TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-297
miRNA Sequence: AUGUAUGUGUGCAUGUGCAUG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000052chrX43212 2462 943 39 1959 92736 2732 2726 2714 2706 2698 2694 949 947 --
NM_000110chr1147 11030 2781 108 1405
NM_000125chr694148 4059 3914 3494 3286 3062 104 91 60 ------
NM_000167chrX21364 348 --2729 392 --
NM_000222chr42703 675 2793 744 22150 2026 --
NM_000280chr1151006 942 783 763 187 1776 ----
NM_000297chr461797 1702 1666 1578 1419 1254 1199 22000 1907 --
NM_000314chr1083057 3045 2937 2416 558 392 221 156 1821 --11284
NM_000325chr44692 510 480 435 2701 626 1237 --
NM_000325chr44692 510 480 435 2701 626 1237 --
NM_000330chrX22084 767 --1393 11859
NM_000332chr696898 6841 6280 4837 2433 1539 1102 718 617 26068 6012 35393 4857 4827 --
NM_000393chr252052 1873 1852 1495 787 11500 2849 529 --
NM_000448chr1153007 2464 2405 863 477 --12627 --
NM_000489chrX73434 2847 2800 2686 2553 2387 162 ----1392
NM_000533chrX--11694 41866 1862 1856 1848 --
NM_000599chr274260 3922 2844 977 969 850 803 1988 24289 380 --
NM_000633chr1864761 4643 1867 1730 807 606 1765 11820 1127
NM_000726chr21200 --1906 1304
NM_000767chr192365 211 11021 --1202
NM_000811chr52593 580 ----1585
NM_000813chr574080 3571 3413 2225 907 836 672 23449 436 44586 3464 3460 3456 11017
NM_000814chr1571276 1214 1026 590 479 204 157 --92612 2608 746 257 253 249 122 118 114 --
NM_000824chr44817 782 247 217 1268 ----
NM_000826chr412618 12276 22482 375 11991
NM_000868chrX62330 2051 1901 1709 561 42 --31925 449 124 1484
NM_000875chr1556949 6258 6201 4354 1191 --26383 1757 --
NM_000899chr1274354 4304 4169 2761 1694 1015 34 34204 3213 645 24389 4385 --
NM_000901chr472525 2141 1939 1723 1592 915 580 22464 1627 1486 1780
NM_000902chr342508 972 548 499 --1863 --
NM_000949chr51765 ----1866
NM_000958chr521193 829 --21352 67 1454
NM_001001481chr883332 2225 2185 2138 1229 560 212 196 ----12243
NM_001001484chr1072273 2173 2141 2110 2078 2003 646 --11629 --
NM_001001664chr283434 3312 2968 2707 2580 1549 1359 838 33656 1156 243 33499 1361 881 --
NM_001001668chr1963450 2822 2802 1187 1087 272 --12857 12860
NM_001001890chr2173384 3339 3303 2895 2744 1720 555 --14329 --
NM_001002243chr24263 172 147 69 1948 1807 --
NM_001003406chr2243046 257 227 199 --4279 209 205 201 --
NM_001003652chr1887513 7126 5495 5472 5400 2217 2104 1007 37057 6715 2119 36537 6480 356 17012
NM_001003674chr1887097 5164 5020 4802 2719 1095 1044 959 1166 56890 4769 2131 1527 937 11611
NM_001003681chr222728 120 --61866 158 136 132 128 124 --
NM_001003712chr1263486 3227 3063 677 280 254 --33781 3197 3065 --
NM_001004065chr923971 3488 --43563 3551 3545 850 23517 145
NM_001004317chr664394 3643 1788 1614 1251 1002 2361 56 1299 24537 3128
NM_001004356chr44335 315 235 204 --4575 505 349 252 1327
NM_001004360chr21673 1357 3675 659 560 --
NM_001005473chr5145732 5319 5304 4780 4761 2036 2020 2008 1989 1962 1800 1751 568 59 35021 2060 1687 36051 4300 2073 22030 2023
NM_001005505chr32640 595 --31537 1535 597 --
NM_001005845chr821921 134 --21646 1642 11649
NM_001006600chr53816 739 305 1210 22164 307 --
NM_001007257chr11447 ----11318
NM_001008564chr1341861 1765 502 356 1493 32050 462 339 --
NM_001008925chr453290 2532 2500 1258 100 --13259 --
NM_001009958chr7----1589 1594
NM_001010861chr172732 2463 2433 2135 1120 613 406 ------
NM_001010888chrX43841 864 732 303 33115 1738 29 14287 --
NM_001010895chr972085 1565 1324 597 551 479 187 21802 843 ----
NM_001012393chr1135102 1033 478 11782 --14310
NM_001012756chr1932942 2792 943 --2853 373 --
NM_001012761chr562729 2125 674 174 151 100 --2330 328 --
NM_001013031chr1022687 873 13523 21120 295 --
NM_001013415chr42627 43 --21138 629 11312
NM_001013620chr12178352 8254 7721 7570 7034 6133 6114 5897 5845 5594 5128 1504 1388 1295 739 585 152 17121 58120 5818 5606 1884 1442 45902 5861 5837 5543
NM_001017969chr93493 98 92 --1442 --
NM_001018004chr15------2651 155
NM_001018067chr185259 4801 4564 4319 3364 1902 1146 424 --41807 1739 1534 620 --
NM_001020658chr141473 1171 1095 292 ------
NM_001024660chr321200 1086 21460 1281 1475 11660
NM_001025076chr1065630 4719 4174 1975 1837 376 1269 24313 2379 --
NM_001025077chr1056988 6077 5532 1734 326 21627 870 25671 328 --
NM_001025079chr363968 3201 2888 2729 1283 892 --11303 --
NM_001025108chr263900 3706 3677 1092 509 326 --53906 3902 3686 3244 870 --
NM_001025366chr641838 1693 1549 1225 --31540 356 352 --
NM_001025580chrX63044 1647 1561 1436 1270 236 22664 1401 33308 1651 1440 23726 2722
NM_001025780chr921629 317 1469 1570 11356
NM_001029863chr673234 3087 2221 2154 1290 944 134 21244 492 42945 2669 946 425 22421 2199
NM_001029875chr552790 2471 1079 620 330 22091 672 2771 505 2774 353
NM_001029998chr44452 405 280 53 --21114 1112 11147
NM_001030007chr1653876 3082 3032 1509 603 --12694 --
NM_001030055chr1473710 2996 911 649 638 547 94 2890 252 156 23860 3044
NM_001033087chr2063241 2789 2613 2328 1304 870 ------
NM_001033117chr344337 625 468 372 --4446 442 376 340 --
NM_001033576chr1722673 1043 1387 11701 22571 1048
NM_001033925chr1031889 787 648 ----1410
NM_001035260chr102614 200 --1273 1495
NM_001037132chr74551 337 196 86 --1832 21602 1590
NM_001039590chrX53959 3593 3173 2903 823 13253 24030 3701 24033 2541
NM_001039618chr1121319 733 --44258 1836 1832 881 --
NM_001039840chrX125878 5397 4994 4876 4701 4668 4179 1249 707 459 238 225 --55969 5411 5401 244 240 25702 476
NM_001039937chr1342838 1361 931 735 11591 41468 428 399 95 --
NM_001040001chr641811 1383 511 501 --41776 1752 1334 1282 --
NM_001040057chr7178 ----11380
NM_001040110chr71326 --4370 366 347 335 11660
NM_001040142chr222143 828 --4852 836 818 814 --
NM_001040152chr754733 3432 3191 947 938 13232 24166 900 --
NM_001040159chr441433 1012 337 222 11387 1112 --
NM_001040214chr651909 1770 551 487 430 --71840 1774 1661 1659 1649 1607 108 1145
NM_001040284chr1644806 651 519 480 --35516 1642 1601 11606
NM_001040402chr452837 2028 1110 989 609 1632 22708 595 --
NM_001040429chr1333333 1018 535 33340 665 420 1951 33407 3094 579
NM_001040441chr113500 11607 24932 675 11408
NM_001040665chr7105018 4128 4084 4020 1576 714 653 640 441 207 130 43787 3280 3159 378 23190 1569
NM_001040712chr942603 2458 1063 71 --3900 896 892 --
NM_001042355chr1633935 860 511 1304 45390 1954 1444 832 --
NM_001042413chr954140 3911 3560 1153 540 13697 23533 1652 --
NM_001042473chr1031611 1360 241 1755 3151 145 141 --
NM_001042481chr1472460 2137 2107 1720 984 897 75 11698 1901 --
NM_001042550chr952045 1627 1264 474 160 11499 11287 3458 307 85
NM_001042555chr12114698 4348 4189 4007 3474 3462 3286 504 307 269 198 24313 3064 23699 3268 11167
NM_001042599chr2117532 7520 7007 6924 5818 5359 4905 4759 2995 1592 502 32136 1531 803 26928 5829 36226 5876 4853
NM_001042603chr1254200 1414 1185 330 185 --21217 1213 13813
NM_001043318chr1443967 3578 3430 2520 13868 13985 --
NM_001044305chr611036 2426 317 21135 1111 --
NM_001046chr552946 2845 2377 757 364 ------
NM_001049chr1431888 1675 1568 --11610 12162
NM_001106chr378690 3848 3329 2139 1324 1219 455 --109476 9334 8764 7430 7424 6075 5934 3210 1367 1365 --
NM_001146chr81909 --42211 883 879 382 --
NM_001204chr2127458 6973 6882 6632 5899 5711 5666 5622 2960 2942 571 467 15852 36069 2138 53 12549
NM_001241chr24915 807 287 62 --3809 654 586 --
NM_001256chr1742451 2049 608 156 --32444 2440 2347 --
NM_001257chr1651475 1459 1006 946 248 --61514 1353 1010 974 952 385 --
NM_001289chrX41663 1636 291 58 1377 21609 420 21179 297
NM_001304chr1743702 3396 2747 1052 11327 --1538
NM_001364chr1153410 3346 960 513 65 21118 711 14055 11156
NM_001429chr221356 11020 1724 2866 163
NM_001438chr1--1921 32751 1273 703 22743 706
NM_001495chr831013 970 951 --41019 1015 1003 993 --
NM_001621chr732999 2609 921 13055 22992 197 1284
NM_001627chr342407 654 335 41 11947 32250 1540 666 --
NM_001650chr1853971 3101 973 446 241 1766 --23890 3873
NM_001668chr121609 573 --11613 22035 769
NM_001701chr941454 1448 1059 574 ----11207
NM_001709chr1132630 2502 132 --162 12869
NM_001854chr141420 1162 115 40 --1117 175
NM_001858chr675049 4443 3700 3658 3384 1654 1371 --23673 1837 --
NM_001938chr141543 1529 536 162 --1502 --
NM_001969chr1451271 1140 928 271 184 --13900 --
NM_001977chr471671 1558 1441 1080 489 463 202 11360 ----
NM_001981chr162287 2164 1610 967 813 247 ----12363
NM_002006chr495338 5275 4089 3744 3584 1835 1380 568 332 15409 34453 715 334 21644 423
NM_002015chr1322178 934 1288 --12848
NM_002158chr273501 3012 2571 2334 1435 968 427 11105 43224 1455 1453 1449 22602 2511
NM_002214chr755543 5451 5197 4016 1788 15562 25186 1984 --
NM_002239chr23771 442 362 1233 6474 470 464 456 452 450 --
NM_002245chr11567 ----1537
NM_002265chr17----11141 11123
NM_002270chr5155604 5445 4716 4695 4231 3988 3822 3676 3594 2277 1688 1391 1242 1182 877 24482 360 14277 --
NM_002310chr556238 5925 5167 1198 948 15397 46569 5021 1719 305 --
NM_002336chr1254611 3753 3647 1064 924 21984 1880 21299 985 --
NM_002487chr151654 1795 1516 1519
NM_002500chr251032 1003 858 526 506 --1834 1897
NM_002581chr9105521 5500 4987 4322 3889 2004 1801 1652 866 237 1365 54970 4940 549 346 239 --
NM_002594chr201100 12225 61915 1909 1889 1885 1859 1842 --
NM_002645chr1152994 2959 268 144 52 --32366 2355 60 --
NM_002655chr8115197 4745 3615 3558 3522 3455 1933 1578 1348 753 258 14212 21926 1327 14650
NM_002709chr273596 3320 3264 786 692 642 46 23313 2431 12590 --
NM_002736chr73724 408 213 --31856 1432 619 --
NM_002822chr1231803 1766 283 --11441 11360
NM_002833chr1521632 439 --2613 611 11626
NM_002843chr1183253 2790 2388 2143 1158 599 352 62 --11222 13285
NM_002874chr952170 2118 1906 1871 1534 ----1226
NM_002959chr111318 --33887 3883 3879 --
NM_002968chr161899 --21002 430 1866
NM_003022chrX1272 ----21242 133
NM_003042chr362002 1647 1487 1410 435 327 --32098 2081 1503 12281
NM_003043chr343308 1143 1077 357 14167 1339 1328
NM_003059chr51140 1314 --1286
NM_003155chr832716 821 657 12700 22376 2364 --
NM_003205chr1562123 1780 1681 1460 521 454 11924 --1401
NM_003246chr1521451 477 1230 11453 11513
NM_003257chr1551019 964 395 292 179 --1400 11128
NM_003262chr364554 4210 4010 3957 1626 1177 --14882 --
NM_003385chr21205 --3673 671 667 1873
NM_003392chr333175 2856 293 13616 53355 3237 1447 1443 1431 --
NM_003410chrX92954 2691 2613 2599 918 911 615 405 223 11168 3875 869 155 185
NM_003411chrY41835 1759 289 89 11443 ----
NM_003430chr1911487 ----11689
NM_003463chr673105 2723 1153 532 392 270 60 1224 11272 --
NM_003468chr243933 3880 1339 1025 --23786 1525 --
NM_003471chr342261 2061 1911 247 --11924 --
NM_003478chr1163232 2384 880 846 824 396 12184 11144 --
NM_003489chr2173392 2913 2798 2460 1221 1069 158 --22514 2512 --
NM_003590chr233948 3621 835 34052 3927 530 1917 1514
NM_003615chr373569 3009 2452 1548 1336 389 24 33452 1528 722 238 28 --
NM_003618chr221312 1156 11068 31229 274 230 --
NM_003622chr1232631 944 613 --1519 177
NM_003644chr1746296 2164 1668 324 14248 26582 4091 --
NM_003677chr126367 242 222 200 166 128 11654 16246 230 226 214 208 204 192 186 182 150 136 134 116 110 96 90 --
NM_003722chr342627 2054 1770 585 --1354 12738
NM_003743chr21567 --141 152
NM_003794chr33836 248 89 11105 199 2703 102
NM_003861chr1432136 641 432 ----11994
NM_003872chr2----6922 914 910 906 902 900 --
NM_003895chr2152187 888 765 517 508 12118 21875 475 1487
NM_003916chrX61108 532 459 326 303 284 --1305 11254
NM_003972chr1041209 1137 1125 225 --2912 902 --
NM_003981chr1511017 --1215 11045
NM_004064chr1221253 95 --173 11151
NM_004124chr1453360 3264 2858 2641 1214 13321 13266 12450
NM_004171chr11109602 9456 8019 7614 7456 7078 2763 2647 2087 1379 13331 78863 7291 3049 3045 3021 2960 2426 22700 1736
NM_004172chr521988 1918 --31995 519 517 11710
NM_004225chr82973 492 11421 --1327
NM_004229chrX12052 12251 --11763
NM_004232chr1831240 577 449 --2481 479 --
NM_004241chr101758 --3697 693 689 --
NM_004272chr521793 561 --31597 1356 1256 --
NM_004293chr963352 3036 1543 659 502 493 --13764 --
NM_004323chr922485 1802 --42682 2673 2653 2644 --
NM_004342chr721976 704 --32252 1520 711 1714
NM_004392chr1382424 2271 2087 2006 1966 944 578 281 ------
NM_004397chr1164246 3109 3005 1022 879 182 --21042 1038 --
NM_004432chr942188 2138 1834 72 32240 1583 43 11963 --
NM_004459chr1721916 1815 ----1485
NM_004464chr444328 1708 1446 962 11609 43935 3198 1651 342 --
NM_004501chr184116 3767 3308 3224 2659 2503 1282 29 11434 43731 2669 1384 1380 --
NM_004586chrX175205 5013 4962 4627 4405 3942 1796 1427 1401 1233 936 818 664 511 475 312 271 14471 23340 477 14807
NM_004612chr974557 1862 1723 1369 1010 616 539 24131 564 13227 --
NM_004687chr1711376 1422 --22079 1402
NM_004719chr1252258 2121 527 487 81 ------
NM_004730chr531785 337 62 ----32088 2078 853
NM_004745chr866540 4936 2620 2606 1190 633 12256 15698 --
NM_004748chr1573966 3928 3606 2953 1300 1219 383 23541 1615 14122 --
NM_004774chr1762946 2874 2765 2103 626 327 ----13166
NM_004801chr221471 1295 --31188 1138 1134 21036 99
NM_004849chr611146 21475 1300 2668 630 --
NM_004850chr22538 131 --41201 470 135 123 11633
NM_004852chr181413669 13097 12255 11403 10352 9800 9581 9016 4745 4534 3993 3722 1179 506 29354 9168 414001 3969 3965 2641 --
NM_004869chr1831570 1456 1292 --11200 21461 286
NM_004929chr831178 255 111 1581 21158 175 --
NM_004949chr1841963 1613 404 197 ----21810 75
NM_004956chr774563 4449 4397 4280 4128 3901 3120 --24260 1081 --
NM_004985chr1274336 2985 1083 776 278 115 31 --24300 3608 --
NM_005063chr101857 11499 63724 1096 1092 1088 740 622 --
NM_005065chr1474414 4062 3714 890 704 557 267 35396 3461 2125 23273 792 1547
NM_005121chr1742396 1541 1026 367 23172 217 23306 2358 1846
NM_005126chr31883 1142 42145 2141 2137 1867 --
NM_005156chr935239 3635 516 1345 --1492
NM_005233chr3112232 2155 2148 2060 2043 964 926 838 636 531 284 --32401 803 401 --
NM_005238chr1133531 3146 2710 13310 33156 3152 3150 12303
NM_005375chr62412 405 1883 1793 --
NM_005400chr232064 1091 250 21143 1035 --11229
NM_005406chr1841566 1458 1443 70 1491 ----
NM_005578chr354260 3903 1537 1469 1165 11051 24162 3905 --
NM_005587chr152332 56 --4175 128 110 106 --
NM_005596chr925867 4359 1821 36114 2053 2049 --
NM_005665chr174572 3348 3224 1884 1326 1048 1030 --31101 463 94 --
NM_005668chr5104230 4071 4047 4013 3978 3869 3661 3636 3179 1602 13721 13587 14018
NM_005725chr142474 2387 1860 1679 1777 82330 2328 2322 2318 2292 2278 2146 541 12203
NM_005748chr1222129 100 52877 2607 765 418 46 22800 2796 --
NM_005754chr541205 934 285 21 130 1287 --
NM_005779chr543203 2821 2264 177 1674 22825 2755 --
NM_005780chr131721 --2637 347 1350
NM_005795chr212350 12024 32109 1887 367 1974
NM_005839chr1------2818 752
NM_005898chr112516 280 12928 --22527 549
NM_005941chr864169 3672 2774 1332 1001 721 33174 2589 1156 22758 618 --
NM_005955chr134410 1078 1067 --35215 3645 3641 --
NM_006037chr254539 3964 3708 1741 1479 --34500 3607 187 11010
NM_006080chr722306 1109 --3836 834 76 --
NM_006153chr33585 416 157 --1161 --
NM_006241chr352447 2437 1871 1819 107 --42081 1811 1491 841 --
NM_006251chr592788 2334 2072 1333 1323 991 328 87 42 13011 1229 13256
NM_006306chrX42163 2101 1327 571 14637 21590 1378 --
NM_006330chr861456 1307 468 437 187 124 --1472 --
NM_006420chr2033293 3112 198 --22848 2724 --
NM_006526chr202321 139 --1240 12037
NM_006544chr1463939 3768 1865 866 534 357 14564 1896 --
NM_006547chr742062 1611 1383 626 11771 31897 1551 99 11441
NM_006595chr113739 655 99 --3729 725 721 --
NM_006599chr16117435 7235 6424 6272 6158 5334 3296 2999 1418 1352 908 27049 3077 67679 7675 6532 2052 2048 303 --
NM_006614chr3113658 3339 3007 2904 2351 1419 901 878 381 96 81 23058 1135 21247 505 --
NM_006626chr932540 626 576 21022 358 --22624 219
NM_006703chr61475 ----1506
NM_006717chr953322 2851 2403 902 422 13281 2437 426 --
NM_006734chr641636 422 301 127 ----21628 1522
NM_006750chr1656507 6451 6141 4954 2732 35610 1818 1407 38082 8022 6715 --
NM_006754chr72465 405 --21088 378 --
NM_006813chr6------3283 136 103
NM_006827chr1423347 876 11342 52412 1329 1273 1210 1028 --
NM_006852chr1732738 1796 925 --42664 2164 2158 582 12171
NM_006874chr45874 834 405 183 115 --1376 1118
NM_006885chr1654208 3533 2666 389 161 11274 23742 3136 --
NM_006902chr152661 2356 2162 1144 1107 --23314 2946 --
NM_006914chr921490 520 --2530 524 2315 222
NM_006915chrX1474 ----12150
NM_006981chr942823 2729 2383 1019 22326 1830 --1997
NM_007006chr1633064 2173 407 12407 2596 60 --
NM_007007chr1263899 3854 3533 2984 1172 833 12996 21234 272 11856
NM_007013chr81659 --2279 261 1865
NM_007038chr2195756 5555 5452 5378 4424 4405 2202 950 448 14355 24593 696 1956
NM_007054chr533964 3711 599 --43968 3290 3159 168 --
NM_007106chr1342334 2295 1047 232 --1686 1439
NM_007114chr383237 3137 2403 2394 700 447 407 319 1286 --1337
NM_007124chr641999 617 301 200 1517 2610 37 --
NM_007125chrY2542 176 --21149 940 1545
NM_007146chr1742302 2092 1846 1020 1387 21071 484 12876
NM_007159chr331513 481 22 --3465 459 408 --
NM_007238chr2051422 1405 1255 485 47 13392 --1868
NM_007331chr442663 476 234 198 --1377 12745
NM_007373chr1051474 1443 1161 371 319 ------
NM_012081chr563094 2465 2445 1196 1063 721 --2573 559 --
NM_012092chr251597 1295 745 729 535 --3738 734 110 --
NM_012096chr343698 3650 3565 448 13588 11466 11345
NM_012120chr642831 1199 634 376 ----1853
NM_012156chr2032439 150 113 --22265 184 1955
NM_012214chr255905 5417 2306 477 287 15364 2428 329 --
NM_012249chr252810 1407 763 493 338 --23417 1060 --
NM_012257chr74383 323 242 39 --141 --
NM_012262chr174833 4740 4669 3994 3216 2107 415 24610 2050 21430 254 --
NM_012302chr12811 33 --1191 2387 175
NM_012395chr753061 2962 2932 2238 2189 ----13150
NM_012399chr2231652 366 284 --3476 277 162 --
NM_012464chr462962 2767 2689 1810 242 55 32279 471 97 ----
NM_013233chr23947 557 483 11379 ----
NM_013374chr322665 1077 11057 11173 1764
NM_013437chr841183 570 415 211 131 ----
NM_013995chrX22368 1687 --21853 1833 162
NM_014048chr1675196 5162 3654 3634 3354 1491 1256 24316 3877 ----
NM_014106chr1542480 1876 361 342 --22677 250 12506
NM_014112chr864771 3525 1588 1535 1120 366 --31894 658 652 --
NM_014117chr1642406 1933 1803 473 1598 2263 59 11796
NM_014166chr131338 1904 31079 340 23 --
NM_014182chr121603 1121 --1650
NM_014271chrX1143 --3851 847 99 --
NM_014319chr1231828 1789 394 --2749 731 --
NM_014331chr4147803 6885 5878 5741 5378 4991 2827 1496 1116 1048 862 439 308 134 17301 65399 5397 2847 2782 2778 1707 1964
NM_014363chr1341302 1136 1061 797 ----1391
NM_014372chr1------22061 1512
NM_014415chr351442 357 322 271 101 --21525 1366 --
NM_014423chr5105484 5399 5271 3966 1498 1353 1091 505 424 77 21564 1041 13515 --
NM_014488chr11------2607 183
NM_014554chr1231806 921 433 31482 585 357 4933 929 445 435 12084
NM_014606chr451539 1247 1057 619 61 --11501 --
NM_014612chr921329 622 ----1611
NM_014630chr1554033 3642 3583 2689 907 23681 3416 23381 3379 --
NM_014682chr822018 1891 11912 --1921
NM_014705chr731804 1706 1592 --31884 1816 1812 --
NM_014720chr1011694 11724 31667 1663 1659 --
NM_014784chr11299 --31022 1018 994 1346
NM_014803chr1021157 763 1568 52243 2138 1864 1071 1067 --
NM_014832chr1362052 1626 1472 420 358 188 --2680 645 1223
NM_014839chr12972 402 --1476 12134
NM_014841chr611058 --11288 2486 375
NM_014904chr1083941 3849 3001 2814 1443 527 518 110 --2531 460 --
NM_014906chr1743059 3051 2532 87 --1354 --
NM_014932chr321289 444 11649 21925 122 1170
NM_014935chr143589 2566 2558 373 --33548 3519 958 12745
NM_014936chr632601 2385 351 --12231 12808
NM_014946chr231066 1058 121 1733 22905 2903 1175
NM_014978chr1021409 469 11193 21766 1751 1397
NM_014989chr651845 1804 1433 278 216 --2297 285 --
NM_014991chr4----12485 22470 1076
NM_015017chr141208 831 173 63 --1833 --
NM_015032chr1352432 1883 178 166 151 1627 21913 955 12096
NM_015035chr2066412 2347 2243 1978 1113 89 --64907 2023 2021 2009 324 322 --
NM_015042chr1523057 1201 --11105 23510 630
NM_015074chr154854 3549 1223 987 439 --1284 --
NM_015076chr653441 1642 1607 135 112 13755 11547 23711 3452
NM_015132chr741930 1876 1638 1622 1657 ----
NM_015137chr862454 2443 996 142 119 93 ----11784
NM_015172chr121386 237 1293 21431 1427 --
NM_015192chr2032900 2698 1042 --31050 1044 484 --
NM_015215chr11340 23121 515 1120 2131 80
NM_015216chr551338 1310 1174 602 418 --1503 --
NM_015265chr242578 2409 2016 983 22438 1741 21887 438 --
NM_015267chr1251768 1731 437 272 28 --12131 --
NM_015271chr454312 3150 2816 1126 409 13488 44210 3185 1182 1170 --
NM_015275chr1271978 1827 1723 455 413 388 25 --1397 --
NM_015285chr1862557 2382 2315 1836 1717 207 --11655 --
NM_015296chr133991 812 306 --1847 --
NM_015313chr1164765 4438 4199 904 753 564 24206 3670 24726 1332 --
NM_015328chr732989 2746 922 167 22962 2958 --
NM_015335chr1252647 2622 2064 886 718 1365 --11034
NM_015455chr544126 3614 3231 981 --23701 3408 1690
NM_015458chr824247 770 24928 1879 45048 5044 5042 775 2778 702
NM_015548chr631000 963 650 --3935 652 402 --
NM_015550chr71494 --23089 900 12862
NM_015554chr1562723 2228 1827 1809 1167 268 12888 12840 --
NM_015564chr583574 2540 1405 1281 922 733 307 69 ----1272
NM_015569chr174352 3293 3124 1802 388 287 55 13419 34647 3670 3407 --
NM_015678chr1351385 1250 1176 1155 259 --11192 --
NM_015691chrX32598 434 149 --41018 971 153 109 --
NM_015852chr783520 3182 3131 1028 876 708 608 524 1389 --23370 779
NM_015878chr822257 1861 ----1328
NM_015885chr114875 763 546 90 --1572 --
NM_015886chr8175558 5537 5493 5411 5136 4769 3927 3613 3478 2205 1898 1704 1572 480 350 91 85 --55678 3530 922 356 354 45115 3807 728 397
NM_015888chr183121 2579 2461 2123 1153 823 801 235 22292 909 22613 139 1488
NM_015906chr154438 3963 3446 1919 783 11734 34377 4375 446 --
NM_015995chr1554844 4578 4177 3420 837 ----14180
NM_016009chr134778 1943 978 1838 --151
NM_016081chr462004 1826 1781 357 297 262 --1397 --
NM_016120chrX2875 267 --1269 1915
NM_016123chr121542 --2372 37 1468
NM_016133chr281522 1187 357 312 306 216 163 65 --21034 152 --
NM_016206chr388178 7732 7289 6346 5828 5630 1807 1671 13576 25902 2839 21340 920
NM_016271chr1832037 1615 717 --51631 1429 921 901 897 --
NM_016300chr32460 354 --2428 155 --
NM_016396chr1552735 2712 2118 2011 586 --31997 689 189 1785
NM_016531chr4113751 3720 3553 3200 1511 1320 1263 1171 1106 869 835 21577 890 33729 3308 3172 --
NM_017420chr14113866 3631 3586 3479 3266 2584 1230 474 452 340 166 1122 ----
NM_017437chr1462136 924 733 683 476 417 ----196
NM_017551chr1032647 400 139 12413 22135 109 --
NM_017594chr932947 2821 767 33325 3187 2826 ----
NM_017610chr1561763 1337 823 686 275 166 1576 11339 --
NM_017628chr494713 4616 4484 3359 708 671 656 546 460 34607 4536 947 23716 109 13597
NM_017633chr633512 3295 2738 --41083 1064 1051 813 --
NM_017637chr968106 5939 5713 1744 831 817 12524 66322 3484 300 294 146 144 26313 3237
NM_017754chr664782 4343 3921 3803 3113 1370 --13625 24877 3896
NM_017769chr1453153 1037 500 473 190 12560 22379 357 --
NM_017813chr8145811 5695 5481 5311 5264 4758 2084 1490 1356 1206 351 254 241 230 ------
NM_017848chrX3989 947 629 --111098 1094 1090 1086 1082 1078 1074 1070 1062 1058 1050 --
NM_017910chr21124 ----1129
NM_017919chr931902 1703 1594 22258 1208 --25840 4032
NM_018008chr31338 --2385 381 161
NM_018027chr1052395 2269 2056 1017 522 --33042 3040 2856 --
NM_018036chr1443496 1742 935 502 13653 12812 1156
NM_018092chr1631524 497 43 --31681 1629 1418 --
NM_018105chr83470 146 45 --21117 459 --
NM_018150chr12132 85 1886 2117 113 1347
NM_018157chr1283258 3188 2353 2096 1193 1095 902 189 --71207 1203 1199 1185 1181 1173 889 --
NM_018214chr611287 ----21037 264
NM_018416chr1242090 2065 725 263 11979 1107 12095
NM_018440chr888226 6873 6733 5643 3328 2511 923 905 16592 11340 18229
NM_018444chr821846 468 11610 41848 470 421 39 --
NM_018448chr1231214 1110 31 2490 41 ----
NM_018566chr154434 4156 3897 3451 1992 43763 1631 749 384 24464 213 13900
NM_018584chr11336 --2995 264 1271
NM_018698chrX71955 1572 704 519 505 266 199 11810 1209 --
NM_018717chr462632 2523 2286 802 543 219 --12269 12274
NM_018718chr721460 112 --31843 1841 1650 --
NM_018841chr183614 3175 2798 2406 1445 1201 481 293 --22573 2410 12578
NM_018847chr91631 11646 51483 621 617 605 601 --
NM_018947chr794623 3050 1708 1409 1199 1183 1167 632 84 14559 1810 --
NM_018948chr131359 279 270 ----1971
NM_019045chrX283 28 --2326 262 1609
NM_019096chr621050 719 --21090 1062 --
NM_019116chr1673493 2453 1082 975 967 508 399 12565 ----
NM_019117chrX93436 2746 2549 1304 1002 718 670 398 193 32803 1157 732 1720 1649
NM_019555chr331510 1454 113 --11398 --
NM_019593chr2072981 1048 994 975 712 438 276 --22913 515 1738
NM_020116chr441765 1622 645 514 11723 1167 11495
NM_020140chr12--1218 --2265 254
NM_020336chr2073616 3470 2937 2780 2773 2360 1226 --23620 229 --
NM_020337chr453089 1222 420 264 70 --23076 2198 --
NM_020353chr321570 805 11744 2538 252 22061 255
NM_020374chr1221385 163 --1445 21695 386
NM_020390chr374225 4199 4146 3674 3616 3422 1759 --13381 1534
NM_020403chr1341125 350 162 41 21457 188 --11128
NM_020405chr1754483 4293 3724 1766 1663 ----14511
NM_020463chr231472 1054 976 ----1109
NM_020699chr134053 106 80 ----14058
NM_020734chr1273062 2317 2261 2191 1114 813 454 1678 42485 2299 2112 2108 12856
NM_020747chr53202 195 58 --2222 218 --
NM_020771chr621106 959 11490 11004 1594
NM_020772chr1776257 5744 5738 3417 2094 1788 749 26818 1129 57998 5748 2385 153 149 48428 2177 827 134
NM_020774chr1876137 5795 5556 4062 1935 792 419 15509 34839 4085 1328 --
NM_020782chr1254427 1414 792 450 380 --51870 1218 488 122 118 14045
NM_020791chr17----51035 287 281 271 265 --
NM_020792chr342047 1747 885 680 12138 21066 67 --
NM_020794chr151444 1387 604 456 64 1299 --1461
NM_020800chr31468 --21225 146 1563
NM_020801chr552206 545 330 234 194 11830 21709 962 11005
NM_020802chr1193303 2769 2144 1135 805 620 604 266 59 --23317 3307 --
NM_020824chr103761 601 259 1219 1175 --
NM_020899chr1741947 1633 834 292 --11906 11636
NM_020935chr283609 3337 3151 800 753 449 289 29 23759 1331 23345 685 --
NM_020940chr1012457 ----22727 219
NM_020951chr1952450 852 693 559 171 --9844 806 771 704 659 653 642 638 581 --
NM_021038chr36953 884 502 308 204 140 --12873 --
NM_021072chr542621 2374 2044 1958 12265 62625 2355 2351 1727 162 158 --
NM_021097chr232958 1149 130 --346 40 36 --
NM_021101chr331846 578 368 --32331 457 308 --
NM_021148chr722343 2298 --32048 2044 1928 12008
NM_021183chrX3967 221 143 ----1291
NM_021229chr1241256 1109 903 839 --21174 110 11136
NM_021954chr1332399 1269 1115 12749 12725 12548
NM_021961chr1197477 7300 6236 4876 2735 1212 1026 854 48 1391 65858 1232 1218 1216 753 37 --
NM_021964chr376287 5809 5721 5033 4794 657 538 --31409 904 902 --
NM_022351chr853606 3124 2940 2684 814 --33239 3128 1428 21554 1116
NM_022475chr43730 248 181 --1190 --
NM_022497chr343377 3283 2692 626 --12380 13303
NM_022735chr131574 1407 1342 --21329 1224 --
NM_022763chr343090 2225 1270 103 --33092 3015 482 --
NM_022781chr952886 2136 883 506 53 12217 23151 2076 12066
NM_022828chr531787 1497 147 --1149 --
NM_022893chr243165 2558 504 488 22496 831 12135 --
NM_023943chr3----168 159
NM_024315chr71160 1474 --1353
NM_024524chr363153 2864 2368 2284 530 471 12853 32312 408 244 --
NM_024613chr831733 1463 478 11331 11715 11586
NM_024624chr231466 520 313 11295 2304 300 1147
NM_024665chr334113 841 637 31486 1172 1152 61504 1502 312 292 140 136 13311
NM_024686chr14451 401 141 31 --2159 116 172
NM_024692chr241817 1791 1596 1411 1725 21821 1810 --
NM_024751chr431835 1743 541 --11942 11885
NM_024808chr133664 108 49 ----1830
NM_024852chr13499 438 103 --1478 154
NM_024913chr721623 236 21664 1280 21527 131 --
NM_024920chr421564 1356 --1358 21066 1012
NM_024953chr1241714 880 782 228 --4906 900 890 886 1162
NM_024989chr2116694 6630 6599 5488 2689 2682 2476 2015 1847 1831 1261 25273 275 37912 2673 2017 17602
NM_025054chr853860 2667 410 245 174 23514 478 ----
NM_025106chr1--1242 31479 1475 1471 --
NM_025134chr1642590 1798 918 786 ----12243
NM_025154chr741339 1260 84 38 --11355 187
NM_025160chr173401 3074 1134 723 550 435 105 --11196 --
NM_025191chr112377 33433 2765 706 21230 979 --
NM_025222chr392240 2137 1926 1148 1128 1115 596 538 324 ----12994
NM_030621chr1494155 4113 3426 3035 1522 1386 1147 1021 169 ------
NM_030625chr10--1702 11890 11895
NM_030627chr533891 3219 3208 24120 402 --1374
NM_030648chr495062 5046 5000 4874 3991 1926 1351 827 144 14026 13646 15622
NM_030650chr273738 3306 3063 2816 1314 718 161 ------
NM_030665chr1731270 1204 970 --31280 1276 1274 --
NM_030806chr1129399 8783 8734 8669 8417 7997 7362 6003 2845 2128 2039 1713 --89389 7453 6371 6014 6012 6008 5994 5988 --
NM_030816chr163675 3510 2960 1070 989 970 33695 3208 336 32673 2465 212 --
NM_030918chr155447 5249 4862 3995 686 --41241 1237 1214 1185 --
NM_031372chr441285 1050 379 224 ----11536
NM_031442chrX22982 2303 1981 42653 2635 2627 869 12821
NM_031483chr2063120 3079 3044 2536 1231 539 --1353 1383
NM_032145chr631215 603 521 3489 415 362 2530 26 --
NM_032199chr1063149 1377 1099 1028 928 155 12973 23151 588 --
NM_032217chr42952 524 ----1955
NM_032228chr1163462 1123 1028 1010 326 33 --31311 697 354 --
NM_032289chr51628 --41936 1893 663 642 --
NM_032325chr11----21971 1967 22028 584
NM_032410chr83875 833 45 1488 --1346
NM_032433chr1931241 276 236 --41580 1576 1572 281 --
NM_032446chr572858 948 806 778 577 464 379 --13544 1640
NM_032451chr16----5138 115 92 88 84 --
NM_032558chr941438 599 206 28 ----11351
NM_032682chr363511 3110 2852 2713 2284 1319 1734 13014 --
NM_032859chr1393983 3958 3767 3591 3566 1375 929 513 193 12753 23677 3485 11435
NM_032866chr1542860 2124 497 408 12583 32991 2970 2889 --
NM_032873chr1154279 3936 3309 551 492 ----14100
NM_032968chrX64103 3138 3064 1297 1062 447 --1631 --
NM_032973chrY64095 3133 3059 1297 1063 447 --1631 --
NM_033083chr342329 728 142 42 --23360 3149 11141
NM_033132chr1332223 1661 683 12129 31925 361 357 --
NM_033224chr757447 7194 6965 2663 2635 11789 11108 11825
NM_033225chr872374 2223 2173 1197 720 195 75 --52357 2353 2201 2197 2193 12362
NM_033285chr8104102 3602 3372 3042 3003 1507 635 587 287 237 13023 13734 --
NM_033389chr1773745 3699 3033 2974 1068 627 130 --34405 2983 75 --
NM_033495chrX5840 826 814 676 235 --4698 690 684 680 --
NM_033656chr2164996 4956 4306 2178 1319 340 --32033 446 255 --
NM_044472chr1--1171 --2762 723
NM_052832chr821090 586 --32768 2450 1094 11111
NM_052867chr131277 --1574 11489
NM_052879chr1264032 4025 1555 1397 1375 1078 1979 43615 353 240 230 --
NM_052885chr1264383 3289 3106 1131 713 371 11834 24868 952 --
NM_052900chr831736 1275 286 11547 --11202
NM_052907chr1253489 2935 2613 1459 636 44013 1263 1148 957 62623 2619 2615 786 483 419 12846
NM_053064chr1452819 2804 2709 2033 743 ----12513
NM_080546chr92596 223 11502 31735 127 51 1558
NM_080867chr1461907 1196 674 299 274 179 13392 14934 --
NM_080927chr323177 1029 --42802 2362 1045 1043 --
NM_130386chr181457 1272 2676 418 --
NM_130808chr32385 299 --2104 102 --
NM_133265chrX53175 2359 678 670 284 ------
NM_133638chr531271 1150 1066 1953 --1102
NM_133646chr275539 5235 3938 2235 2200 2061 433 34718 4230 970 14872 23533 265
NM_134268chr174912 421 401 354 --5467 459 451 447 405 --
NM_138288chr1442200 2014 753 400 --1402 --
NM_138333chr972428 2246 933 806 460 269 236 1684 ----
NM_138426chr712259 12443 --1439
NM_138468chr295806 5556 4944 4038 3961 2337 1221 970 807 24376 628 21028 961 25058 4041
NM_138473chr1243525 3250 636 28 --43341 3337 644 640 --
NM_138731chr1473925 3825 3437 2691 1584 1302 350 24082 2595 43549 3545 3529 435 12700
NM_138779chr13----132 1228
NM_138782chr53566 374 112 1801 ----
NM_139279chr243446 3407 1297 280 22897 875 --132
NM_139318chr141220 --474 70 61 45 --
NM_139321chr2024087 3086 --34091 778 762 --
NM_144571chr4146222 5814 4907 4775 4686 4235 2667 2211 2007 1776 1436 981 776 549 12035 21988 1593 15166
NM_144578chr1444286 1056 636 68 1182 44702 4700 3736 516 --
NM_144632chr252181 1990 915 689 277 --1462 11907
NM_144664chr111865 --2733 148 1303
NM_144710chr221036 526 --21317 1250 --
NM_144963chr852096 931 865 263 139 12659 --12703
NM_144973chr121108 14250 15280 1679
NM_145176chr653492 3477 2938 1199 491 11385 23508 3401 --
NM_145808chr751258 1159 1111 760 376 22909 2826 22390 256 12225
NM_147128chr721044 103 1228 1223 1486
NM_152263chr134983 833 736 16066 34458 1968 878 --
NM_152380chr151079 436 422 411 381 --6440 401 385 363 351 143 1429
NM_152409chr593189 3067 2579 2476 2444 1409 863 684 492 1799 180 --
NM_152424chrX31442 1152 445 --64708 436 426 402 398 366 --
NM_152475chr1942757 2386 837 504 --22246 2236 --
NM_152519chr231803 688 318 1226 7457 386 344 338 330 326 322 2431 349
NM_152527chr211655 --1212 12373
NM_152594chr1532154 615 543 --12249 --
NM_152608chr162492 2476 1646 1574 961 948 --22360 2160 --
NM_152641chr1252797 2661 1095 895 54 --1328 --
NM_152665chr131120 409 367 1445 ----
NM_152745chr761099 859 460 436 274 237 --21103 248 11106
NM_152756chr574086 3838 3761 3559 2733 784 31 --22951 1231 --
NM_152774chr7122657 2440 2192 2096 1908 1101 1006 776 765 758 732 339 22027 296 42679 2663 2659 2629 --
NM_152787chrX33935 3912 2755 --32741 581 577 --
NM_152996chr152085 1643 1517 532 229 --21528 836 --
NM_153184chr341997 516 503 315 --41999 1948 260 245 --
NM_153262chr162895 2528 2420 1223 620 389 --32626 2428 220 12443
NM_153371chr1371879 1773 1534 1469 905 444 112 ----22093 1853
NM_153607chr543095 3086 2940 1103 --1547 11108
NM_153634chr1221449 1085 --11440 11034
NM_153689chr232020 1805 1499 --1552 --
NM_153810chr1065090 3553 3194 1916 1530 1404 --13851 --
NM_153836chr232157 1756 739 1273 11458 11522
NM_172070chr211453 --62002 1998 1799 1534 807 120 --
NM_172071chr152670 1926 1647 1219 395 --51785 1781 1777 1707 332 14565
NM_172127chr441861 212 198 128 --21747 1726 --
NM_172375chr1411154 --61008 1004 995 979 948 944 --
NM_173468chr4125996 4937 4558 4445 4370 4334 4304 4030 2063 1928 493 200 --25485 1539 --
NM_173475chr16----41371 1365 1320 1316 --
NM_173519chr821486 84 --21978 69 11582
NM_173576chr1011873 1779 --1162
NM_173602chr1243728 2867 1522 1247 33528 1175 1046 1257 --
NM_173665chr53297 147 136 1687 1305 --
NM_173667chr521948 444 12142 41979 1977 1705 232 --
NM_173683chr8--2517 212 21231 1227 11462
NM_173808chr141694 858 722 507 1623 14444 14258
NM_173822chr222144 1627 ----1766
NM_175607chr341350 456 255 152 1379 --21593 322
NM_178011chr1042685 2269 1141 780 --1536 --
NM_178013chr14----22798 2755 12748
NM_178509chr17103942 3694 3189 1296 427 357 279 268 174 100 1571 31279 1277 1273 1246
NM_178539chr1262059 1945 1754 1551 665 47 1641 22024 1524 12010
NM_178565chr831572 1530 272 11587 21532 548 1567
NM_178826chr123576 530 246 ----1610
NM_181291chr141286 --3309 305 301 --
NM_181504chr513386 --43901 3881 3877 170 1270
NM_181705chr555729 5224 5215 3749 1193 ----25194 3595
NM_181712chr1--31945 1320 425 21480 135 --
NM_181782chr682157 2009 1782 877 851 685 582 255 11917 4753 749 747 345 --
NM_181784chr232055 218 60 ----12538
NM_181787chr853344 1498 1408 950 940 23492 818 41429 923 748 553 --
NM_181836chr562242 2090 932 771 665 112 ----12307
NM_182485chr453178 883 770 757 475 --31312 129 78 --
NM_194282chr422355 1905 2917 315 11951 1614
NM_194285chr1133396 3385 126 13427 13398 --
NM_194314chr1105530 3824 3517 2067 1956 1884 1745 904 587 547 45033 1671 729 470 32043 1252 1061 21983 1074
NM_198150chr52980 481 ----21500 39
NM_198270chrX53094 2562 2545 696 448 12970 --11316
NM_198273chr542173 868 832 515 13067 22066 859 22152 521
NM_198567chr51336 ----1207
NM_198715chr176267 5100 4494 3832 2448 1843 1782 16077 36164 1383 355 --
NM_198947chr112744 199 --41038 733 731 323 --
NM_199072chr742857 2296 1223 990 --43210 2271 2114 2110 12123
NM_203301chr1451542 527 423 365 35 --31067 369 244 --
NM_203406chr542594 1857 1781 559 11094 42889 940 783 38 1460
NM_203459chr142196 1679 1660 485 1954 ----
NM_206853chr62594 582 --1586 23958 2744
NM_206854chr663708 3660 1855 1843 328 149 --21847 1079 25219 4005
NM_207303chr1053528 2740 1609 1576 1210 31629 813 309 --13485
NM_207311chr1211174 --41241 1237 830 826 --
NM_213609chr3----177 182
NM_214711chr4103851 3826 3725 3242 2616 1331 1218 564 364 300 --43687 2708 1017 1009 23415 2670