TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-29b-1-5p
miRNA Sequence: GCUGGUUUCAUAUGGUGGUUUAGA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr581823 1432 1402 816 681 222 143 21 1697 ----
NM_000081chr151650 1336 575 347 109 1638 --148
NM_000084chrX246690 6404 6193 6042 5651 5579 5122 4896 4748 4528 4457 2762 2378 2163 1784 1579 1359 1057 979 435 376 329 142 45 26566 1611 11006 32419 474 459
NM_000092chr284358 4077 3747 3435 3356 1832 1520 524 --14298 1446
NM_000104chr2103105 2288 2261 2076 1042 659 632 367 339 126 22514 2497 1814 1527
NM_000109chrX52446 1753 873 406 303 --1863 12254
NM_000110chr121013 65 --1917 11088
NM_000115chr1382534 2174 2042 1791 1715 606 359 93 --1197 --
NM_000138chr1562633 2589 2015 770 688 481 22111 75 11686 2639 441
NM_000163chr5102299 2257 1787 1460 948 476 449 390 326 71 1187 1353 1458
NM_000168chr773311 2924 2906 296 238 219 36 22954 522 ----
NM_000176chr5153865 3431 3226 3164 3075 3002 2966 1428 1272 1122 1053 986 718 310 63 11084 13688 12500
NM_000189chr252355 2210 1984 1544 629 --1636 --
NM_000192chr1261302 1084 542 279 178 165 ------
NM_000202chrX62647 2406 1310 586 319 214 --43515 1366 553 413 1676
NM_000208chr1994351 3502 3114 1821 1766 1688 1190 900 177 --23420 263 14410
NM_000210chr242212 2046 858 668 1924 ----
NM_000216chrX53329 3252 2883 609 445 1685 24120 1539 1655
NM_000217chr12135124 4792 4601 4357 3772 3628 3576 1969 1805 1625 1348 286 209 33765 3569 179 1495 14373
NM_000230chr7132403 2072 2052 2006 1980 1738 1114 781 562 438 344 184 138 1395 ----
NM_000232chr453213 2883 2838 246 63 ----11991
NM_000259chr15106281 5722 5375 5088 4429 4352 2052 1276 1087 229 22220 720 33950 2006 1126 --
NM_000267chr17143411 2851 2780 2509 2259 1400 925 841 835 711 568 530 352 28 --22613 752 11144
NM_000272chr27560 369 303 181 132 86 79 140 11278 --
NM_000329chr11364 --148 1767
NM_000332chr6166790 6627 6388 5827 5503 5360 4586 2809 2630 2238 1902 1414 1343 1227 885 521 --11735 --
NM_000337chr5146414 6336 6074 5032 4984 4893 4186 4017 2485 2036 1533 1135 338 239 --34646 2134 750 46460 5840 5586 4113
NM_000346chr1751856 1273 542 275 236 2584 74 ----
NM_000362chr2293470 3431 2826 2736 2663 2439 2295 1137 328 2672 553 ----
NM_000390chrX93105 2727 2687 2351 2111 463 374 360 248 1727 21325 1090 --
NM_000408chr272584 1302 1163 1092 859 77 47 163 1821 --
NM_000430chr1783813 3794 3149 2952 1327 864 516 288 12456 33667 1287 577 --
NM_000441chr772337 2272 1714 1608 1552 621 108 11458 1377 --
NM_000448chr1193018 2842 2556 2533 876 792 344 323 317 22240 272 2631 222 --
NM_000461chr3124530 3573 3518 2959 1558 1506 1451 1276 824 425 359 179 14389 23492 574 13915
NM_000489chrX93375 2605 2383 2131 1380 1196 979 891 35 ----23311 3085
NM_000554chr1963338 2121 648 324 153 112 22797 2042 33242 3201 2420 12191
NM_000555chrX127089 6610 5982 5746 3060 2865 2375 1985 1578 1170 941 577 57437 5773 5273 2249 1227 27604 7191 16420
NM_000599chr2154511 4406 4392 3844 3807 3370 3278 1832 1774 1656 1258 795 657 576 59 --1390 11819
NM_000610chr1182846 2583 2000 1140 854 561 303 223 22087 941 1729 --
NM_000611chr11116975 6908 6392 5825 5302 5197 5050 4528 2239 1877 1262 27048 241 66609 4470 2460 1698 276 172 14655
NM_000612chr11133521 3066 2514 2441 778 749 719 595 565 422 350 310 297 --12503 --
NM_000615chr1172510 1192 1011 372 307 296 162 --2403 274 --
NM_000618chr1285967 5735 4798 4688 4535 2544 2430 1527 25797 4582 --16365
NM_000618chr1285967 5735 4798 4688 4535 2544 2430 1527 25797 4582 --16365
NM_000629chr2184256 2581 1638 1464 1436 1310 573 525 22895 1194 2985 272 12849
NM_000633chr1863797 3552 1682 1593 703 196 24096 3937 11651 14548
NM_000693chr1551371 1350 1264 652 451 --11479 1263
NM_000719chr12136362 6006 5795 5392 4077 2196 1715 1569 1363 1335 673 416 372 45344 4629 134 101 11969 --
NM_000721chr182369 2035 1940 995 645 463 418 50 1155 2244 70 12716
NM_000726chr271119 487 457 366 354 339 63 ------
NM_000793chr14114847 4556 4358 3377 2037 1985 1841 1827 1770 1673 981 --21796 1047 1327
NM_000807chr41733 --1527 1514
NM_000809chr4148664 7968 7398 6254 5915 5813 3542 3469 3046 2634 1848 1778 828 551 36563 2405 397 56670 6551 1057 836 134 28237 565
NM_000813chr5115570 5025 4472 3836 3641 3618 3565 1809 1513 1448 576 1354 43530 1427 1035 48 24781 759
NM_000814chr1553614 2846 1691 1175 938 13274 13653 1444
NM_000827chr572630 2576 1877 946 916 537 163 ----11954
NM_000829chr1191816 1634 1505 1437 1416 798 475 308 97 1314 ----
NM_000831chr195169 4651 2455 2320 2160 1903 1734 1394 1137 55456 4668 2411 780 102 45429 4414 1796 158 26019 1129
NM_000860chr471623 1597 1452 1413 1202 546 368 --11129 1375
NM_000866chr351578 1558 1234 1201 717 156 --11657
NM_000875chr15136700 6521 6374 5558 5426 5315 5206 4974 4313 2131 1175 839 288 24954 1969 36878 6627 2760 16707
NM_000877chr273014 2472 2049 1216 1099 432 157 42344 809 577 138 1312 --
NM_000891chr1763650 3376 3327 2504 793 702 13158 11364 --
NM_000899chr12174126 3993 3986 3781 3703 3522 3453 3203 3084 2899 1529 1061 1004 881 686 620 114 --33654 3415 1037 11280
NM_000901chr482339 2239 2110 1834 1767 1741 1714 264 ----1189
NM_000902chr363127 2926 2238 2011 898 842 23186 2203 1336 --
NM_000926chr11249485 9299 8532 8432 8371 7377 7057 7050 6669 6465 6219 5950 3206 3145 2932 2741 2644 2275 2254 913 601 546 328 265 27724 7469 69219 8889 6655 6027 5872 575 1759
NM_000944chr441790 799 476 185 ----21803 1734
NM_000963chr162164 1853 1653 933 769 37 --2661 526 1232
NM_001001323chr1253080 2993 2325 1239 1216 ----21228 30
NM_001001344chrX72587 2128 1994 1853 1791 1035 369 2813 468 1595 --
NM_001001389chr1182846 2583 2000 1140 854 561 303 223 22087 941 1729 --
NM_001001390chr1182846 2583 2000 1140 854 561 303 223 22087 941 1729 --
NM_001001391chr1182846 2583 2000 1140 854 561 303 223 22087 941 1729 --
NM_001001392chr1182892 2629 2046 1186 900 607 349 269 22133 987 1775 --
NM_001001396chr174467 4105 3811 1499 1352 1298 993 11269 --24396 3840
NM_001001419chr595185 5029 4592 4367 3309 2075 1780 1257 506 --11378 --
NM_001001420chr595185 5029 4592 4367 3309 2075 1780 1257 506 --11378 --
NM_001001433chr2093152 2461 842 828 759 736 614 512 416 --12159 1924
NM_001001481chr843007 2992 2385 2261 23131 2573 ----
NM_001001668chr19184311 4237 4063 3377 3335 3098 2996 2904 2850 2685 920 906 887 697 643 535 348 324 21602 829 24213 3502 --
NM_001001890chr2184292 3821 3433 3080 3073 2693 2642 1300 14054 23908 3052 --
NM_001001928chr22238362 7729 7317 7049 6972 6594 6433 6315 6142 5972 5713 3250 2881 2322 1936 1810 1527 1353 791 671 411 171 141 --37247 2851 2023 26443 2778
NM_001001971chr101395 11274 --2982 553
NM_001002233chr851980 1711 1384 788 87 1291 31929 808 158 11683
NM_001002258chr261920 1621 1599 680 642 507 --11540 1461
NM_001002295chr1021175 212 --1405 1852
NM_001002860chr14104468 4333 2943 2898 1870 1762 1734 1582 1466 970 --2908 77 --
NM_001003407chr1084690 4423 3803 1581 1512 1390 898 100 1992 23234 2041 --
NM_001003408chr1084690 4423 3803 1581 1512 1390 898 100 1992 23234 2041 --
NM_001003652chr18138711 7970 7909 7351 7227 6737 5348 2011 1998 1602 1309 710 540 37864 6779 1122 16611 18065
NM_001003674chr18217089 7075 7062 6665 6020 5787 5398 5259 4884 4505 2784 2729 2051 1816 1550 1328 759 668 429 113 38 11544 15556 27027 172
NM_001003675chr18217089 7075 7062 6665 6020 5787 5398 5259 4884 4505 2784 2729 2051 1816 1550 1328 759 668 429 113 38 11544 15556 27027 172
NM_001003698chr631895 1580 1318 1497 31977 638 35 11942
NM_001003699chr631895 1580 1318 1497 31977 638 35 11942
NM_001003712chr12113543 3309 3223 1579 1151 981 962 508 89 56 22 131 13334 --
NM_001003760chr6103617 3472 3213 3207 2782 2293 1152 936 870 713 1789 ----
NM_001003794chr363090 2739 2179 652 420 283 1885 42994 1952 968 593 1108
NM_001004065chr9113671 2629 2581 2534 1224 1163 800 697 300 51 43 33024 2758 1052 1331 1130
NM_001004419chr12104343 4243 3951 3751 3715 3385 1344 1193 224 218 --1704 32875 1173 60
NM_001005386chr242221 1528 986 785 ----12504
NM_001005404chr17124178 4024 3895 3466 3405 2953 2821 2787 1810 1710 1052 834 --1851 13530
NM_001005473chr5106194 6098 4897 4811 4562 4526 1811 1796 1258 594 25314 396 2558 249 --
NM_001005502chr1275020 4304 3965 3512 3410 3347 42 24603 344 43663 3398 1365 494 13319
NM_001005733chr213393 119 49 --128 1158
NM_001005746chr271119 487 457 366 354 339 63 ------
NM_001005747chr271119 487 457 366 354 339 63 ------
NM_001006610chr166967 882 684 643 395 203 --2845 668 --
NM_001007023chr14114847 4556 4358 3377 2037 1985 1841 1827 1770 1673 981 --21796 1047 1327
NM_001007024chr1794327 4198 4034 3976 3817 3763 273 168 106 --44073 3453 361 331 11737
NM_001007025chr1794327 4198 4034 3976 3817 3763 273 168 106 --44073 3453 361 331 11737
NM_001007097chr9135105 4982 4689 4428 4373 2040 2001 1590 1547 1414 1382 696 501 --23770 1613 --
NM_001007237chr152835 2779 2634 2351 611 --22358 874 --
NM_001007466chr674844 4184 3620 3516 1791 1381 1171 1196 14007 14851
NM_001008239chr1873835 3626 3554 3445 3433 3115 2346 22439 1045 --11065
NM_001008541chr1052326 931 423 235 124 --22081 449 --
NM_001008541chr1052326 931 423 235 124 --22081 449 --
NM_001008726chr1421307 1176 --2199 105 21337 393
NM_001008738chr572639 2617 1151 728 653 257 47 ------
NM_001008925chr473534 3415 3211 3131 437 384 315 12273 ----
NM_001009554chr4114721 4233 4215 4196 4044 3229 2937 1518 1353 1246 1024 --23669 38 13795
NM_001009554chr4114721 4233 4215 4196 4044 3229 2937 1518 1353 1246 1024 --23669 38 13795
NM_001009899chr3126430 6291 6177 5868 4801 4599 1857 1708 1535 540 147 115 35966 5340 4903 45263 4911 4570 4470 --
NM_001009909chr1183879 1206 1176 924 903 337 159 61 13230 13501 --
NM_001009959chr282596 2490 2181 2166 2151 2099 2022 186 11882 11628 --
NM_001009960chr772796 1985 1757 547 373 357 77 --22732 2013 --
NM_001010000chr1873419 3406 2889 2801 970 494 253 12281 --22968 1048
NM_001010846chr173964 3616 3357 1460 675 527 63 --22909 948 14557
NM_001010853chr663214 3028 2384 2354 2250 26 --1500 --
NM_001010861chr142396 1127 1100 131 12232 --12350
NM_001010888chrX74663 4019 3276 1381 1133 910 215 14468 11646 --
NM_001010891chr5126374 6323 5748 5512 5287 4377 1952 1656 1213 1185 510 114 34342 1052 479 1399 16072
NM_001010980chr182818 2797 2652 2149 1220 838 445 333 33139 2788 479 12483 13175
NM_001011513chr464096 3622 3083 436 247 144 11490 11552 --
NM_001011666chr7226506 6019 5969 5962 5695 5640 5058 4931 4609 4540 4385 4153 2426 2419 2075 2040 1730 1704 1561 1167 829 346 --25670 5078 --
NM_001012393chr1175056 4430 4276 3992 3147 1529 1087 --23973 79 --
NM_001012420chr1562577 2480 2146 1955 1159 322 --22613 2566 --
NM_001012423chr1562577 2480 2146 1955 1159 322 --22613 2566 --
NM_001012751chr1071771 1761 1663 1497 1480 692 259 ----1379
NM_001012756chr1963100 3083 2094 2024 1046 526 11175 13106 1390
NM_001013415chr431280 279 188 11479 1285 --
NM_001013620chr12147822 7802 7388 7071 7065 6775 6515 6452 6110 5772 3031 835 419 47 11914 15363 16751
NM_001014380chr13105479 5159 5054 4418 4075 3834 2346 1901 1755 1437 1955 24256 252 11268
NM_001014797chr10218165 6896 6524 6207 5957 5880 5859 5395 3085 2948 2935 2862 2735 2529 2459 2192 1958 1612 1351 1002 35 47774 916 109 65 11170 47699 6722 1709 146
NM_001015877chrX82993 2919 2720 2121 1185 718 579 81 22814 1996 ----
NM_001017368chr1772679 2653 1955 1761 904 638 219 31984 892 399 31889 571 119 --
NM_001017371chr261323 940 891 867 451 383 1994 ----
NM_001017440chr7117927 7292 6507 5690 3043 2170 1893 1782 1505 1400 552 26940 2018 37577 7515 6046 26595 6579
NM_001018054chr121324 344 ----1521
NM_001018065chr9104152 2379 2373 1923 1847 671 527 511 318 253 25373 4750 23779 1892 --
NM_001018066chr9104152 2379 2373 1923 1847 671 527 511 318 253 25373 4750 23779 1892 --
NM_001018067chr163669 1160 1044 1006 985 804 --34814 3746 1821 1774
NM_001018068chr163669 1160 1044 1006 985 804 --34814 3746 1821 1774
NM_001018069chr163669 1160 1044 1006 985 804 --34814 3746 1821 1774
NM_001018074chr5153865 3431 3226 3164 3075 3002 2966 1428 1272 1122 1053 986 718 310 63 11084 13688 12500
NM_001018075chr5153865 3431 3226 3164 3075 3002 2966 1428 1272 1122 1053 986 718 310 63 11084 13688 12500
NM_001018076chr5153865 3431 3226 3164 3075 3002 2966 1428 1272 1122 1053 986 718 310 63 11084 13688 12500
NM_001018077chr5153865 3431 3226 3164 3075 3002 2966 1428 1272 1122 1053 986 718 310 63 11084 13688 12500
NM_001018090chr1542425 396 291 62 --12304 12679
NM_001018091chr1552535 506 401 172 128 --12414 12789
NM_001018102chr1542425 396 291 62 --12304 12679
NM_001018111chr7113960 3400 2878 2700 1108 766 372 282 256 169 46 ------
NM_001024094chr5153865 3431 3226 3164 3075 3002 2966 1428 1272 1122 1053 986 718 310 63 11084 13688 12500
NM_001024372chr862238 2184 1681 1637 628 106 12174 11731 --
NM_001024463chr15111192 1018 919 899 827 419 324 304 191 114 96 ------
NM_001024647chr12247470 7383 6799 6765 5917 5910 5812 5450 2827 2708 2565 2551 2484 2438 2394 2357 2346 2012 1894 1631 1625 1475 794 357 26698 5820 22805 1773 15055
NM_001024649chr562599 2401 2093 1941 1162 260 12645 --1663
NM_001024660chr371702 1639 1553 1126 536 185 47 --11502 --
NM_001024680chr281600 1392 1343 1254 522 398 354 205 1498 21639 1193 --
NM_001024855chr361563 1537 1227 583 554 382 1262 ----
NM_001024858chr1493012 2905 2731 2241 1921 1028 817 800 459 32979 2319 588 32808 2124 932 --
NM_001024956chr11135293 4699 4602 4483 4286 3990 3909 3880 3653 3627 1189 1099 746 11300 34375 1326 127 15691
NM_001025076chr1095944 5826 5686 4447 4437 3936 2483 1927 604 --15457 --
NM_001025077chr10127302 7184 7044 5805 5795 5294 4691 4657 1962 822 401 62 --26815 518 --
NM_001025079chr364027 3861 3803 3638 3427 337 1832 34192 3482 409 --
NM_001025100chr1894020 3898 3527 3270 3042 2942 1580 1418 1019 --141 --
NM_001025356chr1242682 380 286 88 31851 558 492 ----
NM_001025580chrX134333 4308 4154 4107 3431 3115 2826 1607 1555 795 767 755 697 --13706 --
NM_001025595chr471551 1535 1080 1055 621 462 50 ------
NM_001025616chr451663 1602 309 247 75 ----1495
NM_001029858chr6113289 3237 3026 2899 2496 2137 2094 1011 932 864 369 ----12278
NM_001029859chr11112353 2254 2198 1690 737 724 421 343 289 185 54 --11954 --
NM_001029863chr683069 2535 2514 2294 965 403 325 130 --33200 3160 2301 13133
NM_001029875chr582947 2912 1074 795 615 265 77 45 12338 22968 210 --
NM_001030006chr1772246 2066 1724 724 452 434 126 --11634 --
NM_001030007chr1633407 3188 1164 1281 11361 13266
NM_001030055chr1493831 3509 1890 1546 1528 1167 948 267 174 1135 --11255
NM_001031623chr611721 ----21292 85
NM_001031679chr1272479 984 810 755 243 96 58 --12842 22455 376
NM_001031695chr22105241 4236 3959 3586 3559 3385 2055 1202 840 745 24135 943 44030 1927 935 391 14104
NM_001031700chr461842 669 564 363 197 64 --1599 1339
NM_001031804chr16104390 4355 4144 3923 3222 3160 2959 2946 2829 1747 --13297 --
NM_001031812chr552231 1871 568 348 66 --22110 1646 --
NM_001032394chr662726 2483 2085 724 201 155 22243 404 ----
NM_001032395chr672593 2350 1952 1090 591 68 22 22110 271 ----
NM_001032999chr20175321 5137 4722 4586 4569 4501 4420 3739 3592 2014 1228 927 820 357 302 217 188 54467 3731 3628 2149 1826 33648 2069 1745 --
NM_001033045chr273923 3505 3284 3138 2815 1442 221 13194 34316 1275 430 11186
NM_001033087chr2042208 2052 1229 510 12405 13184 13041
NM_001033503chr54374 324 317 136 ------
NM_001033578chr872056 477 457 423 126 94 22 --42429 1832 1626 679 --
NM_001033723chr8132832 2668 2660 2653 2422 1929 1875 1083 927 669 601 316 233 12170 1109 --
NM_001034841chr16125354 4997 4252 4143 3764 1703 1511 896 866 788 331 217 35368 3849 882 43406 2200 747 80 --
NM_001035260chr1051629 1614 1422 1260 1234 ----11587
NM_001037131chr251211 950 906 239 156 --2815 523 1467
NM_001037164chr761805 1707 1611 1385 470 242 31686 266 136 11343 --
NM_001037165chr7148498 8318 8085 7925 7781 7759 5880 2998 2903 2880 2798 1262 1203 1035 48952 2806 1302 1183 27871 465 26263 883
NM_001037174chr262248 2198 1496 888 726 137 --1384 --
NM_001037317chr142396 1127 1100 131 12232 --12350
NM_001037332chr582483 2308 1722 1668 1630 857 66 59 1703 32595 2586 829 --
NM_001037333chr582483 2308 1722 1668 1630 857 66 59 1703 32595 2586 829 --
NM_001037553chr21145197 5141 5102 4316 4249 3592 3319 1744 1725 1540 1432 347 95 60 --34995 4810 1465 21736 1038
NM_001037954chr11123521 3514 3466 3130 2577 1370 1212 1045 913 483 272 204 32544 546 411 12744 179
NM_001039465chr144381 183 65 48 ------
NM_001039538chr2103496 3248 3229 3128 2905 2395 1269 1206 429 96 12828 11449 --
NM_001039580chr484109 1411 1212 1004 809 348 156 67 24686 214 13729 11734
NM_001039590chrX93981 3100 3039 1357 1219 424 364 320 98 23685 2756 --191
NM_001039591chrX93981 3100 3039 1357 1219 424 364 320 98 23685 2756 --191
NM_001039618chr11125950 5929 5463 5168 4417 3860 2198 1855 1685 1389 1233 945 --24340 2044 --
NM_001039709chr20175321 5137 4722 4586 4569 4501 4420 3739 3592 2014 1228 927 820 357 302 217 188 54467 3731 3628 2149 1826 33648 2069 1745 --
NM_001039840chrX115864 5200 3883 2210 2076 1596 1551 1046 901 832 271 25744 1322 14908 --
NM_001039916chr1231190 1085 429 --21133 1125 --
NM_001039917chr1231190 1085 429 --21133 1125 --
NM_001039918chr1231190 1085 429 --21133 1125 --
NM_001039919chr1231190 1085 429 --21133 1125 --
NM_001039920chr1231190 1085 429 --21133 1125 --
NM_001039937chr1364036 3018 1356 1127 310 233 --1409 12594
NM_001040057chr741364 920 311 70 2362 352 ----
NM_001040100chr31238 ----21242 284
NM_001040152chr7144814 4470 4119 4065 3911 3227 1906 1665 1634 1444 1212 880 845 537 23312 1995 13993 --
NM_001040202chr452489 1786 686 475 192 12127 1275 --
NM_001040214chr672133 2074 1921 1708 1574 1473 613 ------
NM_001040272chr951979 1839 1693 1574 755 1355 42114 1710 884 527 --
NM_001040284chr16145796 5784 5454 5351 5185 4823 4145 3598 1727 1663 1279 1181 1165 515 34470 4245 1669 45552 5030 4582 1944 14064
NM_001040402chr482992 2240 2078 1083 810 668 618 378 ------
NM_001040424chr2172278 2116 1933 1077 578 539 291 1992 21973 1944 12385
NM_001040429chr1373594 3457 3166 2949 2636 1405 103 --12586 --
NM_001040441chr1145386 5144 4536 4416 4114 3999 3677 3377 1515 1354 700 583 438 214 11360 55090 3522 1715 1079 860 34828 3922 3410
NM_001040446chr592498 2027 1879 1780 1074 644 591 506 192 --12612 12385
NM_001040450chr1592782 2439 1915 950 454 271 74 51 25 32013 260 155 52729 2386 2178 1166 1116 --
NM_001040453chr1592782 2439 1915 950 454 271 74 51 25 32013 260 155 52729 2386 2178 1166 1116 --
NM_001040458chr541674 1651 1561 1233 ----171
NM_001040624chr882688 2097 1804 1794 1696 1672 1102 764 12158 22715 2525 1695
NM_001040625chr882688 2097 1804 1794 1696 1672 1102 764 12158 22715 2525 1695
NM_001040626chr882688 2097 1804 1794 1696 1672 1102 764 12158 22715 2525 1695
NM_001040627chr882688 2097 1804 1794 1696 1672 1102 764 12158 22715 2525 1695
NM_001040628chr882688 2097 1804 1794 1696 1672 1102 764 12158 22715 2525 1695
NM_001040629chr882688 2097 1804 1794 1696 1672 1102 764 12158 22715 2525 1695
NM_001040630chr882688 2097 1804 1794 1696 1672 1102 764 12158 22715 2525 1695
NM_001040665chr774610 4527 4192 3310 3110 871 281 14707 1339 14559
NM_001040712chr992972 2883 2808 2748 1427 699 303 290 274 22578 2307 13564 --
NM_001040876chr451795 625 328 80 27 --31785 425 145 --
NM_001042355chr1695285 4804 4789 4704 3793 2050 1097 952 391 1995 34484 1741 1117 --
NM_001042404chr171742 1529 428 340 317 180 25 ------
NM_001042412chr1695285 4804 4789 4704 3793 2050 1097 952 391 1995 34484 1741 1117 --
NM_001042413chr983505 3139 2676 1011 694 547 225 105 --32844 2785 452 --
NM_001042481chr1431877 556 538 --1763 22199 604
NM_001042486chr2051440 221 211 52 34 --11326 1231
NM_001042492chr17143411 2851 2780 2509 2259 1400 925 841 835 711 568 530 352 28 --22613 752 11144
NM_001042543chr491573 1560 1153 1006 427 406 377 336 264 11309 11500 --
NM_001042599chr2167115 6780 6362 6281 5697 5571 2318 2140 1613 1228 1160 981 950 617 454 204 22101 268 1302 --
NM_001042601chr392560 2423 2282 2105 1311 1129 1023 182 48 22703 1293 --22293 2016
NM_001042603chr1264739 3660 3608 1526 843 501 33818 1834 1388 24480 947 15301
NM_001042604chr394248 3861 3731 3632 3179 1370 1257 723 248 1643 ----
NM_001042632chr2062374 2105 1793 1770 159 30 32465 2384 565 22058 1799 --
NM_001042633chr2062374 2105 1793 1770 159 30 32465 2384 565 22058 1799 --
NM_001042646chr362037 1981 1851 1809 660 135 --1371 --
NM_001042669chr451663 1602 309 247 75 ----1495
NM_001042749chrX52041 1775 1510 1482 675 11664 ----
NM_001042750chrX52041 1775 1510 1482 675 11664 ----
NM_001042751chrX52041 1775 1510 1482 675 11664 ----
NM_001044385chr273697 3532 3413 1356 1278 1034 320 1229 1235 --
NM_001044722chr552231 1871 568 348 66 --22110 1646 --
NM_001044723chr552231 1871 568 348 66 --22110 1646 --
NM_001049chr1452400 2276 2174 883 701 ----22308 2094
NM_001071775chr1371944 1885 1664 1315 663 634 139 --1155 --
NM_001100108chr1127579 7553 6928 6096 5492 2772 1928 1700 867 775 737 180 26608 656 57464 6135 5771 5253 2187 27594 544
NM_001106chr3149687 9142 8814 8034 7946 7898 7353 7129 6661 3827 847 739 278 90 16041 27024 914 11453
NM_001121chr1051923 1585 1402 1265 610 11542 11236 --
NM_001128chr1633407 3188 1164 1281 11361 13266
NM_001149chr1061383 1216 373 275 216 169 --11339 --
NM_001167chrX166690 5958 5887 5810 5198 5096 5052 4973 4355 4320 2634 1599 1101 954 227 80 2893 690 26096 4102 11615
NM_001173chr1493831 3509 1890 1546 1528 1167 948 267 174 1135 --11255
NM_001174chrX82169 2017 1982 1893 1659 1621 1456 843 ------
NM_001186chr2173170 3137 3038 2999 2259 1173 25 --1574 1923
NM_001204chr2177623 7571 6912 6199 6139 5807 5778 5618 5524 5123 4958 4808 1702 1441 1216 347 337 16849 15979 --
NM_001206chr993087 3027 2600 2568 2494 2009 1004 918 535 --121 --
NM_001219chr782244 2140 2035 1497 871 776 718 130 --21920 1785 --
NM_001233chr752080 2010 1833 1507 111 2655 214 ----
NM_001237chr431051 1035 38 ----21180 1128
NM_001237chr431051 1035 38 ----21180 1128
NM_001256chr1752700 2659 2019 811 326 42763 921 856 355 ----
NM_001257chr1671288 1197 597 527 472 314 110 --11247 --
NM_001259chr786031 4744 4604 4328 4165 1568 177 154 36113 1691 1033 35635 4491 1924 --
NM_001282chr1772246 2066 1724 724 452 434 126 --11634 --
NM_001304chr1742841 1278 1221 294 1300 23580 1432 --
NM_001310chr1252608 708 525 433 34 11095 22897 2530 --
NM_001346chr3112760 2607 2257 1848 883 856 211 140 126 47 27 --22169 977 --
NM_001351chr35703 571 488 239 97 ------
NM_001356chrX92342 2262 2069 1742 937 665 417 180 49 166 ----
NM_001390chr18123601 3338 2545 2495 2288 2281 2241 936 773 697 631 152 --1869 23359 2589
NM_001396chr2162783 2394 2373 2356 2101 89 ------
NM_001401chr931613 480 24 21481 298 21402 645 --
NM_001412chrX83746 2924 2721 2429 2353 327 270 238 --11230 13737
NM_001419chr1994532 1901 1895 1486 1309 1184 373 272 195 --11387 --
NM_001438chr1113613 3442 3410 3019 2924 2504 2347 1437 674 634 105 13167 1578 --
NM_001453chr631465 1351 78 21588 1174 11231 --
NM_001460chr193349 2899 2745 2707 2693 983 684 368 78 139 12483 --
NM_001465chr571664 1537 811 781 342 290 103 1750 ----
NM_001490chr9133747 3732 3711 3577 3420 3358 2734 2602 1479 888 680 370 277 --22676 988 --
NM_001497chr982631 2322 2250 2155 1779 996 150 38 ----22108 2006
NM_001498chr661115 1005 933 474 88 64 1128 21339 1032 --
NM_001542chr152835 2779 2634 2351 611 --22358 874 --
NM_001560chrX72612 1609 961 636 475 168 97 --4895 597 243 228 1929
NM_001609chr10124480 4301 3978 3942 3752 3719 3367 2760 1765 1712 972 828 11025 11416 13084
NM_001616chr263270 3034 2897 2691 388 276 --11282 --
NM_001621chr782705 2695 2602 2518 2055 1161 303 139 --22917 432 12457
NM_001621chr782705 2695 2602 2518 2055 1161 303 139 --22917 432 12457
NM_001650chr1873922 3396 3172 2599 1278 772 688 12832 --23234 3182
NM_001681chr121189 1227 --1596
NM_001682chr1252794 2707 2039 953 930 ----1942
NM_001684chr174184 3822 3528 1216 1069 1015 710 1986 --24113 3557
NM_001689chr261920 1621 1599 680 642 507 --11540 1461
NM_001690chr342211 2024 1853 575 --32125 1003 556 --
NM_001695chr8104048 4039 3953 3638 3609 3401 3157 2685 1668 791 22833 2766 --24184 235
NM_001701chr941392 340 215 203 ------
NM_001718chr661354 1117 950 870 525 111 ----11172
NM_001746chr562599 2401 2093 1941 1162 260 12645 --1663
NM_001754chr2184292 3821 3433 3080 3073 2693 2642 1300 14054 23908 3052 --
NM_001755chr1642128 678 323 256 ----1129
NM_001759chr12124865 4653 4371 4275 3881 3688 2008 1203 954 900 815 523 --14260 23917 1554
NM_001777chr364027 3861 3803 3638 3427 337 1832 34192 3482 409 --
NM_001858chr6134610 4525 3832 3683 3443 1596 1400 1194 1168 1157 1136 967 856 --2176 126 13489
NM_001859chr972635 2544 2532 1549 1064 429 245 13173 33646 2492 594 --
NM_001874chr1275020 4304 3965 3512 3410 3347 42 24603 344 43663 3398 1365 494 13319
NM_001931chr1121165 99 1204 --1419
NM_001949chr693076 3068 2070 1197 1082 719 281 122 32 156 ----
NM_001957chr442047 880 143 55 22275 824 --1286
NM_001969chr1463667 2877 2826 1209 859 730 163 23484 241 12957
NM_001981chr172434 2367 1544 590 381 80 58 --1734 --
NM_001987chr12103480 3298 3097 1280 1013 898 824 740 177 146 --13957 14134
NM_002006chr4115203 4355 4245 4216 4182 3973 2045 1999 857 345 328 15727 14595 --
NM_002009chr1582207 2049 1992 1773 557 459 121 24 1535 --21789 213
NM_002015chr1383260 3035 2830 2784 2271 997 866 582 ----1823
NM_002025chrX219085 9019 8875 8713 8220 6496 6429 6026 5925 5898 5862 3585 3502 3285 3245 3090 2186 2173 1830 1356 550 47988 1746 1603 618 38999 7630 1657 25813 2237
NM_002033chr11104108 3743 3686 3667 1574 1326 948 852 711 280 13894 33886 3433 916 --
NM_002035chr1863459 3077 2751 2723 213 122 13766 23208 988 --
NM_002040chr2173218 2863 2126 690 650 535 312 1433 2937 736 --
NM_002051chr1021175 212 --1405 1852
NM_002061chr161836 1561 1543 649 290 211 --21783 1308 --
NM_002077chr981740 1470 1314 740 730 546 324 268 --2853 642 1823
NM_002126chr17103650 3378 3222 3123 3007 2818 2557 1532 1389 75 33445 3094 2888 11143 --
NM_002128chr1332352 2234 1900 --11735 --
NM_002158chr293689 3675 3464 3292 3135 2887 1318 395 60 --23075 2774 13034
NM_002160chr93533 421 78 ----1456
NM_002182chr372791 2632 2563 2451 2043 1911 1719 ----12083
NM_002214chr785244 4937 4875 4598 3928 1760 1736 748 ------
NM_002222chr33961 928 334 1279 --1326
NM_002223chr1273453 1527 1493 1140 923 807 773 --13471 13801
NM_002241chr182999 2853 2595 2392 2233 1894 846 587 --2529 235 11048
NM_002242chr271955 1944 1909 1249 341 213 40 ----11607
NM_002264chr3114839 4457 3466 3275 3099 1627 923 914 875 848 605 44603 4417 527 215 44507 3566 1926 37 11787
NM_002268chr341719 1338 653 508 11789 11859 11843
NM_002270chr5105251 4328 3710 3563 3477 1898 1843 749 545 355 --24861 116 --
NM_002310chr5176250 6198 5772 4957 4154 4083 1735 1567 1337 1113 983 820 675 666 469 242 176 35055 4898 1784 16514 11587
NM_002313chr1084690 4423 3803 1581 1512 1390 898 100 1992 23234 2041 --
NM_002336chr12114410 4277 3967 3799 1962 1716 1080 423 345 266 107 1445 ----
NM_002374chr2103496 3248 3229 3128 2905 2395 1269 1206 429 96 12828 11449 --
NM_002481chr1187608 7388 6998 6907 6754 6437 6419 6112 5919 3084 2937 2568 2183 2128 1772 816 611 368 17803 22701 1713 27113 2019
NM_002486chr992379 2140 1787 1732 903 844 656 619 416 ------
NM_002500chr261133 1066 872 502 399 317 --1354 --
NM_002545chr1175056 4430 4276 3992 3147 1529 1087 --23973 79 --
NM_002546chr81142 ----1287
NM_002547chrX43393 1178 1109 288 13595 --1274
NM_002577chr383210 3166 2999 2621 1032 832 738 557 13274 13549 --
NM_002581chr9195296 4810 4081 4052 3972 3832 3597 2184 2162 1906 1887 1731 1571 1362 893 615 492 174 124 --11110 --
NM_002586chr641420 1333 1199 571 1454 --11370
NM_002613chr16125233 4708 4100 3984 3885 3854 3514 3465 2130 1042 360 84 --2887 189 --
NM_002641chrX51496 737 616 466 228 1593 --12035
NM_002655chr8105050 5003 4216 3837 3451 1282 1068 874 267 174 24388 3476 2150 133 --
NM_002698chr19123030 3017 2386 2122 675 602 593 568 557 489 469 425 2623 531 32423 611 512 --
NM_002709chr2103129 3002 2925 2682 2629 2463 2255 801 78 25 --13303 2317 299
NM_002715chr571276 1264 1051 980 794 196 36 --1238 --
NM_002718chr342707 2547 1775 575 --12006 11735
NM_002719chr1482069 1727 1576 1537 905 636 380 87 --22230 921 --
NM_002731chr172546 2003 951 857 745 701 223 --12413 --
NM_002734chr1741957 1944 1664 713 --1518 12082
NM_002736chr762185 2171 1781 1678 1370 207 ------
NM_002737chr17106427 6263 5720 4542 2436 2323 1935 1162 753 442 24087 370 1775 --
NM_002740chr351982 1057 930 868 385 1920 --11110
NM_002747chr1891851 1630 1623 1547 634 363 349 249 173 --1785 --
NM_002822chr1261665 1650 1477 1152 395 71 11339 11683 --
NM_002834chr12174108 3598 3564 3514 3108 3003 2938 2900 2578 1516 1358 1343 790 380 235 172 161 11217 23283 549 --
NM_002839chr992972 2883 2808 2748 1427 699 303 290 274 22578 2307 13564 --
NM_002886chr394723 4113 1664 1491 1165 1125 502 96 42 24797 3501 14256 --
NM_002938chr482036 2023 1961 1883 569 481 106 48 ----1417
NM_002940chr451795 625 328 80 27 --31785 425 145 --
NM_002941chr391477 1446 1431 1155 555 532 292 234 39 21629 102 1500 --
NM_002955chr631895 1580 1318 1497 31977 638 35 11942
NM_002959chr1103844 3537 2894 1173 1048 995 595 588 135 40 --22902 2803 24315 3185
NM_002973chr122469 385 ----180
NM_002977chr252634 1100 574 404 280 ----1274
NM_003031chr166967 882 684 643 395 203 --2845 668 --
NM_003034chr12137816 7774 7760 7628 6638 5706 2817 2507 1861 1229 330 230 29 --27849 2571 22636 927
NM_003043chr3114086 3667 3470 3421 2837 2762 1661 1542 802 651 68 --13536 13131
NM_003045chr1365005 3188 1068 938 354 97 11388 34843 742 538 1456
NM_003071chr382075 1931 1600 1491 1423 517 500 481 --1733 --
NM_003099chr15116586 6272 6204 5038 4575 4242 4168 2367 1098 936 446 16228 34526 2044 387 --
NM_003100chr5393 80 70 ----1303
NM_003108chr2107195 7124 6730 6088 4801 4639 4429 2808 2476 1455 --25162 1576 --
NM_003111chr261323 940 891 867 451 383 1994 ----
NM_003137chr641871 1503 1469 684 12039 --21687 764
NM_003144chr662023 1810 1704 904 209 83 1132 2704 462 --
NM_003149chr361600 1403 1334 1123 431 275 1239 21565 1522 --
NM_003155chr872306 2054 1713 1122 995 752 291 22127 598 62512 2180 2046 1849 146 35 1709
NM_003161chr1743452 3287 2258 162 12852 22806 2677 1618
NM_003199chr18105103 4725 3985 3451 2276 2202 1605 1271 449 43 25164 2066 1543 --
NM_003205chr1592268 2104 1984 1739 1614 1543 1518 785 133 1284 ----
NM_003236chr283091 2717 2264 1203 1105 857 574 537 1800 42919 2723 2159 210 --
NM_003262chr394067 3853 3827 2012 1148 817 536 518 195 35129 4829 4182 11040 --
NM_003274chr2142960 2056 2005 1109 189 --22619 2256
NM_003275chr941209 1164 1065 563 --1252 2238 75
NM_003298chr3116025 5748 5144 4989 4732 4416 4379 3888 3788 2339 832 21647 1427 25737 2076 --
NM_003320chr11114325 3965 3777 3156 2858 1377 1108 957 946 646 143 13237 33221 1394 1279 --
NM_003326chr182621 2298 1699 1086 729 575 484 470 --2590 27 --
NM_003338chr1021589 107 ----21414 321
NM_003339chr531539 1478 1164 1505 21523 237 1176
NM_003369chr1162726 2702 2414 850 671 236 ------
NM_003373chr1041902 1738 672 101 21455 315 1422 11449
NM_003387chr272641 2389 2358 1082 1036 425 418 12952 12591 12430
NM_003392chr3104363 4273 3667 3331 3230 3040 2734 2632 1484 208 22873 119 ----
NM_003410chrX72950 2329 2189 2128 522 336 64 ----13015
NM_003423chr1982542 1679 660 633 531 285 269 214 --1818 --
NM_003463chr673389 3251 2711 2413 2166 2092 266 --13317 --
NM_003468chr283998 3749 3687 2734 1660 1642 1155 490 22915 1274 ----
NM_003474chr10112410 2341 2333 2229 2070 1879 1804 1693 909 874 702 ----1681
NM_003477chr114743 709 580 291 ----1282
NM_003478chr1142219 1239 1063 1038 ----1446
NM_003483chr1252184 2167 1854 352 161 12022 --2862 642
NM_003489chr2192252 1152 1099 961 946 920 204 195 39 12882 --13037
NM_003559chr1773807 3263 2945 1571 1496 1151 493 4880 696 28 22 ----
NM_003574chr1855205 4012 1763 985 810 32017 1275 50 ----
NM_003590chr293813 3436 3316 2924 2789 1308 587 125 70 13720 ----
NM_003603chr472171 2004 1827 1719 766 274 139 1403 11380 --
NM_003607chr173994 3598 1298 860 806 448 100 34369 3810 1463 --23572 726
NM_003615chr383988 3483 3230 2766 1451 1432 911 796 13623 --12946
NM_003617chr1134830 4803 4438 4271 3502 3404 3364 3206 1900 1355 720 629 24 21970 262 14446 --
NM_003629chr1143355 3308 2971 2625 2432 2380 2220 2132 1311 1183 679 655 544 352 1280 --13095
NM_003630chr65771 286 146 63 21 --1194 --
NM_003663chr393100 3013 2288 1402 731 672 525 153 98 12808 ----
NM_003743chr261673 1594 605 511 336 293 11966 21815 466 --
NM_003759chr453755 2685 1412 709 134 33909 2918 2769 --11054
NM_003762chr141132 912 221 115 ----1263
NM_003763chr2093152 2461 842 828 759 736 614 512 416 --12159 1924
NM_003861chr1462702 2492 2294 2176 1019 809 11867 2474 111 12267
NM_003887chr262313 1792 852 721 633 76 ------
NM_003895chr2131971 1859 560 1690 --1668
NM_003939chr1083884 3853 3720 3578 3261 1104 398 103 33030 760 751 12813 13455
NM_003941chr72870 565 --22357 1796 1881
NM_003953chr172827 2784 2092 2079 1974 196 40 12396 ----
NM_003958chr652858 2725 2586 1228 999 12963 --12413
NM_003966chr5136957 6503 6348 6311 5747 5698 5509 5116 2777 1064 835 221 123 16253 17373 16452
NM_003994chr12174126 3993 3986 3781 3703 3522 3453 3203 3084 2899 1529 1061 1004 881 686 620 114 --33654 3415 1037 11280
NM_004006chrX52446 1753 873 406 303 --1863 12254
NM_004007chrX52446 1753 873 406 303 --1863 12254
NM_004009chrX52446 1753 873 406 303 --1863 12254
NM_004010chrX52446 1753 873 406 303 --1863 12254
NM_004011chrX52446 1753 873 406 303 --1863 12254
NM_004012chrX52446 1753 873 406 303 --1863 12254
NM_004013chrX52446 1753 873 406 303 --1863 12254
NM_004014chrX52446 1753 873 406 303 --1863 12254
NM_004015chrX52446 1753 873 406 303 --1863 12254
NM_004016chrX62360 1667 1030 787 320 217 11036 1777 12168
NM_004017chrX52446 1753 873 406 303 --1863 12254
NM_004018chrX62360 1667 1030 787 320 217 11036 1777 12168
NM_004020chrX52446 1753 873 406 303 --1863 12254
NM_004021chrX62360 1667 1030 787 320 217 11036 1777 12168
NM_004022chrX62360 1667 1030 787 320 217 11036 1777 12168
NM_004023chrX62360 1667 1030 787 320 217 11036 1777 12168
NM_004028chr1873922 3396 3172 2599 1278 772 688 12832 --23234 3182
NM_004035chr17135177 5170 4826 4122 3783 3776 1789 1244 991 905 807 582 213 1775 11229 --
NM_004080chr751303 452 397 106 78 ----1988
NM_004093chr1362488 2412 2334 1215 312 278 1680 --12547
NM_004094chr1472894 2736 2677 2669 2344 2210 2019 --22381 2176 --
NM_004100chr642612 2488 1025 112 21730 1637 12673 12531
NM_004113chr351410 582 576 548 177 --11475 1259
NM_004124chr1483476 3189 2394 1284 932 557 416 163 158 33254 1341 1158 --
NM_004136chr1583168 3148 3086 2181 1245 536 278 213 12716 12452 22787 417
NM_004163chr18290 67 ----1145
NM_004170chr951714 1317 1179 460 207 --21831 533 --
NM_004171chr11169320 9056 8224 7649 7244 6671 6557 3533 3410 3262 3150 2658 2147 1160 861 258 23130 804 67537 6113 3349 3076 1599 1131 11718
NM_004232chr1873533 3410 3356 3121 3070 2401 1203 22762 811 23739 3011 --
NM_004274chr1431228 500 30 12302 --11135
NM_004293chr993716 3359 3231 2950 2661 2363 1277 789 465 33550 3031 2558 ----
NM_004296chr1494013 3841 3799 3565 3379 3275 3251 1067 573 12945 11134 22485 175
NM_004302chr1262740 2514 2094 1012 883 399 1434 12043 21936 1068
NM_004338chr18217089 7075 7062 6665 6020 5787 5398 5259 4884 4505 2784 2729 2051 1816 1550 1328 759 668 429 113 38 11544 15556 27027 172
NM_004342chr761768 1753 1651 817 783 667 ----11833
NM_004349chr83885 361 51 --11069 1323
NM_004370chr692209 1901 1784 638 625 440 393 313 134 21363 322 ----
NM_004384chr552231 1871 568 348 66 --22110 1646 --
NM_004412chr10105909 5825 2402 1745 1665 1462 1028 944 498 291 14829 21728 1070 --
NM_004426chr1261671 1489 1439 1324 566 288 --123 1737
NM_004430chr852749 2664 2273 1021 712 12164 22400 76 12486
NM_004438chr273288 2681 2663 2364 2336 2269 431 --22302 1262 --
NM_004440chr671866 1812 1398 1285 620 422 350 ------
NM_004449chr213549 432 367 11067 --11375
NM_004454chr381819 892 619 600 593 467 420 204 ------
NM_004464chr4113409 3374 3297 3206 3127 1735 1598 1545 1524 1315 27 12780 ----
NM_004491chr1984387 4280 3349 748 734 236 74 32 14111 23182 842 12773
NM_004496chr1451368 229 85 76 60 11131 ----
NM_004501chr1123883 3579 3428 2742 2724 2603 2572 1576 1426 868 601 527 1415 11439 13200
NM_004523chr1041460 1418 1320 1043 --1193 11520
NM_004529chr931382 290 140 11081 2213 174 11327
NM_004575chr411285 ----1452
NM_004586chrX105482 5345 5103 4958 4527 4077 2030 1891 1826 789 --23863 1565 --
NM_004598chr582671 2205 2104 2063 1192 986 949 931 ------
NM_004612chr9103879 3757 3311 1836 1649 1080 965 850 494 430 14425 11540 --
NM_004622chr252273 2203 852 797 124 ----1510
NM_004631chr121324 344 ----1521
NM_004654chrY31318 876 107 ----190
NM_004660chrY92196 1989 1675 1614 908 846 661 415 50 167 ----
NM_004666chr641116 968 280 195 ----11005
NM_004703chr1772458 2316 1991 1858 930 615 592 11778 21738 1007 --
NM_004726chrX65289 5076 2282 1638 1317 865 45569 5359 4163 465 35031 1192 288 14079
NM_004730chr562198 2104 1511 652 521 151 --1790 21853 164
NM_004734chr1393293 3136 3074 2697 2542 2137 2009 1226 24 12568 12027 --
NM_004736chr162238 2162 2064 1940 1454 806 1241 --1405
NM_004745chr8156886 6403 6337 6268 6193 5985 5899 5673 5399 5349 5301 5093 4479 2656 2420 15235 26346 1867 15382
NM_004748chr1573862 3845 3352 2921 1677 1027 498 --43533 2762 1194 209 --
NM_004760chr761912 1820 1595 341 181 102 --12411 21888 161
NM_004774chr1792754 2355 2304 1942 1006 792 181 68 45 --12650 --
NM_004775chr1882271 1967 1822 975 714 227 118 30 ------
NM_004788chr1142032 245 28 22 ----11747
NM_004798chr2093667 3648 3309 3256 2959 1422 731 401 274 13673 --12789
NM_004805chr241068 439 219 32 --1406 2377 372
NM_004834chr261375 1022 940 723 213 102 22763 1060 11091 23059 1168
NM_004859chr1763021 2874 2345 2064 1217 499 32276 2108 1118 ----
NM_004863chr14145150 4469 4109 4061 3947 3583 3395 2087 1383 1352 1291 287 79 67 14993 44576 4402 3647 1598 --
NM_004866chr584801 4572 4177 3320 1740 1702 1466 390 --34881 3928 141 11445
NM_004871chr1794327 4198 4034 3976 3817 3763 273 168 106 --44073 3453 361 331 11737
NM_004896chr1051544 1529 1337 1175 1149 ----11502
NM_004904chr7226506 6019 5969 5962 5695 5640 5058 4931 4609 4540 4385 4153 2426 2419 2075 2040 1730 1704 1561 1167 829 346 --25670 5078 --
NM_004956chr7144574 4231 4159 3989 3820 2991 2861 1816 1569 1367 1220 938 755 316 --13645 --
NM_004976chr11104923 4539 4465 4255 4200 3954 1804 894 624 272 24906 4569 33848 3834 819 --
NM_004985chr1293754 3099 3069 3036 2820 1172 987 647 215 13981 ----
NM_004992chrX157921 7535 6453 5203 2711 2355 2337 2317 1776 1069 705 527 313 225 31 27329 298 37423 7373 258 --
NM_004992chrX157921 7535 6453 5203 2711 2355 2337 2317 1776 1069 705 527 313 225 31 27329 298 37423 7373 258 --
NM_004996chr1681696 1452 619 534 217 116 102 82 21559 330 ----
NM_005036chr22238362 7729 7317 7049 6972 6594 6433 6315 6142 5972 5713 3250 2881 2322 1936 1810 1527 1353 791 671 411 171 141 --37247 2851 2023 26443 2778
NM_005044chrX114494 3628 3513 3468 3367 3347 3337 3282 3079 1799 562 14400 22969 875 178
NM_005056chr1284983 3904 3852 3411 1770 1087 745 214 34062 2078 1632 34724 1191 240 15545
NM_005063chr1021116 158 13678 136 21411 1354
NM_005065chr1485329 5070 4998 4477 1943 1553 1216 1085 11544 11161 24979 814
NM_005068chr64938 917 360 145 1237 2966 547 --
NM_005093chr20175321 5137 4722 4586 4569 4501 4420 3739 3592 2014 1228 927 820 357 302 217 188 54467 3731 3628 2149 1826 33648 2069 1745 --
NM_005095chr172225 2167 1763 1530 721 692 554 ------
NM_005121chr1783210 2898 2747 2710 2337 1322 1002 979 ------
NM_005126chr351821 699 298 291 207 12089 12311 --
NM_005156chr994756 4539 3748 3264 848 763 423 141 81 1456 24431 247 --
NM_005160chr22105990 5116 4340 4187 2673 1720 1205 613 588 187 12314 16546 26555 2021
NM_005164chr1252559 2250 1876 1759 1045 --12490 --
NM_005188chr11147177 6884 6524 6099 5993 5820 5805 5337 5170 2818 2340 2041 1698 35 27783 2120 26561 3001 16665
NM_005197chr14256125 5960 5900 5801 5611 5175 4828 4158 3924 3891 3881 3867 3837 2365 2089 1843 1293 1227 1218 1001 785 570 287 278 216 25795 1899 11198 35221 2122 1034
NM_005233chr392457 2337 2072 1941 1702 789 471 317 278 2956 750 11811 --
NM_005235chr2167115 6780 6362 6281 5697 5571 2318 2140 1613 1228 1160 981 950 617 454 204 22101 268 1302 --
NM_005238chr1193130 2680 2440 2427 2416 2378 1146 554 316 1209 1184 13385
NM_005277chr431238 412 268 --11376 1196
NM_005339chr4114238 3815 3765 3463 3396 3245 2946 2739 1552 489 261 11373 ----
NM_005359chr18106569 5119 4784 2476 1756 1744 1603 1417 1076 927 14715 16108 26396 4412
NM_005397chr7113960 3400 2878 2700 1108 766 372 282 256 169 46 ------
NM_005410chr55727 291 180 86 70 ------
NM_005433chr1862312 2043 788 600 301 147 2944 727 --1875
NM_005436chr1063352 2757 1464 1144 518 166 54123 3027 2963 1359 193 12612 --
NM_005455chr151392 1272 579 352 289 --1489 11872
NM_005477chr1562101 1831 1632 1021 151 112 --22574 819 22047 271
NM_005477chr1562101 1831 1632 1021 151 112 --22574 819 22047 271
NM_005497chr17135978 5787 5080 5040 4978 4211 4168 4118 2392 2123 1450 866 274 --45551 5097 4305 966 --
NM_005502chr983178 2865 2783 2278 2163 2076 429 397 289 45 1849 13144
NM_005504chr12136426 5527 4574 4304 4231 4094 2504 2302 1241 919 745 464 248 --25812 4921 14506
NM_005578chr3124881 3694 3228 1891 1729 1413 1335 1305 1120 979 633 83 34658 4150 3239 14061 11043
NM_005596chr986324 4763 4444 1742 1304 1040 1030 565 --35644 5422 242 --
NM_005647chrX153406 2635 2542 2498 2237 2124 1390 1362 1304 1230 1111 379 207 121 43 13293 22419 483 --
NM_005665chr174672 4548 4303 3011 1460 332 314 13201 24605 1793 13550
NM_005668chr5124589 4383 3702 3479 3350 3163 1161 1039 864 412 393 250 ------
NM_005669chr582100 1973 1704 1517 1461 907 571 548 11831 21800 840 --
NM_005722chr242221 1528 986 785 ----12504
NM_005730chr12123325 3169 2815 2762 2672 2523 2410 1027 513 412 315 177 12431 1569 --
NM_005738chr761805 1707 1611 1385 470 242 31686 266 136 11343 --
NM_005739chr1581822 1588 882 575 427 334 206 93 ------
NM_005746chr741997 1698 1691 507 --22323 2165 --
NM_005756chrX61527 1512 1063 606 165 88 11138 ----
NM_005759chr274714 4653 4444 4147 1685 919 476 ----23169 292
NM_005779chr5143572 3215 3162 3030 2438 2409 2394 2365 2295 2285 741 469 300 105 11317 13232 13655
NM_005785chr1211822 1389 1380 21374 39
NM_005788chr114535 497 285 183 ----1747
NM_005832chr361452 1366 1342 591 542 244 1463 ----
NM_005840chrX147417 7307 6619 6603 6177 6063 5886 5594 5452 2286 1891 1409 1381 900 --2982 96 17464
NM_005880chr1641353 1155 1039 169 --11195 --
NM_005896chr23310 96 44 ----1122
NM_005898chr11123067 2867 2735 2557 2310 2094 2055 2009 1081 656 406 187 12933 1373 --
NM_005899chr173292 248 168 --21402 1383 1177
NM_005901chr18138711 7970 7909 7351 7227 6737 5348 2011 1998 1602 1309 710 540 37864 6779 1122 16611 18065
NM_005902chr1574272 4129 4038 3643 3201 1556 965 1354 24191 1383 --
NM_005903chr595185 5029 4592 4367 3309 2075 1780 1257 506 --11378 --
NM_005909chr573814 2881 2674 2647 502 266 65 ------
NM_005935chr4135338 4895 4478 4439 3943 3379 2050 1940 1609 1449 1310 903 527 21351 922 1315 21832 1117
NM_005941chr853417 3357 2898 2842 1550 12662 11032 23951 401
NM_005957chr1104788 4256 3892 2993 1749 1541 1419 348 329 218 24918 3309 24735 3936 --
NM_005962chr1052326 931 423 235 124 --22081 449 --
NM_005962chr1052326 931 423 235 124 --22081 449 --
NM_005966chr251949 544 273 190 83 --2714 156 --
NM_006007chr984221 3853 3042 1524 1481 963 640 632 11115 24069 530 12928
NM_006011chr15144131 4070 3904 3564 3306 2642 1731 1582 1503 1401 981 778 535 513 31175 256 136 1310 11648
NM_006024chr77851 750 640 128 83 71 55 ------
NM_006047chr2053433 2540 2500 739 250 ----1841
NM_006080chr751930 898 644 555 359 12937 1863 --
NM_006095chr484280 4113 3405 2996 1455 1370 1363 805 11544 23042 446 --
NM_006106chr1153092 2782 519 461 252 --176 11226
NM_006108chr1162091 1876 854 818 440 209 12313 42243 1951 913 779 --
NM_006136chr741348 884 113 51 --2350 202 --
NM_006139chr2102919 2869 2690 2336 1132 901 676 496 399 148 --124 --
NM_006141chr1652234 2057 368 340 332 --165 22394 441
NM_006154chr1572919 2830 1822 1029 484 369 124 12030 1243 12456
NM_006164chr23347 179 110 --1123 --
NM_006194chr1461102 1091 505 411 366 342 --2924 327 --
NM_006203chr5165503 5447 5176 4923 4739 4652 3995 3596 3400 2160 2068 2040 1475 1246 637 168 13883 ----
NM_006237chr1362168 1749 1549 1522 630 466 1376 --1449
NM_006241chr372241 2151 2136 1983 1964 409 402 --1609 --
NM_006252chr1137591 6536 6219 5561 5088 2709 2380 1590 1281 971 524 462 312 11966 55169 4944 4857 1219 42 --
NM_006256chr192503 932 916 830 759 751 503 312 22 ------
NM_006265chr841376 1209 1108 396 ----11093
NM_006281chr871175 1101 1043 740 731 47 39 ------
NM_006281chr871175 1101 1043 740 731 47 39 ------
NM_006283chr874542 3836 3250 3021 1277 1179 684 --23703 1192 11652
NM_006287chr262646 2238 2086 1701 554 400 1373 1293 --
NM_006306chrX155860 5679 5613 5537 5444 5411 5378 5312 5278 4488 3958 3889 3791 2059 1206 75748 5550 5178 4760 3780 3583 624 35831 4560 4188 --
NM_006310chr172876 416 --3931 188 109 1358
NM_006315chr4114173 4049 3477 3343 3264 3117 3002 1718 1455 760 526 199 --1746
NM_006371chr395302 5163 4688 4460 4372 3574 1917 1517 1422 11095 1678 11016
NM_006375chrX71864 1775 1731 1319 584 525 201 --1481 --
NM_006379chr7112321 2276 1820 1814 1589 1529 1523 925 913 897 591 11559 1645 1293
NM_006380chr1794353 4331 1152 727 707 600 331 69 63 23723 758 21264 638 --
NM_006403chr671837 1780 1660 1454 1251 499 326 --11518 --
NM_006416chr62297 38 ----154
NM_006457chr464096 3622 3083 436 247 144 11490 11552 --
NM_006464chr274683 3345 3120 2882 1030 612 122 14129 14396 --
NM_006472chr13961 887 193 21260 246 2495 437 11080
NM_006529chr491669 1564 1551 1144 418 397 368 327 255 11300 11491 --
NM_006538chr2144212 3246 3185 2995 2782 2755 2560 1617 1593 1395 450 253 100 53 --13819 --
NM_006544chr14145899 5446 5151 4943 4922 4069 3977 1685 1586 1134 748 722 418 268 46077 4418 4206 472 24570 4048 11812
NM_006546chr17146647 5970 5714 4994 4551 4435 4255 2177 2124 1858 1634 1452 1391 370 15189 14466 26255 5305
NM_006547chr7101972 1793 1575 1304 791 688 447 135 118 42 ------
NM_006548chr391676 1173 1096 348 212 198 105 98 68 184 ----
NM_006561chr1095944 5826 5686 4447 4437 3936 2483 1927 604 --15457 --
NM_006572chr1763486 3374 3306 2710 934 914 189 ----
NM_006599chr16167274 7100 6825 6807 6785 6362 6234 6175 5838 5408 5274 5252 3317 2547 2061 1128 37723 5459 1668 16098 --
NM_006603chrX52041 1775 1510 1482 675 11664 ----
NM_006609chr2102805 2756 2728 2556 2418 2342 950 827 626 306 ------
NM_006620chr6104581 4370 4200 4156 3916 3289 3134 3109 1667 594 --44651 4562 1645 620 --
NM_006624chr1071998 1763 1503 1360 794 787 72 ------
NM_006628chr1553815 3089 837 430 222 2802 470 13127 --
NM_006717chr962941 2888 2630 1316 693 616 ----22907 655
NM_006720chr1084690 4423 3803 1581 1512 1390 898 100 1992 23234 2041 --
NM_006729chrX105526 5400 4478 4300 4229 1660 1533 699 682 509 ----15173
NM_006731chr9114847 4836 4691 4324 4073 3939 3577 2122 779 765 97 --25092 1790 --
NM_006734chr611570 1575 --1613
NM_006738chr1594145 3797 3538 3454 1712 1681 1658 1090 388 23902 3327 1666 --
NM_006750chr16207903 7653 7245 7137 6679 6619 6529 5657 5614 4969 2938 2464 2423 1765 1032 911 830 783 719 137 35363 2706 2312 57275 6826 6783 5817 1067 17767
NM_006756chr85485 185 94 79 55 --166 --
NM_006766chr832473 2380 917 1436 12032 170
NM_006777chrX62559 2077 1036 881 706 665 11137 12052 --
NM_006788chr1872073 726 583 378 349 316 309 --11370 1804
NM_006873chr2123551 3286 3211 2761 2282 898 692 492 426 291 155 58 --12563 --
NM_006885chr1684122 4009 3528 3268 3126 1185 699 59 --13717 --
NM_006895chr261639 1385 870 688 215 77 31505 827 636 ----
NM_006902chr1122900 2721 2657 2096 2024 1299 650 516 498 200 193 137 --13045 13213
NM_006908chr751182 1132 1120 167 155 ------
NM_006916chr241316 976 526 76 11203 ----
NM_006918chr11135293 4699 4602 4483 4286 3990 3909 3880 3653 3627 1189 1099 746 11300 34375 1326 127 15691
NM_006922chr242513 1902 1870 990 --12147 1538
NM_006924chr1774485 4432 3976 3732 1564 1467 999 13613 --13041
NM_006925chr144381 183 65 48 ------
NM_006954chr10103339 3127 3115 3106 3042 2422 2254 1398 1061 809 12717 22480 2394 --
NM_006974chr10103339 3127 3115 3106 3042 2422 2254 1398 1061 809 12717 22480 2394 --
NM_006981chr942850 2341 2039 1890 1802 32843 2193 1002 2565 176
NM_007006chr1692685 2487 2392 2347 2285 739 604 541 462 1168 11266 --
NM_007007chr1274258 3580 1572 1341 1133 983 168 ------
NM_007011chr15156723 6337 5168 4939 4266 2467 2394 2095 1777 1488 1009 811 572 546 286 12365 25464 2266 11334
NM_007038chr21135854 5837 5740 5551 4537 4420 4143 4084 2301 1814 1631 1549 619 13890 2828 268 --
NM_007039chr1461807 1766 1442 567 495 370 ------
NM_007050chr20237860 7749 7235 6877 6539 6010 5966 5654 5644 5407 5338 5225 2209 1948 1789 1756 1534 1296 1241 520 338 298 231 27340 5698 47878 6606 6065 1693 --
NM_007054chr583895 3538 3421 1531 1491 1057 1034 672 1345 11250 --
NM_007064chr371702 1639 1553 1126 536 185 47 --11502 --
NM_007106chr1372008 662 518 339 297 169 85 ------
NM_007107chr362411 2381 1894 1630 835 763 1530 --11828
NM_007114chr373269 3217 2138 1102 527 341 206 12109 11281 12220
NM_007137chrX115567 4163 3599 3464 1934 1743 1678 1577 1066 1000 977 25245 4803 14770 35214 4466 1885
NM_007146chr1752583 2433 1044 283 85 2945 211 ----
NM_007153chr19214164 3856 3771 3646 3618 3354 3336 3289 3250 3195 3138 2925 1693 1290 1103 697 664 413 365 188 27 14024 23085 1486 11260
NM_007172chr2283245 3110 2818 2149 827 476 299 266 13193 ----
NM_007175chr893348 3171 3131 3041 2868 2763 2524 2278 236 163 12534 11134
NM_007200chr1594145 3797 3538 3454 1712 1681 1658 1090 388 23902 3327 1666 --
NM_007203chr9113671 2629 2581 2534 1224 1163 800 697 300 51 43 33024 2758 1052 1331 1130
NM_007218chr82890 760 ----1623
NM_007249chr13269433 8589 8411 8214 8138 7926 7692 7562 7043 6910 6852 6814 6663 6591 6403 6369 6179 3703 3449 2414 2148 1547 1304 878 799 627 22993 2541 38343 8252 6796 22621 127
NM_007276chr73752 739 105 1885 11039 1715
NM_007283chr363090 2739 2179 652 420 283 1885 42994 1952 968 593 1108
NM_007287chr363127 2926 2238 2011 898 842 23186 2203 1336 --
NM_007288chr363127 2926 2238 2011 898 842 23186 2203 1336 --
NM_007289chr363127 2926 2238 2011 898 842 23186 2203 1336 --
NM_007292chr17135177 5170 4826 4122 3783 3776 1789 1244 991 905 807 582 213 1775 11229 --
NM_007332chr831464 148 117 --11300 11340
NM_007350chr12124429 3907 3529 3452 2933 1553 1440 1351 1274 1128 989 369 --22963 682 --
NM_007375chr142735 1937 350 258 22811 760 ----
NM_012081chr563655 3601 3475 3331 2912 2874 12929 1277 --
NM_012093chr121082 177 --11048 11095
NM_012096chr373583 3369 3124 2829 2600 2437 341 --12557 --
NM_012097chr262248 2198 1496 888 726 137 --1384 --
NM_012104chr1153634 3523 3333 890 420 --13053 23573 553
NM_012104chr1153634 3523 3333 890 420 --13053 23573 553
NM_012120chr693023 2685 2592 2216 2077 1957 1182 1082 841 ----22602 619
NM_012137chr152848 2410 2183 2041 1788 11080 12580 1677
NM_012141chr1364036 3018 1356 1127 310 233 --1409 12594
NM_012153chr1131983 129 27 149 1615 1352
NM_012156chr2093457 2724 2679 2590 2473 2366 2130 850 51 13094 --32313 382 45
NM_012164chr9147505 7061 6966 5253 4775 3029 1713 1607 1202 1082 821 477 357 88 34662 2124 1922 12958 --
NM_012193chr1195236 3737 3417 2080 1397 1091 369 246 171 11361 34241 217 108 --
NM_012199chr153882 3848 3116 773 178 3901 472 187 23859 908 1511
NM_012214chr2156416 5810 5329 5019 2496 2200 1756 1578 1394 1339 1215 708 583 317 179 15494 36023 4414 522 --
NM_012223chr261103 901 505 441 302 213 --1284 11345
NM_012224chr441168 874 467 244 ----1109
NM_012234chr3103695 3114 2554 2405 2296 1483 790 519 34 26 32813 2587 1332 22351 629 --
NM_012238chr1041314 407 363 242 --21730 1176 21225 103
NM_012249chr293551 2798 2544 2359 1327 1027 913 834 198 1230 12671 --
NM_012252chr773765 1938 1782 1712 1065 978 167 34687 3687 746 ----
NM_012255chr20197 ----1382
NM_012262chr194361 3838 3594 3487 1901 1890 1048 608 598 ------
NM_012281chr782037 1609 886 776 547 469 390 163 12045 --11748
NM_012287chr363749 877 864 649 398 64 1538 --11732
NM_012288chr6105668 5178 4958 2204 1764 1183 976 917 206 191 --34146 1441 732 --
NM_012297chr472629 999 973 660 606 442 250 --21770 1036 1727
NM_012306chr12103142 2883 2758 2194 1375 1345 1215 1193 1070 563 --194 183
NM_012309chr1174766 4245 3898 1887 1862 1558 816 34468 3785 3564 13955 --
NM_012316chr1105269 4237 4081 3920 3493 2265 2080 1260 186 46 --65070 5009 4694 3499 1830 80 13597
NM_012325chr2021512 46 ----1375
NM_012329chr1721659 1537 --127 1268
NM_012334chr5124737 4591 4209 4076 4036 3880 3180 2898 1432 897 313 269 23371 1218 24158 1204 --
NM_012382chr5104566 3981 3835 3017 2989 2919 1156 942 823 138 12893 ----
NM_012397chr1861708 1445 449 331 223 129 --11524 --
NM_013231chr14114248 3332 3060 2895 2880 1714 1683 970 813 762 685 ----13426
NM_013257chr872056 477 457 423 126 94 22 --42429 1832 1626 679 --
NM_013261chr473257 2755 2585 716 586 552 414 1396 ----
NM_013269chr12114270 4170 3878 3678 3642 3312 1801 1271 1120 151 145 --1631 22802 1100
NM_013286chr383129 2649 1278 1225 1185 851 635 156 --11288 11413
NM_013302chr16124516 4295 3965 3798 3552 3503 3462 3413 3276 1773 253 121 --11628 --
NM_013309chr1562489 2465 2456 2167 1636 664 11829 22214 375 --
NM_013322chr761316 1177 1151 1055 345 292 ----1441
NM_013372chr1563312 3226 2306 2122 2091 923 33346 353 71 1683 --
NM_013381chr1251534 1487 940 495 473 11601 1242 --
NM_013396chr2141229 1128 1088 253 21013 206 11270 --
NM_013411chr1102759 2736 2004 1895 1722 887 541 483 398 382 --1333 12155
NM_013423chrX61131 979 944 855 418 198 ----1230
NM_013427chrX61131 979 944 855 418 198 ----1230
NM_013449chr1292775 2675 2405 2143 1170 1145 609 411 238 ------
NM_013989chr14114847 4556 4358 3377 2037 1985 1841 1827 1770 1673 981 --21796 1047 1327
NM_014000chr1041902 1738 672 101 21455 315 1422 11449
NM_014011chr242509 1780 442 30 1558 12628 1600
NM_014023chr1072727 2651 2029 1083 643 440 78 12044 ----
NM_014028chr683276 1097 804 691 578 535 380 361 22342 1069 22157 912 --
NM_014034chr651469 1426 533 490 226 --2309 141 --
NM_014048chr1675134 5096 4644 1786 959 476 412 21820 942 24720 3491 --
NM_014112chr8135092 5072 5036 4212 4136 3381 2129 1368 1202 830 802 334 252 ----14567
NM_014117chr1642391 544 198 41 ----22523 2478
NM_014141chr7114821 4129 3781 3716 3369 1770 1126 799 761 692 663 1885 44019 3732 3677 473 25340 5258
NM_014155chr11187176 7121 6619 6228 5567 5008 4663 4631 2913 2528 2296 2041 1763 1479 941 904 643 498 21556 227 17496 36424 600 247
NM_014157chr16123728 3694 3601 2701 1377 784 487 311 241 206 53 28 23048 731 22725 1022 --
NM_014177chr181366 1458 --1152
NM_014181chr262477 2456 759 355 332 226 12429 --12073
NM_014240chr383594 3243 3191 1558 1429 1259 1194 155 --43757 2581 1093 996 1600
NM_014243chr461812 1799 1728 1442 295 216 --1500 21385 30
NM_014309chr22105231 4226 3949 3576 3549 3375 2045 1192 830 735 24125 933 44020 1917 925 381 14094
NM_014325chr1282282 2178 1671 665 531 426 323 137 --1838 --
NM_014372chr172073 2011 1934 1407 729 79 33 --1589 --
NM_014376chr582483 2308 1722 1668 1630 857 66 59 1703 32595 2586 829 --
NM_014395chr451694 698 543 243 90 ----1121
NM_014423chr5125628 5613 5196 4816 4727 4235 4104 2201 1618 1282 851 614 45407 5256 1487 1213 ----
NM_014447chr471550 1534 1079 1054 621 462 50 ------
NM_014494chr1692261 2241 1948 1632 925 613 358 238 81 --1951 --
NM_014521chr261726 1675 1592 1542 1148 251 11870 31711 1348 1225 --
NM_014574chr1471433 1425 1225 1155 1100 279 145 --11599 --
NM_014586chr2144228 1219 1157 566 21439 1336 33831 1516 1387 13932
NM_014612chr931170 564 182 ----11305
NM_014613chr572764 2500 1057 1049 926 401 174 11117 22887 2425 --
NM_014616chr362841 2492 2361 1145 702 28 --1695 22461 991
NM_014659chr15111192 1018 919 899 827 419 324 304 191 114 96 ------
NM_014679chr112903 220 2917 53 21084 195 --
NM_014701chr1531334 1140 495 --13449 1261
NM_014702chr693387 3223 2749 2306 2199 2170 1310 1130 1032 ----13404
NM_014707chr732119 2109 2015 21666 756 1829 --
NM_014721chr6137126 6440 5657 5546 4904 4682 2986 2880 2662 1738 1639 1255 325 36420 2865 2563 11708 1403
NM_014729chr862238 1734 1615 1482 1406 363 11459 1673 --
NM_014730chr12125076 4949 4881 4471 4173 3663 3581 1211 950 943 720 399 34016 1388 1248 25261 50 --
NM_014730chr12125076 4949 4881 4471 4173 3663 3581 1211 950 943 720 399 34016 1388 1248 25261 50 --
NM_014732chr16105890 5813 4469 4310 4014 1118 741 282 246 136 --33564 1002 100 13999
NM_014733chr552209 815 293 155 48 1567 1455 --
NM_014739chr663715 2781 1617 1475 1441 523 13842 --1615
NM_014746chr294173 3928 3719 3081 1654 1311 1067 540 521 12909 13462 --
NM_014755chr273963 3936 3605 2943 2616 746 391 --13196 1912
NM_014765chr142560 2139 1676 845 22574 2419 22063 582 --
NM_014766chr7103701 3606 3288 3269 3175 3085 2803 2642 550 69 12811 --21110 127
NM_014774chr192688 2182 1095 1025 566 346 219 176 99 1753 --23043 2654
NM_014776chr1242887 896 715 342 12826 2528 403 2837 786
NM_014781chr81262 --1398 11074
NM_014810chr163265 3218 2719 2253 1146 532 --12550 --
NM_014812chr171742 1529 428 340 317 180 25 ------
NM_014819chr572482 1880 1738 1519 928 251 151 --1649 --
NM_014820chr351643 1604 1419 1381 521 1732 1101 --
NM_014826chr173994 3598 1298 860 806 448 100 34369 3810 1463 --23572 726
NM_014827chr151663 1539 1344 1162 691 ----1118
NM_014828chr1441988 865 737 681 --22535 22 11781
NM_014829chr552028 1714 1642 185 177 --1198 --
NM_014832chr134782 626 178 104 --1765 2761 396
NM_014835chr2062225 2034 1864 608 414 91 --1283 22113 696
NM_014838chr2272518 2182 1778 1094 475 372 332 12628 42500 1877 380 107 --
NM_014839chr152543 2348 1688 719 41 --11722 12253
NM_014844chr1443537 1590 1109 349 --33023 2701 1337 23959 1027
NM_014867chr873855 3713 3375 2424 1387 1035 920 --21461 1220 --
NM_014872chr951898 1814 1465 682 420 1133 22181 214 11481
NM_014873chr184109 3771 3621 3337 1809 1598 283 275 14801 13038 184
NM_014877chr17157576 7044 6731 5869 5774 5387 5373 5234 2466 2389 1821 1475 1374 1124 774 --11520 24792 2750
NM_014893chrY62111 1939 1869 925 354 256 --189 --
NM_014897chr1753132 2821 2237 1217 209 --32944 814 201 --
NM_014899chr582990 2518 1947 1089 438 203 156 90 22838 2344 32892 2256 1064 --
NM_014902chr2051440 221 211 52 34 --11326 1231
NM_014903chr1262295 1625 874 692 349 75 --22409 2205 --
NM_014904chr10103346 3115 3033 2739 2676 1607 1100 928 678 191 24026 1575 1384 --
NM_014905chr271983 1807 1719 1611 558 526 27 --11556 --
NM_014912chr1073072 2902 2652 2597 1370 1295 879 ------
NM_014914chr251211 950 906 239 156 --2815 523 1467
NM_014920chr6143718 3494 3382 3253 2946 2508 2452 2428 1392 1355 885 774 722 106 ----23512 2482
NM_014924chr1472847 2791 2456 1105 968 880 497 12590 23165 241 --
NM_014932chr361676 1585 1319 433 174 21 11399 11904 --
NM_014934chr1363762 3424 2686 1556 1484 463 --2600 33 33742 3516 178
NM_014946chr262976 2954 2705 2366 2258 1895 1150 --11985
NM_014961chr452028 1514 1482 531 487 --1149 11416
NM_014962chr2042600 999 863 775 --12921 22461 2065
NM_014982chr1454311 1719 1459 336 313 14676 23545 433 15255
NM_014991chr493118 2492 2448 2351 2265 892 490 356 26 12339 1671 --
NM_015000chr1252981 2527 906 454 445 12360 12744 --
NM_015020chr16103449 3336 3253 3177 2522 2405 838 731 424 205 13875 ----
NM_015026chr12114811 4654 4093 3745 3697 3058 2954 1733 1411 729 465 13278 ----
NM_015035chr20146393 4437 4358 4132 4119 2681 2459 2189 2167 1742 1736 1499 1475 44 --15349 --
NM_015040chr283249 3145 3070 3016 2773 2579 959 801 --23229 1153 --
NM_015042chr15104226 4042 3952 2918 2649 2641 1271 662 327 298 21581 534 1953 --
NM_015049chr263221 3064 2465 2324 986 791 12195 --1902
NM_015051chr983346 2972 2944 2237 1177 893 822 270 32827 767 761 23132 1328 32914 1048 224
NM_015068chr7103666 3322 2971 2917 2763 758 517 486 296 64 1847 12845 --
NM_015071chr5145356 5249 4815 4801 4611 4289 4229 2567 2517 2244 1523 1516 737 216 25605 4025 ----
NM_015074chr1105006 4724 4502 4251 3977 3842 3399 3272 3010 1575 --43924 3193 1756 1155 14414
NM_015076chr6114497 3849 3750 3458 3073 1673 1560 1278 967 89 74 --33296 3230 1636 --
NM_015077chr1763979 2914 1792 866 676 448 14329 31016 643 76 13439
NM_015082chr562443 2316 2055 579 420 299 2730 379 22023 801 21979 853
NM_015090chr1135254 5053 4782 4546 3815 1916 1755 1581 545 159 145 88 66 11463 34588 1774 889 14659
NM_015092chr16134572 3925 3828 3597 3176 2864 1593 1466 1064 635 513 435 80 --23807 3754 --
NM_015093chr651838 1666 1411 446 31 --41762 1144 552 53 --
NM_015094chr22133863 3203 3082 3041 1835 1741 1706 1658 1439 1414 1264 641 495 13984 2924 196 --
NM_015097chr382194 879 719 679 617 587 52 22 ------
NM_015115chr482992 2240 2078 1083 810 668 618 378 ------
NM_015144chr1693552 3456 2602 2466 1574 1474 828 720 34 --12964 11501
NM_015147chr2123233 2796 2657 2576 2192 2035 1319 1060 905 629 321 204 ------
NM_015149chr152191 1896 1735 1384 447 --12200 1855
NM_015155chr1053287 2511 2452 2378 662 12800 13057 12146
NM_015191chr1172538 2417 2290 1977 1087 630 455 1138 12723 1476
NM_015192chr2082620 2377 1990 1885 1120 664 635 325 1871 ----
NM_015199chr352520 1917 879 634 519 --1723 --
NM_015200chr472607 2221 2071 1873 899 424 136 ----12419
NM_015206chr1583906 3104 959 779 456 394 292 107 13897 23488 1404 --
NM_015208chr1883883 2838 2485 1152 1139 1070 385 208 --13937 --
NM_015215chr163116 2210 1213 723 325 275 12477 33015 2889 2391 --
NM_015230chr461631 1609 1515 623 517 371 1604 1732 --
NM_015247chr1695285 4804 4789 4704 3793 2050 1097 952 391 1995 34484 1741 1117 --
NM_015251chr1652352 1666 871 576 59 ----22261 461
NM_015254chr863146 2254 778 396 383 78 22621 2017 --13210
NM_015271chr464327 3697 3621 1406 294 281 23594 74 1315 --
NM_015275chr1271611 710 624 402 290 76 35 ------
NM_015278chr6103228 2732 2480 2459 2431 2277 909 627 582 266 11182 13019 198
NM_015288chr553336 3243 3011 1351 747 2912 492 1815 21310 917
NM_015291chr173540 2178 1334 1293 742 124 79 13208 1904 --
NM_015299chr14113911 2856 2577 1470 1380 1244 1187 1168 1031 188 133 22705 1213 1598 11496
NM_015310chr8178352 7748 6243 6153 6035 6018 5935 5787 5566 5418 5264 3169 2814 2426 2068 1635 1578 36385 5545 2654 ----
NM_015313chr1153956 1937 1824 269 120 14233 11324 1335
NM_015317chr292732 2679 2648 2453 2096 1862 732 554 116 1914 ----
NM_015335chr1261642 793 664 469 237 105 11711 21063 991 12292
NM_015347chr1262610 1927 1101 225 154 76 --22376 1831 12623
NM_015349chr682960 2619 1182 1171 533 402 331 62 --43015 2200 808 617 --
NM_015352chr2073597 2863 1235 970 724 408 67 281 43 23537 3105 --
NM_015355chr1731997 696 533 ----1319
NM_015359chr892248 2129 1829 1061 1023 921 610 318 193 11012 ----
NM_015365chrX134333 4308 4154 4107 3431 3115 2826 1607 1555 795 767 755 697 --13706 --
NM_015436chr473353 3234 3030 2950 256 203 134 22092 1281 ----
NM_015455chr583946 3842 3610 3246 3195 3020 756 503 --32610 1473 155 22764 724
NM_015457chr1131155 1122 113 2293 249 --1309
NM_015458chr894359 4040 3985 3777 1888 1319 811 460 179 13591 13304 22088 871
NM_015493chr1962007 1894 1621 1564 309 41 127 32204 841 793 --
NM_015508chr341606 1339 1142 430 1556 11479 --
NM_015530chr22136 68 ----1706
NM_015532chr1542425 396 291 62 --12304 12679
NM_015535chr284001 3983 3861 1395 977 265 236 153 33465 379 89 ----
NM_015550chr7103403 3381 2942 2866 2625 2352 2215 1327 369 237 --12740 --
NM_015554chr1562563 995 740 722 617 48 11149 42489 2079 1052 144 --
NM_015555chr611721 ----21292 85
NM_015560chr392925 2121 867 645 621 496 460 442 23 --12254 --
NM_015564chr5123609 3165 3014 3006 2729 2560 2355 1138 702 169 113 23 12937 22491 795 --
NM_015568chr2083621 3335 3259 3005 1649 774 708 622 23274 1579 1744 14012
NM_015569chr184509 3948 3658 1785 693 384 119 78 21313 1287 11419 11642
NM_015571chr662619 2526 1729 994 717 38 11847 --12022
NM_015576chr392870 2848 2831 2085 1992 717 704 670 443 ------
NM_015602chr191441 1271 1137 1125 406 300 147 96 23 163 --11635
NM_015640chr163669 1160 1044 1006 985 804 --34814 3746 1821 1774
NM_015726chr131820 1340 163 11180 11634 21721 152
NM_015852chr793280 3064 2913 2338 1370 860 756 384 336 ------
NM_015878chr83836 743 120 1145 31567 416 154 --
NM_015879chr18248634 8074 7444 7282 7268 6871 6161 5851 5820 5787 5419 5235 3372 2912 2695 2158 1664 1378 1274 1175 963 652 192 51 1362 28422 6697 28335 2185
NM_015888chr193293 3183 2693 2686 2568 2287 1362 132 34 ------
NM_015891chr671973 1684 1553 1432 1382 601 444 1673 3778 608 21 --
NM_015901chr101840 --2240 198 2588 53
NM_015904chr24737 620 542 159 ----168
NM_015906chr194817 4133 4088 2957 1592 1534 1389 907 771 --13428 --
NM_015986chr1741493 352 241 181 --2971 320 --
NM_016009chr1144897 4701 4672 4521 4500 4174 3966 3804 1715 1183 1043 634 538 510 --13438 --
NM_016018chr832359 2261 1111 1556 1386 12565
NM_016021chr6103017 2753 2520 2296 2022 1984 1924 1101 1027 860 12778 23040 744 --
NM_016026chr1441493 385 347 293 --2922 503 --
NM_016045chr2031683 1367 498 11499 21346 512 --
NM_016073chr1561127 1044 861 748 87 35 ----1771
NM_016076chr172636 2307 2296 2157 1257 1096 165 21994 525 --1952
NM_016081chr482115 882 745 657 491 115 90 67 11592 ----
NM_016083chr633222 2903 2468 21584 805 33464 2596 1333 --
NM_016103chr54374 324 317 136 ------
NM_016131chr262193 721 596 210 126 66 --2842 457 --
NM_016156chr1151704 765 445 385 331 --32003 1712 1527 --
NM_016205chr411323 --11361 1490
NM_016206chr3108941 8828 7667 6029 3315 3212 3073 1956 642 339 1908 26904 3249 23120 1328
NM_016248chr1382851 2763 1435 1111 559 421 273 54 --1502 --
NM_016255chr632379 838 819 12240 12675 12499
NM_016260chr2157073 7050 6416 6273 6167 2978 2774 2412 1946 1232 974 964 624 463 297 --17026 --
NM_016271chr1871917 1869 1821 1611 762 417 59 ------
NM_016275chr362532 2312 2199 735 632 251 ----1113
NM_016281chr124455 318 310 74 1951 ----
NM_016287chr141328 556 499 240 --1145 11576
NM_016297chr273692 3209 3194 2546 2318 1368 389 33635 865 90 53528 3029 2493 2412 1508 --
NM_016315chr261584 1386 588 437 415 363 ------
NM_016322chr963111 2913 2240 1158 286 179 22378 170 12771 --
NM_016356chr642864 2531 2349 1116 ----1154
NM_016395chr1561545 770 696 650 502 72 1656 ----
NM_016396chr1592822 2352 2250 2237 1123 798 743 225 21 ------
NM_016433chr1251573 1353 1217 289 201 --1494 161
NM_016441chr251525 707 698 559 219 ----2611 69
NM_016442chr562131 1967 1761 886 682 495 ----11603
NM_016467chr221259 319 --31347 511 313 1412
NM_016513chr6143718 3494 3382 3253 2946 2508 2452 2428 1392 1355 885 774 722 106 ----23512 2482
NM_016526chr1182434 2401 1999 429 387 209 173 26 188 32057 727 465 12296
NM_016530chr15134140 4037 3892 3742 3377 3321 2964 2930 2613 1642 1366 1302 700 --12713 --
NM_016531chr4114007 3766 3478 3420 3296 2937 1301 1246 865 852 304 22831 492 ----
NM_016559chr361162 1025 243 95 65 58 11384 ----
NM_016587chr73752 739 105 1885 11039 1715
NM_016603chr551671 1387 646 506 500 --1906 --
NM_016613chr461842 669 564 363 197 64 --1599 1339
NM_016653chr261240 1201 817 348 217 205 --21119 163 11020
NM_016824chr1051923 1585 1402 1265 610 11542 11236 --
NM_016952chr1164119 2763 1418 968 758 106 23968 2832 23975 1226 198
NM_017415chr594369 4162 4000 1736 1614 887 533 422 326 12948 32868 1494 812 --
NM_017423chr441759 1740 1516 63 2838 392 --11959
NM_017522chr121324 344 ----1521
NM_017540chr5103158 3104 2883 2857 2794 2763 2511 2281 2064 1140 --11070 1838
NM_017548chr381786 1598 662 431 277 263 217 108 136 --11815
NM_017551chr1092692 2025 1881 1815 1703 1693 919 83 45 22004 348 12382 --
NM_017594chr993312 2839 2811 2271 1233 942 405 219 172 1964 12323 --
NM_017628chr4115275 5229 5095 4379 4260 3979 3704 3455 2075 1831 1696 ------
NM_017633chr693878 3493 3485 3269 1237 613 441 274 32 --23015 2467 12422
NM_017634chr851912 1863 1648 1388 283 ----1232
NM_017637chr9228857 8284 7311 7180 6680 6218 6073 5826 5732 3652 3478 3247 2970 2951 2356 2329 1791 1615 1434 1076 879 336 33563 3328 2561 49094 8810 7462 5882 11521
NM_017644chr395000 4276 4266 3797 1797 1625 865 159 27 14178 44114 3490 3175 457 --
NM_017650chr7124458 2352 2332 1951 1262 1126 978 911 533 316 203 91 15493 21232 451 2762 227
NM_017651chr661573 1218 293 211 179 57 --1613 1155
NM_017655chr1--11211 1381 11249
NM_017658chr14104581 3664 3111 2944 1805 1795 1662 1392 1090 192 12834 14377 23810 657
NM_017672chr153405 389 168 1490 --1898
NM_017694chr251921 756 76 50 37 1502 1311 11639
NM_017706chr561291 1207 1196 1176 1153 982 --11309 11215
NM_017709chr184249 3675 3544 3320 1526 1268 595 589 13024 --13686
NM_017719chr382187 2158 1689 1561 554 472 434 257 ------
NM_017736chr1643194 889 805 576 11272 1786 22409 325
NM_017738chr931187 966 167 --1240 1377
NM_017745chrX3728 687 516 ----1600
NM_017752chrX62094 2005 1680 1312 667 218 --1739 --
NM_017754chr695073 5042 4693 4134 4126 1893 1748 752 587 24968 621 23324 1810 --
NM_017761chr191452 1051 987 596 303 255 223 168 115 11121 21332 410 --
NM_017762chr1562399 2258 951 799 767 556 ----11664
NM_017769chr1442884 2457 2312 693 --22964 97 1465
NM_017770chr6112957 2678 2657 2606 2468 2434 2332 2234 308 119 96 --12388 2900 555
NM_017811chr962538 2352 2095 910 863 647 --12976 1690
NM_017813chr845274 4588 1305 477 35287 5097 1228 45135 4158 1921 170 14319
NM_017824chr1062712 2138 1042 386 234 154 11973 11028 --
NM_017847chr1102274 2017 1608 1502 1479 1392 511 333 249 154 1105 22174 441 --
NM_017848chrX123940 3611 3272 3226 3206 2897 2830 1585 1175 795 717 643 2681 562 22889 28 11253
NM_017849chr272976 2858 2560 2135 1134 656 263 2695 182 1769 12146
NM_017919chr9105292 4686 4630 4451 4062 3732 3689 2228 1301 950 34278 3826 1659 54829 4735 4603 674 453 --
NM_017987chr1042015 1866 1707 216 175 2881 565 --
NM_018010chr351551 1187 599 287 51 11479 --11451
NM_018017chr1082112 2063 1041 878 841 568 99 35 --31080 998 859 --
NM_018027chr10103021 3002 2877 1181 1117 683 396 110 85 52 22835 332 ----
NM_018046chr591343 1279 777 714 288 189 170 156 80 ------
NM_018048chr1242072 1871 1310 219 1389 --12017
NM_018084chr2123338 3317 3140 3104 2647 2444 2403 2363 2320 1169 581 307 ------
NM_018085chr1178013 7973 7642 7560 7505 7088 5215 3247 2826 2791 2189 2082 1819 1728 1464 1156 48 15798 57823 7659 1675 1643 156 27981 671
NM_018086chr221273 1261 ----1480
NM_018100chr673109 2911 1266 1169 864 426 147 22682 643 --12139
NM_018121chr1093080 2843 2382 2196 1938 992 536 423 30 11115 1320 --
NM_018155chr3102916 2870 2788 2688 2642 2373 1140 676 320 38 12280 173 --
NM_018167chr143965 804 171 ----1329
NM_018176chr471300 1246 1142 417 161 79 67 --186 11344
NM_018211chr162165 2101 695 384 254 223 --182 11553
NM_018225chr975054 4709 4462 4245 4010 1193 1008 13842 21377 23 13542
NM_018227chr473234 3095 3023 2208 1267 828 572 1317 32039 602 79 12842
NM_018243chr4103926 3486 3121 2988 2708 2654 2513 1166 686 482 ----12954
NM_018254chr172448 1777 869 645 485 453 116 ----12350
NM_018257chr2072393 2239 2163 2121 1842 747 389 ----11969
NM_018263chr292617 2360 2309 2008 2001 952 245 136 53 32522 2498 1903 ----
NM_018287chr1041337 985 288 268 ------
NM_018293chr3122935 2648 2590 2131 1059 1017 1005 763 655 400 305 228 1455 2994 317 --
NM_018299chr843007 2992 2385 2261 23131 2573 ----
NM_018313chr372616 2456 2239 2028 659 527 313 21790 1018 1244 11967
NM_018315chr431280 279 188 11479 1285 --
NM_018330chr1031184 92 49 1156 1100 1224
NM_018351chr1264598 2973 1254 1209 281 109 1115 21356 966 1274
NM_018362chr1183875 3660 3376 2475 2469 1512 566 556 --1897 --
NM_018364chr153705 2520 1548 910 275 ----11261
NM_018371chr871403 1338 1087 1068 1017 526 170 1511 ----
NM_018374chr7104894 4850 4611 4296 3555 1940 1891 1718 1645 596 --21669 1400 14691
NM_018383chr231876 1734 1280 11985 1413 11865
NM_018403chr374135 3657 3547 3212 1335 896 875 23114 498 13352 --
NM_018424chr92562 160 ----1332
NM_018425chr1062514 2485 2276 2101 549 170 11784 11950 178
NM_018429chr572484 2341 2234 2221 2079 557 157 --1983 --
NM_018440chr8188487 7901 7058 7040 6951 6745 6665 6540 6485 6276 5711 5426 5255 2529 2015 900 542 311 --11887 --
NM_018448chr125800 411 388 258 216 --11024 1925
NM_018452chr6_random62651 2513 1259 1210 1103 122 2805 458 23382 625 --
NM_018490chr1151723 1599 1483 1293 686 --2151 42 11810
NM_018566chr174850 4617 4396 3960 1216 129 110 --33432 408 301 --
NM_018638chr12125195 4623 4310 3951 3786 3667 2133 2024 1789 1776 1727 73 --14650 11673
NM_018650chr121887 690 ----1512
NM_018698chrX71814 1725 1637 1568 785 186 100 21748 599 21541 456 --
NM_018704chr162099 1528 1425 734 495 108 1309 42088 1604 1365 1351 1209
NM_018718chr752306 2018 1596 1562 104 22050 676 32040 1572 587 1209
NM_018890chr751182 1132 1120 167 155 ------
NM_018898chr5102209 2134 1643 1600 726 699 613 461 32 23 1558 ----
NM_018899chr5102209 2134 1643 1600 726 699 613 461 32 23 1558 ----
NM_018900chr5102209 2134 1643 1600 726 699 613 461 32 23 1558 ----
NM_018901chr5102209 2134 1643 1600 726 699 613 461 32 23 1558 ----
NM_018902chr5102209 2134 1643 1600 726 699 613 461 32 23 1558 ----
NM_018903chr5102209 2134 1643 1600 726 699 613 461 32 23 1558 ----
NM_018904chr5102209 2134 1643 1600 726 699 613 461 32 23 1558 ----
NM_018905chr5102209 2134 1643 1600 726 699 613 461 32 23 1558 ----
NM_018906chr5102209 2134 1643 1600 726 699 613 461 32 23 1558 ----
NM_018907chr5102209 2134 1643 1600 726 699 613 461 32 23 1558 ----
NM_018908chr5102209 2134 1643 1600 726 699 613 461 32 23 1558 ----
NM_018909chr5102209 2134 1643 1600 726 699 613 461 32 23 1558 ----
NM_018910chr5102209 2134 1643 1600 726 699 613 461 32 23 1558 ----
NM_018911chr5102209 2134 1643 1600 726 699 613 461 32 23 1558 ----
NM_018945chr682855 2541 2329 1210 1140 1078 678 180 13500 33464 3375 1245 --
NM_018947chr784492 3456 3266 990 865 692 396 146 24574 1039 34262 4213 3403 13960
NM_018951chr731091 485 227 ----21215 1001
NM_018963chr2151334 1257 513 420 127 --2564 454 11414
NM_018970chr7122626 2440 2247 2105 1983 1092 882 537 400 227 102 36 --22427 888 1262
NM_018976chr1292246 2137 2049 1914 1758 612 363 294 218 ----1749
NM_018979chr1292644 2631 2365 2143 1684 429 415 332 243 ------
NM_018999chr1094361 3836 3556 3526 1756 983 712 638 355 2576 503 31379 301 277 --
NM_019001chr394248 3861 3731 3632 3179 1370 1257 723 248 1643 ----
NM_019041chr652424 2149 640 501 178 1488 12506 1938
NM_019050chr452258 1891 1593 457 426 1549 21410 330 12035
NM_019063chr22848 832 1366 11502 1446
NM_019072chr5104317 3949 3553 3332 3205 3146 2713 862 539 95 33714 3033 1230 1892 13109
NM_019094chr1273514 2722 2328 1182 1123 200 194 --12955 --
NM_019106chr2252896 2762 2388 920 912 --12952 --
NM_019596chr21102909 2831 2456 2423 2075 923 180 144 136 72 1204 1508 11169
NM_019610chr172032 1774 1715 689 633 290 62 22056 2001 --1499
NM_019862chr1681696 1452 619 534 217 116 102 82 21559 330 ----
NM_019898chr1681696 1452 619 534 217 116 102 82 21559 330 ----
NM_019899chr1681696 1452 619 534 217 116 102 82 21559 330 ----
NM_019900chr1681696 1452 619 534 217 116 102 82 21559 330 ----
NM_019903chr1051923 1585 1402 1265 610 11542 11236 --
NM_020116chr441718 297 285 223 --11652 11320
NM_020119chr773674 3644 3104 2476 1476 1186 213 11328 23342 2663 13313
NM_020122chr265540 5166 4779 4514 4156 2394 35369 3888 1350 35472 1762 567 --
NM_020132chr21145197 5141 5102 4316 4249 3592 3319 1744 1725 1540 1432 347 95 60 --34995 4810 1465 21736 1038
NM_020133chr6156489 6309 6152 5752 5699 5073 4851 4629 2051 1470 1219 1175 981 681 135 15592 44496 4188 4118 1462 34861 4446 1009
NM_020141chr13874 376 99 12126 42007 1978 226 200 1679
NM_020148chr1862444 2149 1887 981 954 356 --1268 12747
NM_020177chr583350 3255 3182 3008 2862 2601 2574 1021 --12418 11078
NM_020198chr1761489 1037 1006 426 389 304 1367 ----
NM_020228chr1172179 2001 1783 841 610 399 118 12022 ----
NM_020245chr674750 4090 3526 3422 1697 1287 1077 1102 13913 14757
NM_020337chr463064 1935 1029 838 709 543 --22677 2498 --
NM_020338chr10113535 3470 2786 2711 2525 992 910 743 621 287 269 11100 1520 23151 1146
NM_020341chr2051876 1808 1693 1427 580 --2151 105 21859 267
NM_020342chr292364 2237 1866 971 910 633 353 343 238 32407 865 515 ----
NM_020357chr311525 --1536 1259
NM_020390chr3124055 3696 3587 3417 1875 1783 1647 1466 958 493 340 298 --1328 --
NM_020429chr7123051 3003 2793 2336 1979 1908 934 905 824 801 248 45 12094 21920 808 --
NM_020432chr751896 1450 647 442 321 --11465 --
NM_020443chr1136902 6426 5503 4484 4304 2512 2299 1889 1740 1559 723 631 546 34935 1402 1228 26684 4863 11239
NM_020455chr662726 2483 2085 724 201 155 22243 404 ----
NM_020473chrX51496 737 616 466 228 1593 --12035
NM_020474chr1861713 511 425 298 264 174 1467 11323 --
NM_020475chr882468 2445 1527 987 835 738 465 203 --2442 430 --
NM_020476chr882468 2445 1527 987 835 738 465 203 --2442 430 --
NM_020477chr882468 2445 1527 987 835 738 465 203 --2442 430 --
NM_020480chr882468 2445 1527 987 835 738 465 203 --2442 430 --
NM_020673chr20167743 7545 6266 5764 5498 5333 4843 2885 1871 1853 1729 1537 1279 1142 140 95 --26927 5792 17590
NM_020698chr1242192 1124 948 262 1238 22530 115 13138
NM_020699chr1135269 5263 4513 4335 4295 3990 1937 1486 1262 1248 1205 905 806 1587 54685 4556 1791 1283 822 --
NM_020711chr282596 2490 2181 2166 2151 2099 2022 186 11882 11628 --
NM_020717chrX164915 4818 4763 4350 3910 3658 3628 3200 1385 1320 1185 585 286 234 187 165 34428 3487 1351 11947 --
NM_020718chr1645086 1735 1065 203 34942 791 356 43988 2465 2260 798 --
NM_020727chr2163666 2456 1494 1412 1168 627 11623 32814 812 597 --
NM_020734chr1293406 3185 3086 2989 2588 2268 1001 488 67 ------
NM_020739chr1573862 3845 3352 2921 1677 1027 498 --43533 2762 1194 209 --
NM_020752chr1042842 820 714 152 --42551 2355 330 321 --
NM_020766chrX43128 1547 677 31 24146 3083 34289 4167 4046 --
NM_020772chr17168095 7849 7441 7327 6383 6153 6133 5705 5342 5271 3050 2555 1133 1083 1060 105 16139 ----
NM_020774chr1886256 5969 5842 5192 1752 1203 883 809 33836 1952 659 --14264
NM_020776chr18103086 2925 2712 2628 2094 1022 985 667 286 148 1178 1182 --
NM_020782chr1294038 3917 3297 3017 1775 1631 1340 185 77 --13395 --
NM_020783chr1882411 2047 1949 1592 724 420 256 91 21870 839 --1148
NM_020796chr582255 2084 1050 1005 794 480 98 31 ------
NM_020801chr541981 827 636 143 --21686 1016 --
NM_020809chr1181920 1719 918 865 627 578 402 343 --1519 --
NM_020810chr1462688 1264 1108 882 424 307 ----12755
NM_020828chr1941362 1112 1052 964 ----1553
NM_020830chr272914 2091 1106 1000 628 312 117 --12827 1484
NM_020841chr12113543 3309 3223 1579 1151 981 962 508 89 56 22 131 13334 --
NM_020844chr895745 2893 2877 2334 2211 1175 1140 476 38 26801 5998 16431 --
NM_020858chr1582433 2159 1995 1739 1694 1617 1582 109 ----11820
NM_020859chr4123867 3776 3696 3161 3058 2656 2619 2499 1387 1324 1169 79 13554 12877 13044
NM_020872chr361143 587 567 407 256 202 --21285 1255 --
NM_020899chr1762548 2118 1956 1831 954 374 2964 477 1659 1857
NM_020918chr1083672 3502 3420 3370 2895 2802 1135 790 --22557 2333 --
NM_020921chr14103511 3386 3304 3264 2783 971 835 789 744 407 ------
NM_020935chr2124289 4192 3765 3645 1786 1690 1508 1428 1326 1301 1189 130 --1547 --
NM_020940chr10112831 2791 2125 2039 1940 1928 1884 1801 514 428 132 ------
NM_020948chr123299 1449 11097 1571 13241
NM_020973chr42469 224 ----1255
NM_020975chr1022070 605 --12053 12011
NM_020987chr1061383 1216 373 275 216 169 --11339 --
NM_021003chr143538 337 221 --1584 1242
NM_021032chr351410 582 576 548 177 --11475 1259
NM_021033chr1332883 1038 890 --22842 863 1348
NM_021061chr8113852 3182 2844 2781 1815 1781 1753 1076 768 318 50 11760 14229 --
NM_021069chr472171 2004 1827 1719 766 274 139 1403 11380 --
NM_021072chr562617 2322 2303 2035 398 248 --11044 --
NM_021079chr17113077 2902 2457 978 932 813 557 138 125 47 31 12979 22231 276 --
NM_021083chrX53504 2585 2387 2342 2306 11014 22691 175 --
NM_021090chr22145063 4795 4534 4428 3111 1281 1062 1012 974 924 552 373 273 109 14113 1414 --
NM_021097chr2103099 2828 2441 2387 2235 2150 632 450 413 158 ------
NM_021101chr372489 2209 1917 945 709 39 24 ----1732
NM_021116chr7128345 8277 7532 7395 6982 5952 5802 5720 5709 3108 1014 80 58064 2984 687 508 91 56321 6234 6226 1419 95 16551
NM_021148chr732196 2163 1534 ----1628
NM_021156chr2051012 717 351 307 190 1282 --1894
NM_021159chr451183 1079 1069 694 331 ----1356
NM_021163chr7123565 3324 3063 3038 2893 2781 2691 2488 2462 1475 812 363 13256 1383 --
NM_021167chr792728 2348 2027 1874 1017 760 455 253 120 --32467 707 402 --
NM_021183chrX72360 2189 1900 963 555 330 247 ------
NM_021191chr1261923 955 891 803 755 742 22311 908 ----
NM_021229chr1231059 824 788 ----1795
NM_021238chr1231742 1653 58 --2534 401 11486
NM_021255chr14154117 4089 3582 3561 3511 3445 3092 3035 2622 1356 1077 966 913 335 228 1470 ----
NM_021572chr651024 917 895 834 107 --185 --
NM_021629chr394998 4989 3885 1798 1198 401 206 143 46 15125 33735 3270 1589 --
NM_021638chr4104342 4267 4256 4097 3524 3292 3100 1765 1725 1064 1298 11373 11254
NM_021647chr4114721 4233 4215 4196 4044 3229 2937 1518 1353 1246 1024 --23669 38 13795
NM_021809chr2082458 1914 1862 1796 806 662 230 36 --1393 1941
NM_021813chr6125305 4921 4504 3819 3813 3545 2047 1820 1378 1257 588 95 14976 14135 --
NM_021814chr6101625 1389 1347 1227 1074 534 519 512 93 28 ----1575
NM_021815chr272730 2401 1962 1884 1208 466 155 --22934 1108 12380
NM_021911chr5115570 5025 4472 3836 3641 3618 3565 1809 1513 1448 576 1354 43530 1427 1035 48 24781 759
NM_021912chr1553614 2846 1691 1175 938 13274 13653 1444
NM_021949chrX72882 2423 2289 2148 2086 1795 664 31108 763 176 1890 130
NM_021954chr1372834 2814 2626 2523 2332 60 54 --12951 --
NM_021961chr11115982 5067 2266 2190 2166 2152 1185 954 607 595 488 --46521 5772 3003 1945 11891
NM_021964chr3136443 6373 6046 6017 5841 5309 4460 2401 1312 1219 1140 510 502 ------
NM_021999chr135779 737 683 279 153 1651 --1828
NM_022041chr1682153 2053 1972 1884 812 578 410 193 22017 1771 ----
NM_022048chr15145595 5453 5225 4917 4402 4269 1422 1117 1097 1052 938 864 164 116 55758 4890 3859 1200 1107 45786 5773 4216 2486 --
NM_022049chr191792 1704 1534 1311 752 640 417 310 167 --21669 1282 --
NM_022103chr1971071 960 925 892 324 124 24 --1935 --
NM_022114chr1114600 4312 4271 3839 3794 3737 1541 739 681 514 288 --13028 --
NM_022133chr871819 1734 1654 581 344 315 79 --1449 --
NM_022166chr16106047 4543 4475 4262 2382 1425 1095 878 727 543 31501 1106 53 35501 4419 4178 --
NM_022340chr3102995 2984 2645 2578 2305 2255 909 854 212 49 ----1198
NM_022351chr893795 3647 3590 2932 2906 2371 1298 1162 985 13661 23067 418 --
NM_022444chr771743 1639 478 472 433 385 247 --1102 --
NM_022456chr12247470 7383 6799 6765 5917 5910 5812 5450 2827 2708 2565 2551 2484 2438 2394 2357 2346 2012 1894 1631 1625 1475 794 357 26698 5820 22805 1773 15055
NM_022459chr13125805 5777 5462 5025 4749 2314 2054 2034 1487 1284 1223 945 ------
NM_022465chr1242601 2418 2400 945 22761 1914 32965 2356 1067 --
NM_022473chr1593961 3283 3274 3220 3170 1661 648 225 121 --11360 24347 4083
NM_022491chr12113541 3120 2843 2670 2508 2272 2167 1409 1377 1247 893 --33293 2721 2238 --
NM_022497chr383835 3642 3629 3492 3225 1285 637 42 13050 23688 1045 --
NM_022648chr2104250 3273 2991 2917 1819 1749 1096 468 419 273 ----11528
NM_022716chr1112744 2565 2501 1940 1218 1143 494 360 342 44 37 --12889 13057
NM_022735chr141587 1290 627 230 ----1614
NM_022745chr182750 2733 2656 2336 2207 698 632 464 1495 ----
NM_022753chr152407 2238 1794 426 377 12260 1292 1304
NM_022763chr343052 1971 649 566 2858 659 1173 --
NM_022766chr2241904 1018 66 43 11066 --22427 972
NM_022776chr351349 523 446 250 164 --2504 115 11647
NM_022781chr993191 3125 2534 2105 2070 2056 2034 1056 915 ------
NM_022784chr1541040 331 50 29 1262 2733 222 --
NM_022831chr151765 1733 1397 478 54 1650 21240 116 --
NM_022845chr1642082 632 277 210 ----183
NM_022893chr273119 2769 2736 2491 824 746 478 ------
NM_022898chr14134807 4156 4077 4041 3766 3737 3657 3380 1723 1714 1065 876 485 --34353 3059 1011 13024
NM_023016chr242265 2086 1027 430 --32723 1997 1757 181
NM_023929chr852171 2031 945 558 404 --11963 --
NM_024007chr592584 2291 2115 2019 1146 927 519 326 146 --12086 --
NM_024090chr451493 1416 668 523 23 ----31605 1344 291
NM_024345chr9125655 5557 5274 4641 4579 4373 3802 3767 1517 1421 1020 1007 --11623 --
NM_024423chr1864178 3909 3663 2901 2838 1613 24086 38 32717 2623 1499 --
NM_024512chr363084 2683 2567 1100 306 114 2704 625 33296 2844 2445 --
NM_024525chr17644 591 526 476 173 161 139 --1626 --
NM_024558chr143923 263 46 1988 2736 412 1667
NM_024569chr172904 2861 2169 2156 2051 273 117 12473 ----
NM_024582chr43415 232 53 1854 --1902
NM_024594chr531775 199 91 --11213 156
NM_024607chr8104343 3815 2959 1625 1086 1030 445 372 189 170 --23421 1664 --
NM_024613chr861810 1723 1188 339 47 26 --21629 1407 --
NM_024665chr364105 3853 3471 525 365 95 24706 3078 14452 --
NM_024674chr182976 2511 2068 1275 1124 815 400 227 ----21249 383
NM_024713chr15121167 636 610 604 568 501 388 379 147 134 114 108 --1650 --
NM_024740chr1184034 3857 3535 3366 1238 778 406 322 11353 24060 1447 --
NM_024744chr242652 2433 2408 726 22375 710 2633 107 --
NM_024761chr985281 5269 4439 4396 3975 3917 235 215 24207 3554 15324 --
NM_024769chr111271 194 --3970 801 232
NM_024770chr2146150 5576 4694 4183 4084 2560 2521 2453 2258 2050 1630 1357 1175 779 1991 45790 1994 726 373 131
NM_024785chr241386 1140 356 163 1156 21287 472 11280
NM_024812chr852132 2078 1575 1531 522 12068 11625 --
NM_024834chr1061749 1357 1316 705 585 127 --1109 --
NM_024854chr1261408 1366 1025 508 345 54 11490 1170 --
NM_024884chr1483123 3104 3087 2959 2888 1333 375 176 12830 ----
NM_024920chr441554 1273 178 104 ------
NM_024930chr572363 2169 2133 974 559 424 99 32345 1039 201 ----
NM_024939chr16101567 1245 1140 615 608 529 494 253 233 27 --172 --
NM_024947chr3108888 8747 8422 7760 6861 6811 6559 6331 1354 1182 28458 3800 1477 38670 6253 787
NM_024949chr4125035 4692 4519 4488 4089 3735 3694 1328 1038 620 608 211 --44279 4204 3983 1685 23160 1758
NM_024953chr1262486 2394 1962 1729 740 442 ----1190
NM_024989chr287093 6289 5853 5642 5470 5030 3291 1987 13059 --16709
NM_025054chr833442 2716 1493 ----13574
NM_025073chr1124262 4242 4219 3901 3758 3333 3193 3073 1690 880 761 267 1464 23394 328 --
NM_025074chr462101 765 622 173 99 35 --12016 11029
NM_025151chr851980 1711 1384 788 87 1291 31929 808 158 11683
NM_025160chr194267 4181 3828 3774 3620 1377 1063 178 125 13144 53036 2743 2649 740 570 --
NM_025179chr1124301 3613 3472 3285 3023 1653 1506 1461 1267 1158 728 177 1686 41833 1809 1545 1011 1968
NM_025191chr173451 3098 1377 867 689 680 627 1298 1640 --
NM_025208chr1162071 1596 687 651 499 315 11862 ----
NM_025248chr1752854 1188 416 250 243 12568 1950 1511
NM_030621chr1474069 4059 3819 3747 3501 2578 257 --11258 1859
NM_030625chr1072473 2190 1755 925 711 565 369 ------
NM_030647chr775576 5384 5031 2416 1322 601 511 --44465 4014 1918 40 --
NM_030648chr4135368 4231 4021 4011 3781 3630 3447 2060 1794 1151 1081 151 81 34763 4477 4414 25276 853 14484
NM_030650chr244143 3758 3114 1286 21504 1044 14091 13159
NM_030674chr1285513 4767 4608 3936 3856 3846 2060 2005 1557 23718 3689 --
NM_030762chr1221890 1225 --11654 11692
NM_030786chr151633 1495 722 603 378 2588 92 11307 --
NM_030791chr1451875 1647 1314 383 362 --176 1514
NM_030806chr1188952 8515 8310 8275 8187 7829 7316 7085 6955 6739 6721 5890 2257 2100 1438 1163 1008 973 --48927 6156 5873 24 18227
NM_030816chr1113635 3467 3212 3100 2239 1446 1354 1147 1105 581 493 1549 ----
NM_030885chr362045 1943 1746 1715 787 767 22120 410 140 --
NM_030918chr174241 3465 948 580 407 276 29 22161 667 35216 4769 531 1181
NM_030962chr1131144 645 401 ----11303
NM_031268chr16125233 4708 4100 3984 3885 3854 3514 3465 2130 1042 360 84 --2887 189 --
NM_031271chr841557 1195 364 120 ----21385 274
NM_031296chr472630 2514 2459 1789 1747 738 290 --12774 --
NM_031305chr451663 1602 309 247 75 ----1495
NM_031411chr5102209 2134 1643 1600 726 699 613 461 32 23 1558 ----
NM_031418chr1182645 2168 772 757 718 626 250 103 12183 2364 231 --
NM_031422chr181176 --156 1563
NM_031426chr992665 2649 2307 1996 865 809 361 327 259 ----22814 268
NM_031427chr14165820 5755 5292 5031 5011 4985 4866 4727 3940 3824 2061 1952 1659 1356 506 221 25462 5117 21606 300 --
NM_031438chr541564 762 595 279 11353 11834 --
NM_031442chrX63160 2208 825 755 588 161 --1302 --
NM_031468chr7117927 7292 6507 5690 3043 2170 1893 1782 1505 1400 552 26940 2018 37577 7515 6046 26595 6579
NM_031469chr6113845 3753 3556 3318 3253 2953 2750 2498 495 183 95 43170 1616 1584 437 1189 12563
NM_031844chr1123883 3579 3428 2742 2724 2603 2572 1576 1426 868 601 527 1415 11439 13200
NM_031845chr2103496 3248 3229 3128 2905 2395 1269 1206 429 96 12828 11449 --
NM_031847chr2103496 3248 3229 3128 2905 2395 1269 1206 429 96 12828 11449 --
NM_031849chr5102209 2134 1643 1600 726 699 613 461 32 23 1558 ----
NM_031857chr5102209 2134 1643 1600 726 699 613 461 32 23 1558 ----
NM_031858chr173292 248 168 --21402 1383 1177
NM_031860chr5102209 2134 1643 1600 726 699 613 461 32 23 1558 ----
NM_031862chr173292 248 168 --21402 1383 1177
NM_032041chr882688 2097 1804 1794 1696 1672 1102 764 12158 22715 2525 1695
NM_032042chr5102754 2444 2329 2319 2199 2168 2125 2097 2022 756 1631 ----
NM_032116chr13105479 5159 5054 4418 4075 3834 2346 1901 1755 1437 1955 24256 252 11268
NM_032182chr1041483 1225 1108 356 ----1518
NM_032208chr2133339 3008 2990 2747 2483 1417 1023 884 861 807 739 317 226 --33587 695 306 --
NM_032221chr2041861 1602 1586 439 21648 1608 --11661
NM_032228chr1193494 3234 2691 1383 613 500 300 226 102 ----23294 630
NM_032229chr1361184 436 386 233 172 118 196 1984 --
NM_032291chr161863 1804 1407 575 173 92 1470 ----
NM_032352chr141321 --11108 1446
NM_032373chr10105716 5613 5161 4026 2002 1515 1051 424 204 181 1102 23974 258 --
NM_032434chr251398 414 400 390 292 ------
NM_032435chr181910 1879 1804 1540 767 574 474 256 ------
NM_032440chr1072658 2096 1929 515 503 443 399 21173 953 1885 --
NM_032446chr5103736 3416 3406 3199 3155 2876 2517 2401 1067 934 1131 11430 --
NM_032457chr473066 2837 2615 2419 904 802 193 --22960 1035 13387
NM_032458chrX93323 3249 3050 2451 1048 909 411 241 175 23144 2326 ----
NM_032509chr872619 2011 1871 1844 1737 1680 664 --22163 1818 --
NM_032521chr2093195 2838 2714 2634 2352 2089 1187 1070 86 1262 ----
NM_032646chr1761799 1743 1710 1466 1093 85 21684 1344 --21108 542
NM_032689chr1971622 1559 1511 1084 388 322 165 ------
NM_032727chr1051162 425 344 292 164 ----11298
NM_032818chr982171 1891 1659 771 379 348 341 172 12059 21930 261 --
NM_032825chr194708 324 277 193 ----1911
NM_032826chr7125081 4765 4208 3956 3898 3854 2047 1986 1929 827 503 109 14961 21306 25 --
NM_032833chr142621 2525 2519 204 --32037 955 180 --
NM_032859chr1343818 2748 850 171 22674 1484 ----
NM_032873chr11104410 4104 3366 3267 1807 1527 1278 983 891 843 12907 1378 --
NM_032932chr1786452 5019 4994 4474 4005 1526 1084 930 12227 24568 4242 26052 3965
NM_032968chrX113673 3624 3350 3298 2838 1509 1282 1121 1058 945 349 ------
NM_032969chrX113673 3624 3350 3298 2838 1509 1282 1121 1058 945 349 ------
NM_032973chrY103665 3616 3345 3293 1509 1282 1121 1058 945 349 ------
NM_032975chr18123601 3338 2545 2495 2288 2281 2241 936 773 697 631 152 --1869 23359 2589
NM_032980chr18123601 3338 2545 2495 2288 2281 2241 936 773 697 631 152 --1869 23359 2589
NM_033020chr194817 4133 4088 2957 1592 1534 1389 907 771 --13428 --
NM_033133chr1761523 1239 759 740 636 452 22844 284 1265 --
NM_033135chr1162071 1596 687 651 499 315 11862 ----
NM_033138chr761768 1753 1651 817 783 667 ----11833
NM_033139chr761768 1753 1651 817 783 667 ----11833
NM_033140chr761768 1753 1651 817 783 667 ----11833
NM_033143chr4113740 3705 3628 3537 3458 1855 1646 358 259 241 119 23111 201 ----
NM_033157chr761768 1753 1651 817 783 667 ----11833
NM_033181chr633222 2903 2468 21584 805 33464 2596 1333 --
NM_033224chr7227959 7789 7773 7631 7464 7328 6298 6103 4889 3237 2710 2524 2436 2384 2362 2279 1656 1042 988 630 612 370 21277 969 1473 --
NM_033225chr832369 248 188 --22466 2247 13200
NM_033285chr843941 3684 1430 423 13315 13947 1153
NM_033300chr121324 344 ----1521
NM_033360chr1293875 3220 3190 3157 2941 1293 1108 768 336 14102 ----
NM_033389chr17104645 4461 4423 4252 4022 3617 3334 1589 1517 233 1472 ----
NM_033425chr11123521 3514 3466 3130 2577 1370 1212 1045 913 483 272 204 32544 546 411 12744 179
NM_033426chr1462611 2270 2159 590 394 134 12498 1654 32465 1917 1154
NM_033429chr1593296 2706 2485 1268 938 896 456 321 142 --1493 1743
NM_033505chr285759 5675 5054 4540 1163 644 368 200 36309 5266 75 24584 238 26606 4595
NM_033512chr842169 1947 744 347 1488 1461 22184 1992
NM_033632chr431280 279 188 11479 1285 --
NM_033637chr1083884 3853 3720 3578 3261 1104 398 103 33030 760 751 12813 13455
NM_052832chr892917 2477 2361 2090 1916 1021 650 534 377 --1224 --
NM_052869chr1761799 1743 1710 1466 1093 85 21684 1344 --21108 542
NM_052885chr1264625 3926 969 890 495 318 13588 33743 3236 1030 --
NM_052917chr293348 2367 2300 2117 2111 1128 754 585 218 12527 --11215
NM_052927chr531820 432 169 11804 --22006 1640
NM_052938chr141188 988 177 31 1231 ----
NM_052966chr163281 2415 1105 1058 955 40 --13342 23073 129
NM_053016chr9217945 7683 7554 7418 7129 6727 6687 6558 6409 5290 5103 3126 2981 2926 2907 2894 2700 2389 1383 1366 294 --36665 4885 3068 --
NM_053023chr1172570 2380 2190 1131 1066 1014 1002 ------
NM_053064chr1452787 2670 1983 1157 112 22693 1884 ----
NM_057159chr931613 480 24 21481 298 21402 645 --
NM_057169chr1242887 896 715 342 12826 2528 403 2837 786
NM_057170chr1242887 896 715 342 12826 2528 403 2837 786
NM_057178chr1772679 2653 1955 1761 904 638 219 31984 892 399 31889 571 119 --
NM_057749chr831262 1211 258 --1327 11155
NM_080546chr951935 1780 531 509 425 32260 2248 1466 1145 1156
NM_080645chr692209 1901 1784 638 625 440 393 313 134 21363 322 ----
NM_080666chr1421307 1176 --2199 105 21337 393
NM_080669chr17104654 4523 3810 3698 3057 1755 1640 765 399 149 31481 1353 343 34090 1175 607 --
NM_080676chr2042208 2052 1229 510 12405 13184 13041
NM_080717chr1261302 1084 542 279 178 165 ------
NM_080743chr672604 2398 1944 1918 1766 1608 786 --31868 1779 1012 --
NM_080836chr2084793 4249 3109 3001 1888 1868 785 252 13330 44531 3604 1618 37 --
NM_080867chr1494904 4349 4096 3455 3428 1289 766 578 208 ------
NM_080872chr8113400 3147 2697 1496 1465 1240 1169 803 615 142 117 --2916 623 --
NM_101395chr2183451 3062 3041 3024 2769 2250 757 410 1258 ----
NM_130391chr992972 2883 2808 2748 1427 699 303 290 274 22578 2307 13564 --
NM_130392chr992972 2883 2808 2748 1427 699 303 290 274 22578 2307 13564 --
NM_130393chr992972 2883 2808 2748 1427 699 303 290 274 22578 2307 13564 --
NM_130434chr1531094 1000 201 ----11082
NM_130436chr2162783 2394 2373 2356 2101 89 ------
NM_130437chr2183410 3021 3000 2983 2728 2209 716 369 1217 ----
NM_130438chr2183360 2971 2950 2933 2678 2159 666 319 1167 ----
NM_130439chr1052326 931 423 235 124 --22081 449 --
NM_130439chr1052326 931 423 235 124 --22081 449 --
NM_130809chr552991 2414 2225 1008 617 --13118 1751
NM_130830chr3143761 3726 3642 3277 3261 3031 3021 1129 1017 806 637 597 566 198 12625 33895 3703 842 --
NM_130831chr392925 2121 867 645 621 496 460 442 23 --12254 --
NM_130832chr392925 2121 867 645 621 496 460 442 23 --12254 --
NM_130833chr392925 2121 867 645 621 496 460 442 23 --12254 --
NM_130834chr392925 2121 867 645 621 496 460 442 23 --12254 --
NM_130835chr392925 2121 867 645 621 496 460 442 23 --12254 --
NM_130836chr392925 2121 867 645 621 496 460 442 23 --12254 --
NM_130837chr392925 2121 867 645 621 496 460 442 23 --12254 --
NM_133170chr20237860 7749 7235 6877 6539 6010 5966 5654 5644 5407 5338 5225 2209 1948 1789 1756 1534 1296 1241 520 338 298 231 27340 5698 47878 6606 6065 1693 --
NM_133264chr17103881 3863 3685 2487 1523 1313 699 687 638 432 ------
NM_133334chr4145336 5084 4155 2555 2101 2071 1638 1537 1499 930 658 609 407 162 12515 14759 --
NM_133372chr572639 2617 1151 728 653 257 47 ------
NM_133445chr963518 3372 3091 2643 1077 571 23225 264 ----
NM_133476chr1231190 1085 429 --21133 1125 --
NM_133478chr2112396 2175 1981 1892 1607 1028 848 723 616 487 191 --22005 810 --
NM_133496chr1103727 3670 3575 3514 3449 2785 715 577 428 365 24538 4297 34135 3984 452 --
NM_133631chr391477 1446 1431 1155 555 532 292 234 39 21629 102 1500 --
NM_133646chr2164900 4649 4570 4497 4268 2108 1646 1441 1404 877 606 356 221 199 99 26 --23869 527 15152
NM_138270chrX93375 2605 2383 2131 1380 1196 979 891 35 ----23311 3085
NM_138286chr19103966 3490 3059 2981 1499 1473 768 689 404 189 ----1659
NM_138333chr932573 2278 360 1736 --11869
NM_138348chr5146426 6171 6104 5198 5146 1772 1675 1584 1510 1237 1089 954 333 252 26295 1351 ----
NM_138444chr13104876 4679 4406 4014 3898 3722 3534 1707 606 293 24250 4128 14348 13571
NM_138459chr683614 3404 2778 2418 1377 1308 817 50 --12702 13623
NM_138468chr2136262 5170 5113 4409 4162 4113 2321 1853 1493 1438 561 251 153 45823 4213 1778 499 22268 503 --
NM_138473chr12135182 4858 3815 3557 3377 2076 2052 1491 1275 1080 486 349 130 11591 14035 --
NM_138494chr772796 1985 1757 547 373 357 77 --22732 2013 --
NM_138576chr14134807 4156 4077 4041 3766 3737 3657 3380 1723 1714 1065 876 485 --34353 3059 1011 13024
NM_138621chr2144212 3246 3185 2995 2782 2755 2560 1617 1593 1395 450 253 100 53 --13819 --
NM_138713chr16167274 7100 6825 6807 6785 6362 6234 6175 5838 5408 5274 5252 3317 2547 2061 1128 37723 5459 1668 16098 --
NM_138714chr16167274 7100 6825 6807 6785 6362 6234 6175 5838 5408 5274 5252 3317 2547 2061 1128 37723 5459 1668 16098 --
NM_138731chr1474175 3491 1542 1105 810 147 47 --23817 3005 --
NM_138782chr522104 1607 1513 12167 2786 518
NM_138959chr1166483 6461 6362 5995 5110 5058 2064 1813 1624 1500 1135 1038 924 271 239 130 36239 5753 4528 25385 411 14423
NM_138971chr1153634 3523 3333 890 420 --13053 23573 553
NM_138971chr1153634 3523 3333 890 420 --13053 23573 553
NM_138972chr1153634 3523 3333 890 420 --13053 23573 553
NM_138972chr1153634 3523 3333 890 420 --13053 23573 553
NM_138973chr1153634 3523 3333 890 420 --13053 23573 553
NM_138973chr1153634 3523 3333 890 420 --13053 23573 553
NM_139182chr461631 1609 1515 623 517 371 1604 1732 --
NM_139321chr2094057 3743 3635 3000 2868 1358 930 291 279 12930 22734 422 --
NM_144498chr2062225 2034 1864 608 414 91 --1283 22113 696
NM_144571chr4236648 6467 6441 6429 6308 5407 5145 4939 4862 4695 4413 2803 2770 2504 2325 2118 1702 977 531 391 264 187 60 ----14423
NM_144578chr14145555 5079 4733 4347 4123 3973 3673 2216 1732 665 564 303 295 208 35167 1692 187 --21402 830
NM_144599chr1585116 4497 4075 3359 1500 1050 651 176 ----13797
NM_144601chr1631087 791 404 11013 2875 290 21143 1104
NM_144609chr1751130 1080 957 145 139 1190 1508 --
NM_144628chr2052066 971 704 601 561 1894 11160 1545
NM_144642chr331372 515 337 ----1117
NM_144664chr1161991 1747 810 749 655 499 --11753 --
NM_144767chr1594145 3797 3538 3454 1712 1681 1658 1090 388 23902 3327 1666 --
NM_144775chr17164359 4088 4060 3810 3792 3470 3059 1583 1536 1448 866 769 541 421 301 285 14772 13236 --
NM_144949chr242509 1780 442 30 1558 12628 1600
NM_144963chr872320 1922 1735 834 457 254 206 12467 1570 --
NM_144973chr12105111 4674 3623 3329 2095 1429 1236 1174 349 50 --24454 360 --
NM_145044chr321797 447 1520 1355 11327
NM_145049chr54764 711 420 71 --1438 --
NM_145055chr1873835 3626 3554 3445 3433 3115 2346 22439 1045 --11065
NM_145117chr11112714 2418 2152 2132 1266 805 672 605 533 367 90 --13121 --
NM_145165chr14102864 2845 1977 951 936 738 563 535 426 312 2263 218 21918 1095 --
NM_145207chr4115139 5024 4355 4017 3325 1342 1039 902 486 461 201 15173 14100 11657
NM_145244chr451512 1476 1461 408 47 ----1344
NM_145259chr2107083 6484 5316 4573 4324 1547 1436 893 627 330 --14579 --
NM_145307chr1094430 4176 4052 3984 3029 1369 1212 429 370 23994 1649 ----
NM_145320chr7103403 3381 2942 2866 2625 2352 2215 1327 369 237 --12740 --
NM_145321chr7103403 3381 2942 2866 2625 2352 2215 1327 369 237 --12740 --
NM_145322chr7103403 3381 2942 2866 2625 2352 2215 1327 369 237 --12740 --
NM_145686chr261375 1022 940 723 213 102 22763 1060 11091 23059 1168
NM_145687chr261375 1022 940 723 213 102 22763 1060 11091 23059 1168
NM_145753chr361448 529 374 313 288 62 ------
NM_145808chr782365 2305 2279 2093 1155 1073 721 193 --12485 --
NM_145912chr22104741 4509 4010 3872 1899 1884 1617 519 380 261 --33886 2893 1891 --
NM_147150chr9113671 2629 2581 2534 1224 1163 800 697 300 51 43 33024 2758 1052 1331 1130
NM_147175chrX52155 1955 1822 1526 244 ----1251
NM_147223chr271856 1777 788 694 519 476 89 12149 21998 649 --
NM_147233chr261673 1594 605 511 336 293 11966 21815 466 --
NM_148170chr11145215 4898 4879 4663 4457 4218 4191 4022 2243 1222 1145 943 815 30 24623 252 21955 1125 --
NM_148174chr83836 743 120 1145 31567 416 154 --
NM_148955chr15116586 6272 6204 5038 4575 4242 4168 2367 1098 936 446 16228 34526 2044 387 --
NM_148957chr1362569 2087 1716 1062 153 123 3616 607 169 1173 12035
NM_152261chr1292357 2160 2115 1870 1838 1763 1568 790 159 ------
NM_152263chr1156018 5953 5895 5338 5237 5138 4913 4333 4089 3974 1732 816 540 472 317 15998 11042 --
NM_152267chr2282365 2312 1898 1733 766 567 273 103 --32068 439 165 --
NM_152277chr572112 2068 1731 811 411 194 166 --11793 --
NM_152309chr104687 599 230 194 11528 --21485 888
NM_152330chr1431877 556 538 --1763 22199 604
NM_152352chr1862981 2178 812 784 284 54 --3945 450 171 --
NM_152381chr271259 1209 770 761 211 174 37 ------
NM_152388chr273697 3532 3413 1356 1278 1034 320 1229 1235 --
NM_152400chr44509 335 158 107 --1559 11483
NM_152407chr553211 3197 3108 2239 1193 1539 169 --
NM_152409chr5103400 2996 2900 1220 1032 729 427 418 333 234 --12305 --
NM_152414chr831455 1366 520 11616 --1484
NM_152450chr1582114 1923 1698 1683 1405 709 381 71 21750 1617 ----
NM_152519chr24722 276 167 23 1181 --22066 1430
NM_152529chr273923 3505 3284 3138 2815 1442 221 13194 34316 1275 430 11186
NM_152542chr492207 2189 2133 2114 2087 1955 1484 1391 118 --31624 662 373 --
NM_152556chr752221 887 344 221 42 ------
NM_152588chr1241851 1805 1209 579 --21484 109 1242
NM_152594chr1562202 1836 1522 920 456 229 ------
NM_152622chr573307 3255 3108 2711 2252 1214 853 33373 2583 600 3710 645 372 --
NM_152624chr597341 6347 6266 6175 4867 4794 2400 2023 1841 --15039 16729
NM_152629chr983505 3139 2676 1011 694 547 225 105 --32844 2785 452 --
NM_152641chr1252087 970 425 242 96 --1534 12254
NM_152680chr452247 1468 472 424 105 22291 2097 32364 693 382 --
NM_152686chr582341 2241 1825 1728 649 524 358 205 32116 2098 160 21675 84 --
NM_152707chr103978 274 244 ----1161
NM_152756chr583436 3285 3196 2658 1089 738 694 440 11502 13986 --
NM_152787chrX83972 3865 3690 3133 2531 1053 628 433 22883 662 11100 13470
NM_152789chr741364 920 311 70 2362 352 ----
NM_152793chr784017 3892 3482 3255 3141 872 829 687 13238 23940 901 --
NM_152826chr15116586 6272 6204 5038 4575 4242 4168 2367 1098 936 446 16228 34526 2044 387 --
NM_152836chr871819 1734 1654 581 344 315 79 --1449 --
NM_152837chr871819 1734 1654 581 344 315 79 --1449 --
NM_152838chr2053433 2540 2500 739 250 ----1841
NM_152903chr1351997 1133 1051 849 195 22165 35 2939 607 --
NM_152924chr15156723 6337 5168 4939 4266 2467 2394 2095 1777 1488 1009 811 572 546 286 12365 25464 2266 11334
NM_152999chr774610 4527 4192 3310 3110 871 281 14707 1339 14559
NM_153015chr810949 700 674 658 647 201 194 173 127 119 ------
NM_153042chr661837 1703 1391 405 364 92 ----21850 397
NM_153050chr22145063 4795 4534 4428 3111 1281 1062 1012 974 924 552 373 273 109 14113 1414 --
NM_153051chr22145063 4795 4534 4428 3111 1281 1062 1012 974 924 552 373 273 109 14113 1414 --
NM_153188chr5105251 4328 3710 3563 3477 1898 1843 749 545 355 --24861 116 --
NM_153207chr1273093 2963 2554 1622 991 964 849 --33141 1524 1410 --
NM_153234chr572252 1924 1892 1092 971 528 183 1375 --11816
NM_153261chr1641279 348 331 68 ----21188 590
NM_153262chr14697 323 305 237 11145 23066 2160 1350
NM_153332chr883205 3152 2805 2637 1305 1003 692 388 11193 12709 12928
NM_153354chr52739 32 ----181
NM_153374chr155528 501 469 124 117 ------
NM_153456chr13135617 5447 5055 4622 4506 4001 2469 2164 1556 1235 651 542 359 15136 35915 1985 1243 11493
NM_153607chr592962 2874 2850 2356 2346 2328 343 231 194 ----12457
NM_153616chr1582433 2159 1995 1739 1694 1617 1582 109 ----11820
NM_153617chr1582433 2159 1995 1739 1694 1617 1582 109 ----11820
NM_153618chr1582433 2159 1995 1739 1694 1617 1582 109 ----11820
NM_153619chr15143671 3397 3233 2977 2932 2855 2820 2658 2629 1347 1217 791 702 247 ----13058
NM_153634chr1261521 1414 591 162 81 35 ------
NM_153645chr2283245 3110 2818 2149 827 476 299 266 13193 ----
NM_153689chr241755 1495 614 358 --21782 875 12015
NM_153715chr731091 485 227 ----21215 1001
NM_153812chr132120 1843 1765 21571 198 11682 11660
NM_170665chr12114024 3850 3626 3265 3179 2980 1741 1560 463 386 314 54237 4062 3596 3409 1613 11720 34431 3678 1576
NM_170709chr872056 477 457 423 126 94 22 --42429 1832 1626 679 --
NM_171998chrX132402 2385 2315 2245 1832 1771 1624 1596 1577 1011 995 703 553 11759 ----
NM_172037chr851469 1395 1288 392 121 1320 1238 --
NM_172070chr251686 1413 910 788 727 --12219 12017
NM_172071chr176988 6659 5874 4892 555 471 40 1767 16704 12696
NM_172103chr642612 2488 1025 112 21730 1637 12673 12531
NM_172105chr642612 2488 1025 112 21730 1637 12673 12531
NM_173083chr13908 514 173 --1160 1833
NM_173198chr942850 2341 2039 1890 1802 32843 2193 1002 2565 176
NM_173200chr942850 2341 2039 1890 1802 32843 2193 1002 2565 176
NM_173214chr16167274 7100 6825 6807 6785 6362 6234 6175 5838 5408 5274 5252 3317 2547 2061 1128 37723 5459 1668 16098 --
NM_173463chr4134422 4408 4262 4079 3754 3553 3428 3063 829 543 391 117 74 1899 23907 1397 1140
NM_173468chr4125827 5663 5492 4993 4645 4046 3829 3760 508 189 182 159 15814 --12301
NM_173469chr1561578 1212 1034 999 476 450 --11389 --
NM_173470chrX92874 2674 2667 2093 837 813 454 264 131 --52300 2288 2276 994 877 --
NM_173495chrX92279 2264 2211 964 863 740 551 294 45 22432 2109 12306 1566
NM_173496chr1052783 2569 2563 194 52 --22491 2154 --
NM_173510chr2242781 1114 318 297 --21823 1800 --
NM_173511chr221328 401 33305 2665 2442 13363 13632
NM_173531chr1983601 2974 2456 2428 912 726 426 219 ----33738 882 168
NM_173552chr341606 875 175 53 12373 11671 --
NM_173576chr1051787 1445 808 670 219 --11954 1387
NM_173582chr1195465 4665 4525 4202 2409 1957 1468 1106 767 ----14847
NM_173602chr12113669 3072 3060 2903 2341 1215 924 870 811 767 544 1587 11232 22564 480
NM_173642chr1178604 8354 7781 7549 7475 3480 3415 3067 2982 2786 2421 2364 1536 1384 1262 1203 29 12488 38522 5723 858 21834 104
NM_173808chr1154274 4248 4107 3949 3160 1793 1565 1467 1328 1318 1248 989 909 718 100 12941 --1701
NM_173812chr1261579 1265 392 333 217 84 --1303 --
NM_173822chr231898 647 460 11721 --21887 808
NM_173825chr352064 965 878 439 100 32642 872 613 ----
NM_173829chr5106190 5532 4888 4466 4244 4078 1731 1133 1028 99 15735 35612 1439 193 15426
NM_173851chr864022 3772 3051 1438 906 89 1921 22606 369 --
NM_174858chr121082 177 --11048 11095
NM_174911chr894000 3920 3802 2801 784 766 591 585 452 22650 2495 --13642
NM_175607chr331586 1201 527 11503 21605 1490 --
NM_175612chr331586 1201 527 11503 21605 1490 --
NM_175623chr12247470 7383 6799 6765 5917 5910 5812 5450 2827 2708 2565 2551 2484 2438 2394 2357 2346 2012 1894 1631 1625 1475 794 357 26698 5820 22805 1773 15055
NM_175624chr12247565 7478 6894 6860 6012 6005 5907 5545 2922 2803 2660 2646 2579 2533 2489 2452 2441 2107 1989 1726 1720 1570 889 452 26793 5915 22900 1868 15150
NM_175625chr12247565 7478 6894 6860 6012 6005 5907 5545 2922 2803 2660 2646 2579 2533 2489 2452 2441 2107 1989 1726 1720 1570 889 452 26793 5915 22900 1868 15150
NM_175634chr83885 361 51 --11069 1323
NM_175635chr83885 361 51 --11069 1323
NM_175636chr83885 361 51 --11069 1323
NM_175736chr1287806 7076 5841 5220 1777 1030 269 55 ----11536
NM_175907chr1872732 2318 2162 739 504 70 23 1990 32499 446 355 --
NM_175910chr1951882 1703 984 902 866 --12280 --
NM_176081chr10105909 5825 2402 1745 1665 1462 1028 944 498 291 14829 21728 1070 --
NM_176083chr10105909 5825 2402 1745 1665 1462 1028 944 498 291 14829 21728 1070 --
NM_176814chr7172 ----21443 1354
NM_176823chr193780 3551 3541 2605 1177 1151 473 358 110 23572 2902 11291 --
NM_177438chr1474069 4059 3819 3747 3501 2578 257 --11258 1859
NM_177538chr2168853 8234 7886 7501 7139 5715 5485 3423 3318 3235 3132 2824 1930 602 303 21 37314 3226 1652 75430 2772 1585 1406 1285 466 87 --
NM_177952chr143538 337 221 --1584 1242
NM_177972chr11114325 3965 3777 3156 2858 1377 1108 957 946 646 143 13237 33221 1394 1279 --
NM_177985chr262248 2198 1496 888 726 137 --1384 --
NM_177990chr2051876 1808 1693 1427 580 --2151 105 21859 267
NM_177996chr2093457 2724 2679 2590 2473 2366 2130 850 51 13094 --32313 382 45
NM_178011chr1082943 2909 2893 2470 2399 2176 2146 680 ------
NM_178140chr572502 1974 982 967 834 725 68 ----151
NM_178151chrX127089 6610 5982 5746 3060 2865 2375 1985 1578 1170 941 577 57437 5773 5273 2249 1227 27604 7191 16420
NM_178152chrX127089 6610 5982 5746 3060 2865 2375 1985 1578 1170 941 577 57437 5773 5273 2249 1227 27604 7191 16420
NM_178153chrX127089 6610 5982 5746 3060 2865 2375 1985 1578 1170 941 577 57437 5773 5273 2249 1227 27604 7191 16420
NM_178313chr241959 1745 691 417 --1621 1310
NM_178498chr1194053 3682 3408 3095 2523 2491 1156 874 217 12708 11451 --
NM_178509chr1783773 2861 2762 2738 1169 566 239 186 --13655 --
NM_178539chr1251983 1969 1889 632 158 12067 1844 --
NM_178585chr493118 2492 2448 2351 2265 892 490 356 26 12339 1671 --
NM_178586chr1482069 1727 1576 1537 905 636 380 87 --22230 921 --
NM_178815chr1081034 812 794 691 467 409 356 263 1374 12447 --
NM_178818chr1672377 1672 1600 961 904 372 241 --21898 839 --
NM_180989chr1372388 2330 1975 1839 1529 939 361 --32519 413 396 --
NM_181349chr7123051 3003 2793 2336 1979 1908 934 905 824 801 248 45 12094 21920 808 --
NM_181351chr1172510 1192 1011 372 307 296 162 --2403 274 --
NM_181358chr173591 2950 2694 1688 1428 862 109 --13296 23089 1058
NM_181361chr361452 1366 1342 591 542 244 1463 ----
NM_181443chr2042600 999 863 775 --12921 22461 2065
NM_181481chr18217089 7075 7062 6665 6020 5787 5398 5259 4884 4505 2784 2729 2051 1816 1550 1328 759 668 429 113 38 11544 15556 27027 172
NM_181482chr18217089 7075 7062 6665 6020 5787 5398 5259 4884 4505 2784 2729 2051 1816 1550 1328 759 668 429 113 38 11544 15556 27027 172
NM_181483chr18217089 7075 7062 6665 6020 5787 5398 5259 4884 4505 2784 2729 2051 1816 1550 1328 759 668 429 113 38 11544 15556 27027 172
NM_181486chr1261302 1084 542 279 178 165 ------
NM_181504chr573922 3402 3370 1608 1002 257 110 ----12879
NM_181523chr573922 3402 3370 1608 1002 257 110 ----12879
NM_181524chr573922 3402 3370 1608 1002 257 110 ----12879
NM_181553chr1631087 791 404 11013 2875 290 21143 1104
NM_181554chr1631087 791 404 11013 2875 290 21143 1104
NM_181672chrX61984 1649 1351 1292 721 548 41606 233 146 67 ----
NM_181673chrX61984 1649 1351 1292 721 548 41606 233 146 67 ----
NM_181705chr5115045 4256 3950 3579 3525 1976 1628 1571 684 442 235 13637 33898 1921 1518 --
NM_181789chr1562854 2775 1202 1047 975 51 21283 93 22195 604 22712 1277
NM_181838chr531539 1478 1164 1505 21523 237 1176
NM_181897chr342707 2547 1775 575 --12006 11735
NM_182314chrX71864 1775 1731 1319 584 525 201 --1481 --
NM_182485chr463757 3376 2354 1198 1172 482 ------
NM_182487chr974228 3544 3390 3259 2944 2918 693 21201 472 24173 2932 --
NM_182488chr131978 --2938 829 1241
NM_182646chr463757 3376 2354 1198 1172 482 ------
NM_182756chr22626 51 ----1453
NM_182758chr1573049 2462 1526 1279 928 708 378 ------
NM_182765chr1062083 1919 1482 1456 665 138 21953 1704 21711 763 21768 838
NM_182830chr14112257 2144 2106 1473 1460 908 892 815 781 755 87 ------
NM_182896chr341525 1288 287 52 --165 --
NM_182898chr7226506 6019 5969 5962 5695 5640 5058 4931 4609 4540 4385 4153 2426 2419 2075 2040 1730 1704 1561 1167 829 346 --25670 5078 --
NM_182899chr7226506 6019 5969 5962 5695 5640 5058 4931 4609 4540 4385 4153 2426 2419 2075 2040 1730 1704 1561 1167 829 346 --25670 5078 --
NM_182918chr213549 432 367 11067 --11375
NM_182948chr172546 2003 951 857 745 701 223 --12413 --
NM_182964chr11112714 2418 2152 2132 1266 805 672 605 533 367 90 --13121 --
NM_183004chr1463667 2877 2826 1209 859 730 163 23484 241 12957
NM_183006chr2051440 221 211 52 34 --11326 1231
NM_183238chr1283154 2825 1531 1471 1442 1380 1212 1170 11039 23403 1224 13424
NM_183416chr192085 2071 1970 1333 1294 799 544 538 27 --11700 --
NM_183421chr851016 754 729 381 196 --1889 --
NM_194071chr755105 4424 3768 1886 57 --55283 5002 4554 3700 140 --
NM_194247chr2124065 3977 3040 2867 1740 1453 1369 1195 1123 989 959 587 --13716 13803
NM_194285chr1183320 3121 2593 1239 1208 1055 992 985 --22786 2772 --
NM_194292chr151772 1744 1208 440 344 1633 21236 1195 176
NM_194314chr1115625 4274 4167 3776 1952 1683 1497 1289 1048 140 131 1772 11374 24606 598
NM_194318chr1372416 2341 2279 2054 2015 471 205 22561 2148 --32348 2081 1939
NM_194328chr993191 3125 2534 2105 2070 2056 2034 1056 915 ------
NM_194329chr993191 3125 2534 2105 2070 2056 2034 1056 915 ------
NM_194330chr993191 3125 2534 2105 2070 2056 2034 1056 915 ------
NM_194332chr993191 3125 2534 2105 2070 2056 2034 1056 915 ------
NM_194358chr1211822 1389 1380 21374 39
NM_194359chr1211822 1389 1380 21374 39
NM_194434chr1855205 4012 1763 985 810 32017 1275 50 ----
NM_197941chr573004 2252 1028 857 848 649 550 --11976 1827
NM_198081chr652976 2451 2153 827 765 12193 12812 191
NM_198128chr1871917 1869 1821 1611 762 417 59 ------
NM_198181chr1562878 2763 2380 2345 2334 1890 ------
NM_198196chr341879 766 625 560 32410 2274 1005 1914 1910
NM_198212chr752042 1972 1795 1469 73 2617 176 ----
NM_198215chr101395 11274 --2982 553
NM_198268chr173591 2950 2694 1688 1428 862 109 --13296 23089 1058
NM_198269chr173591 2950 2694 1688 1428 862 109 --13296 23089 1058
NM_198270chrX103223 3183 2834 2336 1129 1084 852 772 416 338 13161 12227 --
NM_198273chr562954 2742 2027 844 161 59 1958 13111 --
NM_198320chr1275020 4304 3965 3512 3410 3347 42 24603 344 43663 3398 1365 494 13319
NM_198321chr5103158 3104 2883 2857 2794 2763 2511 2281 2064 1140 --11070 1838
NM_198400chr1572919 2830 1822 1029 484 369 124 12030 1243 12456
NM_198465chrX72907 2087 1963 1935 724 526 443 --22830 601 22569 1031
NM_198468chr684478 4220 4130 3989 1451 712 249 48 1831 11550 --
NM_198503chr131569 635 50 ----181
NM_198569chr672593 2350 1952 1090 591 68 22 22110 271 ----
NM_198581chr266760 5623 2430 1677 472 132 14793 11341 22677 1820
NM_198595chr4104342 4267 4256 4097 3524 3292 3100 1765 1725 1064 1298 11373 11254
NM_198793chr364023 3857 3799 3634 3423 333 1828 34188 3478 405 --
NM_198829chr751182 1132 1120 167 155 ------
NM_198859chr3104089 3748 3612 3602 3302 3190 1309 1046 809 379 11322 14513 --
NM_198900chr1287806 7076 5841 5220 1777 1030 269 55 ----11536
NM_198968chr1363762 3424 2686 1556 1484 463 --2600 33 33742 3516 178
NM_198990chr762893 2752 2610 2448 929 27 11014 22056 1096 --
NM_199000chr772135 1993 1943 1721 1408 373 279 --11487 11478
NM_199040chr1273514 2722 2328 1182 1123 200 194 --12955 --
NM_199050chr2193584 3269 2832 1603 1556 1508 1461 169 71 --33567 3234 1497 128
NM_199072chr773187 3151 2960 1197 975 815 201 --2761 503 --
NM_199168chr1071352 1095 1065 624 362 111 49 11121 11054 11040
NM_199320chr482778 2459 2422 2212 2038 814 459 159 1378 12871 --
NM_199320chr482778 2459 2422 2212 2038 814 459 159 1378 12871 --
NM_199324chr432833 2404 87 --23586 3013 11433
NM_199355chr1671740 1401 1248 1124 593 500 99 11420 41177 482 79 63 --
NM_199421chr1494904 4349 4096 3455 3428 1289 766 578 208 ------
NM_199436chr262976 2954 2705 2366 2258 1895 1150 --11985
NM_199437chr1172179 2001 1783 841 610 399 118 12022 ----
NM_199438chr1172179 2001 1783 841 610 399 118 12022 ----
NM_199439chr1172179 2001 1783 841 610 399 118 12022 ----
NM_199454chr1114600 4312 4271 3839 3794 3737 1541 739 681 514 288 --13028 --
NM_199461chr1063503 3398 3379 3018 729 722 --32442 2321 513 11135
NM_201263chr152143 2123 1822 672 393 ----21598 58
NM_201278chr1151704 765 445 385 331 --32003 1712 1527 --
NM_201281chr1151704 765 445 385 331 --32003 1712 1527 --
NM_201437chr85485 185 94 79 55 --166 --
NM_201545chr171087 997 566 505 223 214 28 --1382 --
NM_201591chr431238 412 268 --11376 1196
NM_201592chr431238 412 268 --11376 1196
NM_203329chr11116975 6908 6392 5825 5302 5197 5050 4528 2239 1877 1262 27048 241 66609 4470 2460 1698 276 172 14655
NM_203330chr11116975 6908 6392 5825 5302 5197 5050 4528 2239 1877 1262 27048 241 66609 4470 2460 1698 276 172 14655
NM_203331chr11116975 6908 6392 5825 5302 5197 5050 4528 2239 1877 1262 27048 241 66609 4470 2460 1698 276 172 14655
NM_203349chr15112030 1690 1680 1504 1427 735 597 590 430 138 127 11789 1865 1193
NM_203350chr151287 1167 474 247 184 --1384 11767
NM_203446chr2152781 2669 2073 609 293 22079 362 ----
NM_203451chr1352206 2194 565 399 371 --11715 21663 1620
NM_203453chr971969 1578 1275 1268 1260 741 352 --170 11719
NM_203458chr183816 3523 3369 3361 3266 804 514 277 1555 12889 11485
NM_203459chr152446 1975 1595 699 151 --31781 1628 747 --
NM_203463chr2154955 4054 3973 3846 3329 2998 1561 1487 1425 1347 1089 1021 887 820 537 14516 34846 4657 4543 33229 3198 529
NM_203504chr472629 999 973 660 606 442 250 --21770 1036 1727
NM_203505chr472629 999 973 660 606 442 250 --21770 1036 1727
NM_206594chr1113613 3442 3410 3019 2924 2504 2347 1437 674 634 105 13167 1578 --
NM_206595chr1113613 3442 3410 3019 2924 2504 2347 1437 674 634 105 13167 1578 --
NM_206853chr683099 3049 2867 2520 1356 749 614 301 --13349 --
NM_206854chr6134360 4310 4128 3781 3301 2010 1875 1562 888 758 390 293 48 --14610 --
NM_206855chr6145325 5275 5093 4746 4266 2527 1853 1723 1355 1258 1013 844 805 102 --15575 --
NM_206866chr2173170 3137 3038 2999 2259 1173 25 --1574 1923
NM_206876chr2103129 3002 2925 2682 2629 2463 2255 801 78 25 --13303 2317 299
NM_206909chr8178352 7748 6243 6153 6035 6018 5935 5787 5566 5418 5264 3169 2814 2426 2068 1635 1578 36385 5545 2654 ----
NM_206933chr1112847 2721 2415 2286 1970 1076 1052 883 765 314 95 --1803 --
NM_207015chr352322 1971 1715 1525 494 2547 66 ----
NM_207036chr1592268 2104 1984 1739 1614 1543 1518 785 133 1284 ----
NM_207037chr1592268 2104 1984 1739 1614 1543 1518 785 133 1284 ----
NM_207038chr1592268 2104 1984 1739 1614 1543 1518 785 133 1284 ----
NM_207040chr1592268 2104 1984 1739 1614 1543 1518 785 133 1284 ----
NM_207303chr1074173 4142 3962 3560 3290 2559 313 34058 2709 585 13490 1597
NM_207306chr1104415 3979 3963 3750 577 505 351 339 315 187 21441 376 ----
NM_207361chr13106126 5402 4804 4458 3959 1318 675 542 521 81 1981 --14516
NM_207405chr472250 2207 2057 2037 1845 657 638 2644 95 21521 797 --
NM_207406chr4145625 5514 5475 5137 5117 4871 4798 4634 2442 1684 847 708 612 221 --31779 1261 767 25586 544
NM_207577chr1132416 75 67 12109 --21988 672
NM_207647chr952470 2109 1687 634 471 --193 --
NM_212460chr761805 1707 1611 1385 470 242 31686 266 136 11343 --
NM_212471chr1741957 1944 1664 713 --1518 12082
NM_212472chr1741957 1944 1664 713 --1518 12082
NM_213589chr285506 4389 3495 1762 1064 629 480 50 --33765 1626 595 --