201419 --1312 --
NM_000961chr2093292 1586 1198 1148 1137 1006 747 484 340 ------
NM_000983chr131590 1483 520 ------
NM_001001132chr2111146 --11462 --
NM_001001323chr1262865 2557 2366 2133 1127 651 22389 1252 11992 22585 2376
NM_001001331chr3112207 2056 2036 1927 1894 1871 457 264 189 160 87 --22160 351 --
NM_001001396chr1113703 3397 3078 1739 1698 1476 1455 1235 968 810 133 130 23887 574 --
NM_001001433chr2053047 2034 1957 882 129 ----13222
NM_001001549chr752742 2530 1931 464 332 --1599 11952
NM_001001664chr263875 3646 2901 1170 1097 500 ------
NM_001001740chr1----1198 --
NM_001001890chr2154081 3911 2635 1655 459 11493 ----
NM_001001924chr851711 1437 350 323 168 1834 31384 619 609 --
NM_001001936chr101738 --155 --
NM_001001971chr10--11419 11108 --
NM_001002265chr103307 166 144 ------
NM_001002843chr151144 ----1355
NM_001003652chr18108290 7080 6707 3413 1855 1429 723 606 571 415 --78664 7160 6647 2662 2513 2233 46 --
NM_001003681chr2231879 742 668 21847 29 --11925
NM_001003712chr1221323 637 --12763 --
NM_001004065chr993635 3259 3227 3123 3067 2425 939 589 235 11236 1117 --
NM_001004304chr1273004 2702 2277 2128 955 808 251 --32083 537 317 --
NM_001004317chr684207 3863 3294 2737 1742 953 859 423 ------
NM_001004342chr1185569 5558 5005 4113 3839 3752 3724 2358 2275 2238 1965 1924 1405 1079 995 628 118 83 --14492 11701
NM_001005782chr2----136 --
NM_001005845chr851561 399 275 258 164 ------
NM_001006600chr521810 1505 22226 795 21821 1601 --
NM_001007559chr1851697 832 717 488 117 ----12072
NM_001008220chr5103868 3490 3483 3402 2878 2566 1030 598 575 400 13501 1369 --
NM_001008239chr1833224 683 292 --12560 13662
NM_001008392chr393487 2798 2683 2387 1154 905 614 373 185 22897 898 23143 2664 23210 3194
NM_001008408chr7116429 5325 4532 3904 2530 2514 2404 1893 1641 1509 1028 14502 75761 4728 1716 1689 760 631 474 --
NM_001008541chr101385 1667 1532 --
NM_001008660chr115311 270 253 106 58 1997 ----
NM_001008701chr19112957 2671 2396 2174 1996 1125 1009 736 717 301 50 --22146 1226 --
NM_001008710chr821281 125 --21085 656 --
NM_001008738chr582386 2313 1919 1882 1157 1018 995 431 --2948 733 --
NM_001009881chr11480 --155 --
NM_001009960chr762536 2496 2170 459 202 160 ------
NM_001009993chr223101 3018 11775 1504 --
NM_001010888chrX94489 4089 3871 3592 3566 1401 1024 812 491 --21201 140 --
NM_001010924chr1041258 1060 805 98 21069 396 ----
NM_001011538chr41282 ----1347
NM_001011666chr745984 5952 4588 274 14393 2805 316 --
NM_001012393chr11105142 4643 4144 4021 3851 3771 3207 1966 756 272 --21582 1356 --
NM_001012753chr191982 71157 955 871 433 247 165 81 ----
NM_001012755chrX84551 3244 1554 1410 1262 1083 264 149 34439 3751 551 11996 --
NM_001013031chr1053356 2666 965 896 440 33350 2598 2303 ----
NM_001013415chr421513 1371 --11537 --
NM_001014449chr16----2205 30 --
NM_001014797chr10118175 7911 7021 6280 5867 5565 3020 2393 2334 2167 1664 27819 6020 18147 --
NM_001015055chr21301 --1251 --
NM_001015877chrX3479 248 165 --21974 114 --
NM_001017369chr4----1133 --
NM_001017371chr2----1304 --
NM_001017440chr7147438 7342 6603 5982 5483 5124 3201 2835 2662 2369 1908 1878 1117 403 37369 2202 290 57529 7223 2843 571 440 --
NM_001017926chr861814 1759 1700 522 490 41 ------
NM_001017999chr152271 2005 1738 1427 576 --1246 --
NM_001018067chr165041 3902 1168 1020 669 40 --122 --
NM_001018108chr1551756 923 636 468 357 --124 --
NM_001024463chr15187 --1198 --
NM_001024596chr1962803 2604 2558 1471 1119 275 ------
NM_001024668chr122349 201 --2738 720 --
NM_001024948chr143466 3313 2265 856 ------
NM_001025076chr1095703 5043 2302 2190 2006 1743 1437 1372 701 22172 1639 24382 1781 --
NM_001025077chr1087061 6401 4672 2795 2730 2059 965 394 22997 1025 15740 --
NM_001025780chr931387 992 494 ------
NM_001029875chr532500 1901 1877 22060 658 ----
NM_001029997chr192485 242 ------
NM_001030055chr1434216 3746 702 ----1257
NM_001031679chr1253530 3298 2817 2599 152 12517 ----
NM_001031804chr1684091 3687 1281 1202 775 765 586 563 --23384 800 --
NM_001032280chr641473 1057 324 41 --190 --
NM_001033117chr3104392 3266 1961 1935 1855 1442 805 766 242 91 --21863 1669 --
NM_001033551chr17153776 3670 3477 3270 3247 2977 2831 2554 1616 1608 1431 724 615 590 285 --23709 1635 --
NM_001033561chr174311 166 144 108 ------
NM_001034837chr5----2194 97 --
NM_001034845chr441265 492 395 312 1291 ----
NM_001037164chr721971 1484 --1147 --
NM_001038493chr261213 1058 468 436 369 166 165 ----
NM_001038640chr152942 28 ------
NM_001038707chr182053 836 740 558 357 270 261 54 2723 546 ----
NM_001039091chrX3955 479 440 ------
NM_001039479chr1482371 2122 2016 1954 1496 960 674 347 12056 1322 --
NM_001039538chr232808 1004 991 --12910 --
NM_001039577chr1114320 4067 3622 3442 3070 1767 860 838 371 173 64 --23911 3760 --
NM_001039590chrX83321 3314 3123 2958 1383 1284 531 170 --22582 60 --
NM_001039690chr1672214 1783 709 662 472 430 36 1390 --1597
NM_001039888chr13581 526 311 1779 ----
NM_001039916chr122311 167 --2190 65 --
NM_001039937chr1353838 3801 1515 1493 1034 13496 44125 3171 2618 315 --
NM_001040057chr72415 222 ------
NM_001040110chr761433 1377 1355 1280 594 119 --11548 --
NM_001040152chr7105017 4992 4750 4460 4427 3630 3525 1812 1781 614 ------
NM_001040284chr1655572 4427 3956 1068 718 ----15341
NM_001040450chr1562752 2059 2029 1945 1139 511 1899 1540 --
NM_001042486chr2051261 1203 605 290 111 --31106 525 83 --
NM_001042494chr1573341 3039 2743 2585 2434 2344 128 --13489 --
NM_001042599chr287430 7057 6538 5793 5469 1424 1245 576 --27598 2635 --
NM_001042603chr1255112 4956 4468 4392 1601 --1976 --
NM_001044305chr631646 1388 387 ------
NM_001044387chr1954033 3859 1140 1122 609 165 1505 --
NM_001079874chr151863 1507 1453 728 281 --22087 737 --
NM_001106chr3119664 9076 7473 7438 7284 7133 6932 3141 1918 1254 430 28918 416 1823 17311
NM_001186chr2131128 277 234 1266 11054 --
NM_001204chr267391 7239 2008 1500 1460 776 66893 5768 2786 2735 1332 786 26949 5703 --
NM_001206chr942809 2466 755 719 11021 1228 --
NM_001222chr1082008 1979 1953 1780 1653 1638 1272 429 --3298 163 47 --
NM_001259chr795136 4615 4542 3879 1224 994 773 596 306 45618 5524 4318 76 ----
NM_001304chr1783845 3199 3103 2620 1027 878 447 193 ------
NM_001356chrX21979 423 --32224 941 187 --
NM_001364chr1174309 3509 3460 3229 3075 3068 2942 ------
NM_001390chr1882460 2424 2317 1316 741 585 414 92 --23242 2858 --
NM_001419chr19124491 4431 4401 4381 3831 3600 3486 3291 1539 1076 1050 78 --33881 3726 1314 --
NM_001430chr251513 1371 804 597 482 11902 11364 --
NM_001438chr152878 2609 2401 1001 426 --1582 --
NM_001449chrX2501 427 2918 465 1199 --
NM_001455chr664791 3963 1671 155 71 39 33948 1558 217 ----
NM_001655chr1192131 2075 1526 1488 858 590 432 391 146 12002 11365 --
NM_001660chr32811 553 --1275 --
NM_001663chr1452423 2193 1850 812 114 12417 ----
NM_001681chr121131 1287 182 --
NM_001695chr853678 3285 2992 1385 338 187 22979 26 --
NM_001755chr1622097 844 ----1172
NM_001759chr1244550 4380 3308 1868 34627 3609 3593 44847 4316 3977 3932 --
NM_001790chr52275 55 --1305 --
NM_001829chr41253 --164 --
NM_001845chr132523 263 172 --1989
NM_001854chr12483 57 --1251 --
NM_001977chr421436 612 21339 510 ----
NM_002006chr464921 4277 2003 1485 552 367 --1587 --
NM_002037chr61355 1340 --1309
NM_002126chr1764136 3399 3315 661 299 238 21633 735 180 --
NM_002137chr74800 754 364 108 ------
NM_002156chr2----1434 --
NM_002166chr23607 493 484 ------
NM_002207chr31217 --1282 --
NM_002249chr1----157 --
NM_002254chr271856 1440 838 655 556 525 429 --22333 57 --
NM_002264chr3104347 3057 1933 1674 1611 1575 1179 891 541 497 ------
NM_002267chr1332004 813 223 1728 11813 --
NM_002270chr595499 4011 3940 1823 1653 1639 1012 253 136 ----1144
NM_002271chr1342414 1565 257 214 --1587 12407
NM_002336chr1222032 524 23385 2011 24941 630 --
NM_002351chrX2599 318 31651 1624 1537 1552 --
NM_002373chr153362 328 265 --11165 11365
NM_002392chr122211 63 147 ----
NM_002430chr2262410 2355 2208 2163 501 255 --22430 989 172
NM_002442chr1261625 1588 1164 487 409 143 --31404 617 292 --
NM_002465chr12----1108 --
NM_002467chr8189 1372 198 1334
NM_002481chr1157365 7032 6319 6215 6198 5963 5722 5454 2815 2777 2682 1871 1317 620 394 14849 23178 1566 27859 1484
NM_002486chr942152 2086 1756 694 ----1324
NM_002501chr19134042 3712 3639 3521 3373 3256 3152 2792 1401 240 223 193 126 --33396 950 178 --
NM_002505chr631467 1094 385 --2350 67 --
NM_002522chr17123461 3424 3410 3037 1320 1268 1074 948 911 508 475 169 --13192 --
NM_002570chr151422 11300 11261 --
NM_002581chr9112138 2087 1813 1392 1270 1236 1082 993 974 757 695 --15313 --
NM_002583chr12----2528 417 --
NM_002610chr242889 2210 2077 1246 --12821 --
NM_002628chr3----1172 147
NM_002635chr12----1174 --
NM_002641chrX168 --11826 --
NM_002655chr843652 3600 2015 1615 33250 1717 625 34765 4467 4274 --
NM_002698chr1982873 2756 2493 807 738 721 52 41 --31204 815 746 1922
NM_002710chr122329 53 1376 ----
NM_002737chr17126084 5944 4757 4467 2670 2604 1383 1075 526 266 65 34 45333 1269 585 73 45762 2398 2273 42 --
NM_002742chr141535 1490 1714 --
NM_002745chr2294224 4195 3893 3251 1082 578 467 334 91 11449 23308 208 --
NM_002841chr33696 272 95 ------
NM_002849chr1211095 1725 1791 --
NM_002868chr1271815 1760 938 726 230 108 83 ------
NM_002869chr11193 21747 1731 123 --
NM_002881chr211333 --11392 --
NM_002890chr52876 237 --1177 --
NM_002897chr22617 188 ------
NM_002938chr44726 654 580 143 1759 21940 1712 --
NM_002941chr341544 1019 609 412 1194 ----
NM_002968chr161200 --1831 --
NM_002996chr168786 479 409 319 287 239 230 220 --21954 1497 --
NM_002998chr821922 241 1444 ----
NM_003011chr921621 680 --126 --
NM_003029chr171481 1261 1107 938 264 187 63 --141 --
NM_003074chr311662 1504 ----
NM_003093chr6----1213 --
NM_003108chr286850 6153 5542 5412 2900 2551 1133 496 --14649 --
NM_003112chr71260 1829 ----
NM_003128chr241900 759 467 303 1529 22119 1858 --
NM_003161chr1752909 956 732 502 211 ----1257
NM_003174chr10----1661 --
NM_003189chr1103312 3147 2623 2407 1354 908 828 740 271 157 11178 43034 2423 2168 729 --
NM_003202chr551501 1297 333 138 83 --11321 --
NM_003205chr1532259 225 73 1154 21443 743 --
NM_003234chr322317 1542 1334 ----
NM_003247chr671969 1574 659 634 211 151 122 ------
NM_003272chr12524 170 ------
NM_003304chr321294 188 1544 ----
NM_003319chr21117 --1746 --
NM_003320chr1171134 931 863 853 602 528 311 --32750 1154 72 --
NM_003337chr511224 --1659 --
NM_003339chr531531 1186 48 21414 515 2641 614 --
NM_003342chr173512 493 236 1944 ----
NM_003344chr721557 185 1520 --11550
NM_003348chr1221501 1145 --21515 558 --
NM_003350chr8----139 --
NM_003369chr1192493 2398 2162 2153 2089 1826 758 639 70 1564 ----
NM_003373chr1031477 757 623 11431 ----
NM_003392chr3103276 3184 3166 1736 1036 988 936 726 153 24 --11642 --
NM_003400chr22768 36 --1789 --
NM_003403chr14--1117 --1864
NM_003412chr392708 2282 2188 1052 981 623 287 97 80 131 2174 118 --
NM_003453chr13--1668 ----
NM_003458chr3114063 3186 2934 1378 1234 1126 1095 728 341 328 126 --53573 3302 3289 2600 309 --
NM_003468chr243183 3025 1721 236 13231 11351 1325
NM_003470chr1631292 608 483 --21160 376 --
NM_003482chr1282507 2036 1022 994 723 437 401 46 12288 42111 750 370 194 --
NM_003483chr1231901 497 478 1171 21859 698 --
NM_003487chr17----2208 196 --
NM_003489chr2142997 2948 634 561 --1419 --
NM_003505chr741976 1556 658 142 --31664 116 84 --
NM_003574chr1845451 1923 957 708 --1558 --
NM_003597chr242094 2069 2050 176 --1321 --
NM_003603chr4----1580 --
NM_003615chr343195 2622 778 621 1331 12478 --
NM_003632chr171752 1847 2684 668 --
NM_003633chr562476 2278 2085 1744 1628 297 --22351 1699 --
NM_003651chr12------192
NM_003688chrX----1261 --
NM_003716chr3----1924 1789
NM_003718chr73375 167 73 --1544 --
NM_003743chr222198 487 --3527 473 394 --
NM_003749chr1351878 1786 730 368 80 ------
NM_003758chr154602 572 134 44 ------
NM_003787chr1831083 669 177 ------
NM_003862chr51234 ----1271
NM_003887chr231616 103 62 1556 21911 1691 --
NM_003902chr13721 571 52 --1846 --
NM_003913chr644210 3148 2900 1049 33784 3077 1480 11367 --
NM_003939chr10114107 3921 3865 3816 3557 3394 3379 2719 834 810 520 --53087 1379 1364 885 683 --
NM_003988chr1092094 2036 1850 787 506 403 314 287 221 --2888 231 --
NM_004100chr672616 2566 2536 1958 741 418 301 32156 1947 193 1385 --
NM_004187chrX81399 1310 1238 1063 993 957 402 26 ------
NM_004227chr742707 2403 2115 38 --42650 2564 1940 719 --
NM_004229chrX1454 1569 21708 1573 --
NM_004232chr1823493 2919 23587 3392 11106 1361
NM_004279chr722367 1470 11916 1678 --
NM_004286chr2282603 2076 1737 783 771 765 432 381 --42838 2804 820 96 --
NM_004301chr3----1273 --
NM_004302chr12112693 2421 2314 2216 2176 2025 1015 967 444 402 118 --32569 1963 101 --
NM_004316chr1251144 897 464 179 63 ------
NM_004319chr152753 2624 2501 2036 907 --12832 --
NM_004329chr101146 128 1283 --
NM_004392chr1342409 1017 616 537 22350 1051 ----
NM_004397chr1163276 2911 1624 745 527 504 1313 ----
NM_004414chr2121439 541 ------
NM_004423chr3112417 2337 2092 1807 930 902 889 550 429 311 186 1723 ----
NM_004437chr193233 2937 2290 2191 1379 605 371 328 291 --52622 1153 538 484 27 --
NM_004438chr262606 1113 807 646 632 27 --23341 853 --
NM_004450chr142318 91 ------
NM_004454chr322009 861 130 1228 --
NM_004469chrX----2376 136 --
NM_004491chr1984198 3032 1720 943 819 708 487 410 --44219 3726 2758 1504 --
NM_004496chr142850 222 11037 1148 --
NM_004529chr9----1149 --
NM_004555chr16----1202 --
NM_004598chr563167 2706 2394 1292 1242 354 --33276 1029 335 --
NM_004660chrY2421 230 ----2593 181
NM_004711chr22123211 3194 2818 2700 2530 2521 2255 1019 821 745 371 60 --23353 2724 --
NM_004730chr561667 1558 737 371 331 51 1774 --1174
NM_004734chr1373232 3049 1189 432 141 116 43 ----22223 666
NM_004736chr152085 1561 382 340 70 --150 --
NM_004745chr8146240 6033 5752 5568 4838 4809 4532 4374 2398 2109 1796 1600 1589 458 27056 1938 14288 --
NM_004748chr1533744 1434 1322 23057 230 14143 --
NM_004759chr171885 1594 1494 1323 670 346 51 --1567 --
NM_004768chr121188 442 1825 ----
NM_004772chr51287 --1236 --
NM_004774chr1722741 604 31983 169 113 12822 --
NM_004775chr1831973 1844 495 ------
NM_004788chr1171986 1923 1875 1829 490 446 32 --11094 1677
NM_004822chr1794023 3361 3324 3303 2835 2815 2496 1428 155 13453 21384 947 --
NM_004842chr61391 1612 1567 --
NM_004852chr182414337 13615 13250 13241 12359 12286 11281 11084 10836 10561 9430 9247 9002 5396 4185 4088 4018 3177 3075 2343 1933 1525 1376 629 212797 5061 412208 11744 9628 3311 --
NM_004859chr1763036 2732 2304 2033 762 106 2343 170 ----
NM_004860chr171142 --1526 --
NM_004867chrX------1683
NM_004926chr1461612 672 486 172 123 37 ------
NM_004929chr811563 ------
NM_004947chr352185 1960 926 592 82 --11793 --
NM_004961chrX31421 1185 29 ------
NM_005028chr1062323 2242 1988 1650 1441 331 --21630 1463 --
NM_005063chr1053394 1160 473 378 113 23018 2724 33833 337 166 --
NM_005096chrX21248 153 ------
NM_005100chr63804 704 225 --1170 --
NM_005109chr321950 998 12407 2863 510 --
NM_005121chr1742845 253 193 163 --13605 --
NM_005203chr102405 158 ------
NM_005277chr421413 431 --173 --
NM_005316chr111131 --160 --
NM_005324chr1752001 1895 1871 1378 715 ------
NM_005338chr793892 2832 2793 1599 1510 1136 974 84 36 11251 34042 2749 679 --
NM_005359chr18126533 6520 5135 5034 4823 4775 4458 4282 2158 1165 640 298 22054 30 160 --
NM_005381chr2----1434 --
NM_005387chr113450 227 72 ------
NM_005398chr1051368 1123 998 552 279 ----154
NM_005433chr1822534 861 1175 12807 --
NM_005436chr1043604 2687 2579 256 --23326 1432 --
NM_005461chr2051902 1343 1276 648 83 --1540 --
NM_005465chr131794 1665 812 --1287 --
NM_005509chr521186 426 11685 ----
NM_005512chr1192015 1656 1433 1342 827 808 697 119 100 --12034 --
NM_005542chr731203 354 140 --11210 --
NM_005544chr2152 --1173 1281
NM_005596chr9136201 6136 6074 5335 5032 4987 4231 4136 1782 690 668 338 86 11452 25078 932 14678
NM_005604chr6--12218 ----
NM_005610chr12794 234 --152 --
NM_005627chr611004 --1938 --
NM_005785chr1251929 1311 1280 1256 549 --11941 --
NM_005801chr171791 1287 1610 --
NM_005824chr72163 144 ------
NM_005842chr13----1578 --
NM_005880chr16288 66 --1275 --
NM_005898chr1122970 861 23180 1282 1377 --
NM_005911chr221255 294 --1430 --
NM_005934chr19102518 2110 1950 1680 1658 1048 1039 322 191 133 --1114 --
NM_005935chr474121 1924 1662 1023 716 625 147 24378 99 1361 --
NM_006107chr17----1417 --
NM_006136chr721168 538 1320 ----
NM_006145chr193854 395 373 --1258 1844
NM_006158chr841154 389 365 54 ------
NM_006206chr451141 982 920 631 433 2518 369 2743 593 --
NM_006224chr1752271 2040 905 650 566 22565 1952 3765 404 315 --
NM_006251chr523017 572 --12562 --
NM_006256chr12877 523 --161 --
NM_006281chr83977 750 290 185 ----
NM_006317chr5----1594 --
NM_006334chr91207 1277 ----
NM_006380chr1763519 3005 2940 2671 1121 235 1129 11638 13776
NM_006393chr1073976 3150 2959 1398 861 393 273 --11473 --
NM_006420chr2043123 3036 982 906 ------
NM_006475chr13------138
NM_006520chrX11279 --11167 --
NM_006524chr71883 4800 716 380 212 51006 918 341 257 89 --
NM_006544chr1455494 4616 4463 4243 1404 21374 1196 35350 901 68 26012 4024
NM_006546chr17135508 5277 4739 4524 4343 4226 1876 1864 1689 1373 1029 177 164 --34935 4733 1127 --
NM_006549chr1252421 2382 2037 1190 303 31064 887 814 12843 --
NM_006565chr162972 800 --1926 --
NM_006572chr1753322 3020 2581 2397 990 1891 1919 --
NM_006599chr16107525 6323 6287 6202 5133 2644 2585 926 822 29 12680 26812 970 --
NM_006609chr231058 741 680 32942 621 463 1555 --
NM_006614chr382910 2868 2743 2728 2373 2319 1205 247 23324 1472 142 12753
NM_006699chr112069 --1848 --
NM_006717chr973420 3407 2357 1132 964 686 320 13376 11357 --
NM_006729chrX94636 4185 3676 2144 2108 1934 1539 802 420 --15317 --
NM_006750chr16148097 7833 7695 7555 6639 5710 5621 5186 2711 2695 2354 2039 813 82 11023 ----
NM_006775chr6103118 3094 3085 3049 2719 1988 1039 471 181 27 ------
NM_006788chr182286 63 11538 ----
NM_006806chr21--154 1269 --
NM_006832chr14--2913 354 1668 --
NM_006850chr11973 --1349 1240
NM_006885chr1663921 3177 3083 1017 926 757 22599 235 ----
NM_006887chr25650 594 588 457 156 ------
NM_006888chr1482695 2570 2474 2258 1020 982 735 570 12373 --13475
NM_006955chr1042528 2468 2236 1387 43447 3273 3024 2690 13284 --
NM_007011chr1566170 5801 4570 2478 1471 1309 --42249 1802 1662 33 11416
NM_007017chr55718 189 177 157 131 ------
NM_007125chrY1332 --1115 --
NM_007146chr1742709 2267 2177 374 ------
NM_007172chr2263324 871 801 583 335 154 1272 ----
NM_007202chr171280 ----1147
NM_007212chr152305 2265 1895 1677 1456 ------
NM_007249chr13129461 9328 9158 7494 6484 6010 2196 1536 1518 1267 415 170 12964 59018 8219 6965 6027 557 --
NM_007275chr38927 815 775 460 400 352 132 116 --1105 --
NM_007373chr101561 11700 ----
NM_007374chr141533 --1546 --
NM_007375chr132430 1038 785 --1913 --
NM_012081chr543436 2878 618 452 --23019 2296 --
NM_012082chr82702 608 1822 ----
NM_012090chr14444 425 204 42 ------
NM_012104chr1183537 3112 1143 1094 935 325 295 112 --22380 288 --
NM_012193chr1185335 5229 4005 3898 3328 397 155 135 24334 1420 --13784
NM_012197chr931431 360 168 --1633 --
NM_012199chr1104255 3929 3480 1547 1302 1217 970 691 365 205 --3813 742 357 --
NM_012231chr161702 1534 1510 1405 362 301 --11244 --
NM_012294chr754031 3344 2820 511 115 --43273 2879 2768 1294 --
NM_012300chr531809 918 148 --12118 --
NM_012308chr1161936 1821 1701 949 498 134 11957 2320 76 --
NM_012309chr1164644 4616 4202 3795 1566 100 --13377 11868
NM_012316chr195404 5384 5233 4467 2196 1368 873 430 280 25465 4954 44486 4034 1353 61 --
NM_012328chr731170 1047 382 1979 11092 --
NM_012414chr11627 --2220 161 --
NM_012471chrX2287 121 ----11424
NM_013233chr231147 1137 217 21263 1183 165 --
NM_013236chr2221115 410 --1307 --
NM_013261chr443657 3374 1026 881 12698 1706 --
NM_013277chr1211042 1395 1775 --
NM_013279chr1152282 2138 1794 1639 1531 1775 52250 1899 730 661 393 1450
NM_013293chr7----1632 --
NM_013357chr81700 2631 560 1200 --
NM_013374chr342860 2390 2028 2005 23019 78 22112 56 --
NM_013390chr931497 521 87 --11451 --
NM_013396chr2131167 52 36 ------
NM_014011chr22964 407 11621 1285 --
NM_014057chr9198 1236 1355 --
NM_014109chr841278 943 221 89 --1259 --
NM_014112chr844199 3477 3395 1102 1459 1639 --
NM_014117chr1621050 705 1206 11033 --
NM_014182chr121684 --1125 --
NM_014190chr4111775 1282 532 492 461 359 253 197 185 174 86 --2390 60 --
NM_014253chrX62512 2091 1860 1811 176 90 --1443 --
NM_014271chrX4647 578 292 73 ------
NM_014313chr131555 1337 1297 --273 32 --
NM_014315chr14----147 --
NM_014368chr92757 435 31861 777 476 21725 585 --
NM_014388chr165940 4430 2137 1543 1020 850 24042 508 11230 --
NM_014393chr822295 2055 1826 ----
NM_014423chr545039 3754 1790 931 35577 4598 4319 1825 --
NM_014452chr631044 751 211 1442 ----
NM_014454chr62298 289 ----1698
NM_014491chr71919 1976 1151 3837 692 128
NM_014505chr121514 1503 ----
NM_014606chr41512 --41255 502 351 171 --
NM_014607chr231899 818 185 31820 301 228 ----
NM_014612chr921385 1146 1971 ----
NM_014613chr552870 2787 2641 307 198 22277 2254 2983 744 --
NM_014614chr21472 --1990 --
NM_014636chr9113480 3132 2703 1401 1388 1216 1082 975 610 522 459 1598 24231 777 --
NM_014686chr193410 204 96 12539 32209 2004 849 --
NM_014701chr1543168 2279 1362 838 13316 23261 3015 --
NM_014723chr2053076 2612 1289 448 273 11116 33248 2372 314 --
NM_014729chr81190 --11883 --
NM_014730chr1245027 4809 2054 1112 35215 1415 1129 25081 167 --
NM_014731chr2041518 570 190 101 --21531 1324 1250
NM_014741chr1152111 2102 1362 257 241 12018 21982 647 --
NM_014766chr752910 2746 1459 952 479 1989 ----
NM_014790chr52341 31 --1164 --
NM_014820chr351796 1291 585 513 25 162 ----
NM_014824chr1121899 1785 3538 241 231 1264 --
NM_014830chr1283679 3664 3549 3346 2927 2575 1237 1000 13163 21403 512 2563 192
NM_014876chr2252149 1662 650 236 33 2494 285 21853 524 12173
NM_014899chr543176 2792 771 570 --13073 --
NM_014906chr1763879 3384 2509 460 288 250 --12711 --
NM_014920chr653733 3009 2999 1493 1096 1656 --13798
NM_014932chr331605 1330 76 ------
NM_014939chr181204 --11189 --
NM_014945chr561896 1556 1471 1297 612 77 --32032 1848 292 --
NM_014961chr461950 1921 1366 728 458 345 --11619 --
NM_014962chr2032221 869 146 12365 ----
NM_014991chr452358 1124 948 303 289 13022 1913 12705
NM_014992chr143764 249 84 1831 143 --
NM_014996chr31909 ----1936
NM_015000chr1223139 2626 22968 2451 ----
NM_015009chr31684 1136 1143 --
NM_015015chr1951529 830 635 99 31 --31748 306 25 --
NM_015020chr1662675 2474 2391 944 601 329 --23628 404 --
NM_015042chr15184216 3771 3293 3278 2890 1689 1511 1251 1109 1022 978 865 837 643 376 348 317 145 21698 188 13319 --
NM_015045chr1042063 2012 2000 1523 ----12141
NM_015052chr741231 1049 456 185 --2480 88 --
NM_015064chr12123435 3279 2757 2248 1381 1258 1206 573 446 400 369 50 --21015 112 --
NM_015075chrX92139 1613 1536 900 626 577 425 376 87 --42004 1993 1852 350 --
NM_015076chr664059 3921 2815 769 280 27 23796 130 13420 --
NM_015079chr1572485 2462 2444 2263 2060 431 421 --2724 53 --
NM_015092chr1673564 3282 2892 379 366 209 59 13987 ----
NM_015093chr641681 1333 1224 146 11605 11169 11653
NM_015100chr141826 1675 1477 601 11833 --1662
NM_015144chr1663656 2760 2673 2542 1262 983 2847 184 ----
NM_015156chr1433338 567 539 --2884 433 --
NM_015184chr31189 139 1166 --
NM_015199chr342243 1827 940 92 ------
NM_015203chr1----1179 --
NM_015215chr152507 2201 2140 913 878 12671 ----
NM_015272chr1631981 1690 1674 --11654 --
NM_015278chr643327 1335 962 142 --1640 --
NM_015288chr5123858 3787 2494 1330 1095 818 673 597 326 229 101 56 --23692 3226 --
NM_015315chr552777 977 677 510 422 --42749 2201 373 347 --
NM_015317chr292509 2459 2290 2244 2076 1144 471 400 79 --1208 --
NM_015344chr821868 821 --1863 --
NM_015346chr1441466 1418 387 336 1139 11695 --
NM_015349chr61220 12323 2603 157 12284
NM_015443chr1741358 1307 1039 248 ------
NM_015455chr553660 3498 2786 906 642 ----1706
NM_015475chr22402 60 ----1755
NM_015481chr1251050 981 906 71 30 --31026 967 310 --
NM_015526chr19101281 994 906 567 532 519 308 250 175 65 21224 1093 2355 130 11206
NM_015554chr151758 --12608 --
NM_015564chr573601 2457 2431 2224 1274 611 287 23339 835 33113 2316 915 1708
NM_015565chr2121625 1494 2565 152 11938 11918
NM_015568chr2074075 3873 3757 2858 1724 1107 60 13452 73989 2834 1443 1292 1127 140 69 --
NM_015569chr164362 1770 1722 1619 201 172 ----21716 253
NM_015570chr71596 139 11211 --
NM_015576chr352992 2840 2724 2089 2009 --12256 --
NM_015607chr12190 58 ------
NM_015651chr972182 1865 1804 1755 1723 298 255 --21988 1940 --
NM_015726chr141412 506 196 40 1521 160 --
NM_015852chr763386 3252 2957 2504 1222 419 141142 1105 1058 890 853 722 638 554 470 433 302 265 218 50 71184 767 599 515 347 179 95 --
NM_015878chr841819 1654 826 529 ------
NM_015879chr18117565 7370 6121 5463 5373 2957 1435 1168 1027 974 916 32324 559 80 18283 --
NM_015898chr1972478 2283 2130 1923 1724 534 333 --1614 12528
NM_015906chr174804 4161 3718 3496 1319 1303 426 ------
NM_015911chr15654 616 548 187 100 145 ----
NM_016083chr673579 2867 2712 2636 1559 742 268 1602 12573 --
NM_016098chr6----1163 --
NM_016147chr1131094 751 735 --31191 409 149 --
NM_016206chr337465 7231 2962 46143 3160 2587 2506 1240 --
NM_016271chr1831551 1467 790 ------
NM_016277chr631409 1355 1208 2666 459 --11135
NM_016284chr163870 267 77 --2728 105 --
NM_016289chr222233 1632 ------
NM_016308chr11787 ----21727 400
NM_016322chr933251 2504 124 11203 12312 --
NM_016374chr121627 1364 --1543 --
NM_016436chr2031059 828 405 12077 135 --
NM_016486chr1----1138 --
NM_016531chr494242 4025 3848 1652 1628 1114 546 256 179 --13948 --
NM_016623chr81561 ------
NM_016628chr102676 183 ------
NM_016631chr212693 259 ------
NM_016940chr21------1203
NM_016946chr183185 2855 2692 1366 1276 1163 974 269 1801 13170 --
NM_017420chr1463401 2884 2828 2763 2669 616 23627 2555 1946 --
NM_017508chr1152165 1961 1656 906 274 ------
NM_017544chrX----1741 --
NM_017548chr33458 423 21 11866 12036 --
NM_017596chr1143688 3575 2862 1721 1622 1432 1108 1097 1090 991 921 611 605 403 13352 34489 3773 1752 --
NM_017599chr1241565 1329 828 132 21801 1574 1812 --
NM_017672chr1531059 915 847 ----11032
NM_017709chr164033 3567 3504 3287 3248 1118 34230 3775 3002 1186 --
NM_017742chr181238 --11962 --
NM_017747chr5----1286 --
NM_017754chr684973 4819 4425 3817 3726 3707 3672 1005 --44062 3841 3434 955 11699
NM_017811chr982889 2771 2588 2531 2177 1946 538 194 22124 1046 12299 --
NM_017812chr72238 79 --2690 269 --
NM_017824chr103789 566 392 ----11902
NM_017848chrX44127 3578 1333 1298 13529 11796 --
NM_017907chr112461 179 ------
NM_018011chr131191 --1539 --
NM_018013chr642939 2777 2570 992 --2935 163 --
NM_018027chr1052723 845 381 113 98 --1342 1817
NM_018045chr1113021 2927 2685 2541 2348 2320 2054 1918 1012 731 328 --22642 2613 --
NM_018061chr111162 135 ----
NM_018085chr1148094 5944 2660 2435 1991 1868 1698 855 621 438 282 240 112 93 67237 6263 5228 3063 2786 1197 36994 5131 60 --
NM_018086chr211577 --21681 518 --
NM_018133chr311434 1185 1482 --
NM_018159chrX------1632
NM_018178chr111603 --11956 --
NM_018184chr32467 163 41822 1330 670 43 12143 --
NM_018202chr11737 --1344 --
NM_018207chr191282 520 380 332 266 177 87 55 25 --31672 338 278 11662
NM_018247chr641909 710 425 58 1991 ----
NM_018254chr121655 672 ------
NM_018287chr1031058 531 520 1860 ----
NM_018416chr1262044 805 167 75 69 27 1666 22492 590 --
NM_018440chr876443 6243 6108 6006 5737 5692 616 37474 5414 2667 18322 --
NM_018489chr1--1862 12355 --
NM_018509chr1741672 1406 377 77 11379 ----
NM_018527chr131335 ----1178
NM_018534chr23531 150 102 --1132 1232
NM_018557chr2----1452 --
NM_018566chr154318 4179 3141 1250 529 182 25052 4324 --
NM_018652chr152942 28 ------
NM_018834chr5164 21005 850 ----
NM_018837chr202926 278 ------
NM_018976chr1232921 757 277 --22113 982 --
NM_018977chrX2396 224 --1715 --
NM_018979chr1222557 156 --21873 545 --
NM_018994chr11112 --1210 --
NM_019071chr71765 ----1134
NM_019114chr962215 1935 1896 1779 858 675 ------
NM_019593chr2042194 2123 546 133 ----13227
NM_019610chr121835 1743 ----1743
NM_019891chr1----21060 1002 --
NM_020116chr451391 1227 1128 597 574 11180 ----
NM_020133chr675890 4426 1905 1589 774 375 33 12038 14941 1971
NM_020134chr23295 136 48 --3996 305 56 1180
NM_020137chrX----1292 --
NM_020148chr1832658 2290 2196 1460 --1389
NM_020150chr101596 --1140 --
NM_020231chr3--1476 1153 1258
NM_020310chr1772603 2527 2262 1809 921 713 104 22675 1110 32178 1132 862 --
NM_020337chr433137 2031 183 ------
NM_020381chr621501 610 144 --11419
NM_020390chr394836 4410 3395 2976 1724 1216 997 480 99 33912 3525 594 13134 --
NM_020443chr1226741 6726 6525 5813 5713 5030 4979 4962 4912 4703 4623 4574 4515 4308 2595 2235 2030 1508 706 482 452 103 55261 4942 2415 813 737 25246 384 --
NM_020640chr312068 --1102 --
NM_020699chr1105173 5069 4893 4769 3760 3387 908 407 312 37 13589 15186 --
NM_020734chr122597 29 1191 ----
NM_020769chrX4620 376 331 94 ------
NM_020772chr17108056 7518 5681 3281 3023 2355 1264 1102 525 27 22836 2716 ----
NM_020774chr1865892 5145 4243 1994 1556 1528 1158 12301 --
NM_020782chr1244591 3032 1751 578 23239 567 ----
NM_020795chr1771968 1959 1858 541 486 456 403 --11988 --
NM_020796chr562690 2436 2421 2305 698 451 12712 ----
NM_020801chr511747 --1641 --
NM_020808chr11243 1921 1734 --
NM_020810chr1453467 2569 2450 1130 102 ------
NM_020856chr1961562 1458 1365 1237 1215 386 ------
NM_020858chr1522291 127 12094 11642 --
NM_020860chr4------1846
NM_020872chr32347 159 --196 --
NM_020956chr19124400 4260 4000 3780 3453 2987 965 899 821 131 98 54 14676 31584 1351 1023 --
NM_020956chr19124400 4260 4000 3780 3453 2987 965 899 821 131 98 54 14676 31584 1351 1023 --
NM_020981chr2----2604 266 --
NM_020988chr164479 360 139 23 11092 --11058
NM_021005chr151914 1888 ----
NM_021038chr343097 2696 2385 858 --12116 13206
NM_021090chr2284570 3972 3605 3078 1932 1911 471 62 13808 ----
NM_021097chr282721 2564 2281 1972 888 807 744 266 --21009 839 --
NM_021132chr1021277 1128 1133 --1371
NM_021140chrX2290 53 --1123 --
NM_021145chr731022 80 57 ------
NM_021183chrX21770 87 --12545 --
NM_021202chr2052723 2708 801 487 386 --22295 1976 12414
NM_021255chr1433257 1407 281 164 22839 2771 --
NM_021627chr31234 21141 840 1190 --
NM_021637chrX2500 425 2970 135 1218 --
NM_021728chr142974 897 --2651 384 --
NM_021813chr6105465 5400 5122 4048 3734 1883 1866 1734 1644 1446 1341 ----
NM_021943chr662098 1860 1811 1719 1503 412 --21775 1544 --
NM_021947chr1711117 --2891 77 --
NM_021964chr356476 6274 5297 4991 4896 15662 ----
NM_022048chr1565873 5437 4418 4391 684 488 --25242 372 12274
NM_022080chr2032677 1093 348 --12621 --
NM_022351chr862573 1377 1091 864 487 254 1271 31538 625 556 21498 501
NM_022462chr1963101 2697 1501 803 746 739 11282 33304 2323 152 --
NM_022465chr1292139 2043 1104 816 545 384 337 133 100 12439 1900 --
NM_022658chr1251191 1148 1025 924 35 --11320 1127
NM_022719chr2283814 3808 3210 2767 2738 1336 1275 513 1302 ----
NM_022728chr7------193
NM_022758chr672570 2452 2159 1275 1220 1127 978 12884 1674 --
NM_022763chr322882 82 ----13035
NM_022771chr12----2792 45 --
NM_022781chr942777 2770 1271 1161 11182 22561 93 --
NM_022893chr243066 1056 559 79 1816 ----
NM_022898chr1463628 2987 1855 763 350 139 11092 24444 1824 --
NM_022918chr1151686 1347 853 677 500 --11425 --
NM_023943chr3184 ------
NM_024411chr2061248 1199 1096 1087 608 307 1504 ----
NM_024586chr11606 --1669 --
NM_024613chr8----11850 --
NM_024631chr112643 112 --1433 --
NM_024645chr831285 1218 375 1276 ----
NM_024646chr152838 1303 1089 306 38 ------
NM_024680chr11----1515 1225
NM_024700chr12478 332 ------
NM_024715chr521186 372 21831 691 140 --
NM_024721chr851935 1010 552 284 94 1889 11995 1737
NM_024804chr1268 48 ------
NM_024811chr1161711 1632 1537 1464 648 186 --2657 535 --
NM_024887chr151597 1552 672 648 273 21710 366 12044 --
NM_024948chr102524 497 1552 1692 --
NM_024949chr474891 4258 4225 4074 3986 1348 1241 --24833 119 --
NM_024953chr1252297 2173 375 355 201 1264 ----
NM_024969chr21923 --2730 28 --
NM_025133chr21883 ----1976
NM_025191chr143493 2949 2661 2220 --23082 1364 12353
NM_025208chr1162053 887 853 360 70 40 22296 2094 ----
NM_030627chr533498 3163 76 21456 939 ----
NM_030647chr7125275 5146 4913 4896 4832 4553 4412 4338 3912 1896 1885 1866 1222 ----
NM_030648chr4105316 5099 4794 4249 4045 3468 1314 1101 1087 482 --14885 1569
NM_030786chr1125 --31345 291 201 --
NM_030806chr1159241 8173 8026 7179 7173 7042 6844 6724 6455 3378 3348 3340 1025 837 333 29078 2980 13105 --
NM_030809chr1252223 2065 1612 558 364 --12365 1191
NM_030927chr1051629 1236 1103 1073 1067 ----21480 69
NM_030938chr1731056 204 97 ------
NM_030958chr8----1114 --
NM_030964chr5113058 2995 2677 2574 2451 2339 1350 1040 718 476 350 12311 21408 1390 --
NM_031208chr16----175 --
NM_031435chr1243181 2459 2233 1387 ------
NM_031438chr521882 1816 --11868 --
NM_031954chr12112839 2766 2086 2008 1037 862 806 800 524 477 470 --11783 --
NM_032047chr32974 61 --12154 --
NM_032121chrX42202 721 567 219 11108 1174 --
NM_032208chr293506 3286 3275 2979 2952 2702 1092 837 423 31398 1279 802 13642 --
NM_032233chr141908 1585 ----
NM_032287chr2263932 3368 3085 2811 1495 1194 --31686 1028 526 --
NM_032320chr11------1187
NM_032379chr112881 723 ------
NM_032452chr1441417 1344 1203 238 11265 11463 --
NM_032457chr41218 166 1507 --
NM_032458chrX3809 578 495 1100 22304 444 --
NM_032499chr1551715 1705 1437 218 112 ------
NM_032632chr1441431 560 257 39 ----1583
NM_032682chr322728 150 1950 1134 --
NM_032689chr1921468 1283 ----11100
NM_032765chr52868 795 --1751 --
NM_032859chr1353338 3249 3153 669 352 22598 561 12817 --
NM_032924chr73881 286 98 --11114 --
NM_033121chr1261800 1264 1229 1214 1135 312 ------
NM_033129chr20111990 1887 1328 1261 733 517 275 208 158 113 86 --11500 --
NM_033132chr1342235 2026 1931 608 3512 148 127 --1739
NM_033211chr531713 1489 783 21481 1450 ----
NM_033224chr798003 6550 6539 6324 4919 2762 1670 503 217 27560 6166 46673 5554 2569 2295 --
NM_033225chr832335 2041 2001 --22853 121 13077
NM_033240chr15101623 1366 1321 1264 686 591 576 561 376 122 --2490 63 --
NM_033389chr1754132 4070 3981 1920 928 --33770 3079 510 --
NM_033516chr941401 1198 466 165 11172 21591 219 --
NM_052879chr1233694 1021 686 ------
NM_052882chr192262 218 ------
NM_052900chr831453 1400 1367 ------
NM_052905chr2----2552 167 --
NM_053025chr331622 527 384 --11094 11386
NM_057175chr442173 2114 1890 738 22020 1035 12485 --
NM_080743chr662228 2111 2009 1035 728 51 11813 11615 --
NM_101395chr2132354 1309 499 --1142 --
NM_130848chr562035 1997 1482 1385 660 490 12074 ----
NM_133264chr1793951 3667 3479 3024 1113 997 741 246 219 1125 23820 3334 --
NM_133445chr9103399 2828 1332 1086 1010 445 327 287 270 49 13195 ----
NM_133457chr771151 1128 480 426 361 196 46 1282 21193 510 --
NM_133510chr14----1349 --
NM_138288chr142268 87 ----1113
NM_138423chr1532300 1577 488 ------
NM_138426chr721908 701 11947 --1685
NM_138459chr662651 1344 1099 321 110 87 13515 ----
NM_138771chr7--21159 149 ----
NM_138782chr521851 965 ----12271
NM_138799chr251381 594 391 242 171 21857 1762 ----
NM_139057chr1522678 1844 1587 --12644
NM_139076chr431350 206 146 ------
NM_139125chr371587 1194 1006 488 290 148 138 ------
NM_139136chr12----11062 --
NM_139207chr1222226 1858 --158 --
NM_139248chr3----3909 385 163 --
NM_144499chr3111240 976 891 264 213 205 160 137 111 87 63 280 48 1402 --
NM_144571chr455354 4883 4681 2616 442 36876 5331 700 21960 845 --
NM_144578chr1445098 1830 1369 424 21047 839 1118 13478
NM_144726chr52761 267 --2854 461 --
NM_144778chr1342535 2157 921 214 11730 12121 1150
NM_144973chr1294549 4085 3352 2111 1713 1086 919 385 33 34575 1493 1343 34020 3966 128 --
NM_144994chr241546 1032 625 443 --41076 579 137 98 --
NM_145117chr1152494 2477 2338 460 93 32230 2167 590 1967 --
NM_145274chr171692 1946 --2667 365
NM_145276chr1931089 243 225 2782 79 ----
NM_145313chr1041624 1117 1060 363 --21295 157 --
NM_145808chr711119 22188 388 --1371
NM_145891chr1631612 520 22 --21626 1589 1100
NM_147161chr141120 1019 959 199 --11164 2421 240
NM_152237chr22101555 1381 1330 1268 1241 1188 1081 598 360 153 --21107 53 --
NM_152253chr22154344 4129 3908 3731 3711 3679 3170 3009 2752 1635 1265 968 876 479 58 12917 23338 2791 --
NM_152262chr191209 5747 578 247 163 81 ----
NM_152345chr176929 909 720 384 321 252 ------
NM_152380chr141634 609 466 206 ----1523
NM_152390chr22659 99 --2158 115 --
NM_152424chrX94082 3835 3814 3343 1534 1043 467 189 108 --11400 24301 3139
NM_152437chr1242381 662 100 60 ------
NM_152450chr1521872 730 --1455 --
NM_152470chr18154145 3516 3350 3271 3226 3210 3022 2962 2678 1523 1437 1365 1026 559 62 --1338 --
NM_152574chr9------164
NM_152605chr1911032 5456 289 205 121 37 1166 --
NM_152608chr12114 52 --1802 --
NM_152624chr565239 4566 1631 1599 1314 188 27277 5076 26816 788 12565
NM_152641chr1242871 2573 2120 277 ------
NM_152678chr322601 1937 22186 803 ----
NM_152705chr1331078 535 455 1374 2173 26 --
NM_152753chr6102035 1399 1345 755 479 322 284 90 67 52 ------
NM_152756chr533364 1492 593 13953 1654 --
NM_152758chr832418 828 318 --11924 1542
NM_152787chrX11569 11038 13193 --
NM_152835chr131819 721 549 --1380 --
NM_152903chr1311143 21064 555 22770 200 --
NM_153040chr15----124 --
NM_153262chr133143 2884 2300 12352 1115 1470
NM_153343chr462406 2270 1500 908 280 188 1215 22011 452 --
NM_153350chr1671631 1511 1495 1449 1418 544 185 11697 11250 --
NM_153365chr432354 668 516 --11798 --
NM_153367chr10143670 3637 3574 3402 1452 1273 1183 1117 743 713 701 428 293 41 --53913 3761 3586 2845 1190 --
NM_153456chr13145698 5621 5519 4671 4605 4561 2445 2093 2018 1605 1449 713 631 489 44927 893 646 522 26257 466 --
NM_153487chr6134711 4625 4514 4434 4357 4227 3949 3819 3715 1281 860 818 326 11630 64553 4440 3548 3129 1545 30 --
NM_153607chr512785 2656 623 1722 --
NM_153619chr1573529 2670 2216 1365 694 370 311 13332 32880 823 188 --
NM_153620chr761780 418 405 314 70 25 1511 ----
NM_153688chr1651896 1596 491 118 44 ------
NM_153712chr263815 3160 1288 365 112 87 --13397 1335
NM_153810chr1074241 3899 3673 3644 741 547 484 --1809 --
NM_170711chr193913 697 366 --1275 --
NM_172071chr1107178 6292 5630 5451 5404 2273 2049 1480 1452 164 37050 5737 1259 32374 2180 433 --
NM_173475chr1651279 1199 1118 665 637 --11537 --
NM_173510chr223897 748 44 ------
NM_173511chr253817 3783 3681 2835 1143 --23730 186 12736
NM_173536chr444863 1405 1320 1084 24573 1652 14980 --
NM_173595chr12105185 4601 3937 3781 3219 2062 1435 765 230 130 45326 3745 3695 3681 32076 1877 650 1931
NM_173681chr772014 1829 1672 1472 1302 517 250 11634 31729 1490 1312 --
NM_173683chr861563 523 456 256 172 75 ------
NM_173822chr21283 --11757 --
NM_173825chr342896 2765 2116 845 12862 2550 443 --
NM_174916chr153967 945 338 ------
NM_174934chr1162861 2396 2311 964 864 630 33301 1258 591 31342 1219 1040 --
NM_175061chr751601 617 407 332 31 --193 --
NM_175607chr331656 636 203 11290 11434 --
NM_175736chr12157688 6963 6432 6249 6177 2762 2697 2649 2594 2324 1452 1285 1013 432 424 --56256 4869 2316 1472 662 15134
NM_175767chr51448 --21505 1283 1127
NM_175854chr1352758 2397 2365 2192 655 --12547 --
NM_176823chr152923 2789 2429 1504 643 --13093 --
NM_177968chr242002 1844 631 220 --21620 671 --
NM_178140chr562631 2143 1691 1056 1031 667 12297 22752 369 12069
NM_181291chr14----1665 --
NM_181672chrX1494 --147 --
NM_181784chr262479 2402 1936 1892 1052 253 ------
NM_182485chr423676 2985 21279 182 ----
NM_182515chr1975567 4814 2673 1206 415 370 214 35774 332 168 44366 1794 1615 294 --
NM_182526chr14112858 2769 2477 2386 2163 2109 2018 799 658 549 96 --62909 2519 1253 833 816 636 1119
NM_182540chrX1641 --1588 --
NM_182664chr131947 1896 1655 11548 124 11870
NM_183376chr1532572 2449 2083 12612 11707 --
NM_183397chr20104798 4746 4495 4369 4200 3420 3275 1322 1008 277 13597 45123 4162 233 126 --
NM_194247chr233688 1502 177 12901 ----
NM_194286chr12236176 6107 6002 5678 5535 5514 5324 5118 5083 2486 2403 2073 1971 1891 1778 1738 1645 1383 989 865 841 792 327 --11688 12038
NM_194314chr185249 5046 4411 3422 1126 1077 941 365 14928 24295 1480 13658
NM_197941chr552152 2018 1979 1037 913 --11899 1137
NM_198270chrX73362 2912 2621 885 782 345 39 ------
NM_198507chr5----1128 --
NM_198513chr831439 296 135 ------
NM_198568chr62991 412 ------
NM_199129chr203894 478 137 --4995 440 321 33 --
NM_199320chr492688 2425 2394 1933 418 398 325 95 26 --12828 --
NM_203394chr1242399 1756 706 612 4818 747 739 469 ----
NM_203459chr141641 777 554 373 ----22245 615
NM_203494chr151198 ------
NM_206853chr653621 1647 353 336 29 --12733 --
NM_207387chr1781505 1477 1422 1254 1164 1150 536 208 11224 186 --
NM_212467chr1592625 2509 2365 2331 1816 940 636 610 112 --11067 --
NM_213589chr295591 4965 4889 4767 3962 3881 2215 1745 1260 12239 24436 3405 --