TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-298
miRNA Sequence: AGCAGAAGCAGGGAGGUUCUCCCA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000024chr5----1133 --
NM_000037chr81706 --11910 --
NM_000044chrX----158 --
NM_000051chr1142945 2596 2271 729 12826 --1705
NM_000081chr151326 1297 696 606 183 11830 ----
NM_000088chr172360 322 ------
NM_000089chr71327 ----1108
NM_000092chr284596 3935 1737 1691 1409 1260 749 399 24269 1387 33076 2842 121 24516 708
NM_000125chr674016 3780 3249 3208 2649 370 80 23814 3770 44138 2890 183 176 14221
NM_000127chr8----1217 --
NM_000141chr1041338 1195 301 205 --21054 582 11319
NM_000153chr1451687 1631 1175 553 103 21166 627 ----
NM_000163chr512085 11467 1364 --
NM_000189chr2----1103 --
NM_000208chr1954328 1211 1178 357 136 24741 3011 --14612
NM_000214chr2021544 156 1418 21583 309 --
NM_000217chr1244841 4322 3640 3423 13648 25326 1755 1718
NM_000232chr432314 2103 1137 43246 2939 2646 543 13227 --
NM_000238chr71303 ------
NM_000264chr953099 2672 2419 1062 435 12126 13334 --
NM_000282chr13----1215 --
NM_000286chr173910 812 295 ------
NM_000297chr41343 21874 1590 --1134
NM_000307chrX----2336 280 --
NM_000310chr15995 923 875 429 238 21150 477 1180 --
NM_000314chr1052568 1186 472 356 348 32549 1226 1218 --22257 740
NM_000321chr1341605 615 354 87 11554 11615 1508
NM_000332chr6176474 6408 6217 5428 4914 4787 4620 4474 2841 2789 2590 2439 2404 2245 866 733 116 16810 ----
NM_000342chr172611 189 ------
NM_000346chr1721939 1482 21796 762 --11830
NM_000351chrX84296 4250 3225 2654 1664 1525 1394 1102 22919 775 1233 --
NM_000353chr1611239 --11151 --
NM_000362chr2263376 3204 2756 2495 1066 237 12592 12902 12464
NM_000368chr9114531 4202 3968 3904 3565 3316 1648 902 632 600 369 34883 4457 1013 1916 --
NM_000386chr173790 762 310 --1710 --
NM_000390chrX63111 1170 806 711 515 330 --13164 --
NM_000393chr231548 456 418 ------
NM_000397chrX31879 1857 482 1904 12411 12418
NM_000399chr102964 317 ------
NM_000408chr283120 2749 2707 2669 2407 2128 503 435 21389 255 11277 23439 1136
NM_000411chr2162126 1176 982 493 129 121 ------
NM_000414chr51256 175 1221 --
NM_000430chr1793077 2510 1444 1279 1087 938 511 421 354 13759 --1472
NM_000437chr141449 1386 708 224 --21514 1503 --
NM_000449chr121216 303 11129 11336 1476
NM_000461chr374581 4271 4073 3717 3112 992 855 14444 13465 --
NM_000462chr1561718 588 523 371 305 255 --31394 1303 337 --
NM_000484chr211127 1787 ----
NM_000486chr1252914 2566 1254 828 434 ------
NM_000489chrX73134 2713 2413 2300 2240 498 445 32811 2436 1279 1707 12742
NM_000492chr711327 1261 11087 --
NM_000530chr11381 11081 --1760
NM_000555chrX147850 6793 6328 5708 5620 5488 5349 5265 1950 1909 1497 1398 1026 326 36662 2646 1435 167 1347
NM_000573chr162305 2149 1940 1425 476 320 12350 21725 214 --
NM_000597chr2------1307
NM_000602chr751324 413 389 124 98 ------
NM_000615chr11123008 2688 2161 1832 1084 1018 966 918 903 703 629 522 12884 1147 11866
NM_000617chr1212239 ----124
NM_000618chr1276276 5904 5162 5094 4600 2591 2558 11615 26010 4167 --
NM_000633chr18115013 4937 4886 4870 4774 4475 4341 3848 1897 453 351 25091 4640 --13861
NM_000684chr102281 259 1942 21059 503 --
NM_000693chr153244 108 84 1394 --11685
NM_000719chr12154658 4621 4563 2524 1848 1697 1557 1511 1382 1350 1281 847 784 705 123 21883 389 1860 --
NM_000721chr142102 1993 390 220 ------
NM_000724chr1031522 1235 184 1582 ----
NM_000725chr121820 1243 1800 --
NM_000734chr1--11016 ----
NM_000813chr575258 1949 1658 1182 898 694 658 25237 4904 24312 166 14201
NM_000814chr1564118 3665 1365 1118 764 696 52619 1259 1204 600 264 ----
NM_000818chr101381 ------
NM_000826chr442444 1643 881 185 21678 440 ----
NM_000828chrX31975 574 225 ------
NM_000833chr1631355 1271 1142 ----1147
NM_000834chr1231139 949 909 --11101 --
NM_000860chr431574 1280 274 ----11492
NM_000868chrX72305 2105 511 505 309 250 72 22515 1919 ----
NM_000872chr1051065 573 320 253 155 1537 2515 65 --
NM_000875chr15136917 6834 6749 6493 5887 5538 5480 2829 2354 2253 1344 766 589 27084 5935 ----
NM_000891chr17103520 3316 3237 3010 2573 2407 2379 1279 1060 442 32441 847 739 12660 11076
NM_000899chr1223235 98 --11595 --
NM_000901chr44842 762 445 336 1689 1698 1567
NM_000912chr873150 2632 1284 1228 1104 893 283 11363 --21111 781
NM_000919chr5180 --1160 --
NM_000921chr121184 --1492 --
NM_000933chr2041740 1518 1375 46 31677 688 471 ----
NM_000938chr4------1142
NM_000945chr221802 780 21580 1326 133 12033
NM_000950chrX103631 3514 3338 3122 2691 2217 1170 488 235 187 1444 13033 --
NM_000963chr172220 2130 965 436 424 219 182 ----1104
NM_001001323chr1283219 3038 2293 1199 1130 888 680 458 12824 ----
NM_001001394chr22681 35 ----192
NM_001001396chr194451 1641 1537 1523 1314 1018 953 854 815 24314 2719 23875 1073 --
NM_001001419chr5135178 5128 4402 3785 3266 2040 2033 1977 1904 1894 1004 798 656 45211 850 689 475 35083 3613 1934 14172
NM_001001436chr16----132 --
NM_001001549chr752844 2618 2517 2141 1968 52770 2578 758 400 94 ----
NM_001001556chr1561444 1283 1201 1166 401 61 --189 --
NM_001001664chr263019 2674 2622 890 861 95 64105 3951 3888 1273 773 372 13788 --
NM_001001669chr532185 1760 861 ------
NM_001001787chr11198 ------
NM_001001790chr92342 121 --1360 --
NM_001001870chr17--1814 ----
NM_001001890chr21103696 3203 3119 3103 1193 1075 863 665 657 336 ----14273
NM_001001933chr12487 475 --1510 --
NM_001001971chr10--11130 --1928
NM_001001974chr1011569 1563 --11820
NM_001002026chr351740 686 430 395 92 ------
NM_001002243chr23911 583 313 1756 ----
NM_001002838chrX31731 1209 90 21868 172 ----
NM_001002909chr1731525 1493 1433 --31633 752 230 1351
NM_001003407chr10154914 4877 4716 4485 4295 4131 4119 3995 3778 3552 3525 3284 1775 1227 732 1864 13988 13748
NM_001003652chr18198579 8543 8052 7880 7698 7566 7450 7191 6635 6419 6195 5582 3218 3122 2809 2289 1146 599 549 56765 3095 2637 1448 1166 21088 51 --
NM_001003665chr162768 1043 821 802 102 92 1964 ----
NM_001003674chr18117035 6347 6117 6086 5863 5137 1444 871 829 819 140 31170 1092 637 11948 11635
NM_001003681chr221661 ----11766
NM_001003682chr121016 1002 ------
NM_001003688chr431134 1011 762 1847 11124 --
NM_001003891chr22----1128 --
NM_001003940chr1533494 2461 690 ----23353 1364
NM_001003954chr8----1394 --
NM_001004196chr3--11208 21095 499 --
NM_001004360chr231830 1747 520 2306 253 1285 --
NM_001005209chr2----1675 --
NM_001005271chr1721172 419 ----11129
NM_001005291chr17----162 1484
NM_001005336chr92594 136 ------
NM_001005354chr122433 42 ------
NM_001005366chr125960 667 150 49 26 1838 2762 756 --
NM_001005386chr252185 2006 1787 606 233 --21623 912 --
NM_001005404chr1764481 3679 3142 1311 974 149 11640 1559 --
NM_001005463chr1071860 1848 1687 1649 912 903 843 22133 411 1771 --
NM_001005739chr21861 ------
NM_001005920chr16----1261 --
NM_001006115chr361924 1865 1763 1726 1042 995 12759 12581 --
NM_001006600chr522445 823 11660 1481 --
NM_001006612chrX----1387 --
NM_001006946chr231823 1510 566 21339 515 21188 189 --
NM_001007067chr83984 885 873 ----163
NM_001007072chr152234 91 ------
NM_001007097chr984419 4341 3632 3536 1932 1892 327 125 25002 1205 1379 --
NM_001007102chr671333 1321 1057 329 222 215 34 11184 --21274 623
NM_001007156chr1521874 1257 11545 ----
NM_001007226chr1731118 1013 1005 1427 ----
NM_001007246chr2181930 1394 1261 1228 629 528 482 370 ----1177
NM_001007277chr11--1365 --162
NM_001007277chr11--1365 --162
NM_001007471chr92651 155 ----1583
NM_001007553chr141200 1184 408 394 1356 1961 --
NM_001007794chr11760 138 ----
NM_001008220chr532691 2635 1087 ------
NM_001008225chr7183 163 --2595 587
NM_001008239chr1833798 1312 805 1370 33505 2390 560 --
NM_001008407chr721476 1412 11643 1507 --
NM_001008408chr7105834 5505 5411 4873 4805 4738 4562 1173 929 600 65843 5163 5119 5008 4528 1524 14644 --
NM_001008493chr111750 ------
NM_001008495chr872085 1819 1741 1488 310 270 165 22079 560 ----
NM_001008564chr1321895 416 32142 1965 1955 1836 --
NM_001008711chr82494 59 1348 --11713
NM_001008738chr572833 2807 2664 937 697 190 152 32887 451 134 ----
NM_001008801chr1922192 1685 22078 282 ----
NM_001009552chr8--2549 102 ----
NM_001009555chr41136 21394 76 21738 1271 --
NM_001009569chr1031515 1172 469 31579 1362 1315 ----
NM_001009571chr731449 352 239 1328 ----
NM_001009880chr22114930 4250 4048 3722 3682 3558 3339 3203 1354 1314 860 34903 4776 1459 1650 --
NM_001010861chr122470 200 12575 1634 --
NM_001010867chr176106 5374 5227 4885 4766 2640 711 --22233 1966 --
NM_001010891chr5166560 6509 6423 5785 5460 5322 4928 4656 4281 4248 2131 1191 992 576 330 290 24449 1382 21172 447 --
NM_001010924chr102951 498 1364 21201 858 --
NM_001010942chr121906 ----1822
NM_001010971chr13764 712 359 1679 ----
NM_001010989chr163561 366 132 ------
NM_001011515chr421063 949 ------
NM_001011553chr7--3962 931 192 ----
NM_001011663chr106998 956 755 694 410 284 ----146
NM_001011666chr796012 5094 4648 4323 2548 1664 1633 422 243 24113 281 1666 --
NM_001011713chr1431214 415 214 --21437 1165 --
NM_001012267chr9184 11347 ----
NM_001012329chr142347 2313 475 287 ------
NM_001012393chr1185074 4657 4108 3459 2017 1497 536 105 34121 3663 685 11079 21313 600
NM_001012398chr161269 1853 1190 --
NM_001012423chr1562042 1808 827 697 582 418 22465 2059 22890 2316 --
NM_001012512chr18--2118 57 ----
NM_001012514chr231148 803 245 ----1974
NM_001012756chr1953043 3004 2931 2883 365 1768 12992 --
NM_001012989chrX262 42 ----1655
NM_001013415chr451091 558 479 361 241 --11432 --
NM_001013622chr411069 ------
NM_001013635chr123866 338 190 --1456 --
NM_001013690chr1252429 1926 822 546 328 --4581 510 415 177 --
NM_001013699chr12--140 ----
NM_001013739chr7--144 ----
NM_001014435chr161150 ----1432
NM_001014442chr13----1110 --
NM_001014797chr1098046 7873 7321 7156 5947 5608 5597 2842 2080 22135 777 27431 821 --
NM_001015045chr422336 2081 12378 21592 118 --
NM_001015877chrX82247 2014 1981 1008 929 686 301 222 --1630 --
NM_001015880chr1051461 1266 1188 625 26 --11653 1427
NM_001015882chr92765 387 --1949 --
NM_001015885chr20--1271 --1351
NM_001017395chr373619 3206 2695 2659 1400 1204 578 --32953 2639 1355 --
NM_001017405chr42233 100 2900 735 1360 --
NM_001017415chr13296 217 92 2660 602 ----
NM_001017420chr841431 950 531 438 11367 ----
NM_001017440chr7148283 8014 7271 7080 6876 6746 5363 3024 2627 2470 2332 1488 1170 681 35324 5252 1186 37348 2345 1963 --
NM_001017523chr12--11180 31874 1588 1480 11752
NM_001017926chr831820 1203 306 1195 ----
NM_001017963chr142630 144 --1942 --
NM_001017969chr91245 1424 ----
NM_001017998chr91955 ------
NM_001018037chr91969 --2509 401 --
NM_001018064chr961935 1905 1818 1776 795 312 11699 1498 1331
NM_001018067chr165277 4675 4072 1368 963 276 21696 930 24833 45 24695 59
NM_001018108chr1552141 1430 807 495 146 --1692 11968
NM_001023567chr1572381 2363 1829 1548 615 585 418 --12282 --
NM_001024218chr141200 2815 798 ----
NM_001024372chr83512 455 281 22016 893 ----
NM_001024401chr1631103 591 466 --22451 1900 --
NM_001024647chr12106916 6174 5637 4755 1637 1350 1193 1026 918 546 16862 1507 1118
NM_001024666chrX2676 58 --1456 --
NM_001024937chr172490 227 --197 --
NM_001024947chr52859 250 ----1171
NM_001024948chr192653 2502 1349 1303 1229 1137 757 730 271 12577 1227 13149
NM_001024948chr192653 2502 1349 1303 1229 1137 757 730 271 12577 1227 13149
NM_001025076chr10135917 5907 5858 4838 4245 3914 3822 3799 1892 1792 1659 143 132 12475 55203 3920 3832 794 679 --
NM_001025079chr374041 3439 2944 2827 2579 951 502 33788 3744 2726 1753 11312
NM_001025107chr152665 2403 2240 1807 466 --12367 --
NM_001025108chr263665 3464 2604 1351 1195 278 23598 839 13142 1143
NM_001025202chr7--144 ----
NM_001025266chr373436 3292 1091 904 548 205 46 --14315 14839
NM_001025366chr631645 1465 321 --11350 --
NM_001025579chr171330 ------
NM_001025580chrX143882 3859 3837 3785 3684 3553 3167 3080 2628 1275 340 313 305 281 21262 229 ----
NM_001025780chr931516 1107 223 1553 --1314
NM_001029863chr642785 2758 2039 698 --21131 999 --
NM_001029875chr552996 2955 2782 1091 559 --22222 2161 --
NM_001029882chr12622 586 2484 214 1601 --
NM_001029883chr233135 2927 399 21180 490 21097 1043 --
NM_001030007chr1683999 3981 3707 3402 2745 699 587 211 ----13159
NM_001030055chr1484128 3361 3143 3069 1220 1117 387 292 34141 755 561 --11153
NM_001031677chr52486 68 --1215 --
NM_001031680chr132376 1844 1701 --1261 12542
NM_001031695chr22104758 4634 4558 4523 2178 1692 497 489 215 200 1465 23573 2184 --
NM_001031746chr102280 103 ------
NM_001031812chr532263 2179 676 12244 1312 1383
NM_001032280chr631636 1203 308 11245 ----
NM_001032283chr122939 925 ------
NM_001032288chr2031506 1451 252 --11089 --
NM_001032296chr1382873 2359 1999 1853 928 729 598 247 42780 2299 1021 952 --1513
NM_001033045chr223983 1739 1971 13662 1123
NM_001033047chr42160 149 --12350 --
NM_001033059chr621522 822 32047 1715 594 1208 --
NM_001033081chr161913 1627 1595 1532 1199 26 ----11763
NM_001033087chr2063175 3130 2862 2293 1012 260 --11000 --
NM_001033117chr3124790 4589 4486 4242 3589 3293 1733 1689 1511 1484 1270 581 ------
NM_001033503chr51367 --193 --
NM_001033551chr1743979 3431 2837 411 --13797 13573
NM_001033561chr172591 147 1909 ----
NM_001033578chr82406 282 1572 ----
NM_001033723chr852575 2539 456 365 270 22510 1858 --1304
NM_001033910chr142116 1732 1688 147 1592 21761 1562 --
NM_001033925chr1021903 172 1581 11877 --
NM_001034850chr541653 1422 1392 189 1611 ----
NM_001034954chr1083177 2498 1988 1124 875 860 718 243 23007 2827 --12662
NM_001035260chr102659 421 1433 ----
NM_001035521chr2----1170 --
NM_001037132chr732147 1710 107 1876 --12086
NM_001037164chr741910 547 523 220 --11669 --
NM_001037339chr161625 1462 1306 1183 713 515 1300 --21227 586
NM_001037535chrX3525 445 77 ------
NM_001037582chr431736 1478 1185 --11331 --
NM_001037954chr11103446 2403 2376 2154 1114 773 539 459 190 159 1667 2681 651 --
NM_001038493chr241369 1362 630 547 11333 1574 --
NM_001038640chr153897 653 270 ------
NM_001038702chr572706 1945 964 919 684 616 78 22392 244 12614 --
NM_001039091chrX260 42 --1395 --
NM_001039111chr3121 1412 ----
NM_001039465chr143215 203 102 ------
NM_001039590chrX82816 2560 1568 1435 1408 1117 504 66 13722 23058 1034 --
NM_001039618chr11145840 5813 5390 4975 4909 4696 4686 3925 2383 2294 2209 754 483 390 --21467 542 --
NM_001039690chr1642134 1848 885 567 ------
NM_001039802chr111147 31154 100 25 ----
NM_001039840chrX125494 5475 5344 5055 4556 4077 3927 2089 2062 1166 416 136 43699 1062 817 198 26024 24 14019
NM_001039888chr11597 --1729 --
NM_001040056chr16----1702 --
NM_001040101chr431587 1198 348 --1123 --
NM_001040110chr741854 1837 259 187 11625 ----
NM_001040142chr242216 1723 1652 1588 ------
NM_001040167chr74902 853 302 183 --11190 --
NM_001040202chr412380 31981 1863 1031 --22139 611
NM_001040409chr241053 992 915 384 1154 1747 --
NM_001040424chr2142756 1990 1138 481 32449 2297 493 11037 --
NM_001040429chr1332444 355 309 1555 145 --
NM_001040441chr155374 4328 3715 1556 143 14242 --12058
NM_001040450chr1531865 969 411 --22287 337 --
NM_001040613chr831452 90 56 11564 --1544
NM_001040665chr764728 4656 4210 1629 1203 388 23556 242 15000 14276
NM_001040712chr943258 3197 2202 62 12714 ----
NM_001042355chr16104596 4492 3591 1358 1036 643 550 402 160 76 65401 3295 1988 1451 560 194 13353 --
NM_001042368chr9----2245 213 --
NM_001042388chr181900 --1268 --
NM_001042404chr142013 1614 357 240 ------
NM_001042406chr6----1254 11083
NM_001042413chr973327 1558 1466 1320 1242 746 57 63354 2646 1118 777 731 618 ----
NM_001042473chr1012171 1160 ----
NM_001042481chr1472691 2569 2214 1851 1832 864 662 22448 2236 12310 --
NM_001042533chr342574 954 757 750 --22814 2037 --
NM_001042599chr2187819 7713 7401 7283 6542 6476 5894 5481 5018 4994 2915 2670 2118 1746 1562 1116 662 550 12928 16144 15244
NM_001042601chr383244 3176 3151 3079 2431 862 838 358 ----12337
NM_001042603chr12154896 4705 3900 3502 3444 3386 3328 2145 1796 1506 1401 1312 965 527 344 35352 3635 1937 104660 3527 3519 3469 3461 3411 3403 3353 3345 805 14128
NM_001042604chr364394 4000 3452 1871 1516 600 24225 3742 14420 --
NM_001042681chr182092 1983 1935 1885 999 939 917 799 2884 514 12609 --
NM_001042683chr621733 1355 21846 530 --1585
NM_001043318chr14114127 3920 3722 3625 3347 2638 2559 1478 1247 766 110 --34004 3475 3442 14141
NM_001044305chr611608 ------
NM_001069chr6----141 --
NM_001077628chr11656 ------
NM_001083621chr163852 3062 2865 1619 1564 681 --13278 --
NM_001092chr1762467 2383 767 737 396 155 --11577 --
NM_001095chr1251554 1499 1208 341 299 ------
NM_001106chr3189652 7582 7500 7318 7200 6878 6842 6743 6285 3216 2680 2268 2094 1724 1549 1173 1007 896 48751 8456 8448 3911 27331 3077 --
NM_001121chr10----11800 --
NM_001123chr102684 335 ------
NM_001126chr11431 1397 ----
NM_001144chr1661397 1371 1191 922 243 74 ------
NM_001148chr432057 1980 308 1140 11445 1451
NM_001167chrX146750 6706 6678 6464 5703 2208 1941 1486 1133 1074 913 885 854 504 46536 6417 4997 370 11797 --
NM_001174chrX22217 1537 --11546 --
NM_001177chr122773 515 12226 12351 --
NM_001191chr202519 346 --21128 181 --
NM_001198chr662250 2181 2145 1893 1822 1642 1492 --22042 888
NM_001204chr2247582 7488 7430 7416 7334 7293 7187 7079 6609 6021 5813 5645 5210 2673 2284 2031 1806 1713 1532 828 617 597 426 214 56509 5832 647 208 38 27063 1354 --
NM_001206chr993067 2285 2112 2023 1099 861 560 320 271 1984 ----
NM_001218chr1562435 1952 1662 785 430 379 --1489 22683 1049
NM_001219chr762189 1556 865 819 184 52 12260 ----
NM_001221chr41125 ------
NM_001259chr7235950 5754 5585 5121 4710 4634 4301 2543 2463 2336 2238 2197 1950 1738 1712 1330 1137 1082 805 620 459 396 126 25187 1271 --1778
NM_001273chr12----1105 --
NM_001277chr1121084 411 ------
NM_001284chr51505 --2387 104 --
NM_001286chr142753 2289 965 198 --12904 --
NM_001289chrX1434 174 1263 --
NM_001290chr42429 281 ------
NM_001300chr101144 1100 ----
NM_001304chr1753814 3536 3210 3076 2640 23050 317 --1568
NM_001310chr1292958 2768 2541 2452 2288 1963 1881 978 937 21917 306 ----
NM_001315chr652149 1696 1546 463 271 --2529 371 --
NM_001326chr111369 --147 --
NM_001344chr14----1243 --
NM_001351chr331607 1346 190 --21811 1129 --
NM_001356chrX32029 1775 1546 ------
NM_001358chr4----1405 --
NM_001364chr11114412 4047 3366 1709 1679 1644 1082 860 663 448 268 1108 54067 3303 2899 1586 349 --
NM_001365chr171786 ----1764
NM_001378chr2--1340 178 --
NM_001386chr861797 1712 1591 756 708 195 22098 650 ----
NM_001390chr1863333 2693 2536 2414 1136 488 21237 1174 21187 285 --
NM_001391chr18----148 11021
NM_001395chrX2995 782 --2699 197 --
NM_001396chr2172319 2003 1827 975 891 448 235 --22479 1124 22414 905
NM_001406chr1751672 1351 557 367 346 ------
NM_001412chrX41155 1024 554 34 23386 797 13403 23379 2891
NM_001419chr19104874 4318 4154 2990 1337 1205 1121 986 773 85 --11140 24603 1174
NM_001420chr1942412 2244 2181 2092 --11925 --
NM_001427chr721935 254 --21606 444 --
NM_001438chr123687 3092 23602 3199 1530 --
NM_001448chrX31538 600 409 11725 ----
NM_001449chrX41266 522 218 65 --31058 515 446 1267
NM_001451chr1641278 1272 829 333 ----21240 522
NM_001458chr7------1684
NM_001463chr25709 645 335 161 154 --1144 1264
NM_001482chr151971 --1182 --
NM_001493chrX1596 --2287 249 --
NM_001518chr72918 161 ----1381
NM_001530chr141839 --21165 1103 --
NM_001540chr7----189 --
NM_001546chr631236 265 227 11025 ----
NM_001570chr341417 1355 1174 218 1386 ----
NM_001584chr1111097 21040 465 1223 --
NM_001616chr272582 2575 2283 515 287 238 85 13421 22966 1166 12384
NM_001621chr743010 2343 348 154 21912 634 ----
NM_001627chr362294 1965 1818 1697 770 433 22345 1801 --11523
NM_001650chr18103610 3549 3464 2961 2915 2893 1375 1341 1324 1242 ------
NM_001654chrX3446 387 161 ------
NM_001660chr34723 703 683 588 ------
NM_001668chr182285 1922 1782 1735 858 646 481 138 21838 73 --1580
NM_001677chr12836 296 2939 138 ----
NM_001693chr841081 1028 951 47 ----166
NM_001706chr32963 371 1700 ----
NM_001755chr1642038 1434 625 526 2881 209 42316 2258 2063 875 11899
NM_001759chr12195262 5004 4770 4526 3867 3582 3317 3276 2073 2040 1889 1692 1594 1093 845 693 651 111 60 11482 11050 --
NM_001760chr61309 --1737 --
NM_001769chr121103 1128 ----
NM_001810chr201808 --1537 --
NM_001821chr154532 3941 3931 1873 1336 21144 780 14887 2465 393
NM_001829chr4--2266 141 ----
NM_001838chr172862 377 ------
NM_001839chr11158 ------
NM_001842chr9--187 --1110
NM_001843chr12184 ------
NM_001845chr133548 540 231 31024 920 259 ----
NM_001855chr92816 301 1227 ----
NM_001860chr9186 --1452 --
NM_001901chr62798 725 ------
NM_001904chr32236 188 1672 --1249
NM_001913chr71624 ------
NM_001935chr2--1248 1174 --
NM_001939chrX73847 3133 2771 1470 727 265 205 ------
NM_001945chr561378 1366 1356 1139 306 248 ------
NM_001946chr121829 1412 --1361
NM_001949chr632796 679 619 1894 ----
NM_001957chr432153 1976 219 ----21607 307
NM_001968chr42871 377 --1170 --
NM_001980chr1242240 1739 1716 880 ------
NM_001981chr131940 860 318 52311 1686 1597 546 361 2312 265 21785 917
NM_001992chr521382 251 ----1505
NM_001995chr42599 547 21520 390 1316 --
NM_001999chr53946 551 358 ------
NM_002007chr113237 193 171 ------
NM_002010chr131392 1173 ----
NM_002015chr1372973 2728 2501 982 630 484 464 1525 ----
NM_002017chr11--11312 1166 --
NM_002023chr11479 --41265 526 180 72 --
NM_002024chrX21873 1375 1809 1387 --
NM_002025chrX168870 7026 6890 6701 6235 3429 2662 1979 1788 1584 1178 1114 985 798 466 129 17348 57878 6967 6821 6252 6245 16088
NM_002026chr22902 223 --1378 --
NM_002028chr142847 84 --11282 --
NM_002033chr112416 119 22916 195 1816 13681
NM_002039chr44666 132 61 22 ------
NM_002063chrX51197 976 845 361 352 ------
NM_002069chr751864 1372 1244 758 137 1255 ----
NM_002071chr181117 --1176 --
NM_002073chr2211069 1156 ----
NM_002074chr141670 1462 1266 599 11532 ----
NM_002077chr932008 611 46 11644 11638 1786
NM_002084chr52271 152 1855 ----
NM_002094chr16183 1114 ----
NM_002105chr112991 431 11006 ----
NM_002106chr41104 ------
NM_002107chr1----1482 --
NM_002112chr15----1252 --
NM_002119chr632650 1785 814 --12561 --
NM_002126chr1794029 3530 3262 3135 1659 1292 1261 461 84 43894 3818 2625 708 13766 --
NM_002128chr132597 363 1875 2529 523 --
NM_002137chr722046 1852 11973 ----
NM_002140chr91455 2762 151 1111 --
NM_002146chr1731452 944 576 ------
NM_002147chr172901 275 --1249 --
NM_002161chr92387 331 ------
NM_002166chr2--2539 244 ----
NM_002167chr13368 345 51 2487 441 ----
NM_002182chr372738 2205 1021 862 676 204 157 ----22591 2199
NM_002188chr52567 71 ------
NM_002196chr203980 193 183 1262 ----
NM_002199chr4------1409
NM_002214chr775695 5466 5284 3849 1991 1356 949 34839 4543 616 15586 --
NM_002228chr11493 1777 --1395
NM_002239chr221179 1060 1251 ----
NM_002247chr1042357 842 795 645 12300 ----
NM_002264chr394871 4358 4096 3240 3090 1297 1050 806 775 24595 939 24578 758 --
NM_002267chr1312063 --2834 694 --
NM_002270chr565349 4141 4059 3809 2151 1598 44305 1231 771 515 13957 --
NM_002271chr1362264 2229 2162 2120 1572 123 1422 --12391
NM_002274chr17171 1357 ----
NM_002275chr17------1274
NM_002278chr171224 1389 1411 --
NM_002315chr11------1225
NM_002336chr1294969 4092 4051 4044 1786 1544 1339 1158 770 31979 901 261 24526 3373 --
NM_002355chr1241418 1070 184 132 1441 11035 1257
NM_002359chr1783508 3231 2966 2891 2706 1405 1209 252 --21292 1286 11094
NM_002375chr322289 1711 22236 818 11858 --
NM_002395chr66604 520 230 215 198 182 --2985 432 --
NM_002397chr51694 ----11709
NM_002398chr221448 1148 1380 ----
NM_002408chr142590 93 1706 --1731
NM_002430chr2272467 2039 1901 1765 1001 833 470 12001 32100 1754 278 22564 262
NM_002442chr1221641 355 --11281 --
NM_002444chrX31548 1429 1260 1301 ----
NM_002449chr52925 856 1168 1483 --
NM_002460chr653685 3605 3180 2334 1246 2954 416 11054 --
NM_002465chr12------137
NM_002466chr20----1110 --
NM_002479chr13728 690 665 ----2514 67
NM_002480chr1231400 371 167 --1576 --
NM_002494chr4--1135 --1169
NM_002499chr152854 769 32418 2202 236 32069 2011 988 --
NM_002501chr1954000 2650 1532 1197 379 --24094 1315 --
NM_002504chr9----21083 764 --
NM_002505chr631145 597 97 ------
NM_002515chr1451766 1702 1644 1544 92 ----11266
NM_002522chr1753815 3139 2936 1325 395 --22822 2396 13569
NM_002569chr1511284 ----21298 449
NM_002574chr11252 ----162
NM_002575chr182114 106 --1126 2445 22
NM_002576chr1141232 926 870 417 --140 --
NM_002587chr51443 --1402 --
NM_002612chr741746 1637 1393 160 11554 ----
NM_002633chr13515 504 389 --1455 --
NM_002634chr17----176 --
NM_002646chr171889 1712 866 773 739 675 668 11844 ----
NM_002648chr651331 1003 827 439 343 --31082 451 61 --
NM_002655chr874677 4300 3359 1700 1210 361 101 14989 ----
NM_002660chr2021162 262 ------
NM_002670chr331208 343 21 2472 335 ----
NM_002699chr121346 1324 --11387 --
NM_002710chr121980 ----1230
NM_002715chr521080 244 --1272 --
NM_002719chr1462257 2011 1924 1906 1764 355 22190 54 11553 --
NM_002731chr132974 2296 483 1796 11156 --
NM_002734chr1741922 1719 674 547 11402 --11985
NM_002745chr22104441 3806 1396 1293 1164 1141 890 489 295 144 13625 23313 2950 24191 1829
NM_002749chr171267 1116 1307 --
NM_002752chr52546 417 1106 ----
NM_002756chr17----1669 --
NM_002763chr12202 167 --1220 --
NM_002767chr172431 222 1473 ----
NM_002775chr10199 ----1216
NM_002779chr10--1217 ----
NM_002822chr1221809 635 11558 1137 --
NM_002824chr12----1504 --
NM_002828chr18--2839 254 --130
NM_002829chr951230 972 927 432 402 ------
NM_002835chr73479 306 130 ------
NM_002840chr1----2494 228 --
NM_002841chr33140 70 38 ----1472
NM_002849chr1221036 967 --2829 713 --
NM_002857chr172561 2030 1697 1087 279 228 202 12235 21886 1851 1554
NM_002858chr111359 21245 1223 11332 --
NM_002867chr11302 ------
NM_002868chr1272380 2332 2303 2214 1827 874 354 --22258 377 --
NM_002874chr951960 1832 1005 841 811 12317 12243 2264 245
NM_002886chr393638 3305 1999 1829 1506 1263 1155 932 586 11958 15201 --
NM_002890chr54912 822 348 151 124 --1971
NM_002894chr18--1187 --1155
NM_002895chr202971 675 2649 46 1641 --
NM_002898chr12------1270
NM_002902chr152504 63 1567 ----
NM_002918chr1921017 749 --167 --
NM_002951chr201254 ------
NM_002957chr943570 645 367 173 ----11435
NM_002959chr174131 3605 2753 1763 1129 795 117 34417 1777 355 1345 --
NM_002968chr162754 145 11115 1102 1242
NM_002971chr3--21067 384 1350 --
NM_002998chr842148 704 453 204 11704 --21404 61
NM_003010chr1741531 537 468 233 --12435 --
NM_003011chr931369 1090 216 11650 ----
NM_003013chr4157 ----2718 140
NM_003020chr152175 168 ------
NM_003026chr911001 --21106 407 --
NM_003030chr331938 1622 712 ------
NM_003039chr1163 --1607 --
NM_003043chr344174 4106 1290 448 24213 3803 14233 --
NM_003074chr391843 1742 1521 802 538 530 409 353 335 --21400 578 --
NM_003098chr201428 ------
NM_003100chr5--1341 ----
NM_003101chr12626 491 11564 --11028
NM_003106chr31818 1909 ----
NM_003107chr632461 1675 484 22101 2070 --12610
NM_003108chr2156854 6616 6480 6233 6040 5572 5526 5427 5120 4788 4653 2125 1043 610 500 --24873 2268 27273 6606
NM_003112chr732636 2080 1988 33208 2612 901 ----
NM_003118chr551373 758 687 347 93 ------
NM_003128chr232632 685 415 22434 589 11060 --
NM_003150chr1731799 1788 57 2573 404 2393 139 --
NM_003155chr822413 219 22164 177 --1155
NM_003156chr1161355 1193 482 436 354 52 --1314 --
NM_003157chr3------1957
NM_003161chr1753548 2363 1248 1129 318 12311 1628 --
NM_003162chr24791 260 106 100 1147 --11093
NM_003170chr171459 ------
NM_003173chrX1545 1345 1356 --
NM_003178chr332240 872 297 2721 503 ----
NM_003181chr62697 597 1638 ----
NM_003185chr202931 888 31254 324 164 ----
NM_003189chr1103194 3102 2353 1358 1338 1204 1039 667 306 173 13268 1437 --
NM_003200chr1942089 1578 830 675 22155 616 11587 --
NM_003201chr102750 400 --1147 --
NM_003205chr1552294 1601 1565 558 251 ----1276
NM_003214chr62952 173 ------
NM_003221chr654125 3905 3437 1631 548 21438 1122 32803 990 579 --
NM_003246chr1561934 1697 654 253 116 58 ------
NM_003247chr671909 1766 1682 1662 1534 1414 427 11438 ----
NM_003253chr2141620 1612 1601 1575 1620 --1226
NM_003255chr1731866 389 136 51987 1058 1044 466 379 ----
NM_003257chr1561357 1330 972 907 898 244 --11388 --
NM_003274chr2172848 2408 1847 802 693 408 160 --22076 562 22051 859
NM_003275chr931231 389 107 11512 1601 --
NM_003285chr14452 350 169 35 196 ----
NM_003295chr13----153 --
NM_003298chr395949 5163 3924 2415 2115 2006 621 520 208 25911 1095 34760 1575 500 --
NM_003304chr321583 505 1207 1192 11370
NM_003337chr511172 1104 ----
NM_003339chr521625 67 --11254 1193
NM_003342chr1783213 2868 2655 2274 2252 1077 923 532 13179 21292 102 --
NM_003347chr2272335 1903 1808 1678 1650 384 211 ------
NM_003348chr1231681 1085 42 ----1645
NM_003358chr9--1137 ----
NM_003373chr1041960 1954 1942 691 1198 ----
NM_003374chr51520 140 1715 --
NM_003380chr101298 193 ----
NM_003389chr92199 172 --1231 --
NM_003404chr2021882 1341 --11899 --
NM_003406chr841561 1238 639 275 11913 11498 --
NM_003410chrX51197 723 651 623 161 12872 --1829
NM_003411chrY31646 1122 614 --21617 667 --
NM_003418chr3131 1165 ----
NM_003453chr13--1698 197 1572
NM_003455chr1131671 1611 426 --11446 --
NM_003458chr3104028 3806 3713 3697 3373 2924 2630 925 858 385 --23965 1208 --
NM_003463chr642173 1189 1060 1018 12611 ----
NM_003471chr341691 1566 1487 83 ----1938
NM_003472chr6----1963 --
NM_003483chr1222140 47 32903 2717 83 1970 21910 1822
NM_003489chr2153075 2274 362 335 168 --1525 1229
NM_003498chr1662532 2238 1000 899 679 258 2970 650 1373 --
NM_003506chr861222 1196 1167 1158 995 902 ----198
NM_003507chr231869 757 740 21565 95 --11587
NM_003558chr9--1266 ----
NM_003569chr63594 486 252 --1614 --
NM_003583chr1263764 3632 3442 2822 1471 1259 ----1738
NM_003591chr101119 ------
NM_003593chr171195 ------
NM_003607chr1113517 3293 3185 3060 2977 2854 1557 1045 994 813 345 14104 13895 14282
NM_003613chr15----3663 98 27 --
NM_003615chr3153661 3346 3101 3081 3021 2687 2655 1291 1284 1002 772 703 402 246 227 33631 496 253 --12892
NM_003626chr1151337 1293 1275 1236 372 ------
NM_003629chr153242 2958 2375 1257 419 1100 1809 21268 728
NM_003632chr171290 ------
NM_003633chr552360 2158 2029 1015 564 22051 756 ----
NM_003644chr1785442 4689 4555 4309 4275 4227 1202 1100 16273 16281 --
NM_003657chr204912 189 121 98 ------
NM_003670chr32543 224 1987 1481 --
NM_003685chr192189 61 --175 --
NM_003711chr5----1112 --
NM_003713chr171706 1587 1464 1133 707 436 316 1457 1104 --
NM_003716chr32735 88 --2983 704 --
NM_003721chr19----1141 --
NM_003728chr42665 559 --1507 --
NM_003743chr26789 750 557 325 164 72 11509 --21954 1618
NM_003745chr161353 ------
NM_003758chr152117 84 ------
NM_003760chr12542 251 ------
NM_003768chr111529 --11829 --
NM_003772chr113337 169 25 --1348 1270
NM_003787chr1841731 1550 1268 83 ------
NM_003799chr1864410 3935 3881 2988 1306 37 11128 --21254 178
NM_003800chr622236 489 11662 32306 1899 817 11878
NM_003822chr13968 882 828 --12070 --
NM_003825chr152371 163 21329 576 1290 --
NM_003827chr191441 ----1648
NM_003831chr1831759 1461 647 --1117 --
NM_003846chr13733 620 289 --1217 --
NM_003873chr1031943 980 941 22297 951 ----
NM_003885chr175859 785 395 377 169 ----12504
NM_003887chr241722 1606 841 676 32047 1661 590 ----
NM_003888chr1521597 280 --21461 1258 11445
NM_003899chr1352086 636 382 151 22 2794 261 ----
NM_003902chr13725 634 189 --1597 --
NM_003907chr31329 ------
NM_003908chr202925 907 122 11034 1255
NM_003913chr6124246 3875 3597 3258 3127 1693 1583 1560 1370 1280 1115 692 11242 --14179
NM_003927chr1851026 744 688 267 228 --184 --
NM_003945chr52500 490 1193 ----
NM_003948chr452199 1727 921 133 115 42650 2635 1863 427 21738 845 1645
NM_003956chr102420 392 ------
NM_003958chr633300 2707 1554 11077 21330 287 --
NM_003968chr3------1677
NM_003971chr172644 85 ----144
NM_003972chr10148 11291 ----
NM_003980chr61937 2556 275 11070 1594
NM_003998chr41597 1591 ----
NM_004036chr23665 581 501 --1632 --
NM_004050chr1422171 969 1729 12289 --
NM_004061chr53560 536 207 ------
NM_004080chr721364 568 ------
NM_004082chr2----1337 --
NM_004093chr1372593 2382 2311 2077 1978 839 510 12941 1399 --
NM_004096chr10102139 2016 1978 1972 1900 1799 1643 1604 1504 772 1251 2783 670 11662
NM_004113chr331784 495 442 1137 ----
NM_004124chr1493554 3153 3129 3104 2240 2177 1435 1406 356 32368 513 247 ----
NM_004162chr32813 803 1938 135 --
NM_004163chr181118 ------
NM_004170chr921360 370 31480 1470 545 ----
NM_004181chr42345 281 1120 1114 --
NM_004185chr1----1677 --
NM_004225chr831386 381 103 1538 --165
NM_004229chrX62125 1982 1544 875 269 178 --22117 1640 --
NM_004232chr1873568 2904 2464 2447 885 654 630 33726 1404 762 192 --
NM_004253chr9--1162 1674 --
NM_004263chr241624 1146 420 343 1224 ----
NM_004274chr1432948 2216 1173 32114 850 358 --12068
NM_004279chr721885 1613 --3801 793 726 --
NM_004293chr953125 2335 1113 979 121 22552 48 ----
NM_004302chr1262938 2905 1967 920 665 92 --22801 2543 --
NM_004309chr1731129 794 281 --1231 --
NM_004342chr742177 2091 1944 801 1412 ----
NM_004349chr8----11098 1924
NM_004370chr662179 1554 1489 1446 657 59 22004 1513 11727 1468
NM_004379chr211270 2689 638 1242 1159
NM_004389chr23754 678 582 ------
NM_004393chr342023 373 233 220 32373 2366 1726 11463 --
NM_004395chr51530 ----1779
NM_004397chr1173758 3032 1545 1346 1012 764 263 11706 13678 11610
NM_004418chr2----1191 --
NM_004421chr1----1816 --
NM_004426chr1231634 1580 1232 1650 21397 593 1118
NM_004428chr12802 651 ------
NM_004431chr13845 753 735 ------
NM_004432chr952393 2359 1713 833 413 --12093 --
NM_004436chr1--1529 --191
NM_004437chr143389 2921 2901 190 23432 2476 23411 966 --
NM_004438chr253148 2531 833 334 240 --1928 --
NM_004441chr331235 1066 863 ------
NM_004442chr141117 1065 666 588 ------
NM_004451chr111729 ------
NM_004454chr361970 1501 864 741 724 248 12285 ----
NM_004458chrX42573 1060 774 251 21628 181 12253 --
NM_004459chr1752036 1742 1475 803 383 41901 1875 1441 1326 ----
NM_004468chr12565 114 1617 ----
NM_004482chr21175 1167 ----
NM_004492chr15151 --136 --
NM_004501chr121149 536 22993 732 ----
NM_004506chr61500 --1137 --
NM_004525chr2----1619 143
NM_004529chr921393 1174 ------
NM_004537chr1221298 1092 1134 2488 50 --
NM_004540chr212777 170 ------
NM_004555chr162533 42 ----1432
NM_004566chr1062469 2226 2121 2059 696 358 22555 38 --2810 552
NM_004575chr441445 1349 1262 79 21491 524 164 --
NM_004583chr17--2728 186 1244 --
NM_004588chr1144004 3126 2926 976 12598 --24028 3010
NM_004593chr31139 2227 169 ----
NM_004612chr964842 4043 3439 3101 764 193 24052 1075 1659 2927 118
NM_004622chr231739 726 706 --1526 --
NM_004630chr1121210 1075 1999 ----
NM_004637chr311231 --1893 11332
NM_004642chr123628 482 461 1172 ----
NM_004643chr142553 539 1584 ----
NM_004651chrX1293 --1360 --
NM_004663chr1571385 1238 1053 605 379 138 89 1977 ----
NM_004671chr181131 ------
NM_004697chr92267 98 --1427 --
NM_004709chrX61439 1379 1312 1189 715 335 --21816 1550 --
NM_004716chr112811 217 1893 ----
NM_004717chr721554 490 --1283 --
NM_004719chr1242908 1896 648 381 12486 --22200 180
NM_004730chr541930 1815 1735 1603 --1818 --
NM_004742chr351653 1544 1250 1196 186 --21268 130 --
NM_004745chr866516 5182 4514 1291 1114 81 12666 21343 195 16765
NM_004751chr151340 --1160 1418
NM_004758chr171935 --1319 1959
NM_004760chr74965 883 579 567 ----1351
NM_004762chr1741987 1680 1623 494 --1141 11525
NM_004772chr551519 1313 1277 471 79 11464 ----
NM_004774chr1743049 2499 2154 1233 12000 32493 2447 2400 --
NM_004781chr141104 678 460 52 1199 1541 --
NM_004786chr18----1196 --
NM_004788chr1162060 1895 554 498 81 74 --21675 619 11866
NM_004789chr9------1287
NM_004798chr2093444 3412 3204 3164 2410 1383 974 635 45 12663 ----
NM_004799chr1294 25 ------
NM_004831chr191438 --11013 --
NM_004834chr233248 960 702 33357 3074 3048 ----
NM_004839chr154636 539 523 501 --178 194
NM_004846chr2162 ------
NM_004849chr63657 447 331 11608 21355 68 1260
NM_004852chr181913108 12518 11526 10857 10056 9933 9869 9092 8846 5284 4892 3349 2822 2216 2062 1134 1088 907 182 411255 8921 1691 889 212297 1220 23018 1703
NM_004857chr1494083 3755 3260 3172 2909 1028 474 368 192 23325 1060 11588 13844
NM_004861chr221260 ------
NM_004863chr1485318 5097 3762 3448 1407 1218 1122 630 33853 3350 266 188 --
NM_004866chr585069 4521 3366 3176 1930 880 854 31 54588 3315 3245 1813 698 --1642
NM_004874chr8----1483 --
NM_004902chr201220 1292 ----
NM_004906chr62181 78 --1195 --
NM_004921chr142594 1719 635 272 22560 1928 ----
NM_004930chr12607 70 --1197 --
NM_004937chr172927 593 1347 1709 --
NM_004938chr92784 321 --11105 --
NM_004952chr12814 771 --1779 --
NM_004956chr7123856 3685 3400 3018 1508 1502 1340 1331 584 216 87 31 54445 3473 1126 529 50 11110 11447
NM_004973chr621116 121 --21623 494 --
NM_004975chr2031002 991 29 184 ----
NM_004978chr1----1513 --
NM_004981chr222431 113 ----1398
NM_004984chr12----1216 --
NM_004985chr12104326 3081 2774 1431 1187 929 362 345 269 255 13893 13865 14195
NM_004992chrX247455 7146 7053 7019 7008 6729 6638 6377 6203 5587 5519 5428 5414 5401 5395 5188 2789 2559 2406 2370 2052 1847 1241 1234 15762 37164 5673 1853 --
NM_005012chr1----1125 --
NM_005045chr73887 865 758 ------
NM_005063chr1073740 3112 3090 2570 2513 961 444 1343 33437 2456 483 --
NM_005076chr153801 3254 1377 1051 168 1868 13412 12922
NM_005080chr222930 866 --1337 1796
NM_005095chr141682 1577 1553 650 11651 1580 11842
NM_005096chrX31058 857 287 --11252 1207
NM_005110chr51106 --2679 160 --
NM_005114chr41675 1440 --1125
NM_005116chr20114355 4278 4101 4011 3274 2806 1831 1074 505 144 107 14571 11309 --
NM_005126chr352293 2021 691 640 385 ----22029 1590
NM_005153chr162736 255 --2670 171 --
NM_005156chr944744 3403 3286 88 24723 4648 24240 3648 15279
NM_005160chr22146794 5782 5635 5507 5041 4364 2306 2233 2028 1661 505 451 377 55 25941 535 54642 4379 2279 2107 884 --
NM_005171chr122869 420 ------
NM_005180chr1031339 655 117 1272 11544 --
NM_005206chr1761106 1092 1067 341 248 150 ------
NM_005207chr22133665 3620 3478 3382 3280 1223 1178 1044 499 462 329 223 38 22601 120 13083 --
NM_005220chr1711458 ------
NM_005225chr20----1405 --
NM_005231chr1151259 977 281 177 91 --1166 --
NM_005245chr41219 ----1659
NM_005254chr1541089 1015 954 33 21354 206 ----
NM_005256chr111830 ----1172
NM_005257chr1831288 353 65 1325 --11159
NM_005259chr2--11418 11433 --
NM_005264chr101379 1613 1181 --
NM_005277chr441803 1790 1644 1596 1262 --1347
NM_005296chrX----1219 --
NM_005324chr1722022 635 2257 40 11852 1324
NM_005328chr84734 569 277 154 1547 ----
NM_005329chr1652266 1882 1791 1446 224 ------
NM_005339chr454251 3653 3006 2852 1134 34112 1242 78 13730 --
NM_005342chrX72597 2348 884 786 595 481 318 22827 574 ----
NM_005349chr4----1508 --
NM_005354chr194656 608 593 423 ------
NM_005359chr18206213 5937 5701 5620 5361 4994 4831 4389 4375 4166 2574 2273 2247 1816 1775 1365 1150 624 97 91 36474 906 563 36483 6419 1634 31899 1359 774
NM_005375chr611132 1981 --1810
NM_005378chr23814 709 160 ------
NM_005392chr92618 560 --126 --
NM_005398chr102498 120 21236 1034 ----
NM_005399chr184004 2810 1769 1674 1401 1053 267 55 23626 1455 1890 33889 1755 150
NM_005400chr272975 2642 2141 1966 1217 1107 1023 11005 42754 2630 2252 454 --
NM_005415chr23681 239 156 1597 ----
NM_005433chr1832118 2013 693 12443 1968 1533
NM_005436chr1073536 3228 2555 1514 818 538 301 --23936 3246 --
NM_005437chr1041179 439 89 31 1494 --11459
NM_005443chr41162 ------
NM_005461chr2051995 1962 1485 1270 356 21597 1432 ----
NM_005466chr14------1486
NM_005475chr1243271 2891 2369 1156 --12876 --
NM_005493chr6----1647 --
NM_005502chr963300 2553 2344 1079 973 552 23115 2487 --12561
NM_005504chr1296620 6553 6333 5867 5374 5031 757 346 291 35967 4651 1465 ----
NM_005517chr12537 33 21087 1047 ----
NM_005522chr72299 228 ----1948
NM_005537chr132163 153 ------
NM_005539chr101907 ------
NM_005552chr141527 1208 ----
NM_005561chr135926 883 208 187 87 --1857 --
NM_005565chr51589 --1609 --
NM_005575chr53560 306 168 ----170
NM_005578chr355032 3434 1864 1024 429 23401 239 --21150 270
NM_005584chr131789 --167 --
NM_005587chr153887 875 28 1312 ----
NM_005596chr9146038 5932 5021 4932 4777 4749 2514 2435 2154 2010 1861 1569 1402 389 24925 1991 ----
NM_005599chr141100 1002 532 286 11565 ----
NM_005611chr16--21262 467 1329 --
NM_005614chr721101 862 --199 11025
NM_005629chrX1102 --11181 --
NM_005634chrX2600 143 --1573 --
NM_005639chr1211772 123 11788 --
NM_005662chr8--1394 183 --
NM_005665chr174867 4715 4425 4205 3466 1782 1203 11716 13147 11144
NM_005678chr151291 11006 172 --
NM_005684chr12328 320 ----1286
NM_005715chr651971 1786 692 184 156 ----1983
NM_005719chr12--1196 172 --
NM_005721chr23911 256 54 1704 --1870
NM_005724chr15----1304 --
NM_005725chr172350 2051 2023 1590 1529 814 228 --1878 --
NM_005736chr1021037 490 --11149 --
NM_005742chr21229 ----1166
NM_005746chr782610 2456 2226 2082 991 905 825 495 ----11870
NM_005748chr1243345 2867 1298 599 21156 757 134 --
NM_005752chr1661011 996 796 469 176 152 --1240 --
NM_005759chr263856 3752 3349 1784 621 188 23594 554 --14488
NM_005762chr19----1137 --
NM_005765chrX1258 ----1578
NM_005768chr12----2704 578 --
NM_005780chr132925 845 --1809 --
NM_005819chr163501 3307 3183 1214 451 335 1722 22318 377 33150 2642 1366
NM_005822chr612017 ------
NM_005828chr1785060 5025 4693 4238 1648 1396 1370 37 --11026 --
NM_005832chr321172 978 21394 234 ----
NM_005841chr42875 264 1284 1919 --
NM_005843chr251798 1751 1549 1236 702 --21833 619 --
NM_005851chr11----1397 --
NM_005853chr161431 1240 ----
NM_005857chr161215 1156 1042 370 43 33 11476 21448 1277 --
NM_005859chr521148 362 ------
NM_005870chr1321233 225 --11299 1193
NM_005896chr2267 36 --1738 --
NM_005897chr13808 790 100 ----160
NM_005898chr1182756 2537 2437 1267 1031 871 803 208 12397 --1738
NM_005899chr172304 55 21047 448 ----
NM_005902chr1541654 1619 333 147 23956 1533 --21444 1139
NM_005907chr651662 1604 393 65 25 1129 1492 --
NM_005909chr553245 2951 2746 2636 170 --1294 --
NM_005916chr7----1127 --
NM_005920chr133915 2867 2835 22949 233 21446 1179 --
NM_005924chr7--1931 2432 279 --
NM_005930chr142742 721 --188 --
NM_005934chr1952594 2387 1023 601 367 --1990 --
NM_005935chr4135211 4805 4709 4290 3955 3268 2127 1546 1197 1084 563 475 441 143 ----
NM_005941chr8113967 3877 3705 3187 2850 1507 1342 1232 450 375 356 --23940 3596 132
NM_005955chr1145155 5145 4786 4610 4534 4461 3932 3674 3627 1952 1873 1573 930 433 44921 4896 1064 602 22199 263 12168
NM_006010chr3----1184 --
NM_006011chr1534179 2841 2798 21341 1151 --11144
NM_006016chr61293 22014 209 11410 11960
NM_006022chr1311017 1981 ----
NM_006040chr16----1267 179
NM_006043chr162679 260 --137 --
NM_006047chr2073335 3322 2901 2850 2786 2753 2493 1495 1724 --
NM_006055chr253018 2575 1253 1194 449 23190 45 11024 --
NM_006060chr7124433 4410 4398 4245 4208 4125 3752 3621 3462 2712 610 178 --12726 23779 2957
NM_006064chrX1421 ----1102
NM_006067chr163744 344 267 ------
NM_006091chr1531729 555 198 11244 11773 11295
NM_006099chr12215 135 1776 ----
NM_006106chr112709 147 13254 2314 241 --
NM_006135chr161311 404 261 197 173 97 ----11444
NM_006147chr1------1451
NM_006148chr1782904 2670 2642 2520 2064 1957 875 641 --3170 161 141 --
NM_006153chr31450 --1215 --
NM_006160chr1731630 1252 543 --133 --
NM_006161chr51250 ----1243
NM_006166chr1231858 1690 345 ----21664 974
NM_006186chr231246 1014 479 21149 123 ----
NM_006194chr1431326 1190 379 21055 405 1108 --
NM_006196chr23252 66 33 1308 ----
NM_006202chr193475 462 141 21316 631 ----
NM_006224chr174426 359 298 105 2540 29 1554 --
NM_006242chr204822 627 470 127 1307 --1343
NM_006246chr142854 391 179 --1510
NM_006251chr552978 2832 2769 1017 419 2950 813 --128
NM_006252chr1167347 6068 5923 5683 4751 2962 2692 1891 1504 1349 1241 915 805 738 73 21 25609 822 ----
NM_006268chr1131038 738 363 ------
NM_006275chr2061856 972 839 733 249 232 ----187
NM_006282chr2074484 4227 2992 1667 964 629 342 1462 42902 1654 1605 90 --
NM_006306chrX105874 4937 4700 4437 4038 3872 1814 1782 1469 1057 --1895 11725
NM_006310chr176900 885 435 330 272 30 1399 ----
NM_006311chr17--1347 --1328
NM_006317chr52792 714 ------
NM_006320chr43959 852 824 11124 ----
NM_006336chr921276 231 ----1130
NM_006357chr21395 --190 --
NM_006373chr1741382 570 292 61 ------
NM_006375chrX2229 134 1568 ----
NM_006378chr92491 193 1294 ----
NM_006390chr1261299 1293 1191 707 680 322 1477 1365 11700
NM_006393chr10134542 4052 3970 3833 3670 2885 2872 1736 1484 1248 1165 426 277 14489 24394 4038 1794
NM_006400chr121354 --1323 --
NM_006420chr20112988 2980 2832 2785 2658 2187 1232 657 449 253 57 ------
NM_006449chr231994 485 377 ----1872
NM_006451chr551042 974 704 347 285 ------
NM_006465chr15----1393 --
NM_006469chr11306 ----1123
NM_006471chr181290 ----192
NM_006478chr221282 ----168
NM_006480chr51521 1451 ----
NM_006496chr161609 1569 1460 1417 1326 1224 31905 1403 672 31251 1241 61 --
NM_006526chr2072215 1905 1401 883 495 192 183 21651 318 ----
NM_006532chr191763 --11951 --
NM_006538chr2173947 3729 3616 3208 2899 2876 2813 2578 1601 1494 1143 1001 720 591 379 167 41 14097 13167 --
NM_006540chr841461 1074 362 115 ------
NM_006544chr14206126 6046 5807 5712 5505 4654 4486 3709 2307 1912 1467 1365 1073 913 670 566 504 383 375 201 22363 542 1664 --
NM_006546chr1746658 6106 5561 5113 26440 1727 21231 1194 --
NM_006557chr941446 623 378 350 11533 --1303
NM_006559chr1--1925 --1178
NM_006565chr162501 425 --31107 886 431 --
NM_006574chr32221 118 --1243 --
NM_006575chr1411443 31331 441 158 11152 --
NM_006577chr221186 285 124 --1858
NM_006589chr1----1194 --
NM_006591chr1151650 1619 622 429 151 11246 21332 475 --
NM_006595chr1172067 2050 1950 1418 673 393 208 21310 289 --11999
NM_006599chr16188224 7987 7815 6794 5914 5746 5633 5588 2964 2773 2191 2072 1995 1726 1585 1439 422 372 28265 2438 27730 2895 --
NM_006609chr242036 1988 696 560 ------
NM_006614chr343550 1347 651 200 13081 11312 --
NM_006621chr13790 688 278 21356 152 ----
NM_006624chr1021831 158 31993 139 103 11437 --
NM_006628chr15104587 4007 3915 3764 1861 1004 849 708 653 402 34378 738 635 --21634 391
NM_006640chr1711638 --11843 --
NM_006646chr1373093 2799 1981 525 469 446 103 1688 22244 2054 21944 130
NM_006658chr771114 819 359 304 204 185 81 1297 11107 --
NM_006670chr61171 1542 ----
NM_006675chr1263339 2266 2147 1176 1149 576 11058 1307 --
NM_006690chr202899 510 1715 2438 224 --
NM_006698chr2031217 427 230 1500 ----
NM_006703chr6----1185 --
NM_006704chr132427 338 ------
NM_006717chr962420 2346 2305 2295 998 330 43346 2642 2126 845 ----
NM_006727chr5--1397 ----
NM_006729chrX84788 4414 4267 3906 3575 3538 1890 1856 24116 110 35340 5273 3698 --
NM_006732chr1961840 1741 761 713 642 203 22136 2074 --11642
NM_006734chr631563 1413 132 2628 472 ----
NM_006742chr1631446 665 408 --11603 --
NM_006756chr861247 1133 1104 1021 346 228 1577 --1162
NM_006772chr631728 1294 1120 --11250 11535
NM_006802chr12201 26 ------
NM_006805chr551724 1517 1414 1177 112 1356 ----
NM_006838chr1231649 556 37 1364 ----
NM_006851chr1242396 2242 2043 462 1349 12829 --
NM_006861chr1211890 12085 1340 --
NM_006874chr421101 889 1317 21129 824 --
NM_006875chrX1268 ----1780
NM_006885chr1692859 2747 2626 1622 1332 929 690 665 259 1824 --11701
NM_006887chr22561 266 ------
NM_006888chr1463356 2804 2774 1340 738 109 33536 3417 2829 1148 13332
NM_006893chr1------184
NM_006897chr12----1610 --
NM_006902chr153032 2362 661 384 38 12322 ----
NM_006908chr741021 982 938 325 31492 1356 1327 11466 1409
NM_006914chr921546 1510 --1601 --
NM_006915chrX52503 2388 2377 2281 75 --22225 717 --
NM_006920chr271789 1728 1602 1528 692 642 467 ------
NM_006927chr1622158 334 12117 21734 189 --
NM_006931chr1242051 795 612 94 --1209 --
NM_006941chr222972 140 11052 ----
NM_006943chr2052585 2307 2240 2196 552 ----1317
NM_006946chr111389 --2383 185 --
NM_006950chrX2777 71 --1252 --
NM_006951chr103766 269 24 ------
NM_006963chr1061229 1193 1063 829 439 398 1449 1124 --
NM_006965chr181906 1341 ----
NM_006981chr94755 351 292 148 --22830 2635 12255
NM_006988chr2131289 1224 273 --11038 --
NM_006990chr172236 2199 1753 984 799 402 312 1638 31612 1570 540 --
NM_006999chr541596 1267 705 224 ------
NM_007006chr1673442 3379 3341 3114 1187 455 215 23021 2540 22273 109 --
NM_007007chr1284844 4621 4566 3645 3353 3021 1578 683 34148 3078 1782 21421 624 1250
NM_007011chr15166822 6596 6038 5828 5788 5298 4656 4630 4234 2696 2046 1856 1825 1762 1147 334 --15871 --
NM_007030chr5104343 3918 3883 3848 3813 3778 3708 3673 3638 3483 --15014 13522
NM_007039chr1442338 2223 2098 510 --1660 --
NM_007040chr193836 226 191 --1747 --
NM_007051chr1----1119 --
NM_007106chr1362783 2421 2141 1930 1760 303 ------
NM_007118chr51563 2305 256 ----
NM_007124chr641947 1807 1302 738 --1412 --
NM_007125chrY2297 35 155 ----
NM_007129chr132729 338 --1657 2860 767
NM_007137chrX35385 5256 3424 24388 3997 --14674
NM_007139chr711002 ----11122
NM_007170chr12651 133 --1888 --
NM_007173chr1151874 1798 1559 795 414 21910 309 --1236
NM_007174chr1242161 2031 1513 275 ------
NM_007185chr131027 757 235 --1291 1317
NM_007212chr151624 791 709 645 118 2865 317 ----
NM_007217chr31312 ------
NM_007219chr201884 --1116 --
NM_007232chr20----1762 --
NM_007236chr1582401 2105 2001 550 478 262 208 143 11644 ----
NM_007246chr441007 969 925 689 1196 ----
NM_007249chr13199258 9132 8911 8517 7886 7627 7371 7280 6333 3269 3115 2678 1651 1148 828 683 608 303 155 59278 3758 3691 1542 768 27942 3377 13247
NM_007260chr11540 --1734 --
NM_007271chr641873 1685 1447 674 11748 11272 --
NM_007286chr5--11459 12127 --
NM_007294chr1731197 182 152 ------
NM_007345chr1881868 1756 1523 1479 1451 392 205 35 12158 ----
NM_007350chr12124495 3919 3736 3099 1475 1173 1138 1092 998 839 583 358 1172 11342 --
NM_007371chr92491 144 --187 --
NM_007372chr173887 846 225 --1776 --
NM_007373chr1051587 676 510 224 128 21299 174 ----
NM_007375chr142177 778 603 467 42449 2403 2286 977 ----
NM_012064chr1241046 428 384 36 --1156 --
NM_012090chr131166 832 308 ------
NM_012092chr251880 1747 1680 1472 502 1436 1118 --
NM_012095chr1043406 2324 1343 402 --1786 12142
NM_012096chr352652 2498 2305 586 400 42813 1488 1276 849 ----
NM_012104chr1173695 3540 2679 2324 858 742 269 23807 3453 ----
NM_012111chr141154 ------
NM_012120chr692638 2340 2134 2050 1996 954 889 177 93 --12387 --
NM_012137chr182220 2170 2153 1889 950 886 544 455 22889 2112 22144 484 --
NM_012164chr9147462 7208 7101 7067 6829 5666 5555 5003 4698 4556 2086 855 403 144 75986 5517 5371 2973 2147 653 569 36697 6023 5700 16438
NM_012175chr11----1788 --
NM_012197chr981604 1465 1287 614 567 469 78 47 ------
NM_012199chr1104657 4612 4039 3689 3325 3228 2916 1599 816 653 1918 11618 --
NM_012215chr1031767 1220 538 21346 317 ----
NM_012218chr1942935 1971 828 358 31114 385 260 --133
NM_012234chr373744 3483 3473 3279 2628 2459 134 21098 932 23070 94 --
NM_012242chr101100 1762 ----
NM_012248chr16----1674 --
NM_012249chr232726 714 346 12512 11246 --
NM_012257chr71969 21041 766 1919 --
NM_012259chr651138 1003 547 428 227 11398 ----
NM_012261chr201500 1514 ----
NM_012262chr1124864 4518 4422 4412 4345 3921 3857 3299 3228 1771 1703 527 23793 1024 24684 390 1876
NM_012264chr2221475 658 --1641 --
NM_012281chr782319 2198 2156 2145 2061 847 572 214 190 --11640
NM_012294chr763907 3487 923 762 499 445 1666 ----
NM_012297chr452108 1977 1953 1608 354 --1323 --
NM_012301chr741746 1363 894 678 2775 699 --11839
NM_012302chr141170 820 260 154 1474 11099 --
NM_012309chr1174861 4148 3745 3307 1827 1805 1085 34360 709 328 23700 1128 --
NM_012316chr185275 4438 4073 4051 3670 2087 1967 1716 11161 11994 1575
NM_012323chr22------11579
NM_012325chr2061567 1549 1376 1013 464 75 21666 1312 11193 --
NM_012328chr751419 1162 910 237 72 2942 372 ----
NM_012329chr1751037 675 611 167 120 1564 ----
NM_012330chr1061782 1583 1381 731 538 221 --1306 11536
NM_012333chr14653 444 263 78 1395 1468 --
NM_012340chr20----1171 --
NM_012342chr103149 56 48 ------
NM_012347chr672847 2837 2410 2390 2040 1943 349 32282 2140 453 1369 132
NM_012382chr5124380 4363 4270 4263 3463 1710 1385 1242 1234 603 572 355 11670 --14214
NM_012383chr9----244 35 --
NM_012395chr74829 578 503 287 2591 480 22376 1245 --
NM_012425chr1052742 780 729 403 377 12708 1165 --
NM_012426chr16----179 1317
NM_012428chr153801 382 64 --1703 1734
NM_012463chr1241774 718 472 205 2299 134 11646 --
NM_012464chr472561 2533 2419 1080 845 497 269 ------
NM_013230chrY11529 31460 1331 1155 11692 --
NM_013231chr1494273 4266 3680 3570 2743 1596 1408 1063 666 24314 1314 ----
NM_013233chr24928 416 199 76 11045 ----
NM_013261chr473266 2962 2780 2735 2607 2496 978 22545 865 32626 1436 791 12973
NM_013275chr161642 1763 2738 292 --
NM_013279chr1142325 545 397 376 --11450 --
NM_013302chr1694742 4582 3644 3512 3310 3056 1304 979 656 24328 459 ----
NM_013322chr741599 1143 562 512 --1185 --
NM_013323chr174986 911 425 236 21058 278 ----
NM_013354chr821460 446 2428 387 ----
NM_013368chr191247 --1185 --
NM_013396chr2121549 551 21491 1427 1262 --
NM_013433chr1941634 576 241 27 11847 1568 --
NM_013437chr82970 247 --1390 --
NM_013438chr971693 1314 1195 1184 512 182 99 2427 169 --31727 1534 223
NM_013438chr971693 1314 1195 1184 512 182 99 2427 169 --31727 1534 223
NM_013444chrX21119 722 1354 ----
NM_013449chr1262611 2430 1850 774 272 226 --22369 698 --
NM_013995chrX22418 594 --1415 --
NM_014011chr242556 1991 505 229 ----1576
NM_014023chr1062876 1918 625 523 192 66 22599 536 --1340
NM_014038chr7----190 --
NM_014043chr331615 420 24 2402 93 1162 1258
NM_014055chr121509 ----1466
NM_014112chr8135356 4483 4382 3582 3567 3361 2173 1685 1383 1013 713 152 137 32201 1998 1991 24035 4015 1783
NM_014139chr32915 128 ----1732
NM_014141chr744256 3313 2074 986 15183 1437 22109 216
NM_014153chr161248 1530 1626 --
NM_014155chr11157367 7010 6776 6094 5239 4731 4696 4557 1933 1803 1779 1201 821 783 416 57302 6525 2365 2202 2106 --1464
NM_014171chr23179 140 45 1256 ----
NM_014178chr142565 237 ----1588
NM_014181chr272801 2423 2116 1876 740 668 599 32443 487 368 ----
NM_014232chr1731657 1513 1505 ------
NM_014243chr442053 1418 553 174 1181 --11780
NM_014245chr311116 1360 ----
NM_014253chrX32239 1995 618 12269 --11587
NM_014268chr1831475 269 52 11064 ----
NM_014271chrX1300 ------
NM_014278chr41107 --1162 --
NM_014279chr9----1633 --
NM_014286chr973646 3484 2585 2559 546 514 333 --2385 46 --
NM_014288chr1--1268 1284 144
NM_014289chrX21206 130 ----21415 1306
NM_014299chr1951642 1630 1453 640 407 ------
NM_014319chr1241507 1439 464 296 21470 243 --1767
NM_014325chr1252246 1931 790 709 456 1852 ----
NM_014331chr487671 6932 6612 6287 5829 2005 1321 72 47364 2807 2489 356 11064 15556
NM_014351chr2251383 1364 968 931 480 --11456 --
NM_014363chr1331256 1230 851 ----11071
NM_014382chr331702 1288 217 21142 549 --1291
NM_014410chr18------1361
NM_014423chr542117 1822 1202 361 35659 5144 3507 31338 1154 1085 23760 1168
NM_014431chr101570 11436 --21381 1262
NM_014454chr651051 738 234 146 135 ------
NM_014458chr121120 897 11219 ----
NM_014470chr122799 705 ------
NM_014491chr721044 945 ----1894
NM_014494chr1632376 2302 901 --11896 --
NM_014515chr1221028 260 1382 ----
NM_014517chr381992 1982 1713 1620 755 723 682 376 11661 1729 --
NM_014547chr151198 ------
NM_014554chr1262148 1644 1626 804 271 168 32348 2165 190 ----
NM_014569chr731482 1160 607 --1375 --
NM_014571chr142603 2350 2236 80 12786 22665 2405 --
NM_014572chr1331444 170 136 1577 11131 --
NM_014575chr32517 43 --149 --
NM_014612chr951436 1335 1133 594 531 1414 --11185
NM_014613chr592645 2381 2239 2078 1202 1186 955 693 529 12536 --12666
NM_014616chr322866 1166 22123 1039 --2832 405
NM_014620chr121532 ------
NM_014630chr1562927 2459 1108 745 737 345 --1215 --
NM_014647chr1662236 2082 1840 1725 348 86 151 1718 --
NM_014648chr31449 --1397 --
NM_014649chr192199 177 ------
NM_014653chr123558 433 268 --21720 511 --
NM_014660chr731131 824 269 1279 1165 --
NM_014661chr1063733 2742 2607 1462 452 287 --22453 1480 31516 1351 557
NM_014663chr14967 818 391 191 ------
NM_014666chr531326 1123 382 11136 ----
NM_014671chr72498 126 ------
NM_014686chr1931874 641 183 --11918 --
NM_014699chr16----1318 --
NM_014705chr762095 2058 1838 1611 758 260 11738 21766 582 1439
NM_014707chr741970 1710 1569 1514 21812 389 12274 --
NM_014729chr821531 259 ------
NM_014730chr1285194 4339 3329 2113 2010 1491 1064 569 24990 73 23954 3401 --
NM_014747chr1105293 4872 4593 3775 1800 974 505 466 454 90 34824 3919 610 --15788
NM_014751chr871979 1414 677 407 257 248 124 41992 1785 737 223 ----
NM_014752chr116554 538 287 260 245 161 11336 ----
NM_014755chr2104270 4098 3985 3808 3774 3074 1008 442 432 142 1571 1997 22771 1275
NM_014757chr562395 2085 933 568 545 401 11525 12028 1842
NM_014761chr164854 741 168 100 11171 31102 1096 1022 --
NM_014767chr1042387 1354 501 322 ------
NM_014772chr1823284 689 --1888 --
NM_014784chr111080 --1367 --
NM_014795chr231397 1226 563 3943 923 875 ----
NM_014810chr173394 2745 985 610 380 98 54 43570 3132 3100 3060 22931 252 --
NM_014819chr552473 2135 1923 859 463 ------
NM_014820chr362056 1789 1596 1483 1448 109 1553 11428 --
NM_014824chr1141809 1740 1600 793 --1420 --
NM_014827chr151563 1203 1043 241 226 11388 21585 599 --
NM_014839chr162188 1773 865 842 664 66 3731 423 261 21867 746 --
NM_014840chr1263419 2970 2321 2086 351 192 13043 42750 2662 2204 183 --
NM_014841chr61381 ----1424
NM_014858chr1----1153 --
NM_014868chr122610 67 --1849 --
NM_014869chr331422 1041 202 ------
NM_014872chr982297 2004 830 670 629 366 169 55 ------
NM_014873chr184194 4005 3765 3444 3302 1510 596 313 24304 719 ----
NM_014876chr222327 208 11646 --11752
NM_014877chr17127729 7097 6621 5667 5297 2689 2201 1949 1708 1032 454 41 47223 2515 412 184 --14967
NM_014893chrY5807 570 553 228 196 12123 --11831
NM_014899chr572883 2806 2694 2197 2059 595 80 33086 1057 237 ----
NM_014901chr542229 1922 1860 865 1766 ----
NM_014904chr1093642 3022 2962 2932 2745 2613 1552 1401 1291 33949 2946 915 22724 1339 --
NM_014912chr1083276 3183 2732 2170 858 778 633 347 12274 22674 691 12189
NM_014926chr3--11078 1248 --
NM_014946chr263052 2963 2829 2570 1137 389 1840 11086 --
NM_014947chr173027 3004 2642 2548 325 128 43 2463 260 1846 --
NM_014949chr11872 2969 181 ----
NM_014951chr1082656 2597 2389 1967 788 551 428 78 22561 707 21025 752 --
NM_014962chr2052429 888 538 457 344 ------
NM_014969chr1----1449 --
NM_014974chr1031811 1521 1276 11638 11787 --
NM_014977chr141503 --1446 --
NM_014988chr442069 637 125 112 1204 ----
NM_014989chr651951 1596 1382 422 114 41612 1308 822 370 ----
NM_014999chr1251483 1452 1195 1148 1103 --21186 1028 11252
NM_015000chr1263131 2876 2753 1933 1024 303 1530 13022 --
NM_015001chr1----1381 --
NM_015009chr3----1767 --
NM_015015chr1912031 ----1325
NM_015020chr1683509 2909 2496 1474 1089 1035 661 71 22582 575 13572 12609
NM_015025chr272611 2051 464 286 231 94 55 1646 ----
NM_015026chr1234726 1700 1343 2524 389 168 --
NM_015042chr1543795 3778 3526 1467 1483 --13449
NM_015045chr1032129 1820 663 12087 1481 --
NM_015051chr942960 2350 2152 387 --2861 659 --
NM_015063chr1941420 1380 1264 163 11391 1964 --
NM_015074chr184555 1747 1556 1023 934 787 576 360 13708 14901 --
NM_015075chrX11490 --11962 11999
NM_015076chr694457 3726 3315 3276 1788 1569 1461 1178 492 34308 1649 874 23538 1241 23526 275
NM_015090chr1146240 6127 6042 5672 5464 5248 5165 5086 5028 4081 2484 658 421 336 46055 1658 1166 482 15794 --
NM_015091chr142737 548 ------
NM_015092chr1694609 4347 3138 3109 2938 856 775 615 267 24507 1315 33273 998 949 --
NM_015093chr62725 127 ------
NM_015094chr2222886 1149 1451 21674 1158 --
NM_015097chr331661 1485 394 2628 151 1909 --
NM_015100chr131730 472 301 1780 21320 236 11894
NM_015107chrX52322 1909 1809 1671 449 1403 --12276
NM_015124chr2232389 2293 2054 ----1110
NM_015132chr751238 730 698 193 63 21296 223 --11221
NM_015137chr862470 2307 2096 1839 787 680 22176 416 --11718
NM_015138chr1582801 2746 2148 1807 1070 1022 276 23 --1497 --
NM_015144chr1683920 3808 2497 1329 1282 1092 451 257 33033 1412 705 ----
NM_015149chr132182 769 658 12158 21786 1756 --
NM_015155chr1063310 3251 2642 1329 1065 840 --1141 12526
NM_015156chr14113786 3489 3136 1430 1314 1252 891 863 719 469 459 23985 2857 ----
NM_015161chr1651206 506 470 402 59 ----11511
NM_015170chr821991 1870 ------
NM_015171chr161181 --2404 32 --
NM_015176chr121118 259 1297 ----
NM_015192chr2021983 898 12330 --12003
NM_015199chr362534 2278 1977 1901 980 535 32751 1117 263 22859 2209 --
NM_015205chr1324720 381 25179 4501 15159 14790
NM_015210chr1811182 2771 36 ----
NM_015215chr183182 3162 2713 2169 1012 811 616 60 --1258 --
NM_015227chr211166 ------
NM_015236chr4--11033 11333 11174
NM_015252chr2--1826 ----
NM_015265chr252202 1765 887 158 48 12075 ----
NM_015270chr1231913 1882 1763 --1939 --
NM_015271chr4114264 4001 3900 3844 3399 2762 2722 1324 761 619 134 33541 289 176 23877 1375 1360
NM_015277chr18144 ----278 57
NM_015284chr12263 90 ----11355
NM_015288chr543908 3759 1365 981 --23480 2621 --
NM_015291chr173391 3114 2753 2375 2171 1150 817 43385 2143 1128 633 12610 11089
NM_015296chr131503 21227 841 11042 --
NM_015310chr8208029 6122 5873 5633 3141 3100 3071 2502 2418 2357 2318 2221 2023 1800 1270 1150 703 279 226 63 35795 200 154 1184 11366
NM_015335chr1252433 2412 1735 841 502 32461 2283 160 12132 1333
NM_015338chr2061463 1452 1331 599 572 171 --1421 11939
NM_015347chr1252800 2734 2531 2515 2221 ----11907
NM_015353chr1752831 2533 2257 958 196 12610 ----
NM_015355chr1721565 769 2330 219 11792 --
NM_015359chr842578 2377 1979 1906 32976 2853 2806 ----
NM_015361chr22901 130 1376 180 --
NM_015393chr483453 3094 2643 2626 2332 1277 513 173 23558 1197 ----
NM_015397chr971932 1902 1425 393 233 181 63 ----11868
NM_015429chr3--11135 124 --
NM_015435chr821292 132 1595 11105 --
NM_015457chr11----1358 --
NM_015461chr18----1168 --
NM_015464chr71114 ------
NM_015466chr32249 185 ------
NM_015470chr22889 192 ------
NM_015472chr31387 1214 ----
NM_015475chr24912 435 154 23 ------
NM_015481chr1221115 1031 ------
NM_015483chr7--1750 1396 --
NM_015488chr211742 ------
NM_015508chr311388 --11294 1582
NM_015511chr203816 778 438 --11119 --
NM_015527chr161660 --1781 --
NM_015534chr11892 --1805 --
NM_015542chr103998 926 219 21153 1122 ----
NM_015548chr61727 2241 117 1670 --
NM_015550chr7113460 3344 3260 3108 2919 2472 2372 1170 506 466 53 11181 22250 1308 --
NM_015554chr1542767 2502 2268 698 12860 11877 --
NM_015557chr183655 3135 2765 2435 1402 1142 1103 556 12697 23088 900 22540 327
NM_015564chr563453 3071 2843 2585 2571 562 23218 3042 11044 --
NM_015567chr1321325 449 --1373 130
NM_015569chr184846 4574 4334 3746 3076 638 431 410 13145 14624 --
NM_015576chr333003 2159 193 21016 878 1432 --
NM_015584chr1731410 371 344 --1551 --
NM_015601chr101941 ------
NM_015609chr132802 997 603 --11053 1657
NM_015626chr172293 185 11099 31159 1152 286 --
NM_015630chr22356 218 ----1256
NM_015649chr19----1377 --
NM_015691chrX52749 2553 1851 687 662 --12848 12390
NM_015726chr131569 747 110 21604 616 11555 --
NM_015850chr862290 2069 1988 1630 815 372 22038 1678 21884 824 --
NM_015853chr111217 ------
NM_015855chr11--2907 684 ----
NM_015872chr121307 459 11245 11260 11359
NM_015878chr821398 107 1864 ----
NM_015879chr18108645 7867 6750 6259 3396 2950 2796 2500 1706 396 36936 2214 333 28458 5629 22755 140
NM_015888chr1133003 2930 2353 2298 1099 1071 1063 1029 918 747 684 263 154 22441 625 33404 889 502 --
NM_015892chr10112022 1846 1834 1620 1541 1524 883 737 720 525 352 1798 12114 --
NM_015898chr1931589 490 202 --21637 870 --
NM_015933chr3----184 --
NM_015981chr593128 2988 2089 1081 937 813 641 631 90 --13216 1133
NM_015984chr1129 ----137
NM_015994chr142700 502 ----1155
NM_016002chr11801 ----177
NM_016009chr1104737 4560 4303 3977 2996 1591 477 458 261 138 11709 11067 24257 1615
NM_016018chr872468 2301 1754 1105 1030 730 583 ------
NM_016019chr72890 193 ------
NM_016021chr652996 2747 2739 829 507 22035 54 ----
NM_016022chr141048 367 148 136 ------
NM_016072chr1242267 957 560 549 12292 12198 --
NM_016076chr142496 2489 1287 384 12867 23167 247 --
NM_016083chr663343 3196 1419 1104 773 666 --13097 13843
NM_016107chr531085 858 259 --11368 --
NM_016118chr7275 30 ------
NM_016131chr242143 1675 1523 387 32262 2097 326 ----
NM_016132chr1572957 2841 2715 2694 2624 668 39 1539 22381 363 1770
NM_016162chr121663 --1263 --
NM_016179chr13----1195 --
NM_016201chr331679 746 737 ------
NM_016205chr431374 466 190 1315 ----
NM_016206chr3168236 8104 7366 6234 6195 5967 5444 3307 3101 2606 2421 2082 1814 1789 489 249 --18637 --
NM_016221chr582356 2306 2231 2014 921 868 841 517 1451 ----
NM_016231chr1731681 1060 662 --11082 --
NM_016250chr14----1796 --
NM_016257chr1103091 2676 2648 2497 2426 2344 1385 1164 1060 1007 --1274 --
NM_016269chr4168 11009 1865 --
NM_016275chr322088 2021 1198 --21818 32
NM_016281chr12------11095
NM_016287chr141910 1853 1784 1630 1216 --11931
NM_016319chr122709 200 --180 --
NM_016322chr983072 2840 2764 2125 930 692 478 446 11030 1541 185
NM_016339chr1721274 1253 --31552 576 342 --
NM_016340chr5--41267 1023 183 72 --11352
NM_016351chr7--1503 1421 --
NM_016396chr1551873 554 403 283 52 31007 708 93 11971 --
NM_016422chr1163188 2346 900 626 474 124 32701 805 325 122 --
NM_016436chr2061960 1884 1775 1675 1073 639 21716 271 1239 12705
NM_016470chr201106 ------
NM_016512chr8148 ------
NM_016525chr93625 298 104 ------
NM_016530chr1573967 1653 1521 1488 1354 891 354 33372 3146 2574 ----
NM_016531chr473971 3401 3362 3076 2769 1472 237 ------
NM_016544chr2103871 3740 3478 3319 3188 2868 2417 1384 1238 1190 --12839 1609
NM_016605chr552711 2255 2223 2042 782 12007 1839 --
NM_016607chrX51664 1651 1645 680 243 --2515 300 1256
NM_016612chr81272 193 ----
NM_016623chr82498 166 147 ----
NM_016626chr1821757 1601 1497 ----
NM_016827chr33538 504 142 --134 --
NM_016829chr33593 559 197 --289 72 --
NM_016932chr25931 368 361 210 31 ------
NM_017409chr122579 307 1757 --1773
NM_017412chr8----11038 166
NM_017413chrX52496 2342 2078 1826 798 --32479 1777 397 --
NM_017415chr593353 3139 2941 2826 1815 1647 1519 491 444 ----14042
NM_017510chr5----171 --
NM_017540chr533267 2819 504 --23117 545 --
NM_017542chr131279 562 447 11797 1267 --
NM_017548chr33829 383 25 22180 813 ----
NM_017582chr131725 1526 580 11461 --11796
NM_017593chr4142 2331 315 ----
NM_017599chr1251858 1320 1312 344 217 2712 677 ----
NM_017602chrX3657 600 107 --2774 99 --
NM_017607chr191463 --145 --
NM_017610chr151762 2243 222 ----
NM_017633chr6103796 3764 3316 3034 2978 2455 1566 835 553 534 11560 ----
NM_017637chr9119259 8760 7486 7072 6798 6754 3123 2105 1511 470 193 49336 8158 1937 1395 27796 3268 29365 2709
NM_017641chr1221037 319 21069 1016 ----
NM_017643chr1762828 2637 2507 599 230 100 32877 904 622 1466 --
NM_017649chr101400 ----1381
NM_017650chr7125988 5981 5404 3995 2060 2051 1840 1745 1680 1559 605 254 22218 158 15366 --
NM_017658chr1464346 3390 1156 970 679 74 24646 252 --11017
NM_017664chr135918 816 247 236 123 1418 ----
NM_017693chr1321561 1546 --11286 --
NM_017709chr163911 3570 3405 2788 1025 120 11349 ----
NM_017715chr72289 118 1623 1530 --
NM_017730chr3----1133 --
NM_017736chr16103132 2962 2396 2060 878 852 686 638 605 462 ----1276
NM_017744chr142482 664 246 47 21954 126 21781 1703 --
NM_017769chr1442778 1156 789 753 42640 2251 2149 911 11186 --
NM_017789chr2------156
NM_017798chr2031106 327 138 ------
NM_017799chr1481677 1603 1330 417 387 249 237 194 1656 11695 --
NM_017801chr35797 455 308 300 108 --11688 --
NM_017811chr973107 3026 2684 2647 2555 2506 556 ------
NM_017831chr1854152 3998 2948 1480 376 ----14752
NM_017847chr12466 139 ------
NM_017848chrX144637 4612 4412 4265 4255 4245 4004 3358 3151 1479 365 192 164 55 --13243 --
NM_017880chr22437 153 --2314 26 --
NM_017887chr11489 ------
NM_017922chr141119 1238 --1263
NM_017925chr921963 236 11849 --11824
NM_017926chr141358 2584 310 --1349
NM_017944chr1162387 2051 1928 1186 1071 414 33063 824 586 12080 --
NM_017952chr224205 3524 34385 3872 2914 23847 367 --
NM_017988chr124926 917 841 116 1697 1962 --
NM_018045chr153024 1993 1205 341 279 1919 32647 2493 2059 12700
NM_018046chr521561 696 11957 1579 --
NM_018064chr61235 --196 --
NM_018084chr252793 1035 939 743 81 --22345 406 --
NM_018086chr271788 1717 1359 487 322 235 186 2588 530 ----
NM_018090chr121144 32 --11186 --
NM_018092chr1641333 1158 1091 647 --1612 --
NM_018121chr1042666 2644 2471 168 ----1522
NM_018126chr411298 --2605 60 --
NM_018133chr351570 1494 621 506 69 21931 1652 11465 --
NM_018151chr22793 564 1767 ----
NM_018159chrX31697 466 230 1318 193 --
NM_018179chr122543 46 ------
NM_018181chr1821924 1338 11775 11494 11262
NM_018191chr1351347 526 371 313 23 189 ----
NM_018193chr152619 579 --139 1205
NM_018208chr1--21184 149 1726 --
NM_018211chr121409 732 11941 31704 1461 631 --
NM_018223chr1241074 1028 310 303 1268 1149 11171
NM_018237chr10--1223 ----
NM_018243chr463812 3177 3169 3144 1329 147 ----144
NM_018244chr2021171 904 --11120 --
NM_018246chr862805 2563 722 240 166 63 --2401 329 --
NM_018247chr633132 2495 2012 1933 1819 11021
NM_018287chr1021061 894 2481 110 --11315
NM_018293chr392496 2451 2359 2263 2072 1894 1883 705 474 12094 1886 --
NM_018325chr961166 1138 1020 389 213 102 --11319 1428
NM_018327chr2031897 680 259 ----11277
NM_018332chr1611363 ------
NM_018354chr20--1219 1248 --
NM_018361chr883979 3319 2678 1472 1450 912 811 357 63927 3279 2517 1173 990 303 2939 447 --
NM_018362chr1193527 2965 1274 1139 810 405 223 187 30 11440 ----
NM_018364chr1113801 3054 2572 1419 1222 1155 868 816 779 586 233 1471 ----
NM_018371chr831308 1222 1128 --11448 146
NM_018374chr794204 3430 3213 1856 1782 1502 1380 1180 369 45108 1550 976 665 34519 4152 1736 --
NM_018387chr91200 ------
NM_018394chr331450 1354 382 --1207 --
NM_018398chr3----1287 --
NM_018403chr363541 1566 1532 1291 832 71 23868 3121 ----
NM_018416chr1242524 1043 551 421 12625 2599 311 12124
NM_018425chr1082129 1636 1040 936 650 571 562 197 1342 ----
NM_018427chr1611223 --1496 --
NM_018440chr898536 3400 3379 3339 3193 2312 1171 558 162 42480 2431 2010 1516 48462 5809 660 58 15622
NM_018444chr842393 1517 645 117 ----12197
NM_018448chr121993 ----11177
NM_018469chr1721144 486 --1125 --
NM_018482chr841933 1616 429 168 12363 --12073
NM_018490chr111291 11534 11449 194
NM_018509chr1741715 1390 362 65 ------
NM_018566chr185065 4978 4415 4076 1732 1279 1079 225 34806 1132 1056 13296 --
NM_018569chr421104 276 --1202 --
NM_018571chr21447 --1486 164
NM_018638chr12145602 5448 5305 5290 4219 3606 3564 1933 1927 1714 1490 1207 316 92 15669 --13546
NM_018650chr161791 1603 752 733 250 239 42170 1809 1537 314 32241 2038 1759 11565
NM_018653chr171392 ------
NM_018682chr72234 147 136 1552 1618
NM_018684chrX3995 176 161 --1416 --
NM_018704chr13787 680 68 4870 846 833 423 11782 --
NM_018713chr1177 ------
NM_018715chr152008 1606 895 599 562 1182 11639 --
NM_018718chr731980 1833 1494 12195 --192
NM_018719chr71922 11113 --11236
NM_018834chr52939 112 1822 ----
NM_018836chr11818 --1168 --
NM_018837chr202719 201 --1213 --
NM_018847chr911214 11683 21912 1904 --
NM_018898chr542203 2164 1606 1551 --11711 1801
NM_018940chr52754 42 1964 ----
NM_018948chr141099 1048 937 490 21385 530 ----
NM_018970chr721960 1237 42878 1170 451 132 --13093
NM_018979chr1232656 2441 373 12549 2928 874 --
NM_018993chr2051435 1395 1142 335 206 11463 ----
NM_018999chr10104641 4615 4301 3854 1906 1887 1665 1559 392 152 --11986 1775
NM_019006chr151180 --1457 --
NM_019012chr123538 154 126 --127 --
NM_019015chr7----1137 --
NM_019016chr17192 ----1240
NM_019045chrX3926 366 316 1274 ----
NM_019046chr10----1352 --
NM_019049chr1--2510 110 1715 --
NM_019072chr534251 3560 218 22646 687 21364 1041 --
NM_019074chr15------2662 57
NM_019080chr1361572 472 428 368 170 154 2603 207 --11523
NM_019087chr52678 339 1158 1264 --
NM_019102chr7172 --195 --
NM_019106chr2232623 2419 1326 1989 32963 2874 2502 --
NM_019114chr942464 2247 778 143 --22257 43 --
NM_019116chr16103648 3582 3459 1455 1323 1271 1220 1130 611 513 --31259 1236 1075 12961
NM_019594chr921536 1006 ------
NM_019842chr61360 ------
NM_019845chr22726 593 ------
NM_019886chrX2623 161 ------
NM_020117chr52272 224 1132 ----
NM_020122chr2106038 5743 4293 4178 4105 2322 1688 1333 1074 513 54274 2015 1648 930 385 --15494
NM_020123chr1031325 1153 1120 --11143 --
NM_020145chr92196 122 --1605 --
NM_020148chr1882798 2497 1132 574 244 128 82 25 11087 ----
NM_020150chr1022168 798 ------
NM_020159chr441167 423 254 149 11607 2694 600 --
NM_020168chr151902 --11246 --
NM_020198chr1741515 1188 1160 985 1436 ----
NM_020199chr51274 --1117 --
NM_020211chr1531460 600 568 ------
NM_020225chr4----126 --
NM_020336chr2093689 3012 2900 2448 1172 1086 660 554 286 23679 1157 ----
NM_020337chr432826 2374 961 13165 12411 --
NM_020340chr611766 2659 220 2553 291 --
NM_020342chr262506 2209 1890 1861 1672 735 21919 1605 1316 --
NM_020348chr102755 113 12060 ----
NM_020390chr354600 3850 1540 1421 787 23685 146 ----
NM_020401chr121216 ----185
NM_020403chr133685 605 561 1156 1624 --
NM_020424chr161560 124 ----
NM_020440chr172466 1253 665 652 625 327 209 1146 ----
NM_020443chr1146482 5928 5730 5197 5152 4775 4247 2497 2258 1871 1757 1141 1125 320 26642 2172 25344 2522 35523 4339 2134
NM_020453chr441453 597 589 241 --21373 1337 --
NM_020456chr132560 410 42153 758 498 32 ----
NM_020474chr183360 315 64 ------
NM_020526chr131844 1683 609 ------
NM_020546chr581014 753 626 423 345 328 183 60 12440 174 --
NM_020638chr1232114 1587 795 --31895 1861 704 --
NM_020640chr341463 1446 819 73 ------
NM_020644chr112940 69 ------
NM_020648chr1862697 2551 2457 2110 788 339 22779 61 12085 --
NM_020651chr251486 209 192 155 89 --11212 --
NM_020666chr51287 ------
NM_020693chr111163 176 ----
NM_020699chr164426 3667 3333 1640 1531 1356 25233 838 2217 72 15179
NM_020717chrX114268 4229 4125 3944 3671 3421 3058 2009 1808 862 306 33276 3119 971 11693 --
NM_020718chr16196545 6457 6327 5861 5494 5255 5053 4997 4902 4752 4438 4409 4143 2234 1691 825 409 193 86 86247 4468 4166 2052 1614 1324 857 512 25565 1056 --
NM_020728chr753150 3052 2089 557 183 32948 2055 1237 11972 --
NM_020734chr1282930 2799 2667 1335 1130 470 356 329 ------
NM_020747chr51607 --1180 --
NM_020752chr1022759 2378 32717 854 572 ----
NM_020771chr661475 1405 1177 489 366 146 11523 --1407
NM_020772chr17178702 8490 8395 7138 6875 5902 5666 2924 2707 2370 2318 2232 1714 1505 1141 895 427 37124 1000 33 48457 5474 3408 278 --
NM_020775chr11174 ------
NM_020777chr41254 1923 12569 --
NM_020781chr743025 2821 2361 2182 ------
NM_020783chr1832381 2136 482 11572 12445 --
NM_020794chr151418 1130 342 244 80 ------
NM_020796chr582700 2388 2331 2164 2039 1125 648 601 ----12745
NM_020801chr542666 647 401 310 1660 1111 --
NM_020805chr1831706 683 122 31845 1781 466 1581 --
NM_020824chr101315 3716 576 128 ----
NM_020825chr1672911 2709 2651 2634 2405 437 338 --43798 2791 2495 1031 12981
NM_020826chr1153598 1496 1287 213 63 13642 --11114
NM_020830chr223266 1145 23034 683 ----
NM_020845chr1232085 2049 287 2634 468 --12011
NM_020850chr1653187 2400 1117 610 368 --1994 12009
NM_020856chr1941597 1394 1293 1205 11006 --1411
NM_020858chr1531936 1767 233 1612 1185 --
NM_020860chr431020 269 255 ------
NM_020866chr131709 --1763 --
NM_020873chr3386 50 22 161 ----
NM_020888chr141784 1614 702 402 ------
NM_020898chr125530 501 323 192 115 1631 3685 549 135 --
NM_020924chr93461 195 76 --1179 --
NM_020927chr1652339 2218 2131 1457 416 1853 171 --
NM_020964chr18124499 4208 3476 3221 3171 2988 1553 1438 1358 1208 1114 210 34832 705 469 31168 1061 351 --
NM_021005chr153839 457 435 11086 178 --
NM_021035chr20----126 11169
NM_021038chr343274 2892 1031 995 12449 --12457
NM_021072chr552601 2526 1835 1018 750 ------
NM_021076chr222153 92 --2556 423 --
NM_021097chr232995 2138 1226 23027 2684 22032 1933 --
NM_021136chr141586 ------
NM_021140chrX2312 35 2746 62 ----
NM_021155chr1992453 2228 2192 2142 1138 926 257 168 119 1408 22358 2220 --
NM_021174chr82480 254 ----1234
NM_021183chrX2998 791 ----2935 444
NM_021194chr11299 --132 --
NM_021222chr141086 985 528 88 21446 1187 11042 --
NM_021235chr19------1154
NM_021238chr1271717 1407 805 753 601 333 104 ----11918
NM_021239chr1431036 431 284 2520 331 ----
NM_021252chr1062107 1615 1374 471 360 337 155 1325 12015
NM_021269chr1911564 ----12011
NM_021614chr5136 1314 ----
NM_021626chr171183 ----1137
NM_021648chr662716 2477 2383 1056 928 763 2358 209 --21718 26
NM_021728chr14----1680 --
NM_021784chr201577 ------
NM_021807chr71779 ------
NM_021809chr2062483 1937 1896 516 488 384 11889 21638 266 --
NM_021931chr2011067 --1222 1814
NM_021938chr192118 74 ------
NM_021945chr662992 2294 1406 649 555 217 13431 2577 512 --
NM_021946chrX21020 482 1541 1427 1435
NM_021960chr152780 2701 2658 839 773 --12597 --
NM_021961chr1155864 4609 4572 2681 2456 22695 838 47291 2099 2068 1457 36645 5316 4986
NM_021964chr3126085 5877 5565 5060 4922 4184 2086 1957 1865 1532 1425 1033 45922 4648 820 558 14563 34136 4061 2637
NM_021965chr951333 1187 932 276 119 --11346 --
NM_022048chr1555503 4738 4643 1978 1951 15004 16205 24782 4474
NM_022049chr121820 236 ------
NM_022058chr251845 1629 253 239 182 11839 ----
NM_022062chr1141930 1770 1687 735 ----11736
NM_022075chr12270 210 ------
NM_022114chr133936 3911 444 34619 4457 554 24368 4189 --
NM_022117chrX2207 101 --1232 --
NM_022130chr58982 545 373 321 269 190 164 68 178 2112 59 --
NM_022166chr1686313 6221 6142 5994 2333 747 588 241 56245 6157 6133 4995 1633 35726 5214 4586 --
NM_022437chr21197 ------
NM_022444chr731892 237 38 1441 ----
NM_022459chr1366058 5044 4387 2428 1573 728 41881 1785 1494 38 25822 182 --
NM_022463chr171286 1142 ----
NM_022465chr1272971 2906 2871 2698 2219 276 89 --32173 1125 203 12504
NM_022477chr2051669 1425 695 494 360 2658 421 1641 1394
NM_022484chr731412 980 911 11003 --1112
NM_022552chr21322 --1917 --
NM_022719chr2243730 1386 477 424 --23481 2727 --
NM_022749chr8----21109 103 1307
NM_022753chr162302 2151 1721 1029 360 144 1686 173 1615
NM_022758chr642802 2356 878 353 --22184 638 1797
NM_022763chr383221 2703 2129 2017 1109 844 296 86 33136 2831 2056 12674 1316
NM_022764chr1621370 266 ------
NM_022780chr251717 1318 731 356 216 21303 1196 21704 1224 --
NM_022822chr111117 ------
NM_022826chr23400 187 76 --11053 --
NM_022831chr171663 1370 1140 726 661 484 409 --2392 29 --
NM_022836chr131528 1185 325 ------
NM_022838chrX1290 1213 1262 --
NM_022841chr1562562 2521 2411 2386 1971 527 22494 2453 ----
NM_022894chr24707 626 561 525 ------
NM_022898chr14114541 4132 3838 3805 3688 1861 1392 1369 1035 725 289 1229 14138 --
NM_022902chr5--1393 1300 --
NM_022912chr2103045 2526 2426 2112 1902 953 863 524 305 246 ------
NM_022918chr1111853 --11406 --
NM_023010chrX------2557 205
NM_023016chr272494 2414 1008 956 832 249 158 ----1676
NM_023112chr1452467 781 717 600 120 12095 1949 --
NM_024007chr572935 2617 1213 1195 808 635 46 43125 2337 304 246 1534 --
NM_024016chr171799 1727 1186 --
NM_024034chr20------1995
NM_024045chr10143 ------
NM_024046chr341091 992 272 246 --1254 --
NM_024052chr1722624 2538 23107 986 32824 2650 1062 11995
NM_024090chr431875 1729 762 ----1516
NM_024095chr1231313 207 200 1244 11513 --
NM_024295chr831927 591 464 --1481 --
NM_024315chr71336 --1379 --
NM_024337chr5--1277 124 --
NM_024491chr32527 448 1658 --1602
NM_024523chr771221 1020 906 220 150 69 30 ------
NM_024524chr361244 1158 850 613 112 67 2630 521 22047 753 --
NM_024545chr2------1710
NM_024567chr81138 --1698 --
NM_024595chr12195 167 3323 127 64 ----
NM_024613chr831292 542 324 21349 1195 --1210
NM_024616chr33345 295 91 21460 78 11065 --
NM_024630chr62326 258 --1700 --
NM_024646chr153982 2711 978 382 323 33608 3552 3228 --1419
NM_024665chr3184540 4363 4066 3510 3387 3297 3231 3159 1677 1588 1081 1044 1014 919 846 767 593 203 24188 1329 ----
NM_024674chr173144 940 919 863 478 411 291 --129 --
NM_024704chr201756 11038 1918 --
NM_024721chr842655 1688 776 259 --12050 --
NM_024769chr112952 834 1412 ----
NM_024779chr1231091 441 163 --21497 1102 --
NM_024873chr42166 87 1440 ----
NM_024884chr1484584 4515 4243 4094 3707 3535 3459 1117 ------
NM_024946chr1621515 344 --11584 --
NM_024947chr398959 3602 3304 2894 2831 1732 1198 996 367 39244 3298 2362 12810 --
NM_024948chr10------1256
NM_024949chr473824 3298 1949 1580 846 827 368 --13569 --
NM_024954chr10----1675 --
NM_024963chr715663 14238 11419 12004
NM_024989chr2187474 7174 7032 6660 6420 5909 5739 5381 5040 4969 3223 2960 2797 1993 1934 1113 917 365 28053 5096 11504 --
NM_024993chr231076 329 116 1999 1103 --
NM_025054chr843865 1453 587 340 21681 1150 13203 12983
NM_025083chr152701 105 --21318 121 --
NM_025104chr1731300 1217 34 11197 ----
NM_025106chr11693 11422 ----
NM_025133chr23437 394 280 --1427 --
NM_025134chr1642434 1831 707 186 32489 1590 155 ----
NM_025147chr23808 276 32 1223 ----
NM_025154chr73577 556 383 11211 11505 --
NM_025160chr1114286 3858 3582 3462 3252 2996 886 795 463 313 131 12700 2346 28 --
NM_025165chr151389 --1510 --
NM_025179chr1114462 3867 3724 3694 1445 1372 837 798 450 433 292 24922 1669 23242 1361 14523
NM_025187chr1641205 1082 948 345 --1186 --
NM_025201chr1582056 1962 1369 1316 803 387 333 32 31304 675 655 22065 84 --
NM_025208chr1122498 709 1879 --12208
NM_025214chr1842751 1729 474 250 ------
NM_025248chr1723095 1253 --23084 1986 --
NM_025251chr81872 --2292 158 --
NM_030571chr51629 51372 1251 512 460 199 1442 --
NM_030579chr1693680 3612 3315 2340 2264 1489 1433 1250 282 --11126 12907
NM_030621chr1464027 4018 980 825 626 209 11451 22872 244 11382
NM_030625chr1031776 1694 401 12576 ----
NM_030627chr563419 3314 3179 3138 245 99 23117 1217 33337 455 52 --
NM_030645chr151239 1192 1093 896 308 ------
NM_030647chr7146267 6092 5805 5458 4503 4065 2445 2016 1796 1472 1290 1211 884 407 26197 2025 36234 6052 654 24736 872
NM_030648chr465527 4640 4621 3758 3684 1210 2885 622 34648 3975 3722 --
NM_030650chr293962 3859 3292 2804 1059 961 859 211 86 32919 733 305 ----
NM_030751chr10------1503
NM_030791chr1421831 1326 1661 --196
NM_030794chr13----1240 --
NM_030796chr732195 550 56 11749 2380 203 --
NM_030798chr72841 834 ------
NM_030806chr1168748 8548 8333 8020 6561 6081 3478 2906 2535 2508 2218 1985 1740 1466 1322 397 47968 6090 5857 287 ----
NM_030820chr62971 44 ----156
NM_030885chr31158 189 ----
NM_030915chr232051 1831 791 1129 1123 --
NM_030927chr1041339 1277 1026 150 ----11209
NM_030938chr1721146 46 11076 2270 171 --
NM_030939chr631187 792 360 ------
NM_030958chr82526 423 ------
NM_030963chr6156 ------
NM_030964chr5123439 3358 2876 2755 2378 1189 1167 1160 993 879 732 51 --43691 3267 1358 642 --
NM_031216chr1862183 1863 1449 239 215 34 12090 1393 --
NM_031283chr21322 1114 1829 --
NM_031284chr152734 26 1595 1934 --
NM_031372chr461521 1469 1458 601 522 289 11226 178 --
NM_031422chr18------1238
NM_031442chrX41978 741 141 135 23012 1186 11006 --
NM_031444chr2221876 547 --12372 12499
NM_031445chr263403 3055 2898 2772 1067 687 13189 --1831
NM_031452chr15--1493 170 --
NM_031461chr872163 1746 1701 1495 755 506 53 ------
NM_031483chr2052735 2210 1101 522 448 22346 345 --12744
NM_031892chrX3935 676 58 --1952 --
NM_031904chr1172130 2072 2044 1487 1421 740 152 ------
NM_031936chr1----1125 --
NM_031964chr171115 1348 ----
NM_032042chr542790 1100 1060 909 1150 1699 12058
NM_032108chr19--1285 1302 --
NM_032109chr541129 1091 1063 357 11283 ----
NM_032121chrX82726 2664 2010 1973 1966 1884 528 494 ----12591
NM_032146chr31109 ------
NM_032153chr372743 2007 1793 1783 958 422 415 ------
NM_032160chr18124204 3360 2954 2808 934 892 806 567 455 442 245 218 24075 3392 ----
NM_032199chr10123808 3606 3503 3193 2979 2537 2516 2498 1511 1283 973 668 12821 ----
NM_032207chr1941267 847 819 188 ----1217
NM_032228chr1153191 3141 2968 2237 572 1522 --13282
NM_032229chr132807 42 11096 ----
NM_032233chr144896 651 334 118 2266 97 ----
NM_032236chr14760 694 417 338 ------
NM_032239chr43499 368 38 --11181 --
NM_032268chr1652634 2627 558 545 443 22971 886 12181 1126
NM_032320chr111817 167 ----
NM_032373chr10125803 5406 5314 5192 4546 4374 1686 1525 744 298 288 194 45825 1951 1214 574 1552 15736
NM_032410chr82784 328 --151 --
NM_032413chr152428 23 160 1101 --
NM_032420chr51675 ------
NM_032430chr19------1390
NM_032431chr115854 835 795 249 36 ------
NM_032436chr132906 166 2688 210 ----
NM_032440chr1042952 2795 2347 2206 1121 --1219
NM_032446chr552604 1399 1265 544 76 22798 929 11233 11088
NM_032449chr122884 148 ------
NM_032457chr473879 3732 3242 3210 2815 2779 2604 33233 3107 3081 1133 --
NM_032458chrX82577 2344 2311 1338 1259 1016 631 552 --1960 --
NM_032505chr382817 2752 2563 2256 2116 1074 679 642 42774 2444 1895 1861 11784 11031
NM_032547chr431418 1377 876 21368 1109 --1996
NM_032557chr4--1759 1734 --
NM_032558chr941418 1166 1030 146 125 ----
NM_032560chr1421115 379 --1137 --
NM_032562chr101373 ------
NM_032575chr162723 268 --21546 75 --
NM_032594chr14163 --2826 438 --
NM_032622chr431425 1081 493 11467 ----
NM_032632chr1451868 1842 1521 1409 1375 --1755 --
NM_032638chr331436 1077 343 11259 ----
NM_032682chr373660 3358 3319 2420 2231 767 511 53574 2955 2442 1053 696 ----
NM_032717chr43926 237 174 1363 ----
NM_032765chr5--2660 136 --1857
NM_032784chr61665 1373 ----
NM_032859chr1353724 3573 3343 2884 620 53974 2826 2612 1474 411 23456 1560 --
NM_032875chr17----1771 --
NM_032982chr782353 2304 2287 2132 495 344 187 90 --22051 1780 --
NM_033058chr8--1232 --1636
NM_033067chr11757 1498 1787 --
NM_033129chr2021939 1904 ----11572
NM_033132chr1332053 519 492 11801 ----
NM_033143chr483801 3552 1563 1536 1280 740 642 172 21713 277 1571 --
NM_033224chr737505 5512 2415 56989 6764 2544 2448 665 37179 1427 270 18040
NM_033225chr862491 1029 625 499 481 320 21959 655 --22753 1118
NM_033259chr31720 --1615 --
NM_033271chr14------1399
NM_033296chr42142 90 1742 ----
NM_033387chr942383 1723 741 338 --2588 508 --
NM_033389chr1794565 4498 3933 3451 3289 1634 961 320 121 13329 --24191 698
NM_033393chr43911 738 55 ----22065 693
NM_033394chr231529 649 610 11603 1284 --
NM_033495chrX--1973 11036 --
NM_033505chr2136668 6385 5704 5539 4362 2560 2465 2038 2028 1969 1105 1043 536 36557 5804 4990 ----
NM_033512chr8133032 2950 2846 2771 2635 2582 2372 2274 1119 1066 684 545 502 2658 591 21204 153 --
NM_044472chr13698 473 217 ------
NM_052840chr1531147 554 185 --11351 --
NM_052875chr1142151 1859 560 204 --21924 1454 --
NM_052879chr1243577 3473 2939 1199 23842 413 23958 1026 --
NM_052900chr831838 1743 316 21169 655 --11706
NM_052905chr281927 1875 1803 1642 1336 1167 755 484 --1584 --
NM_052907chr1254229 4204 2924 920 726 1664 140 --
NM_052925chr193692 192 64 --1897 --
NM_052937chr862449 1825 1024 460 287 133 22412 791 1597 --
NM_052954chr2131827 1425 653 11962 11771 --
NM_052998chr11144 ------
NM_053024chr341282 201 192 167 ------
NM_053025chr341604 1457 562 476 --11492 --
NM_053056chr1143088 2633 2581 2261 --12013 --
NM_053064chr1432731 303 264 22946 702 31901 1893 1069 11878
NM_053280chr111189 ------
NM_054111chr63731 256 29 ----1959
NM_057175chr412489 12660 ----
NM_057749chr8------11244
NM_058170chr11496 21084 276 2621 377 --
NM_058172chr461678 1206 665 569 188 100 --21780 151 --
NM_058246chr731265 392 328 ------
NM_080391chr11240 ------
NM_080546chr931685 1435 832 ------
NM_080617chr2021053 961 --1934 --
NM_080664chr1441591 1382 200 33 2791 635 12036 --
NM_080723chr631329 1028 390 ----1960
NM_080867chr1462000 1870 1567 1370 1171 541 24897 879 14790 --
NM_080872chr863605 3552 2618 1434 1079 76 --13343 --
NM_080927chr352267 2117 721 562 472 ------
NM_101395chr2172987 2671 2495 2212 1116 903 546 --13147 13082
NM_130830chr351091 519 449 111 65 --13991 13173
NM_133171chr201906 --2482 84 --
NM_133264chr1743764 2412 986 954 --1283 --
NM_133265chrX63471 2967 2692 2304 1012 647 23596 2340 ----
NM_133446chr10------1251
NM_133452chr193963 57 48 --1423 --
NM_133468chr71204 198 11742 22200 1965
NM_133496chr1104045 3746 796 398 312 285 250 219 206 45 53813 3427 1282 1016 845 --14203
NM_133507chr122385 360 --137 --
NM_133633chr221941 --197 --
NM_133638chr541187 560 448 129 ------
NM_133646chr275124 4919 4841 2091 1972 426 169 15596 14911 15245
NM_134428chr9----1385 --
NM_138288chr1421565 1539 --1576 --
NM_138335chr43759 745 585 ------
NM_138370chr22751 667 1506 ----
NM_138385chr42883 389 ----1204
NM_138423chr1572268 2129 2009 1495 766 75 68 --22235 1727 --
NM_138426chr752476 2098 2049 1740 82 --1611 1429
NM_138473chr12135136 5090 5056 3913 3632 3544 3351 1756 1640 1226 1192 492 221 21303 576 23952 790 --
NM_138479chr12310 115 1317 --11534
NM_138724chr121272 ----1331
NM_138782chr5--152 1851 22043 671
NM_138795chr121012 147 ------
NM_138927chr2111076 ------
NM_139072chr24862 356 330 290 1139 ----
NM_139126chr62926 633 ------
NM_139136chr1211033 1830 1126 --
NM_139167chr8265 37 ------
NM_139207chr1251972 1766 250 210 182 1808 1724 --
NM_139246chr93948 497 298 12163 11623 --
NM_139278chr81901 --21181 367 --
NM_139280chr1761505 545 509 470 415 215 --1239 --
NM_139283chr1232162 2043 543 22104 1934 1126 --
NM_139321chr2054247 3682 3604 2830 563 --11586 1206
NM_144567chr122502 1913 194 12675 --
NM_144571chr4146413 6382 6238 5190 2165 2147 1409 1391 1383 1294 1233 897 469 341 47038 6564 6219 1802 26075 849 --
NM_144578chr14135434 5426 5413 5244 4869 4151 4088 3743 3620 3446 2182 1561 1529 11196 1901 --
NM_144628chr2082908 2473 1133 940 667 285 238 97 12238 22316 1206 1306
NM_144633chr341149 333 317 71 1210 ----
NM_144664chr1191045 895 725 687 641 236 135 77 59 32484 2235 99 ----
NM_144667chr12----1113 --
NM_144723chr52775 277 --1207 --
NM_144963chr842637 160 151 33 12222 1693 --
NM_144967chrX2679 217 --1194 --
NM_145008chr113838 342 263 --1647 --
NM_145117chr1192639 2176 2104 2060 908 880 788 655 245 1828 1223 12429
NM_145204chr153200 42 26 ------
NM_145239chr161275 --1146 --
NM_145251chr1431359 1155 438 11502 --1175
NM_145279chr141843 1539 1278 135 --11718 --
NM_145284chrX72486 2443 1928 1899 1568 1027 201 22232 502 11706 --
NM_145296chr191349 --1831 --
NM_145309chr1131335 1315 1035 --11368 --
NM_145800chrX4926 841 707 420 ------
NM_145808chr733051 2378 2300 32904 2468 2459 21102 462 --
NM_145891chr1651519 1248 428 205 174 1408 11400 --
NM_147128chr7--21677 455 11579 --
NM_147161chr1----1827 --
NM_152247chr22----1226 --
NM_152253chr2223393 1346 --33612 919 126 --
NM_152261chr1232101 983 559 12489 --12186
NM_152263chr196090 6055 5463 5434 5352 4605 1791 888 323 21473 569 11707 --
NM_152271chr821149 1066 2465 149 11155 --
NM_152280chr193167 2662 2319 2302 2282 1322 965 793 194 12880 1980 13122
NM_152344chr1761232 621 377 349 315 253 1533 11137 --
NM_152346chr172762 331 ------
NM_152390chr21120 1689 1520 --
NM_152400chr411971 ----11614
NM_152409chr533079 2180 853 13306 1141 --
NM_152423chrX2478 37 1270 ----
NM_152424chrX104737 3808 3780 3528 2894 1607 950 857 615 240 --1167 --
NM_152437chr1262386 1805 683 519 464 120 1928 11639 --
NM_152440chr1261012 798 783 445 322 264 ------
NM_152449chr1531652 1499 93 --11709 --
NM_152450chr1571859 1633 1564 1474 534 175 36 11611 1528 --
NM_152470chr1893969 3256 2795 2715 1515 727 631 408 84 44155 4048 3888 1583 13090 13480
NM_152487chr141160 1144 577 494 --1506 --
NM_152519chr231965 758 161 1103 11378 --
NM_152520chr211053 2902 884 ----
NM_152523chr21730 --1201 --
NM_152527chr221493 838 1584 1850 --
NM_152534chr3----1166 --
NM_152556chr752045 1950 1827 1007 879 ------
NM_152586chr101916 --1953 --
NM_152594chr1542320 2159 235 75 12226 22188 1626 --
NM_152622chr542363 1319 756 307 --22374 426 --
NM_152624chr5247051 6948 6915 6826 6431 6188 5841 5723 5595 5539 5456 5420 5140 2491 1834 1762 1537 1381 1113 807 566 257 132 119 17408 36668 4903 1642 25313 830
NM_152638chr1241166 1036 981 884 ------
NM_152641chr1242729 2373 915 676 22652 2566 --22552 800
NM_152653chr33680 281 227 --1587 --
NM_152660chr12814 75 ------
NM_152678chr332176 1917 558 12349 1472 --
NM_152680chr472067 1718 1694 1566 411 357 275 1759 1128 --
NM_152695chrX4897 770 391 91 1783 2647 214 --
NM_152716chr1141265 600 264 33 31342 270 240 2226 207 --
NM_152723chr1111079 --1222 --
NM_152739chr711138 21078 854 ----
NM_152745chr731143 742 167 ------
NM_152749chr7134 1328 ----
NM_152754chr7103776 3113 3051 2937 2763 2734 1258 1048 562 105 --156 --
NM_152756chr574246 3851 3410 3347 2981 373 205 34188 3237 1082 --1114
NM_152758chr863011 2848 843 258 224 95 22839 2782 --1971
NM_152780chrX1238 --195 --
NM_152787chrX33844 3248 2521 13634 23197 288 1951
NM_152835chr162856 2846 2698 2135 902 291 22578 452 22448 43 --
NM_152890chr111000 --1386 --
NM_152902chr141715 1613 435 215 1113 11446 11454
NM_152903chr1392835 2019 1153 496 334 301 283 214 124 ------
NM_152910chr131173 1126 ----
NM_152991chr11----1541 --
NM_153000chr182183 88 ------
NM_153029chr1653118 2517 858 241 217 1524 23952 1029 --
NM_153035chr152695 2611 2151 1281 74 --21985 569 --
NM_153042chr641482 1167 1129 623 --1419 129
NM_153183chrX2439 128 ----1850
NM_153184chr321399 748 21311 1248 ----
NM_153207chr1293470 3301 2982 2917 2724 1391 840 266 168 13291 --1556
NM_153252chrX1157 --2377 98 --
NM_153261chr1621557 189 31575 326 250 185 --
NM_153262chr153150 2592 2341 948 763 12638 ----
NM_153267chr9--2223 182 --1144
NM_153347chr111830 --11068 12487
NM_153350chr16----11130 --
NM_153354chr52727 279 ------
NM_153365chr441856 1041 816 304 --11936 --
NM_153367chr1073076 2888 2848 2838 2826 1604 1493 22602 231 ----
NM_153456chr13106048 5861 5523 4275 4051 3924 2362 977 381 57 46201 4114 1789 199 12395 --
NM_153607chr553076 3009 1120 1066 72 42341 1185 964 78 ----
NM_153635chr3----157 --
NM_153689chr282279 2209 2165 1749 481 341 167 52 ------
NM_153690chr32895 195 2756 724 1796 --
NM_153756chr121500 1298 1732 1446 --
NM_153757chr431068 897 487 --11191 --
NM_153810chr10115052 4588 4393 4214 3686 1932 1854 1269 1191 1145 253 34959 3597 3481 54856 4400 3233 555 426 35078 2022 746
NM_170606chr741776 656 127 100 31783 638 75 1245 --
NM_170665chr1294560 4374 1062 781 628 275 148 140 77 33857 3590 474 --1411
NM_170672chr241388 692 397 41 1318 ----
NM_170707chr11362 1653 1355 1136
NM_172070chr221580 370 31662 1563 455 196 --
NM_172071chr1187472 7425 7099 7030 6671 5726 5227 5134 4975 4610 2638 2576 2105 2020 1600 1210 498 259 26433 1345 66368 6037 2624 2227 913 30 --
NM_172127chr472136 1838 1695 825 687 547 136 ----167
NM_172373chr1341136 326 317 240 ----11214
NM_173065chr133253 2945 2388 --1559 --
NM_173075chr41206 ------
NM_173156chr162173 2151 2048 1799 1441 103 12019 ----
NM_173353chr12----187 --
NM_173354chr2141961 1841 487 461 ------
NM_173359chr361780 536 481 430 290 121 1576 11256 11909
NM_173469chr1531300 1261 176 11139 ----
NM_173470chrX72427 1995 1024 777 613 365 255 1394 --1342
NM_173491chr541324 1122 478 470 ------
NM_173495chrX22286 1638 11006 --21679 455
NM_173508chr1--11144 11161 --
NM_173510chr2272449 2432 1876 1011 638 215 179 12289 22455 1919 12514
NM_173552chr322410 437 11864 --2656 190
NM_173563chr6------1219
NM_173576chr1042273 2154 1688 749 11428 12137 --
NM_173582chr11116187 6134 4880 3918 2340 2231 1555 1535 1232 1167 1001 44905 2287 542 336 --11158
NM_173595chr1275312 1864 1840 789 696 470 311 --1237 23817 581
NM_173602chr12173824 3637 3536 3250 2965 2953 2872 2788 2529 2523 1263 1057 721 421 403 395 171 1141 --12547
NM_173658chr3--2344 240 ----
NM_173681chr711499 --1139 --
NM_173683chr821755 263 21680 538 21289 1109 --
NM_173808chr183964 3825 3787 3166 2742 799 666 520 21683 1136 --1132
NM_173822chr271804 1462 777 521 480 381 26 ------
NM_173851chr853960 3932 3238 3063 2592 21451 69 1939 11048
NM_174909chr52712 256 2243 166 ----
NM_175061chr721557 592 1136 1622 --
NM_175733chr1142237 2199 1643 675 ----1192
NM_175767chr521559 1355 11546 ----
NM_175768chr63647 519 447 11078 --152
NM_175839chr20------1113
NM_175852chr141135 1003 754 591 42709 2690 817 178 22936 2343 --
NM_175854chr13122670 2652 2601 2374 1885 1114 1031 923 660 406 319 268 12106 1335 --
NM_176792chr101434 ----1126
NM_176871chr842860 2295 2122 802 --1629 --
NM_176880chr191472 165 ----
NM_177539chr11650 ------
NM_177968chr261791 1364 688 214 170 27 ----21852 451
NM_178126chr1742051 721 604 194 21657 507 11774 11790
NM_178135chr4----1233 11286
NM_178140chr542384 1957 934 754 ------
NM_178148chr61564 --2171 58 --
NM_178313chr252145 1969 1435 1367 639 1451 11554 --
NM_178496chr351047 366 312 186 76 21472 140 ----
NM_178505chr1073625 1194 895 779 639 600 581 1403 22766 203 --
NM_178539chr1251735 1384 781 565 319 31844 1332 360 1390 --
NM_178815chr1042110 1882 308 37 11716 32033 668 246 --
NM_178826chr124565 506 54 42 1766 ----
NM_178830chr191518 --1512 --
NM_178835chr41704 2876 52 ----
NM_178864chr11----1500 --
NM_181077chr1551827 1546 615 585 418 --12275 --
NM_181291chr141211 1696 ----
NM_181358chr1114287 4033 3969 3880 3534 3198 2817 2783 2759 994 539 42898 1553 620 123 11011 1279
NM_181491chr963214 3173 2413 1127 897 350 22090 2048 22352 70 --
NM_181504chr564030 2665 1658 783 600 352 12572 23476 773 --
NM_181645chr111102 1186 1720 --
NM_181670chr123971 546 282 1168 ----
NM_181705chr595498 5109 4967 4560 4492 4173 3573 2266 590 35714 1022 507 --14167
NM_181706chr111367 --12238 --
NM_181712chr14653 403 181 155 22002 496 11740 --
NM_181714chr641773 1682 1314 632 ------
NM_181723chr832339 1807 144 ------
NM_181787chr8103403 3193 3116 3086 1464 1401 1337 911 425 150 13868 1126 177
NM_181836chr542637 1786 1022 564 31649 1015 455 ----
NM_181843chr11----1125 --
NM_182485chr493150 3073 2928 2548 2531 2420 2266 505 297 33398 3023 2471 21415 102 --
NM_182488chr133783 729 30 ------
NM_182509chr1421212 1092 --21398 200 --
NM_182540chrX4700 599 134 37 1835 1173 --
NM_182557chr113627 598 333 1203 31599 476 399 --
NM_182580chr172588 2540 2463 2124 1014 791 747 12093 ----
NM_182700chr751820 1557 1515 624 123 11851 1152 --
NM_182717chr1021350 450 11310 1247 --
NM_182734chr2032230 1145 141 12577 --12250
NM_182767chr1241822 1756 325 166 2723 419 --11748
NM_182970chr2054240 1253 617 334 219 ----11205
NM_182975chr12947 879 ----1817
NM_183238chr1273542 2961 2779 2417 1387 63 54 1478 23559 2556 --
NM_183416chr151551 725 655 236 200 1619 1173 --
NM_194285chr1163358 3213 3103 2522 2375 1029 43413 2214 578 365 22130 375 13392
NM_194314chr1105166 4763 3948 1093 912 799 668 581 526 184 43895 3434 1143 266 --15400
NM_197941chr542915 2332 2124 1195 --2954 171 11043
NM_198066chr1453023 2589 2127 670 555 --11061 11019
NM_198081chr641167 562 474 160 12943 158 --
NM_198270chrX53332 2405 835 634 579 --12927 --
NM_198334chr111126 --2712 69 --
NM_198402chr3----1290 --
NM_198404chr131627 1764 1263 --
NM_198427chr1----1434 --
NM_198465chrX32605 2219 244 ----1226
NM_198503chr162387 2366 2231 563 502 62 12049 ----
NM_198504chr33958 742 51 ----1667
NM_198513chr861856 1385 565 448 361 84 --1804 --
NM_198560chr353431 3269 3053 2564 395 22870 1041 43782 966 811 56 13553
NM_198571chr741579 1480 1034 556 --3482 388 165 --
NM_198947chr11------1125
NM_199131chr1063123 1321 1066 1058 774 346 --23442 1369 11465
NM_199168chr10--11196 ----
NM_199320chr422568 1980 32957 1917 1171 11937 --
NM_199453chr51180 130 ----
NM_201263chr161994 1988 1845 1689 1563 480 11677 140 --
NM_201613chr121256 ------
NM_203303chrX----2220 42 --
NM_203364chr111487 --126 --
NM_203365chr21467 --149 2543 400
NM_203390chr8--21665 362 21341 168 --
NM_203394chr1252597 2535 2177 1964 1039 22498 407 1123 12115
NM_203446chr2142820 1114 846 625 22992 198 1681 1171
NM_205841chr5--1181 161 140
NM_206853chr664044 3391 3033 1526 1256 644 33714 841 123 11143 --
NM_207009chr101711 ------
NM_207303chr1053268 2637 1454 617 386 130 2821 52 --
NM_207361chr1355093 4753 4538 1919 73 56210 5454 2430 1366 172 24888 4705 --
NM_207371chr105547 514 491 179 46 11356 ----
NM_207372chr1041818 1679 1633 92 42333 1994 1735 690 32169 1661 646 --
NM_207422chrX31084 416 403 --2968 150 --
NM_207506chr821193 337 ------
NM_207645chr1121328 970 21342 1206 11306 --
NM_213589chr295456 5438 4934 4872 4440 1424 925 512 466 24778 279 12033 15306
NM_213606chr1042382 2258 235 69 12246 ----
NM_213609chr31425 ------