TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-29b-2-5p
miRNA Sequence: CUGGUUUCACAUGGUGGCUUAG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr551823 1511 1432 538 77 1223 2681 143 2817 22
NM_000081chr161772 1336 636 575 109 46 11651 ----
NM_000084chrX166658 6564 6193 5651 5579 5517 5122 4748 4528 1359 1057 1005 472 457 329 45 21580 436 12417 44458 2164 980 377
NM_000092chr2114358 4336 4297 3893 3747 3356 3061 1832 1477 524 38 34078 3436 1521 1444 --
NM_000104chr273105 2518 2076 813 632 525 339 32262 1043 127 --1660
NM_000109chrX42446 2252 1753 303 1407 2873 862 --
NM_000112chr585386 5080 4277 1902 1751 1245 1159 728 25212 4953 ----
NM_000115chr1351791 626 606 196 93 42535 2175 1716 360 12042 --
NM_000138chr1542589 1685 637 439 1689 22633 2015 1482
NM_000163chr582299 1787 476 456 431 390 352 326 2450 72 21460 948 --
NM_000167chrX51741 603 521 429 117 11200 --11334
NM_000168chr743311 547 238 194 1297 --137
NM_000176chr5163865 3687 3226 3164 3075 2978 2966 2498 1428 1272 986 718 450 310 259 63 23003 1123 ----
NM_000192chr1231252 553 542 11303 21084 178 --
NM_000202chrX83536 3514 1365 1310 674 586 412 319 --1552 --
NM_000216chrX64119 3297 3252 1538 1362 653 43330 2884 610 446 ----
NM_000217chr12135124 4901 4818 4632 4371 4078 1912 1835 1805 947 494 209 177 44602 4358 3773 1970 11348 23577 1626
NM_000232chr452883 1989 811 787 63 1247 --12839
NM_000245chr762229 2077 1746 736 285 179 ----11701
NM_000248chr351180 634 539 438 324 32523 855 651 --1365
NM_000259chr15136387 5722 5598 4310 3949 2412 2052 2005 1699 1386 1276 1147 139 26282 5376 11125 24353 1088
NM_000267chr17143419 3411 2158 1400 1148 1142 751 711 568 530 352 292 277 163 42510 2260 836 29 12612 --
NM_000272chr251455 369 181 132 86 2561 304 11277 180
NM_000297chr451336 685 540 369 205 11452 ----
NM_000318chr842803 2683 212 144 --1160 1768
NM_000332chr6145845 5503 5360 4927 4625 4586 4436 2238 1758 1734 1446 980 785 533 65828 2631 1903 1228 886 522 16388 --
NM_000337chr5216458 6336 6324 6074 6056 5871 5017 4893 4676 4645 4186 2133 2036 1990 1135 995 963 749 471 338 304 46415 4985 2486 1534 45838 5584 4111 239 14018
NM_000340chr351475 1185 1033 343 46 1212 ----
NM_000346chr1761955 1856 1842 1412 542 285 ----1276
NM_000362chr2283448 2736 2558 2439 2295 1137 328 264 --12826 13471
NM_000368chr9124621 4573 4322 4164 3780 1888 1867 1479 1332 658 645 413 34349 3832 3492 23405 681 --
NM_000408chr242494 820 652 47 22585 1164 177 1860
NM_000411chr2142217 1171 882 54 43041 3006 2140 377 1632 13212
NM_000430chr17113813 3794 3666 3149 2952 2786 1327 1286 864 576 516 ------
NM_000439chr562288 2152 1014 904 604 397 22374 1938 1887 1946
NM_000448chr1182842 2533 2505 969 876 630 221 165 2324 318 13018 1793
NM_000461chr3154530 4507 3913 3573 3378 3203 2959 1506 1451 1276 978 716 573 425 350 1360 23491 179 21559 825
NM_000489chrX103309 3083 2605 2598 2131 1380 979 556 514 35 21197 892 12383 --
NM_000527chr1972438 2186 2089 1957 1734 557 46 31720 418 84 11678 1617
NM_000533chrX41960 1686 1472 632 ----11751
NM_000554chr19103200 2926 2608 2538 2441 2189 1132 1119 971 112 1325 33241 2419 153 13339
NM_000555chrX77603 7320 7190 3000 1985 1800 1322 37090 2376 578 16418 46611 3061 1579 942
NM_000575chr231067 829 805 1329 2995 364 1158
NM_000599chr293990 3844 3710 3681 3354 3271 3113 1445 137 44512 4393 1657 658 21817 389 1796
NM_000609chr1082878 2866 2844 2110 1108 843 595 23 11996 152 --
NM_000610chr1172846 2000 1869 808 728 561 303 22584 855 --11141
NM_000611chr11146975 6289 6162 5151 5050 4653 4313 2136 1719 1697 1433 275 191 171 45826 5198 1878 1263 36608 4469 2459 16909
NM_000612chr1163391 3360 2890 2325 719 565 6779 750 423 351 311 298 32514 2502 595 12442
NM_000615chr1162127 1011 402 372 355 273 42511 1193 308 163 1296 --
NM_000618chr12106088 5967 5253 5236 5109 4798 4688 4535 1130 979 15736 26363 2544 --
NM_000618chr12106088 5967 5253 5236 5109 4798 4688 4535 1130 979 15736 26363 2544 --
NM_000621chr1361452 1280 1054 495 330 289 11305 --21259 109
NM_000633chr1874546 4421 3797 1650 968 703 299 11594 ----
NM_000663chr1682950 2620 2491 2322 1978 1965 791 331 22220 1907 12153 --
NM_000686chrX51064 1029 598 375 369 11182 --1125
NM_000693chr1571478 1371 1350 1189 451 261 206 1653 ----
NM_000719chr12115985 5667 5630 5542 4611 4556 4287 2308 1715 1335 939 26363 5393 45795 1968 1569 372 --
NM_000721chr162714 2521 1758 930 645 376 32036 1941 51 3418 243 69 --
NM_000726chr221431 1119 3458 367 64 --2488 355
NM_000793chr1464584 2037 1985 1795 1046 981 44557 4359 1842 1771 21673 325 --
NM_000809chr4188436 8235 7968 6669 6550 6297 6254 5915 5675 3469 3046 2086 1056 835 828 749 563 133 48665 7399 3543 552 21848 1778 --
NM_000813chr5104826 4779 3641 3529 2000 1448 1426 1034 757 47 45026 3837 3619 3566 --24473 577
NM_000814chr1554198 3652 3614 938 442 11692 --11176
NM_000827chr552630 1001 323 279 163 31878 917 538 11952 --
NM_000829chr1161816 1634 1505 1416 475 185 31438 309 98 ----
NM_000831chr196017 5991 5322 4413 1903 1795 1654 952 843 --75428 2455 2320 2160 1734 1127 157 11138
NM_000838chr682676 2043 993 925 556 232 121 36 22289 302 ----
NM_000859chr541132 664 614 421 11062 11469 --
NM_000866chr341655 1558 1234 1201 11579 --1718
NM_000875chr15176982 6877 6626 6374 6304 5426 5386 5365 5315 5206 4974 4313 1710 1360 1175 386 288 16701 36521 2759 1967 --
NM_000877chr262483 2348 1216 1182 1099 157 22473 2050 1311 13015
NM_000891chr1783650 3376 3327 2694 2363 1410 1363 702 12505 --1794
NM_000899chr12153993 3703 3653 3641 3414 3084 2830 1278 1067 1036 1004 881 620 192 114 44127 3987 3523 1530 23453 2899 13204
NM_000901chr482339 2110 1991 1878 1767 1714 1026 264 --21834 187 11742
NM_000926chr11239218 9144 8888 8371 7277 7057 6654 6465 6229 6026 5871 3667 3206 2932 2741 2644 2275 2064 601 574 546 328 265 59486 9300 8433 2255 914 1757 37378 7051 3146
NM_000956chr1441133 866 399 327 --1991 1812
NM_000961chr2084031 4021 1351 1329 1135 840 491 234 2800 502 12446 --
NM_000963chr151944 660 525 230 37 42165 1654 934 770 ----
NM_000983chr121561 542 --21525 112 155
NM_001001323chr12102766 2325 2100 1951 1239 1226 873 340 257 28 33081 2994 1217 ----
NM_001001344chrX62407 1994 1647 977 594 369 32588 1854 1036 11791 12129
NM_001001389chr1172846 2000 1869 808 728 561 303 22584 855 --11141
NM_001001390chr1172846 2000 1869 808 728 561 303 22584 855 --11141
NM_001001391chr1172846 2000 1869 808 728 561 303 22584 855 --11141
NM_001001392chr1172892 2046 1915 854 774 607 349 22630 901 --11187
NM_001001396chr183838 3811 3498 1474 1409 1352 1298 27 --14394 14468
NM_001001419chr5105185 4592 4205 3571 3419 3309 3276 1780 1399 59 25030 4368 21377 506 --
NM_001001420chr5105185 4592 4205 3571 3419 3309 3276 1780 1399 59 25030 4368 21377 506 --
NM_001001433chr2083172 2461 2180 2067 922 828 759 416 33153 737 513 22158 614 --
NM_001001481chr843007 1293 1035 957 12262 ----
NM_001001668chr1984311 4224 4212 3501 3377 2904 665 324 53099 2997 921 907 349 24237 3335 44064 2851 2686 644
NM_001001669chr572479 2356 1805 886 795 784 106 --1560 12289
NM_001001890chr2193907 3073 3051 2693 2633 1490 1431 323 190 23822 2643 --11301
NM_001001928chr22158362 7431 7049 6972 6441 6340 6142 5713 5282 3221 2881 2448 1085 791 693 46595 6434 1528 412 77729 7246 5972 2850 2776 2022 671 27318 2323
NM_001002257chr272693 1401 869 677 604 557 516 22778 1045 --1535
NM_001002258chr23532 507 459 21600 681 21920 1539 --
NM_001002843chr151803 1163 1420 1881
NM_001002860chr14144333 3373 3339 2996 1870 1762 1734 1582 1466 1102 929 907 826 76 12899 ----
NM_001003407chr1094943 4432 4254 3803 3322 3233 1581 714 100 24424 899 44690 2040 1512 1390 --
NM_001003408chr1094943 4432 4254 3803 3322 3233 1581 714 100 24424 899 44690 2040 1512 1390 --
NM_001003652chr18138711 7909 6737 6610 6455 6036 5348 3484 2110 2077 1427 1309 604 21999 541 38063 1602 710 17971
NM_001003674chr18117075 7062 6665 6020 5555 5532 2729 1328 1276 429 170 52785 1817 1551 760 114 17025 34885 4506 39
NM_001003675chr18117075 7062 6665 6020 5555 5532 2729 1328 1276 429 170 52785 1817 1551 760 114 17025 34885 4506 39
NM_001003679chr171912 1695 1643 825 661 530 237 ------
NM_001003681chr2262139 1917 1877 1719 1374 26 31705 1699 289 ----
NM_001003712chr1273589 3309 3223 1579 1151 508 89 1982 13333 --
NM_001003760chr663472 2757 2505 936 870 713 43618 3208 2294 1153 --12783
NM_001003800chr973713 3569 3202 2350 1285 543 322 ----12975
NM_001003940chr1593886 3675 3358 2795 2755 2560 1213 1142 382 1683 11079 11349
NM_001003942chr1593886 3675 3358 2795 2755 2560 1213 1142 382 1683 11079 11349
NM_001003943chr1593890 3679 3362 2799 2759 2564 1217 1146 386 1687 11083 11353
NM_001004065chr963671 3065 2756 2645 800 128 2698 301 42629 2581 2534 330 252 44
NM_001004317chr643657 1694 601 145 2502 471 --24197 3058
NM_001004419chr12134567 4343 4243 3951 3751 3544 2917 2873 1193 1171 1129 985 58 33716 3386 219 1703 11345
NM_001005375chrY4371 248 195 185 ------
NM_001005404chr1784147 3528 1710 1479 1273 850 463 392 23467 2954 34178 3895 1052 24025 1811
NM_001005463chr1072149 1923 604 542 345 160 108 12201 --12055
NM_001005473chr5116194 6134 4897 4811 2163 1811 1796 1288 1173 557 248 14527 11258 --
NM_001005502chr12153912 3777 3684 3410 3397 3347 3317 3167 1892 1386 1364 1205 515 493 106 --23965 3662 24305 3513
NM_001005746chr221431 1119 3458 367 64 --2488 355
NM_001005747chr221431 1119 3458 367 64 --2488 355
NM_001006600chr562357 2158 1808 1503 836 167 12410 1438 --
NM_001006610chr166967 882 844 667 395 203 --1684 --
NM_001006946chr241915 1792 1361 674 21785 684 --1697
NM_001007023chr1464584 2037 1985 1795 1046 981 44557 4359 1842 1771 21673 325 --
NM_001007024chr17104429 3976 3611 3452 1741 1735 1031 360 330 317 1274 24072 168 34328 4199 4035
NM_001007025chr17104429 3976 3611 3452 1741 1735 1031 360 330 317 1274 24072 168 34328 4199 4035
NM_001007094chr10134078 3876 3393 1418 1396 1372 1170 966 494 466 382 291 45 33840 847 197 43808 3524 3205 545 --
NM_001007097chr994982 4428 4373 3811 3769 3333 1612 303 166 35106 4690 1591 12001 --
NM_001007156chr1551820 1340 1218 638 113 ----1598
NM_001007237chr192881 2835 2779 2634 2530 2260 873 793 675 --22357 611 12352
NM_001007466chr644184 4006 1381 753 34845 3621 3517 11171 21792 202
NM_001008239chr1863835 3626 3499 3433 837 290 13116 11063 13555
NM_001008392chr3123599 3184 2607 2597 2247 2224 1420 1388 922 895 331 41 ------
NM_001008401chr1961141 574 405 321 202 72 1116 1237 --
NM_001008541chr1081872 1446 602 515 448 423 235 124 22327 932 12080 --
NM_001008541chr1081872 1446 602 515 448 423 235 124 22327 932 12080 --
NM_001008726chr1481625 1492 1335 1307 1146 391 198 104 --11176 --
NM_001008738chr51522 42640 2618 729 258 --21152 48
NM_001008801chr1991819 769 685 602 518 434 332 163 79 1208 1249 --
NM_001008925chr443415 712 384 315 23535 3212 --1438
NM_001009554chr484721 3793 3668 3487 3264 1518 720 37 54234 4216 4045 2938 1354 --13230
NM_001009554chr484721 3793 3668 3487 3264 1518 720 37 54234 4216 4045 2938 1354 --13230
NM_001009899chr386430 5868 5262 5241 4910 4569 1283 1276 26178 1709 44801 4599 4469 147 16292
NM_001009909chr1193879 3692 3500 2778 2403 1270 1206 1176 61 53235 925 904 338 160 ----
NM_001009959chr262596 2300 2181 2166 2151 910 1187 32099 2022 1627 12491
NM_001009960chr772796 2012 1985 1779 357 238 158 --42731 1757 373 77 --
NM_001010000chr1883419 2966 2889 2801 1336 1046 970 385 23407 254 ----
NM_001010846chr184555 4054 3915 3357 2908 1460 947 843 1676 1527 --
NM_001010853chr633028 2619 2354 22251 27 1499 --
NM_001010861chr172396 2348 2230 2124 1921 1127 337 1132 --11101
NM_001010862chrX102944 2014 1282 1218 946 852 619 456 162 86 22203 1072 ----
NM_001010888chrX74663 4209 4019 3607 1645 1309 351 13277 1910 --
NM_001010891chr5126905 6374 6070 4206 1952 1633 1610 1281 1213 1185 1142 398 1115 46323 1656 510 477 25749 4378
NM_001010895chr94798 659 94 59 1173 ----
NM_001011513chr453538 3083 1551 1241 629 43623 437 248 145 ----
NM_001011666chr7176019 5695 5077 4901 4873 4609 4540 4153 2426 2143 1730 1704 1561 1299 1165 417 346 35641 5059 2076 15669 12420
NM_001011708chr282898 2609 2444 2419 1824 1151 1057 419 179 22212 260 --
NM_001012393chr1174142 3972 3205 1529 1380 668 78 35057 3993 1088 14276 13148
NM_001012398chr162351 163 2698 308 1734 --
NM_001012420chr1582612 2565 2480 2268 2146 1159 1014 322 22578 1956 ----
NM_001012423chr1582612 2565 2480 2268 2146 1159 1014 322 22578 1956 ----
NM_001012753chr1981116 1097 952 868 430 244 162 78 ----11038
NM_001012755chrX134510 4290 4139 4087 4036 3748 3369 3296 1100 872 781 548 313 25006 377 1760 13929
NM_001012761chr552624 2413 1858 700 692 --1850 --
NM_001013031chr1073123 2956 2703 2595 2246 438 310 ----13157
NM_001013620chr12157733 7388 6775 6749 6515 6307 6110 6089 5362 5271 2902 2093 1101 419 47 57823 7066 6453 5773 836 ----
NM_001013659chr19104900 4802 4744 4536 4340 4219 3626 1491 1329 367 55069 4682 4109 3428 2093 1754 --
NM_001014380chr1374255 2346 1901 1755 1218 1086 251 35480 3835 1438 35054 4418 1266 --
NM_001014797chr10167909 7816 7697 6896 6524 5395 5370 3085 2935 2459 2192 1958 1707 1169 1002 722 32949 2530 36 36720 2735 144 45881 2863 1613 1352
NM_001015877chrX32121 949 805 52994 2920 1186 719 82 ----
NM_001017368chr17112713 2193 1955 1888 1790 925 904 638 570 219 118 22654 1762 ----
NM_001017395chr353377 2381 1167 446 374 23315 278 ----
NM_001017420chr851168 527 376 267 72 11024 21237 1062 --
NM_001017440chr7187927 7576 7514 6593 6577 6045 5371 2813 2367 2221 2170 1732 1505 1000 717 552 527 123 35691 1894 1783 13043 --
NM_001018054chr13956 519 344 ----11325
NM_001018067chr194980 4813 3745 3669 3304 1820 1549 804 772 31161 1045 986 ----
NM_001018068chr194980 4813 3745 3669 3304 1820 1549 804 772 31161 1045 986 ----
NM_001018069chr194980 4813 3745 3669 3304 1820 1549 804 772 31161 1045 986 ----
NM_001018074chr5163865 3687 3226 3164 3075 2978 2966 2498 1428 1272 986 718 450 310 259 63 23003 1123 ----
NM_001018075chr5163865 3687 3226 3164 3075 2978 2966 2498 1428 1272 986 718 450 310 259 63 23003 1123 ----
NM_001018076chr5163865 3687 3226 3164 3075 2978 2966 2498 1428 1272 986 718 450 310 259 63 23003 1123 ----
NM_001018077chr5163865 3687 3226 3164 3075 2978 2966 2498 1428 1272 986 718 450 310 259 63 23003 1123 ----
NM_001018111chr7133960 3945 3400 2920 2878 2722 1144 1018 766 462 319 256 169 147 12700 --
NM_001020825chr551340 1162 550 453 441 1478 ----
NM_001024094chr5163865 3687 3226 3164 3075 2978 2966 2498 1428 1272 986 718 450 310 259 63 23003 1123 ----
NM_001024372chr842184 1730 1697 1681 1629 --12239
NM_001024647chr12287470 7383 6979 6765 6518 6478 6225 5910 5859 5812 5583 5405 5239 5216 5053 2804 2708 2484 2357 2325 2201 2073 2012 1772 1475 905 794 357 55451 2566 2439 2347 1626 22827 1894 --
NM_001024649chr541941 1874 661 577 21163 261 22599 2401 --
NM_001024660chr351702 1553 1501 1126 663 3537 186 48 --11640
NM_001024680chr281827 1660 1638 1392 1343 1268 1192 205 --2522 354 11601
NM_001024855chr361595 1227 583 554 506 260 31564 1538 383 ----
NM_001024858chr1492986 2905 2351 2123 1876 931 817 800 45 23013 1029 12807 11922
NM_001024948chr183366 2989 2530 903 854 656 381 90 22361 717 ----
NM_001024956chr11115689 5348 5293 4699 4602 4393 3909 3653 3627 3599 746 24484 1100 54374 4286 1325 1189 126 13881
NM_001025076chr1095944 5456 4996 4822 4108 3936 1997 1405 604 14438 15686 --
NM_001025077chr10127302 6814 6354 6180 5466 5294 4691 4682 2763 1962 1150 822 25796 4658 37044 517 401 --
NM_001025079chr394191 4027 3638 3481 3228 2929 723 408 139 23862 3804 ----
NM_001025108chr2103955 3885 3498 3491 2737 1407 572 378 181 78 ------
NM_001025233chr1252300 994 679 540 484 32341 733 273 --1376
NM_001025252chr863072 3044 2327 2309 1074 650 11036 22957 900 --
NM_001025253chr863072 3044 2327 2309 1074 650 11036 22957 900 --
NM_001025266chr394803 4342 4049 3995 3272 1933 1908 1047 809 12979 14430 --
NM_001025580chrX104333 4308 4090 3705 3653 3439 3385 1607 795 56 33432 768 756 24154 697 11556
NM_001025595chr451551 1535 1080 1055 233 151 2621 462 --
NM_001029858chr663237 2899 2276 1011 932 864 33290 2138 2095 1369 12497
NM_001029863chr673199 3159 3131 3069 2502 965 130 42536 2295 404 326 12514 --
NM_001029875chr5112967 2947 2912 2879 826 615 428 265 209 77 45 1796 11074 --
NM_001030055chr1473831 3509 3297 1890 1546 1253 174 31529 1168 949 ----
NM_001031623chr641721 1290 514 89 --183 --
NM_001031679chr12102841 2479 2453 2249 777 402 243 230 150 96 159 2755 374 --
NM_001031685chr12688 376 --1332 1596
NM_001031690chr782645 2227 2143 1211 208 186 113 91 ----12268
NM_001031695chr2285241 4228 4102 4029 3842 1202 934 840 12056 21926 390 1746
NM_001031700chr461842 598 564 363 337 197 165 1669 --
NM_001031804chr16124390 4355 4284 4156 4144 3296 3160 2959 2946 2829 1381 413 23924 1748 --13223
NM_001031812chr562109 1645 919 908 898 66 12232 21871 568 --
NM_001032394chr622483 724 --12726 1156
NM_001032395chr632350 1090 591 --12593 123
NM_001032999chr20115165 4420 4402 3583 2068 2036 1975 1228 927 302 75 65322 5138 4570 4502 3740 2015 23647 1744 24723 3593
NM_001033025chr141544 441 397 341 2957 173 --11442
NM_001033045chr2123707 3620 3505 3367 3160 2815 1296 1274 1184 898 451 429 33285 1443 222 34315 3923 3138 --
NM_001033047chr472394 1061 947 900 881 369 225 --11975 --
NM_001033059chr632028 1960 281 ----21618 498
NM_001033117chr3144529 4120 3825 3732 3337 1876 1578 1167 1067 803 778 764 507 312 14728 23850 3788 --
NM_001033507chr171911 1849 1842 1832 1620 1476 285 ------
NM_001033578chr8102428 1831 1625 1536 866 477 423 274 126 57 --42056 678 457 22 --
NM_001033925chr1042023 716 559 124 1233 1566 --
NM_001034841chr16114997 4252 3764 3430 2221 2199 1935 1198 866 241 217 --43405 1703 746 79 25355 897
NM_001034850chr531580 1292 1255 1301 --11132
NM_001035260chr1031585 1244 1100 11615 11260 21423 1235
NM_001035511chr162094 1797 1459 668 628 52 12027 --2706 680
NM_001035512chr162201 1904 1566 775 735 159 12134 --2813 787
NM_001035513chr162201 1904 1566 775 735 159 12134 --2813 787
NM_001037131chr26893 522 498 465 239 156 1951 2906 814 --
NM_001037164chr751611 1482 1385 1342 360 --11805 1243
NM_001037174chr252248 1496 726 383 137 12199 ----
NM_001037317chr172396 2348 2230 2124 1921 1127 337 1132 --11101
NM_001037332chr5112594 2585 2483 2364 1722 1630 1612 952 828 594 59 --11668 --
NM_001037333chr5112594 2585 2483 2364 1722 1630 1612 952 828 594 59 --11668 --
NM_001037553chr2155148 5102 4316 1812 405 85198 5142 3593 3320 1726 1541 1433 61 64994 4809 1734 1464 1036 95 11745
NM_001037954chr11103521 3514 2743 2577 1370 913 544 204 77 32 2484 273 22542 1045 --
NM_001038493chr221198 62 --1417 21459 1029
NM_001039199chr20164789 4764 4322 4015 3763 3734 3568 3240 1675 1361 1338 670 617 509 475 377 24447 4052 34300 3546 1052 --
NM_001039538chr263248 3229 2675 2395 1448 96 23497 430 --32906 1270 1207
NM_001039547chr3218082 7478 7353 7069 6909 6147 6004 5883 5864 5583 5561 5441 5000 4933 2533 2156 1896 1710 509 188 24 37095 2458 676 37456 7249 5419 --
NM_001039570chr22134337 3941 3709 3123 3056 2991 2925 2880 1455 1184 864 424 130 --33651 1433 842 --
NM_001039571chr22134337 3941 3709 3123 3056 2991 2925 2880 1455 1184 864 424 130 --33651 1433 842 --
NM_001039580chr4103740 3728 3344 3193 1732 1411 1299 809 462 67 34110 1213 1005 1348 --
NM_001039585chr184161 3748 3529 2956 2873 1643 662 23 11094 1245 13904
NM_001039590chrX83100 3039 1344 1282 320 284 98 89 33982 1358 425 11219 --
NM_001039591chrX83100 3039 1344 1282 320 284 98 89 33982 1358 425 11219 --
NM_001039618chr1195950 5929 2198 2043 1941 1685 1636 596 413 35169 4418 1856 25463 4339 --
NM_001039693chr2113675 3218 3066 2899 2624 2546 1328 1244 707 340 271 13239 33182 2877 2715 --
NM_001039709chr20115165 4420 4402 3583 2068 2036 1975 1228 927 302 75 65322 5138 4570 4502 3740 2015 23647 1744 24723 3593
NM_001039840chrX166007 5780 5117 4907 4159 4037 2210 2076 2004 1805 1580 1551 1046 901 697 271 15865 25200 832 --
NM_001039916chr1231124 1085 781 11191 11132 --
NM_001039917chr1231124 1085 781 11191 11132 --
NM_001039918chr1231124 1085 781 11191 11132 --
NM_001039919chr1231124 1085 781 11191 11132 --
NM_001039920chr1231124 1085 781 11191 11132 --
NM_001039937chr13103924 3594 3422 3274 3018 2592 1491 1356 1127 408 2311 234 --14037
NM_001040020chr741461 535 207 199 11303 ----
NM_001040108chr1452981 2118 1078 704 596 --12927 22516 1227
NM_001040110chr731595 393 204 1237 --1420
NM_001040142chr262177 2026 1851 960 593 155 12194 --1280
NM_001040143chr262177 2026 1851 960 593 155 12194 --1280
NM_001040152chr783992 3260 3227 1906 1724 1634 793 269 34066 3912 881 14470 24815 1666
NM_001040202chr452489 1786 514 475 192 --1274 1687
NM_001040214chr652074 1812 1708 1574 613 11474 11921 --
NM_001040272chr942113 1839 1709 883 11980 21693 526 --
NM_001040284chr16195796 5748 5539 5351 5295 5185 5029 4929 4468 4145 4117 3598 1814 1672 1452 1181 1165 1029 515 31728 1664 1280 55551 4823 4581 4062 1943 --
NM_001040402chr442240 2078 668 618 1379 11083 12993
NM_001040429chr13103594 3489 3192 3166 2949 2931 2862 2370 1438 1405 1104 12585 13458
NM_001040441chr1185386 5112 4826 4558 4416 4114 3999 3920 3863 3542 3408 3377 1902 1736 1515 1078 1048 881 23678 1355 75089 4536 3521 1714 859 583 438 1701
NM_001040446chr562611 1085 1074 591 506 192 --32498 2383 1780 --
NM_001040450chr1582385 2177 1915 1165 1137 387 271 51 32440 951 75 42728 1115 454 25 --
NM_001040453chr1582385 2177 1915 1165 1137 387 271 51 32440 951 75 42728 1115 454 25 --
NM_001040458chr551878 1806 1561 1392 69 21675 1234 11651 --
NM_001040624chr8102714 2688 2524 2179 2115 1992 1830 1774 693 331 31805 1795 765 11672 --
NM_001040625chr8102714 2688 2524 2179 2115 1992 1830 1774 693 331 31805 1795 765 11672 --
NM_001040626chr8102714 2688 2524 2179 2115 1992 1830 1774 693 331 31805 1795 765 11672 --
NM_001040627chr8102714 2688 2524 2179 2115 1992 1830 1774 693 331 31805 1795 765 11672 --
NM_001040628chr8102714 2688 2524 2179 2115 1992 1830 1774 693 331 31805 1795 765 11672 --
NM_001040629chr8102714 2688 2524 2179 2115 1992 1830 1774 693 331 31805 1795 765 11672 --
NM_001040630chr8102714 2688 2524 2179 2115 1992 1830 1774 693 331 31805 1795 765 11672 --
NM_001040665chr7114610 4527 4192 3937 3916 3708 3310 3110 1345 338 108 --14557 --
NM_001040708chr85896 750 421 309 212 1263 ----
NM_001040712chr963563 3084 2748 2305 699 303 32884 1428 275 1290 --
NM_001040876chr471784 1703 1196 424 405 144 27 21796 626 ----
NM_001042355chr16105285 5133 4804 4483 3807 3759 3570 1116 1097 29 --21740 391 12051
NM_001042361chr1051075 1049 1033 1020 975 21423 634 ----
NM_001042364chr1051075 1049 1033 1020 975 21423 634 ----
NM_001042365chr1051075 1049 1033 1020 975 21423 634 ----
NM_001042387chr1051075 1049 1033 1020 975 21423 634 ----
NM_001042393chr1051075 1049 1033 1020 975 21423 634 ----
NM_001042396chr1051075 1049 1033 1020 975 21423 634 ----
NM_001042397chr1051075 1049 1033 1020 975 21423 634 ----
NM_001042404chr151529 428 317 180 25 1341 ----
NM_001042412chr16105285 5133 4804 4483 3807 3759 3570 1116 1097 29 --21740 391 12051
NM_001042413chr9113505 3489 2896 2843 2784 2676 2664 845 508 469 451 23140 1012 1694 --
NM_001042424chr472688 2558 2202 965 887 486 387 12314 12594 --
NM_001042437chr24914 874 792 219 --2670 651 --
NM_001042481chr1452619 2197 762 602 538 21878 557 ----
NM_001042492chr17143419 3411 2158 1400 1148 1142 751 711 568 530 352 292 277 163 42510 2260 836 29 12612 --
NM_001042494chr1583053 2709 1350 1292 1200 1178 242 99 21323 484 11440 --
NM_001042495chr1583053 2709 1350 1292 1200 1178 242 99 21323 484 11440 --
NM_001042496chr1583053 2709 1350 1292 1200 1178 242 99 21323 484 11440 --
NM_001042497chr1583053 2709 1350 1292 1200 1178 242 99 21323 484 11440 --
NM_001042510chr851691 1681 1624 461 214 22204 1927 ----
NM_001042511chr851691 1681 1624 461 214 22204 1927 ----
NM_001042533chr32220 125 13107 --22701 974
NM_001042537chrX62532 2187 1934 446 415 173 1686 --11987
NM_001042543chr491560 1499 1307 1153 1006 427 377 336 264 21574 407 ----
NM_001042599chr2127115 6362 6281 5811 5697 5571 4950 1723 1613 1243 981 301 22319 1229 36780 454 204 1951
NM_001042601chr382834 2291 2282 2014 1023 910 182 48 12561 22423 2105 --
NM_001042603chr1285299 4739 4479 3258 1467 946 678 51 --23608 1526 --
NM_001042604chr333861 1314 723 43633 3180 1371 249 23731 1257 14249
NM_001042632chr2072563 2068 2057 1770 1626 808 78 11794 1159 12106
NM_001042633chr2072563 2068 2057 1770 1626 808 78 11794 1159 12106
NM_001042646chr361809 1534 335 198 167 35 21982 136 32037 1851 370 --
NM_001042681chr192598 2368 2324 2308 1797 577 490 227 33 12671 21730 1644 --
NM_001042682chr192598 2368 2324 2308 1797 577 490 227 33 12671 21730 1644 --
NM_001042682chr192598 2368 2324 2308 1797 577 490 227 33 12671 21730 1644 --
NM_001043351chr151881 930 841 530 498 --12230 1689
NM_001044385chr293697 3532 2894 1034 958 876 733 457 320 13414 21356 234 --
NM_001044387chr19123832 3505 3108 1408 1359 1167 1138 978 896 792 401 344 13940 33601 583 559 --
NM_001044388chr19123832 3505 3108 1408 1359 1167 1138 978 896 792 401 344 13940 33601 583 559 --
NM_001044722chr562109 1645 919 908 898 66 12232 21871 568 --
NM_001044723chr562109 1645 919 908 898 66 12232 21871 568 --
NM_001046chr53772 718 64 ----22765 2360
NM_001048183chr193657 2345 1495 1248 830 808 457 390 276 --12323 12301
NM_001071775chr1371944 1664 677 634 355 154 139 21316 664 --11886
NM_001099678chr376288 5353 5288 4840 4416 3957 86 31115 1085 573 33968 2544 1598 --
NM_001100108chr1176928 6500 6156 5770 5514 5252 3222 2186 1997 1928 1700 1367 1028 775 542 241 180 --57592 7553 7463 6134 5492 16097
NM_001106chr3148367 8034 7436 7353 7023 5902 3496 1451 913 428 399 378 278 79 49688 9143 7947 91 --28815 7130
NM_001113490chrX103463 3123 3041 2996 2916 2860 2637 1362 1112 790 1889 11475 --
NM_001121chr1041923 1609 1265 610 11403 11235 --
NM_001146chr882165 2024 629 555 288 263 67 42 ------
NM_001149chr1051383 1338 1131 373 169 11217 2275 216 --
NM_001160chr1262756 2321 2241 2183 411 67 11924 ----
NM_001167chrX106117 5887 5052 4489 4320 4123 2634 1613 1101 954 36691 5199 5097 36095 4101 227 15959
NM_001173chr1473831 3509 3297 1890 1546 1253 174 31529 1168 949 ----
NM_001174chrX61893 1659 1456 782 439 25 12018 11621 --
NM_001186chr2193137 3038 3011 2999 1173 1080 921 573 25 --13170 --
NM_001198chr662364 2018 1716 1578 943 166 22136 2112 ----
NM_001201chr483884 3603 3504 2700 2627 1118 917 818 ------
NM_001204chr2157623 7571 7511 6139 6092 5978 5807 5618 5524 5123 4925 4808 3037 1702 1216 --26199 1441 --
NM_001206chr942902 2600 2568 535 33088 2010 1005 22494 918 --
NM_001219chr752035 1919 1784 175 130 42245 2141 777 719 21497 871 --
NM_001237chr451178 1126 1051 1035 38 ------
NM_001237chr451178 1126 1051 1035 38 ------
NM_001259chr766076 6064 5634 4328 1923 992 36032 4605 4166 24490 154 1178
NM_001271chr1582927 2812 2709 2471 2289 1064 600 86 22938 2051 11991 --
NM_001304chr1783791 3579 3296 1431 1221 1065 967 876 22842 295 ----
NM_001310chr1242529 2369 708 525 --12896 2434 35
NM_001329chr1041543 456 387 263 21437 1365 1143 --
NM_001331chr1172691 2406 915 613 361 267 236 32472 2005 998 12543 --
NM_001346chr3102760 2607 2272 2168 1980 856 794 664 326 140 2884 28 32257 976 47 --
NM_001351chr32182 97 1704 --1240
NM_001356chrX52342 2069 1864 1742 665 1418 149 --
NM_001364chr1154185 3862 3797 1728 1509 24645 3915 34201 3721 155 --
NM_001387chr582865 2676 2310 2265 2172 1253 1225 829 21162 939 --155
NM_001390chr18103601 3564 3357 2903 2515 2495 2281 2241 936 868 23339 698 22587 152 1632
NM_001396chr2152394 2131 2101 2076 1886 22374 2357 12783 --
NM_001397chr192551 2499 2196 779 566 479 380 139 54 --62422 2221 1915 1835 635 348 --
NM_001402chr651972 371 297 272 218 1592 ----
NM_001412chrX73746 2924 2429 2405 1268 270 238 12354 33735 1229 327 --
NM_001419chr19124597 4532 4024 3663 3225 1386 1184 696 373 246 179 57 31902 1896 196 --11310
NM_001423chr1291892 1699 1450 813 704 676 629 144 46 3744 619 92 1439 --
NM_001438chr163442 3019 2504 2347 634 76 32925 675 106 1577 --
NM_001439chr141544 441 397 341 2957 173 --11442
NM_001453chr661465 1230 629 590 343 56 --11351 179
NM_001460chr193107 2844 2832 2745 2707 2693 2547 2482 684 23350 369 22899 78 1984
NM_001465chr561537 781 342 290 127 103 --1811 --
NM_001490chr9123732 3577 3420 2858 2697 2675 2592 2464 1479 987 680 370 1889 23358 2602 13748
NM_001497chr972658 2004 1899 1779 1079 996 25 22251 2156 12106 --
NM_001527chr694530 3525 1946 1506 1063 1055 750 691 31 13547 12998 --
NM_001542chr192881 2835 2779 2634 2530 2260 873 793 675 --22357 611 12352
NM_001560chrX101895 961 927 636 618 596 475 242 227 90 1169 2894 97 --
NM_001609chr10103978 3942 3771 3719 3082 2814 2760 1712 1548 126 34481 1766 973 11415 13368
NM_001616chr273034 2516 2230 1281 234 212 66 2389 277 ----
NM_001621chr762916 2695 2518 2455 2077 431 22706 140 22055 1161 1304
NM_001621chr762916 2695 2518 2455 2077 431 22706 140 22055 1161 1304
NM_001634chr632028 1960 281 ----21618 498
NM_001650chr18123922 3615 3232 3172 3087 1469 1365 1278 772 688 676 179 13397 23180 2599 --
NM_001656chr53495 382 223 --12026 11871
NM_001663chr1442191 2184 1016 602 22703 1713 --140
NM_001668chr132242 1663 41 --12078 11640
NM_001682chr1292480 2039 1814 1139 1057 953 940 587 54 32795 2708 931 ----
NM_001684chr183555 3528 3215 1672 1191 1126 1069 1015 --14111 14185
NM_001689chr23532 507 459 21600 681 21920 1539 --
NM_001690chr332124 1002 555 --22211 575 --
NM_001695chr8114182 4104 4039 3780 3638 3502 3371 3197 3157 1197 233 11669 24048 3953 23610 3402
NM_001701chr931392 215 203 1341 ----
NM_001742chr761348 1248 502 361 92 58 11153 ----
NM_001746chr541941 1874 661 577 21163 261 22599 2401 --
NM_001754chr2193907 3073 3051 2693 2633 1490 1431 323 190 23822 2643 --11301
NM_001759chr1294865 4259 3915 3673 3606 1552 954 523 94 64372 4276 3689 2009 1204 901 14653 1816
NM_001777chr394191 4027 3638 3481 3228 2929 723 408 139 23862 3804 ----
NM_001830chrX53688 3477 3232 327 148 23168 626 22592 664 --
NM_001855chr94654 341 234 65 --1672 --
NM_001859chr963667 3565 2635 1064 782 615 12533 53645 2491 1549 593 245 --
NM_001874chr12153912 3777 3684 3410 3397 3347 3317 3167 1892 1386 1364 1205 515 493 106 --23965 3662 24305 3513
NM_001918chr1178245 8017 6807 3700 3584 3349 3006 2488 2461 2062 1718 1477 1462 1329 667 399 271 58466 8104 3450 1928 1920 68938 8232 2439 1696 1563 377 13416
NM_001935chr24783 646 240 118 1112 ----
NM_001942chr1861861 1643 1311 1258 643 522 21755 68 1129 --
NM_001957chr452333 2047 389 143 55 1881 1284 12281
NM_001987chr12134132 3817 3700 3515 2859 1623 1520 1037 1013 898 824 177 44 23481 147 13956 --
NM_001992chr562123 2016 1795 1475 1402 853 1710 11773 --
NM_001995chr431134 568 198 21471 1114 --11504
NM_002006chr4115479 5266 4594 4182 4011 2012 1483 1271 992 881 345 65204 4356 4217 3974 2000 858 1328 14246
NM_002009chr1571787 791 557 459 211 121 24 22208 2050 ----
NM_002015chr1383260 2376 2271 2224 2094 1186 997 821 33036 2785 583 22830 866 --
NM_002025chrX219085 8998 8875 8713 8220 7781 7652 7629 7599 7128 6496 6026 5811 5679 3523 2219 2186 2173 2140 1962 1656 79020 5926 5899 5863 3586 3246 551 43285 2235 1830 1356 --
NM_002033chr11103885 3743 3686 3667 3432 915 852 757 642 313 34109 1575 712 1948 11327
NM_002035chr1893459 3229 3077 1523 1280 1250 987 627 383 12724 23207 213 12752
NM_002040chr2163218 2286 2126 936 735 431 3691 651 536 ----
NM_002061chr161804 1782 1698 1543 546 211 31562 650 291 11307 --
NM_002062chr651557 1358 1350 1316 385 1343 21180 304 11018
NM_002074chr141603 531 373 39 1210 1662 1165
NM_002077chr971769 852 821 740 730 641 546 21471 1315 1324 --
NM_002086chr1742191 2147 1382 735 11763 11443 2714 357
NM_002126chr1783378 3366 3222 3007 2689 2557 1532 1142 21390 76 ----
NM_002128chr1322551 1734 12353 22234 1900 --
NM_002158chr293689 3200 3135 3074 3032 2773 2542 395 60 33465 3293 1319 ----
NM_002182chr382791 2632 2563 2451 2081 1911 804 636 --12043 11720
NM_002193chr261492 1419 1373 663 636 185 11853 --11579
NM_002202chr51852 1683 --11049
NM_002203chr5104156 3744 2744 1567 982 944 784 604 572 28 33396 3390 116 23258 1299 --
NM_002223chr1273799 3470 3453 1520 1140 923 880 31528 1494 774 1807 --
NM_002232chr151363 1123 1030 916 91 11286 --1325
NM_002242chr251955 1944 1545 689 509 41910 1611 1250 342 11605 1214
NM_002264chr3104839 4457 3466 3099 1925 1785 1627 848 605 36 23276 876 24506 3565 --
NM_002267chr1352002 1933 604 560 135 22177 506 1651 12296
NM_002268chr361858 1841 1610 1264 653 524 21720 1339 ----
NM_002270chr575251 4860 3563 1898 416 355 115 33711 750 546 11843 14329
NM_002271chr1382437 2304 2033 1705 454 437 212 191 131 --1285
NM_002285chr2103955 3885 3498 3491 2737 1407 572 378 181 78 ------
NM_002310chr5136513 6250 6198 6097 5772 5565 4154 1735 1585 1567 820 802 675 64958 1338 1114 470 243 177 1983 --
NM_002313chr1094943 4432 4254 3803 3322 3233 1581 714 100 24424 899 44690 2040 1512 1390 --
NM_002336chr1243295 1537 423 107 44411 3968 1717 267 11080 --
NM_002359chr1763855 3752 3029 1482 887 843 21050 616 13479 13450
NM_002374chr263248 3229 2675 2395 1448 96 23497 430 --32906 1270 1207
NM_002397chr562191 2178 2137 1772 1393 862 2825 764 1561 12131
NM_002398chr241517 1024 367 280 ----21398 1003
NM_002451chr973650 3613 3159 2685 1418 778 499 --11396 --
NM_002486chr951754 903 888 656 619 22141 417 21732 844 --
NM_002499chr1542483 1928 878 196 1436 32003 1735 1514 12261
NM_002500chr241133 502 353 317 1873 ----
NM_002519chr112138 119 2310 233 21380 950 1528
NM_002545chr1174142 3972 3205 1529 1380 668 78 35057 3993 1088 14276 13148
NM_002556chr1152152 1868 1326 201 195 1137 21719 699 --
NM_002577chr363548 3538 3210 1458 738 49 --22999 2621 1833
NM_002581chr9125141 4810 4533 3972 2184 2162 1663 1532 1109 1080 482 408 75297 4082 4053 3598 1732 493 175 11906 21888 1363
NM_002610chr292474 1034 870 703 628 514 284 135 112 --2926 306 --
NM_002613chr16155233 4708 4264 4100 3885 3514 3465 2130 1143 1042 766 360 188 123 84 --1886 --
NM_002641chrX92033 1583 1530 1496 737 466 261 228 187 ------
NM_002645chr1162910 2700 2458 2235 2047 1055 13033 1213 --
NM_002655chr885050 4386 3662 3451 1727 1282 267 132 --2174 149 15004
NM_002698chr1963017 2623 2499 1884 688 610 93031 2387 2123 603 594 569 558 490 426 32422 529 511 1470
NM_002709chr283407 3365 3302 2580 2255 315 297 78 33130 3003 2926 22463 25 --
NM_002715chr551276 980 946 196 36 21052 795 1237 11265
NM_002716chr1193621 3365 2476 1185 1081 822 626 496 204 13669 22820 137 --
NM_002718chr332005 575 386 32708 2548 1776 11733 --
NM_002719chr1482229 1727 1690 1576 1537 920 905 636 1381 --12070
NM_002731chr152546 2412 2003 223 73 2952 746 ----
NM_002734chr1741957 1944 1664 517 --12080 1714
NM_002737chr1786427 5720 5711 4090 4035 2323 1168 774 16264 1753 21936 443
NM_002740chr371982 1946 1108 1020 930 696 385 21058 869 ----
NM_002745chr2263881 3566 3467 3093 3049 2792 13235 ----
NM_002760chrY205854 5467 4845 4815 4705 4612 4449 3960 3746 3688 2275 1757 1429 1027 965 694 259 170 113 61 14764 65937 4949 4825 3938 2075 1005 --
NM_002814chrX--162 --1747
NM_002822chr1251682 1477 1152 596 422 21666 1651 171 --
NM_002834chr12114108 3598 3514 3405 3282 3255 2977 1531 1402 548 172 43565 2939 2901 1359 31516 235 161 13004
NM_002839chr963563 3084 2748 2305 699 303 32884 1428 275 1290 --
NM_002852chr32609 38 ----2129 27
NM_002874chr992387 2346 1673 1564 647 585 538 322 236 --11651 --
NM_002886chr3114723 4388 4255 4113 3800 1681 1664 1491 1125 532 502 143 196 --
NM_002892chr1441323 1113 587 327 --11551 --
NM_002897chr21152 1659 --1143
NM_002938chr462023 1961 1874 756 578 415 32037 570 482 --1107
NM_002940chr471784 1703 1196 424 405 144 27 21796 626 ----
NM_002941chr371582 1446 1225 555 499 234 39 31478 1432 1156 --1533
NM_002959chr184313 3183 2901 2802 995 942 595 178 33845 3538 136 42894 1048 588 40 11174
NM_002977chr241100 982 280 272 1575 --1405
NM_002997chr241915 1792 1361 674 21785 684 --1697
NM_003001chr162201 1904 1566 775 735 159 12134 --2813 787
NM_003031chr166967 882 844 667 395 203 --1684 --
NM_003034chr12137848 7760 7628 6638 5899 4966 2570 2069 1861 1609 1016 925 29 27817 2818 37774 2634 2507 1331
NM_003042chr391866 1787 1684 1564 1557 830 500 376 322 ----21795 904
NM_003045chr1384931 4842 1579 1395 1277 741 537 454 15006 2354 97 11069
NM_003051chr132015 1746 330 --2787 120 1686
NM_003068chr841096 925 797 352 ----2978 54
NM_003071chr341931 732 481 180 42076 1601 1492 501 --1518
NM_003099chr15115969 5680 5425 5338 5281 5066 4547 4343 2043 936 386 26587 5039 24525 4242 26273 6205
NM_003100chr53301 93 80 --170 --
NM_003108chr2157124 6801 6730 6088 5856 5632 5209 5161 4429 2686 2476 1594 1575 1455 1360 --24801 4639 --
NM_003144chr651810 1642 669 461 209 1905 31704 703 83 12024
NM_003150chr1782418 2012 1761 899 692 670 584 239 11811 196 --
NM_003155chr892791 2511 2306 2179 2054 1848 707 394 34 2996 753 42045 1713 291 145 11123
NM_003161chr17103452 3287 2850 2805 2676 2258 829 616 471 288 1163 ----
NM_003165chr951819 1640 1558 68 47 --11933 11245
NM_003199chr1865103 4725 4180 1271 542 449 43986 3452 2203 1606 143 12277
NM_003236chr263007 2918 1203 574 528 468 13092 42158 857 798 209 22718 2265
NM_003262chr394469 3827 1202 1039 817 597 518 368 195 44068 3854 2013 537 ----
NM_003270chrX41189 284 167 122 1115 ----
NM_003274chr2142960 2056 698 641 11110 22617 2254 12006
NM_003275chr981164 1065 1053 1028 251 242 236 101 11210 2563 73 --
NM_003298chr335736 5329 2075 34733 4417 3889 26025 5144 --
NM_003320chr1164275 3965 1108 957 946 715 23778 3157 43220 1393 1377 1278 --
NM_003338chr1031981 1589 1412 --2319 107 --
NM_003339chr551539 1522 1434 236 174 ----11165
NM_003342chr1762621 2399 2297 2201 2012 1245 13272 ----
NM_003369chr1152754 2726 2459 2414 236 ------
NM_003373chr1091902 1738 1453 1447 1428 731 421 101 32 --1672 --
NM_003387chr292590 2389 2358 1082 1036 814 462 425 418 --12428 12642
NM_003392chr394375 4363 4273 3721 3667 3182 3106 1011 413 23231 2633 1123 33041 2735 209
NM_003410chrX53013 2950 1248 522 336 32330 2190 65 --12129
NM_003421chr10134078 3876 3393 1418 1396 1372 1170 966 494 466 382 291 45 33840 847 197 43808 3524 3205 545 --
NM_003423chr1961679 817 660 531 269 214 12543 ----
NM_003439chr773249 2888 2546 2169 734 551 23 1580 12325 --
NM_003441chr481152 990 860 424 344 329 176 91 --11072 --
NM_003463chr643316 2166 2092 266 --12413 --
NM_003474chr1071804 1726 909 874 851 679 580 42411 2230 1880 1694 --12334
NM_003478chr1152219 1063 930 444 228 ------
NM_003483chr1272395 2184 2176 1869 956 787 640 21855 353 2860 161 12168
NM_003489chr2183384 3035 1244 1152 1099 961 946 108 22253 40 1195 --
NM_003566chr1242886 2749 2481 938 2677 115 --12207
NM_003583chr1253277 3149 2899 714 212 23196 3120 22957 1058 --
NM_003590chr273827 2789 1308 1064 592 125 70 13437 ----
NM_003603chr452004 1379 766 274 139 12172 --11720
NM_003615chr363988 3230 3106 2944 1401 564 33484 1433 797 11451 12767
NM_003617chr1124445 4323 3992 3791 3611 3404 3364 1983 1900 1775 1689 865 64272 3503 3207 1356 721 630 24438 24 --
NM_003629chr143355 1183 940 339 43309 2133 680 545 33093 1311 352 32626 2221 656
NM_003630chr64771 193 63 21 1287 --1147
NM_003644chr17166448 5882 5810 5477 5430 5318 2560 2410 2268 2214 1910 1793 1464 874 420 340 35661 1943 1681 15405 11579
NM_003663chr3103100 3013 2927 1245 1208 731 525 239 153 98 21403 673 12288 --
NM_003671chr993102 3014 2395 1312 1239 807 698 625 594 13437 12318 --
NM_003679chr193219 2697 2540 1232 1143 1069 811 466 380 13386 12613 --
NM_003701chr134879 417 281 245 164 --1824
NM_003714chr5102109 1958 1087 1075 951 833 803 320 170 24 32912 2842 1183 ----
NM_003722chr331836 1825 203 22766 943 12344 12704
NM_003759chr483897 3615 3550 2767 2626 1412 1120 1052 12686 2709 134 --
NM_003762chr151319 1030 912 386 74 --1261 1116
NM_003763chr2083172 2461 2180 2067 922 828 759 416 33153 737 513 22158 614 --
NM_003800chr622434 363 11480 --1294
NM_003848chr36891 755 685 679 389 35 ----1321
NM_003861chr1462863 2702 2480 1019 587 473 --32492 2265 110 12295
NM_003873chr1082528 2494 2443 2281 1659 409 348 338 ----1252
NM_003884chr341676 361 343 29 11192 11497 --
NM_003885chr1782451 2275 2198 2003 1841 1041 95 63 ----1892
NM_003896chr24914 874 792 219 --2670 651 --
NM_003908chr2021289 401 --1349 2946 361
NM_003913chr664342 3901 3074 2937 1346 544 1788 ----
NM_003916chrX61299 486 475 379 358 315 ----1396
NM_003927chr1841089 1034 979 189 ------
NM_003929chr171784 1616 1304 1293 1244 557 157 --1297 1701
NM_003939chr1083453 3045 2812 2740 2717 1104 427 103 ----23885 3579
NM_003941chr772356 1795 1707 1007 879 870 565 ------
NM_003966chr5137404 6945 6503 6450 6348 6251 5747 3101 2599 2543 1919 562 123 46958 5510 5117 2778 17372 16312
NM_003994chr12153993 3703 3653 3641 3414 3084 2830 1278 1067 1036 1004 881 620 192 114 44127 3987 3523 1530 23453 2899 13204
NM_004006chrX42446 2252 1753 303 1407 2873 862 --
NM_004007chrX42446 2252 1753 303 1407 2873 862 --
NM_004009chrX42446 2252 1753 303 1407 2873 862 --
NM_004010chrX42446 2252 1753 303 1407 2873 862 --
NM_004011chrX42446 2252 1753 303 1407 2873 862 --
NM_004012chrX42446 2252 1753 303 1407 2873 862 --
NM_004013chrX42446 2252 1753 303 1407 2873 862 --
NM_004014chrX42446 2252 1753 303 1407 2873 862 --
NM_004015chrX42446 2252 1753 303 1407 2873 862 --
NM_004016chrX42360 2166 1667 217 1321 2787 776 11031
NM_004017chrX42446 2252 1753 303 1407 2873 862 --
NM_004018chrX42360 2166 1667 217 1321 2787 776 11031
NM_004020chrX42446 2252 1753 303 1407 2873 862 --
NM_004021chrX42360 2166 1667 217 1321 2787 776 11031
NM_004022chrX42360 2166 1667 217 1321 2787 776 11031
NM_004023chrX42360 2166 1667 217 1321 2787 776 11031
NM_004028chr18123922 3615 3232 3172 3087 1469 1365 1278 772 688 676 179 13397 23180 2599 --
NM_004035chr17175177 5170 4367 4107 3783 3776 1811 1106 991 941 905 807 716 582 492 213 203 14827 21789 1228 14123
NM_004050chr1492606 2301 2273 2137 1971 1959 1743 1682 937 ------
NM_004080chr75986 484 106 78 69 --11303 --
NM_004081chrY4371 248 195 185 ------
NM_004093chr1353218 2545 2412 2005 543 11216 1278 22489 313
NM_004094chr1462894 2380 2344 2276 2210 2175 32737 2678 2020 12669 --
NM_004100chr652672 2529 2341 814 190 22613 1026 1112 --
NM_004124chr1453253 1340 1157 416 182 53477 3190 2395 1285 933 2557 163 --
NM_004133chr871789 990 865 703 620 589 393 2725 267 --12626
NM_004136chr1573148 2785 2451 570 278 241 162 33169 2182 214 23086 415 11246
NM_004170chr951583 1449 1179 532 460 --11830 1208
NM_004171chr11209075 8728 7244 6671 6557 6228 6112 3817 3790 3763 3533 3410 3348 3201 3075 2658 2486 2302 1716 1130 49321 7650 3151 862 27536 1598 --
NM_004232chr1843738 3070 1203 380 12402 23356 3010 --
NM_004293chr943716 2859 1460 465 63554 3232 2662 2364 1278 790 ----
NM_004302chr12112900 2666 2660 2514 2094 2086 2060 2015 432 350 288 12741 32042 1934 1066 1884
NM_004338chr18117075 7062 6665 6020 5555 5532 2729 1328 1276 429 170 52785 1817 1551 760 114 17025 34885 4506 39
NM_004349chr831215 1068 321 1362 --152
NM_004370chr6112209 1901 1686 1657 1520 1361 798 638 440 313 106 31785 626 394 ----
NM_004380chr16132652 2612 2528 2235 2086 1991 1757 812 779 746 720 695 171 --11900 1607
NM_004384chr562109 1645 919 908 898 66 12232 21871 568 --
NM_004392chr1362687 2619 1808 339 203 21 2666 593 1433 --
NM_004397chr1173526 3455 3100 2901 1222 641 310 --1475 --
NM_004412chr1085909 4591 1727 1665 1462 1069 596 238 42403 945 499 292 35825 1745 1028 --
NM_004432chr961640 1589 738 689 65 38 12217 --12033
NM_004438chr282821 2364 2336 2301 1261 431 207 165 23289 2682 22663 2269 --
NM_004440chr661866 1812 1398 1285 422 350 ------
NM_004449chr2131373 432 130 --11072 2550 368
NM_004457chr251355 1343 1241 481 109 11433 ----
NM_004458chrX2865 693 2522 136 --1804
NM_004481chr142090 1787 825 414 11058 22618 439 199
NM_004491chr1974280 3181 2771 1440 984 841 748 24388 75 23349 734 --
NM_004496chr14176 41369 230 86 61 ----
NM_004501chr173883 3450 3198 2771 1438 1400 527 42743 2604 2573 602 43579 3428 2724 1426 --
NM_004504chr292567 2517 2288 2109 1891 1863 1127 770 428 1164 ----
NM_004523chr1041518 1180 1133 59 21419 1321 21043 192 11461
NM_004529chr941331 246 212 173 31383 291 141 11325 --
NM_004571chr21103474 3359 3149 2979 2793 2518 2197 564 428 328 11097 22329 2273 --
NM_004586chrX115345 5175 5103 4958 3862 1977 1924 1841 1826 1586 1355 25483 1892 11564 34078 2031 790
NM_004588chr11114068 3959 3603 3028 2773 1611 1589 1031 571 516 194 --22884 1529 12575
NM_004598chr592671 2409 2205 2104 2063 1192 1010 986 931 --1949 --
NM_004612chr974164 3757 3311 1649 1080 850 430 31837 966 495 11539 13880
NM_004622chr272273 2150 1950 852 804 797 508 12204 ----
NM_004631chr13956 519 344 ----11325
NM_004654chrY41305 1240 287 88 31319 877 108 ----
NM_004655chr1741138 976 334 316 2326 104 ----
NM_004660chrY31794 1675 661 1416 150 11990
NM_004663chr1531326 273 158 1344 --11186
NM_004685chr1352975 2865 2675 2618 701 ------
NM_004690chr63300 187 150 ----2695 544
NM_004703chr17102316 1991 1858 1737 1026 1006 707 592 579 198 1616 ----
NM_004726chrX115755 5287 5116 5089 5030 4905 4847 4077 1645 1638 287 12283 35076 1191 865 11318
NM_004734chr1383293 3074 2555 2253 2026 2009 1226 1102 --13136 --
NM_004736chr152162 1940 1454 705 637 1807 1403 --
NM_004745chr8166710 6337 6193 6154 5899 5673 5418 5399 5349 5341 4479 2656 2420 1866 324 268 36887 6269 5302 46403 6345 5985 5380 --
NM_004748chr1573845 2761 2637 2585 1027 576 208 33863 2922 499 23532 1193 13353
NM_004772chr541081 494 167 88 --1108 --
NM_004774chr1773110 2739 2649 2304 1006 68 45 22356 793 1181 --
NM_004775chr1842271 1679 974 30 21968 1823 2714 227 --
NM_004788chr1121935 1745 229 23 1245 12033
NM_004798chr2083399 3309 3256 2959 2787 731 621 519 23668 3649 --11423
NM_004824chr61520 21474 529 --11239
NM_004834chr263057 1375 1320 1090 940 723 1214 21166 1022 --
NM_004836chr22755 238 ----1899
NM_004859chr1783021 2997 2874 2064 2031 1217 1116 340 ------
NM_004863chr1494761 4575 4401 4230 3646 1619 1597 1352 1015 54470 3948 3396 2088 1384 2287 79 15151
NM_004866chr5154880 4801 4572 4553 4199 3927 3917 3320 1985 1775 1466 1443 1424 390 140 --14177 --
NM_004871chr17104429 3976 3611 3452 1741 1735 1031 360 330 317 1274 24072 168 34328 4199 4035
NM_004896chr1031500 1159 1015 11530 11175 21338 1150
NM_004904chr7176019 5695 5077 4901 4873 4609 4540 4153 2426 2143 1730 1704 1561 1299 1165 417 346 35641 5059 2076 15669 12420
NM_004924chr1931053 732 715 1700 ----
NM_004926chr1471610 1196 651 634 471 330 225 11849 1479 --
NM_004949chr1861537 1503 631 578 236 42 1272 ----
NM_004956chr7144632 4574 3644 2974 2861 1816 1569 1367 1326 1318 1220 938 781 755 34160 3990 2992 1316 --
NM_004976chr11115057 4879 4539 4465 4255 4200 3847 3214 818 673 167 1625 23954 3833 --
NM_004985chr12103927 3903 3754 3616 3069 3054 2820 2792 411 237 11173 23099 647 1988
NM_004992chrX158176 7921 7422 7372 6774 6652 6303 6065 5162 2355 2277 1169 1069 705 257 132 27334 2317 --
NM_004992chrX158176 7921 7422 7372 6774 6652 6303 6065 5162 2355 2277 1169 1069 705 257 132 27334 2317 --
NM_004996chr162534 217 31697 117 83 21452 619 1103
NM_004999chr664363 3932 3681 1259 1008 421 23237 3084 13910 --
NM_005011chr731595 393 204 1237 --1420
NM_005036chr22158362 7431 7049 6972 6441 6340 6142 5713 5282 3221 2881 2448 1085 791 693 46595 6434 1528 412 77729 7246 5972 2850 2776 2022 671 27318 2323
NM_005044chrX144410 4205 3367 3337 3131 2968 1799 1602 1267 1244 1063 896 562 76 13283 44494 3468 3347 874 --
NM_005056chr1295543 4983 4723 3502 1711 1190 922 295 214 --33852 1770 239 --
NM_005063chr1083639 3108 3015 1409 1352 1116 600 35 1159 ----
NM_005065chr1485329 4977 4014 1943 1728 1625 1160 528 34478 1217 1086 24998 812 --
NM_005079chr863072 3044 2327 2309 1074 650 11036 22957 900 --
NM_005093chr20115165 4420 4402 3583 2068 2036 1975 1228 927 302 75 65322 5138 4570 4502 3740 2015 23647 1744 24723 3593
NM_005095chr142167 1763 787 370 41531 722 693 555 12225 --
NM_005119chr15927 846 812 496 79 ----1333
NM_005121chr1773859 3347 2898 2747 1322 979 959 11003 ----
NM_005126chr352310 1821 890 400 298 2292 208 1699 --
NM_005135chr1583053 2709 1350 1292 1200 1178 242 99 21323 484 11440 --
NM_005156chr984756 4539 4430 1608 848 763 423 246 33749 142 82 --13265
NM_005160chr22136553 6508 6336 5990 5116 4187 4152 2673 2019 1720 1213 1205 1103 --36545 4340 187 --
NM_005164chr1222559 2250 --12489 21877 1046
NM_005188chr11127787 6884 6663 6265 6099 5993 5337 5170 3000 2349 1698 321 27178 6525 26560 5805 --
NM_005197chr14226125 5960 5930 5300 4158 3924 2256 2216 2145 2089 1911 1843 1293 1197 1047 1032 1001 785 638 570 505 322 75901 5802 4829 3892 2366 288 279 45219 3867 2120 216 25176 3882
NM_005233chr372457 2337 1810 821 789 471 410 42073 1942 1703 318 ----
NM_005235chr2127115 6362 6281 5811 5697 5571 4950 1723 1613 1243 981 301 22319 1229 36780 454 204 1951
NM_005238chr11123383 2795 2473 2440 2427 2378 554 386 316 183 36 25 11147 23130 2680 --
NM_005239chr21101978 1881 1729 1696 1655 1272 823 253 150 54 --11962 --
NM_005329chr1671927 1901 1607 943 753 617 525 32165 2075 314 11464 --
NM_005339chr484238 4050 3396 3299 2946 1552 489 261 --13815 --
NM_005359chr1884974 4821 2476 1744 1076 958 806 158 36570 1604 928 46394 6107 4410 1756 14785
NM_005397chr7133960 3945 3400 2920 2878 2722 1144 1018 766 462 319 256 169 147 12700 --
NM_005410chr54291 180 123 70 2728 87 ----
NM_005426chr12688 376 --1332 1596
NM_005433chr1852043 873 600 301 147 --1788 --
NM_005436chr1074127 2867 2685 2611 1503 1144 254 12758 11464 --
NM_005455chr141870 579 352 289 11393 1488 11273
NM_005487chr2262139 1917 1877 1719 1374 26 31705 1699 289 ----
NM_005497chr17135866 5787 5096 4978 4490 4326 2392 1607 1450 937 866 621 274 34212 4169 2124 45550 5080 4304 965 --
NM_005502chr993178 3142 2865 2783 892 707 429 277 264 32279 2164 398 1848 --
NM_005504chr1275811 4574 4504 4304 1931 799 248 22303 465 56426 5527 4920 1241 919 24232 4095
NM_005506chr482964 2355 2308 2259 950 198 67 27 ----22552 1953
NM_005578chr3114666 3694 3535 3193 1891 1729 1335 1041 979 405 83 34882 3229 1414 24060 1120 --
NM_005596chr995643 5421 1500 1040 701 616 286 241 219 36325 4445 1031 ----
NM_005602chr371312 1264 997 966 848 194 82 21125 109 ----
NM_005647chrX93406 3018 2566 2542 2418 1380 1362 482 207 32636 2125 380 11111 21391 122
NM_005665chr163548 3522 3506 1792 1460 332 14673 34604 3011 314 --
NM_005668chr5104383 3350 1724 1161 1039 574 440 393 357 138 13164 13479 1413
NM_005669chr541799 839 651 548 22101 1705 2907 571 11974
NM_005715chr642120 1838 1761 405 --22053 417 11038
NM_005725chr151576 830 567 343 254 1600 ----
NM_005737chr262620 2106 2032 1997 1965 743 1124 --1839
NM_005738chr751611 1482 1385 1342 360 --11805 1243
NM_005746chr762562 2322 2164 1698 1691 285 --11997 --
NM_005748chr1252968 2314 1028 983 820 13462 11217 --
NM_005756chrX21063 594 31528 1513 89 --2607 166
NM_005759chr284714 4653 4479 4147 3167 1704 1685 290 24445 920 --1477
NM_005779chr5183653 3417 3322 3231 3215 2892 2438 2409 2394 2295 2285 939 835 700 469 335 300 105 13573 13030 --
NM_005788chr114745 651 535 285 1498 ----
NM_005795chr253033 668 405 310 188 43055 964 868 360 12771 --
NM_005808chr3123599 3184 2607 2597 2247 2224 1420 1388 922 895 331 41 ------
NM_005819chr193121 3099 2974 2518 2450 2383 1187 430 236 ----13213
NM_005840chrX86063 5886 5744 5594 1555 1381 981 95 37418 5453 2287 37462 6603 1409 26620 1892
NM_005868chr74797 343 147 68 22484 1848 11728 --
NM_005880chr1621194 618 31354 1156 170 11039 --
NM_005898chr1152577 2557 2310 372 105 32010 657 407 21081 187 --
NM_005899chr1771401 1382 318 292 248 175 78 1169 ----
NM_005901chr18138711 7909 6737 6610 6455 6036 5348 3484 2110 2077 1427 1309 604 21999 541 38063 1602 710 17971
NM_005902chr1594336 4190 4038 3913 3201 1382 1056 1045 107 44273 3644 1557 966 ----
NM_005903chr5105185 4592 4205 3571 3419 3309 3276 1780 1399 59 25030 4368 21377 506 --
NM_005909chr543814 3507 2814 2647 22882 503 2266 65 --
NM_005935chr4144895 4439 4375 3379 1940 1830 1609 1397 1355 1115 1056 527 314 54 21450 1311 15338 1904
NM_005941chr863949 2963 2898 2660 1031 399 23418 3358 22842 1550 --
NM_005955chr185541 5367 4771 4628 4045 1791 114 100 11541 14119 1290
NM_005962chr1081872 1446 602 515 448 423 235 124 22327 932 12080 --
NM_005962chr1081872 1446 602 515 448 423 235 124 22327 932 12080 --
NM_006007chr9134259 4119 4068 2926 1524 1497 1481 1198 963 632 615 308 27 1641 23042 529 --
NM_006011chr15104131 4086 3904 3265 1731 1582 1442 1083 891 254 21402 779 44070 1646 981 309 23565 536
NM_006016chr632141 826 175 22283 167 --158
NM_006037chr293195 1859 1198 1178 652 531 458 146 64 14595 24321 4015 1265
NM_006047chr2043037 2807 839 739 --32500 846 250 13434
NM_006052chr2171867 1643 1525 1389 368 248 46 --12009 --
NM_006055chr242348 950 353 294 11090 23127 1200 2831 653
NM_006060chr764367 2825 1461 1270 1182 1008 13402 --34389 1228 935
NM_006080chr782966 2487 862 644 555 359 38 21 1899 --11931
NM_006095chr464294 4280 1455 1363 805 445 --24113 3041 --
NM_006106chr1163102 2617 1224 787 252 75 22783 462 --1520
NM_006108chr1152242 2091 1950 1876 912 --2778 440 2855 819
NM_006136chr751348 884 201 113 51 --1349 --
NM_006139chr242919 1132 922 496 32691 677 149 2399 23 12870
NM_006141chr1642754 2392 439 64 --22057 340 22235 333
NM_006154chr1562919 2830 484 369 242 124 11030 12454 --
NM_006158chr81622 --145 11491
NM_006164chr23144 122 110 1348 ----
NM_006166chr1222419 817 --12117 21036 936
NM_006194chr1461091 1030 923 342 326 289 3506 412 367 --11103
NM_006203chr5105503 5447 5269 5079 4923 3624 3596 3400 859 637 34740 3996 2069 --12041
NM_006206chr452319 622 505 458 63 12857 1425 --
NM_006212chr175235 4340 3927 3365 2040 1291 999 15143 34044 3343 1257 --
NM_006237chr1341868 1522 447 286 32169 631 467 11749 --
NM_006241chr342151 1983 1964 608 2410 403 ----
NM_006252chr1157523 6819 6219 5168 4965 4856 4786 2709 1281 1218 492 462 312 186 41 27592 5089 24943 971 1525
NM_006256chr152503 2391 932 503 312 1760 1916 123
NM_006258chr1041425 1049 1028 416 21183 1079 ----
NM_006265chr871220 1209 1189 1091 1020 396 181 11377 11108 --
NM_006281chr841175 1056 1043 748 1732 147 2741 40
NM_006281chr841175 1056 1043 748 1732 147 2741 40
NM_006283chr8104542 3995 3552 3075 1650 1191 1179 684 614 179 23837 1278 13702 --
NM_006287chr252646 2086 1701 845 292 1401 --12239
NM_006306chrX165860 5830 5679 5613 5554 5537 4943 4769 4559 4488 4187 2262 1178 1085 516 399 --75444 5411 5378 5312 3791 3581 2059 15279
NM_006310chr1771354 930 277 267 259 187 108 1417 1356 --
NM_006315chr494173 4049 3477 3343 3117 1718 1532 1105 744 23265 527 --11456
NM_006353chr641352 419 307 187 51285 1270 1134 385 69 --1326
NM_006359chrX62532 2187 1934 446 415 173 1686 --11987
NM_006371chr3105302 4723 4688 3721 3631 2013 1254 1014 677 126 24461 1918 11517 23575 1423
NM_006375chrX41864 1740 480 201 31776 1320 585 --11732
NM_006379chr752234 1589 644 291 76 42277 1815 1524 914 32321 925 897 --
NM_006380chr17104331 3215 3202 2938 2669 1263 1170 637 331 258 ----164
NM_006393chr1084374 4343 3146 1452 1265 1197 549 346 33503 1559 380 11074 --
NM_006403chr681837 1517 1454 1251 662 499 326 175 21781 1661 ----
NM_006407chr361252 541 531 347 242 197 1484 --1187
NM_006420chr2083336 3121 2876 2318 2296 2244 1015 836 --12607 13084
NM_006457chr453538 3083 1551 1241 629 43623 437 248 145 ----
NM_006460chr1771388 1206 1162 669 469 196 120 21686 1678 11427 --
NM_006464chr234395 4151 3367 32883 613 123 23345 1030 24684 3121
NM_006467chr581843 1787 1688 628 431 353 320 143 12329 ----
NM_006482chr1253277 3149 2899 714 212 23196 3120 22957 1058 --
NM_006504chr1072913 1997 1132 802 785 721 57 12112 22183 1181 --
NM_006524chr751042 797 713 293 125 ------
NM_006529chr481551 1490 1298 1144 418 368 327 255 31670 1565 398 ----
NM_006538chr283818 3114 2995 2755 1440 443 352 253 33247 2783 54 11395 12561
NM_006539chr16--1200 --3476 408 121
NM_006544chr14135446 5240 5028 4922 4896 4569 4330 4069 1810 1134 748 418 268 45900 5152 1686 723 14047 13978
NM_006546chr17166686 6647 6478 6253 5547 5314 5292 5264 5245 4551 4465 4435 1634 1120 162 49 15715 35303 4255 1391 --
NM_006548chr361676 1173 1086 652 212 105 31097 349 99 --169
NM_006549chr12102696 2267 2113 2035 1883 972 811 466 324 91 12203 2909 473 --
NM_006561chr1095944 5456 4996 4822 4108 3936 1997 1405 604 14438 15686 --
NM_006572chr1753320 3306 3018 2839 2710 23375 915 23486 934 --
NM_006595chr1171733 1620 805 785 241 218 32 11377 ----
NM_006599chr16127274 6825 6785 6285 6097 5408 5327 2813 2322 2061 1868 528 57101 6808 5253 2548 1129 16362 15839
NM_006609chr262756 2728 2458 1056 950 306 12806 22556 827 --
NM_006620chr654561 4370 3134 1378 619 23110 595 64650 4581 4156 3916 1667 1644 14201
NM_006624chr1041998 1763 1503 794 1788 --173
NM_006625chr11128 --1283 1216
NM_006625chr11128 --1283 1216
NM_006625chr11128 --1283 1216
NM_006628chr15113815 3241 3126 3089 3026 1114 1085 901 837 430 222 ------
NM_006629chr1872125 1911 1889 753 347 232 54 ------
NM_006699chr151060 978 835 715 221 2881 424 1122 1380
NM_006720chr1094943 4432 4254 3803 3322 3233 1581 714 100 24424 899 44690 2040 1512 1390 --
NM_006722chr351180 634 539 438 324 32523 855 651 --1365
NM_006729chrX65526 5400 5171 4478 4229 1861 21661 683 1509 14301
NM_006731chr9175318 5113 4996 4894 4713 4691 4073 3577 2306 2122 2068 1789 1519 765 685 288 213 --35091 4324 779 198
NM_006750chr16217765 7653 7274 6825 6782 6679 6529 6119 5838 5614 5600 5184 3024 2938 2704 2464 2423 1242 830 137 80 47904 6620 5658 4970 45816 1066 911 719 27138 1766
NM_006766chr852380 693 650 68 50 --22473 2031 --
NM_006777chrX92823 2559 2361 2202 2077 2051 881 665 188 1707 11142 --
NM_006832chr146767 312 265 254 135 24 ------
NM_006854chr75481 350 235 99 93 ----11974
NM_006868chr18102832 2751 2573 2310 2114 1037 1029 982 932 591 1661 62981 2075 780 571 516 36 12712
NM_006873chr2103573 3551 3211 2562 2282 1411 1175 898 692 253 2427 156 2492 58 13287
NM_006885chr1654122 3716 3528 3126 1258 21186 60 --24010 700
NM_006916chr271201 976 546 526 92 76 36 11317 ----
NM_006918chr11115689 5348 5293 4699 4602 4393 3909 3653 3627 3599 746 24484 1100 54374 4286 1325 1189 126 13881
NM_006922chr242146 1902 536 242 32514 1871 991 ----
NM_006924chr17114432 4423 4320 3927 3045 3039 1564 1467 1344 1266 1141 23977 1000 13732 --
NM_006954chr10123339 3106 3014 2479 2459 2422 2393 2229 1398 1022 492 235 23043 1062 ----
NM_006956chr7102183 1765 1703 1607 889 449 342 300 178 54 11636 2284 161 11884
NM_006974chr10123339 3106 3014 2479 2459 2422 2393 2229 1398 1022 492 235 23043 1062 ----
NM_006981chr962192 1001 563 497 174 78 12342 42850 2842 1890 800 --
NM_007006chr1693135 2487 2392 2347 2285 2152 739 462 31 --21265 604 --
NM_007007chr1274258 3465 1572 1518 1133 983 220 13581 11341 --
NM_007011chr1586601 5485 5463 4266 2476 2410 2265 1777 32096 547 287 21332 572 12468
NM_007038chr2195740 5717 4420 4084 2411 2301 827 619 267 65855 5838 4538 4144 1815 1550 25551 1631 --
NM_007039chr1431547 567 495 21808 371 --11767
NM_007050chr20267877 7344 7235 7133 6894 6605 6539 6139 6064 5966 5654 5338 5148 4893 4887 2693 2481 2085 1767 1692 1572 1464 1438 1170 904 298 37861 1535 339 11948 27750 1297
NM_007064chr351702 1553 1501 1126 663 3537 186 48 --11640
NM_007073chr664130 4027 3707 2772 2627 1061 33601 3157 1620 11461 --
NM_007078chr1072898 2796 2630 2306 2272 1983 1062 1211 12608 --
NM_007106chr1312008 2340 170 2297 85 2663 519
NM_007107chr372411 2381 1894 1826 1598 542 201 1836 ----
NM_007114chr383269 3217 2184 1305 1280 691 422 414 1528 32218 2138 206 --
NM_007137chrX165567 5286 5212 5093 4769 3599 3377 2191 1934 1898 1883 1828 1799 1678 1283 166 21578 1001 24464 1743 14164
NM_007153chr19133947 3195 3106 2925 1485 1258 1103 664 580 564 243 188 74 53857 3619 3355 3290 1291 33646 3084 413 --
NM_007172chr2222149 177 33246 2819 267 1827 --
NM_007175chr873348 3131 2763 2533 2524 1132 236 13042 --12869
NM_007197chr122728 689 ----1767
NM_007203chr963671 3065 2756 2645 800 128 2698 301 42629 2581 2534 330 252 44
NM_007249chr13159156 8718 8411 8251 8138 7926 7562 6910 6814 6403 6179 3449 3295 2757 799 58590 8215 7693 6370 628 89433 8342 6795 6663 6591 2619 878 125 --
NM_007292chr17175177 5170 4367 4107 3783 3776 1811 1106 991 941 905 807 716 582 492 213 203 14827 21789 1228 14123
NM_007350chr12144429 4313 3654 3529 3329 3090 2962 2952 2933 1553 1440 989 387 369 23908 1352 21274 681 23453 1129
NM_007375chr152809 2735 1960 783 520 1259 31937 758 350 --
NM_012081chr573655 3601 3321 3310 2432 276 91 22913 2875 ----
NM_012095chr1093101 2811 2642 918 865 729 543 422 184 --23079 1118 --
NM_012096chr343583 3391 2343 227 --32829 2556 341 12438
NM_012097chr252248 1496 726 383 137 12199 ----
NM_012102chr192598 2368 2324 2308 1797 577 490 227 33 12671 21730 1644 --
NM_012104chr1183333 3326 3052 2611 1078 890 551 280 13524 13571 23635 421
NM_012104chr1183333 3326 3052 2611 1078 890 551 280 13524 13571 23635 421
NM_012120chr652685 2600 2216 617 306 43024 2078 1183 1083 1841 11958
NM_012129chr712477 ----22350 117
NM_012137chr122419 1788 32849 2411 2042 32579 2183 675 --
NM_012141chr13103924 3594 3422 3274 3018 2592 1491 1356 1127 408 2311 234 --14037
NM_012156chr2093457 3251 3092 2473 2110 1085 380 51 43 --42724 2590 2311 850 --
NM_012164chr9137061 6966 5921 5253 3029 2957 2153 2006 1753 1452 1433 1202 758 21714 89 37505 1082 357 --
NM_012180chr41676 --1481 1523
NM_012193chr11155227 4448 4240 4229 3896 3523 3467 3417 2080 1397 1365 1091 889 216 107 33738 247 172 --15237
NM_012199chr194253 3858 3848 3594 3046 1300 907 191 178 13117 23882 509 --
NM_012214chr2126457 6416 5019 4502 4413 4347 3974 2350 2200 1361 1339 521 41757 709 584 318 16022 35811 2497 180
NM_012215chr1071971 1551 1400 780 677 255 102 ----11595
NM_012223chr251343 901 423 302 283 --21103 441 2506 214
NM_012224chr43467 244 107 ----11169
NM_012234chr363114 2350 1483 790 628 26 12297 23695 2554 1520
NM_012238chr1041729 1314 1223 363 1408 21175 101 --
NM_012243chr13778 244 237 ----1185
NM_012249chr272670 2359 1327 1103 922 913 27 23552 2545 21027 198 --
NM_012250chr1141102 1026 891 494 --21140 1018 --
NM_012252chr751938 1904 1712 1065 167 23766 1783 --1979
NM_012259chr611152 ----21232 556
NM_012262chr153838 3594 1674 1048 608 43488 1902 1891 599 14361 --
NM_012281chr771986 1746 1609 886 547 390 163 --22037 469 --
NM_012287chr383885 2979 1730 877 649 184 64 30 1865 13749 1399
NM_012288chr6105668 5178 4608 4145 3504 1462 1440 461 191 120 2918 207 21183 731 11765
NM_012290chr231693 1510 1161 ----21341 489
NM_012294chr793688 3360 3194 3067 2872 2815 1334 530 136 --33668 1604 1572 --
NM_012297chr482629 2027 1769 1035 999 725 451 250 2974 443 1660 --
NM_012301chr772185 1786 1694 689 635 540 438 2415 247 ----
NM_012304chr562542 2065 2050 1803 1739 887 ----12426
NM_012306chr1293030 2565 2432 817 622 341 332 302 93 --42758 1345 1193 81 13143
NM_012308chr1162557 2514 2391 2082 1870 1727 12157 --133
NM_012309chr1194873 4766 4245 3954 3898 1887 800 574 384 11863 ----
NM_012316chr1155069 5008 4714 4572 3920 3595 2265 2080 1981 1829 1590 1491 1366 495 186 44238 4082 3494 1261 24693 79 --
NM_012328chr741397 1355 446 380 ------
NM_012329chr1761659 1537 1124 483 266 26 ------
NM_012388chr1562869 2800 2592 2094 1085 111 22469 1209 11063 --
NM_012464chr472357 2262 786 655 548 460 128 --1620 --
NM_013229chr1262756 2321 2241 2183 411 67 11924 ----
NM_013231chr1494333 4248 3424 2895 2880 1683 813 685 573 21715 971 ----
NM_013250chr1141336 472 229 171 1365 2428 208 --
NM_013255chr7178623 8432 7806 7784 7753 6937 5961 5904 3387 3177 2758 1832 1239 1099 899 756 651 38258 7501 6240 18527 12026
NM_013257chr8102428 1831 1625 1536 866 477 423 274 126 57 --42056 678 457 22 --
NM_013261chr443372 2680 586 414 43258 2756 2586 553 1716 --
NM_013269chr12134494 4270 4170 3878 3678 3471 2844 2800 1801 1120 1098 1056 912 33643 3313 146 1630 11272
NM_013302chr1674295 3965 3552 1773 1650 1627 1272 44517 3799 254 122 13413 23504 3277
NM_013309chr1562456 2346 2213 2187 2042 374 22466 665 --22490 1637
NM_013313chr22133405 3329 3301 2956 2686 2561 2212 2192 1145 840 820 463 48 22944 349 ----
NM_013316chr72990 408 31056 1016 270 ----
NM_013322chr721055 439 31317 346 293 --11152
NM_013341chr282898 2609 2444 2419 1824 1151 1057 419 179 22212 260 --
NM_013372chr1563226 2122 2091 682 407 270 23313 924 ----
NM_013381chr1261599 1534 1487 940 697 225 1496 1241 --
NM_013386chr171170 455 441 328 274 187 36 11380 ----
NM_013396chr2141525 1269 1229 253 11129 11088 --
NM_013411chr152465 1722 993 483 332 52005 1896 888 542 383 32759 2736 2153 1399
NM_013423chrX4855 418 228 130 1980 ----
NM_013427chrX4855 418 228 130 1980 ----
NM_013449chr1262675 2086 1962 1145 779 609 1239 32775 2405 1170 1412
NM_013989chr1464584 2037 1985 1795 1046 981 44557 4359 1842 1771 21673 325 --
NM_014000chr1091902 1738 1453 1447 1428 731 421 101 32 --1672 --
NM_014011chr262627 2509 2243 2236 1035 598 1443 11780 --
NM_014016chr331496 1406 1078 11584 --11366
NM_014034chr651469 543 533 308 140 ----2491 227
NM_014035chr54351 312 254 185 21234 1228 --160
NM_014048chr1685096 4719 4498 4249 3618 1364 569 149 31787 960 413 13490 25135 4645
NM_014057chr92346 265 ----11257
NM_014112chr895092 5072 3905 3685 3381 1202 830 456 252 14213 14565 1335
NM_014141chr785256 4344 3731 3716 3676 3593 1290 692 33782 1127 762 55338 4821 4018 3369 472 --
NM_014155chr11187495 6798 6633 6444 6422 6228 5712 5567 4663 2839 2793 2041 1798 1748 788 428 245 35 57177 5009 4632 1764 1480 47121 904 598 498 1644
NM_014157chr1673413 2724 1377 1021 601 206 28 13602 12701 33695 785 488
NM_014181chr242635 2214 759 747 32457 333 227 12071 1356
NM_014240chr394038 3191 2693 2580 1429 1194 995 864 598 --33756 1259 1092 13244
NM_014243chr471812 1442 1429 1383 862 499 89 21800 1729 2216 28 1296
NM_014250chr2262139 1917 1877 1719 1374 26 31705 1699 289 ----
NM_014294chr83518 294 39 ----21463 1411
NM_014309chr2285231 4218 4092 4019 3832 1192 924 830 12046 21916 380 1736
NM_014372chr162073 1934 1407 588 172 33 ----1730
NM_014376chr5112594 2585 2483 2364 1722 1630 1612 952 828 594 59 --11668 --
NM_014381chr1452981 2118 1078 704 596 --12927 22516 1227
NM_014382chr341384 282 232 30 --11586 11348
NM_014393chr862194 874 777 722 671 151 ------
NM_014423chr565613 4816 4595 851 614 543 45197 4728 4236 4105 --15629
NM_014447chr451550 1534 1079 1054 233 151 2621 462 --
NM_014494chr1672261 2097 1832 1632 950 358 238 32242 926 614 11948 --
NM_014521chr271895 1726 1710 1592 1347 1224 251 11543 21675 1148 --
NM_014553chr283145 2644 2099 1192 643 310 192 160 ----23115 1324
NM_014572chr1351295 1146 418 325 83 11582 1477 --
NM_014574chr1451598 1425 1368 1237 1021 31156 1101 280 1145 --
NM_014613chr593045 2973 2886 2500 2397 2251 1115 1057 797 22765 927 22424 174 --
NM_014616chr352459 1145 989 694 340 12842 ----
NM_014636chr9124077 3890 3311 3221 2937 2894 2832 1741 1330 1193 108 43 --13085 --
NM_014674chr3103808 3533 2901 2788 1592 1451 1197 1037 56 31 ------
NM_014682chr852000 1791 1666 483 170 ------
NM_014683chr1761984 539 200 180 163 93 --11514 --
NM_014690chr782645 2227 2143 1211 208 186 113 91 ----12268
NM_014701chr1563448 3307 3028 2124 1334 259 1496 11140 --
NM_014702chr673402 3387 3153 3017 2199 2170 882 52750 2307 1311 1131 1033 --13224
NM_014721chr6147356 7136 7126 6440 5657 5546 4782 4682 1707 1648 1639 1320 1177 51 24905 326 1401 12881
NM_014729chr841980 1482 917 483 --2672 363 21735 1616
NM_014730chr1275260 4118 4053 4041 3566 720 563 25077 4174 149 14950
NM_014730chr1275260 4118 4053 4041 3566 720 563 25077 4174 149 14950
NM_014732chr16115879 4624 4520 4469 4310 3997 1937 1001 800 741 566 25891 5814 33563 1118 99 1283
NM_014733chr55901 815 525 454 155 2294 49 12209 --
NM_014743chr462781 925 861 547 487 68 1247 12604 1668
NM_014746chr263719 3461 1762 1311 642 540 24174 522 21654 1067 13082
NM_014747chr1145410 4900 4841 4629 4605 4190 3538 2307 2135 1407 1113 714 556 296 --44511 1857 1815 1381 --
NM_014755chr274181 3605 3195 1653 910 391 218 43964 2944 2617 747 ----
NM_014757chr562352 2195 1690 530 409 311 2511 292 ----
NM_014765chr152062 989 581 365 115 12561 ----
NM_014766chr763701 3257 2744 1108 711 69 23086 551 33288 2803 125 13607
NM_014774chr1103041 2652 2110 1025 641 346 301 200 176 99 22689 1096 1566 --
NM_014776chr1262736 2679 835 784 527 402 12888 3896 715 342 --
NM_014803chr1032928 2104 108 ----1210
NM_014810chr143265 2549 1128 532 22720 1147 13218 --
NM_014812chr151529 428 317 180 25 1341 ----
NM_014819chr532482 1738 744 41520 929 252 152 1648 --
NM_014820chr372020 1947 1756 1419 565 521 511 --31643 1381 100 11605
NM_014828chr1482534 2188 1785 1779 990 681 300 21 --1737 --
NM_014829chr562028 1642 197 185 152 133 ------
NM_014830chr1263864 3638 3270 2814 2438 2388 22982 2419 1815 --
NM_014832chr1371872 1557 759 394 366 316 178 1783 1104 --
NM_014835chr2062225 2111 730 694 608 414 --1282 192
NM_014838chr22102518 1876 786 588 475 448 379 372 332 106 11095 22499 2182 --
NM_014839chr152543 2251 998 364 41 22349 1689 11721 --
NM_014850chr3144529 4120 3825 3732 3337 1876 1578 1167 1067 803 778 764 507 312 14728 23850 3788 --
NM_014864chr1124199 4059 3970 3613 3233 3224 2876 656 642 590 172 25 22695 502 23592 2850 21197 161
NM_014867chr8103855 3713 3522 3446 2790 2424 1395 1219 920 212 13376 11460 --
NM_014872chr952180 2058 1663 1479 1465 1683 1213 --
NM_014873chr184109 3613 3522 3102 3037 1598 283 82 23338 1810 23621 275 --
NM_014877chr17167576 7044 6731 6516 5869 5425 5387 5028 4790 2748 1821 1519 1475 1417 1283 1124 22390 775 35774 5373 1374 --
NM_014888chr741461 535 207 199 11303 ----
NM_014893chrY72174 1939 1869 1762 595 256 88 --1925 --
NM_014897chr1773132 3066 2943 1217 1149 813 200 12238 22821 209 --
NM_014899chr592990 2891 2589 2255 1921 1063 618 425 156 31948 439 204 --22519 91
NM_014903chr12102408 2295 2204 2007 1961 1760 874 692 349 75 ----11626
NM_014904chr1073356 3103 2739 2676 928 678 191 53347 3116 3034 1608 1101 1383 --
NM_014905chr251983 1719 1555 526 27 1559 11611 11808
NM_014906chr17113577 1387 1298 1228 758 560 522 478 382 365 149 1896 13523 --
NM_014912chr1042848 2395 409 92 21371 1296 23072 2597 --
NM_014913chr1871416 1277 1214 324 318 257 149 1940 21227 167 --
NM_014914chr26893 522 498 465 239 156 1951 2906 814 --
NM_014920chr693718 3510 3382 3253 3040 2946 2480 1392 1355 32453 886 107 13494 32429 775 723
NM_014924chr1483164 2847 2791 1208 880 678 497 240 --22456 968 --
NM_014932chr381986 1903 1603 1328 1319 596 433 21 21586 175 --11677
NM_014934chr1383740 3514 2937 2917 1556 1484 599 176 --32686 463 32 13425
NM_014936chr682335 2292 2020 941 617 592 414 212 148 1240 --
NM_014946chr292976 2366 2258 1983 1895 1034 795 525 148 22955 2706 ----
NM_014961chr462028 1414 726 487 148 63 31515 1483 532 ----
NM_014962chr2062920 2459 2219 2074 2063 796 2864 776 12466 --
NM_014982chr1485253 4017 3544 2061 1459 1389 432 336 34312 1720 314 ----
NM_014989chr661586 1579 377 332 262 60 ----1653
NM_014991chr432821 670 482 32493 491 357 22265 26 33119 2449 2352
NM_015008chr353377 2381 1167 446 374 23315 278 ----
NM_015020chr1653449 3382 1066 424 205 1839 43336 2522 2405 731 --
NM_015025chr262531 2026 805 727 719 23 12362 ----
NM_015035chr20106336 5536 5370 4774 4132 2082 1499 923 527 383 --55348 2189 2167 1475 44 36394 4438 1737
NM_015039chr133481 823 153 --1532 14259
NM_015040chr2123415 3249 3228 3145 3070 2773 2579 2512 1174 1152 801 474 ------
NM_015042chr1584226 4042 2918 2641 1695 1271 976 952 22650 663 23952 327 --
NM_015049chr252644 2465 2324 2121 900 1987 --1792
NM_015051chr993420 3025 2912 2830 1327 1081 1046 296 222 42945 1178 894 271 13131 --
NM_015055chr1162343 2131 2027 755 472 194 12002 --12822
NM_015064chr1293241 2755 2436 2269 1256 444 385 313 129 23173 2964 1732 12548
NM_015068chr742844 758 576 486 22918 2764 13322 23667 518
NM_015071chr5106467 5860 5603 5356 4289 2567 2244 1516 1322 671 21524 738 --24816 4612
NM_015074chr174502 4251 3945 3192 1755 1176 1154 24725 1576 44412 3923 3399 3010 --
NM_015076chr6133498 3295 3229 3092 3073 1560 1278 1194 1036 967 609 516 89 44498 3850 3459 75 23750 1635 --
NM_015090chr1154782 4657 4587 4213 4044 3815 1773 1641 1401 1073 975 888 545 159 66 15054 21916 88 35255 4547 1582
NM_015092chr16114572 3984 3806 3753 3143 1615 635 316 136 127 80 33829 1467 1065 21593 435 13598
NM_015093chr671838 1761 1666 1143 492 446 31 --2551 52 11412
NM_015094chr2294681 2953 2880 2860 1878 1208 923 794 48 53864 3204 1836 1707 642 21439 195 --
NM_015115chr442240 2078 668 618 1379 11083 12993
NM_015138chr1582345 2023 1992 895 734 720 529 147 22493 2385 11758 --
NM_015144chr1683711 3552 3456 2963 2466 1499 720 34 ----11575
NM_015147chr293233 2796 2576 1319 905 817 436 321 116 32658 2193 205 --11061
NM_015156chr1464041 3799 3423 3169 1330 276 23385 3275 12886 1510
NM_015161chr1651417 1188 614 550 52 ----2483 456
NM_015191chr1162722 2267 2184 776 746 116 1456 2630 474 22418 1088
NM_015192chr2051990 1978 1885 635 192 32621 1121 326 22377 664 --
NM_015198chr7130 11333 1397 11111
NM_015199chr382604 2520 2377 2189 2022 722 634 487 21918 520 --1880
NM_015200chr442417 2071 526 200 42608 2222 900 137 ----
NM_015206chr1563487 959 779 714 456 173 33907 3105 293 21403 107 1395
NM_015208chr1873936 3905 2838 1412 1070 904 208 31153 1140 386 13883 --
NM_015215chr153014 2390 1992 723 621 --33116 2888 325 21214 276
NM_015225chr972328 2303 1023 810 574 508 491 --12829 12676
NM_015230chr461770 731 517 401 361 316 21632 1516 31609 623 371 --
NM_015247chr16105285 5133 4804 4483 3807 3759 3570 1116 1097 29 --21740 391 12051
NM_015263chr152919 450 --1805 11021
NM_015267chr1292138 2046 1946 1645 819 605 545 497 406 --11591 11931
NM_015271chr474327 4249 3697 3598 1406 709 314 2295 282 --13622
NM_015278chr673174 2798 2431 2324 2277 140 96 22481 267 23018 1180 23229 2460
NM_015299chr1493539 2760 2703 2589 1494 1211 1168 720 597 21245 1188 21031 133 12578
NM_015310chr8197951 7896 7590 7149 6851 6423 6243 6018 5935 5787 5264 3169 2814 2068 1635 1436 1405 853 447 37749 6154 6036 18352 --
NM_015313chr1143536 1323 333 120 31938 1825 270 --13957
NM_015315chr573110 2358 2267 2227 1250 822 335 2805 411 --1598
NM_015317chr282679 2648 1061 732 554 469 219 116 11863 22096 912 12454
NM_015328chr793068 2271 2229 2087 1993 904 872 810 214 21987 152 12576 11161
NM_015335chr12101922 1642 793 734 681 469 396 212 105 63 --32290 1062 990 --
NM_015346chr1461892 1713 1416 1380 1185 334 11439 11530 --
NM_015347chr1292914 2621 2610 2375 1830 758 410 225 154 11928 ----
NM_015349chr692960 2619 2368 2199 2156 616 533 48 35 21172 403 33014 807 331 --
NM_015355chr1741900 1493 696 317 --1533 11998
NM_015365chrX104333 4308 4090 3705 3653 3439 3385 1607 795 56 33432 768 756 24154 697 11556
NM_015387chr23740 693 358 11656 --11699
NM_015396chr321022 1010 11036 162 11108
NM_015435chr81179 --1403 11040
NM_015436chr443234 531 203 134 23354 3031 --1257
NM_015455chr5113842 3658 3610 2762 2609 1472 756 722 503 336 154 23947 3247 ----
NM_015458chr8154980 4443 4377 3777 3303 2086 2061 1888 1454 1319 869 811 553 179 164 24360 461 13985 --
NM_015520chr362200 2060 1858 845 175 68 12397 11783 --
NM_015526chr19101287 1214 1142 1113 1011 948 592 517 367 114 11351 ----
NM_015550chr793403 3381 3355 2942 2739 2580 2215 1224 237 42867 2353 1328 370 ----
NM_015553chr6124974 4758 4641 4203 3570 3223 1803 1709 1192 723 434 97 11389 44876 1877 1641 1445 34577 3814 3479
NM_015554chr1582563 2488 2078 1051 873 708 663 143 --2995 48 --
NM_015555chr641721 1290 514 89 --183 --
NM_015560chr372925 2774 2615 2253 460 442 285 --1496 1646
NM_015564chr593023 2935 2490 2397 2355 2181 1356 794 23 33166 2561 114 21138 169 23007 703
NM_015565chr215847 623 562 200 158 --189 --
NM_015569chr1104270 4157 3948 3590 1640 1418 1179 384 192 78 13659 --21786 1319
NM_015571chr662526 2171 2020 1988 1729 717 12620 --139
NM_015576chr362838 2722 2628 2043 737 717 22832 2086 12848 1705
NM_015602chr151633 1441 1125 147 23 11272 ----
NM_015605chr1051075 1049 1033 1020 975 21423 634 ----
NM_015640chr194980 4813 3745 3669 3304 1820 1549 804 772 31161 1045 986 ----
NM_015641chr71101 2980 401 1253 1115
NM_015852chr7161385 1370 1300 1220 1139 1055 971 887 860 719 635 551 467 299 215 47 33281 3065 2914 1384 --
NM_015878chr861566 743 415 291 153 120 1837 ----
NM_015879chr18158634 8409 8333 8315 7444 7268 6161 6052 5704 3353 2183 1551 1274 1175 652 76872 5420 5236 2913 2159 1665 52 48421 7282 6696 192 38075 3373 1379
NM_015888chr163183 2686 2568 2287 1362 34 33294 2694 133 ----
NM_015891chr661973 1553 1432 820 444 137 21383 602 1777 --
NM_015904chr22166 66 2738 621 1542 1160
NM_015906chr194817 4133 4088 3427 2957 1592 1289 907 771 11390 --11535
NM_016009chr1154897 4701 4672 4500 4299 4174 4087 3966 3687 3459 1675 1183 1043 510 128 11716 24521 3437 1539
NM_016018chr852563 2414 2330 574 385 12360 --11112
NM_016021chr643039 2296 1845 743 42521 2023 1985 1028 22753 1101 --
NM_016025chr1621839 1621 1138 --21880 343
NM_016045chr2061790 1683 1367 511 498 270 --11345 --
NM_016072chr1262189 581 492 298 256 232 2853 485 ----
NM_016073chr151861 31128 1045 88 2769 35 --
NM_016075chr1392393 2374 1976 1109 938 797 772 652 221 ------
NM_016083chr683577 3463 2951 2595 2468 2409 1332 266 --13222 --
NM_016089chr3122170 821 766 737 653 401 346 317 233 204 149 65 2613 109 1444 --
NM_016096chr851691 1681 1624 461 214 22204 1927 ----
NM_016131chr27841 721 596 456 210 126 66 12194 ----
NM_016156chr1151719 1711 1526 445 331 31705 766 386 12002 --
NM_016206chr3138941 8828 7667 6903 3254 3248 3212 3118 3073 2584 2412 1326 339 26030 643 1906 13316
NM_016217chr653501 2594 1331 1098 347 53173 1059 964 889 320 --13697
NM_016221chr532176 378 323 11507 22162 1726 11939
NM_016224chr61214 1109 --21637 1444
NM_016226chr121168 --1443 2434 55
NM_016228chr4--1701 --2491 198
NM_016252chr23264 214 103 151 2284 110 181
NM_016255chr652674 2497 819 335 322 12380 22238 838 --
NM_016260chr2157463 7281 7073 7025 6332 6273 6167 5501 4929 2978 2678 1596 1030 624 297 37051 2775 464 16416 12413
NM_016271chr1871917 1869 1821 1611 801 788 445 --159 --
NM_016272chr2282502 2180 879 870 728 674 505 39 12471 --12028
NM_016275chr372312 2199 1774 907 554 251 111 2736 633 ----
NM_016297chr2123692 3527 3028 2514 2411 1507 1269 1007 851 799 389 88 --23194 2492 --
NM_016315chr21363 3589 438 416 11584 11387
NM_016322chr932502 2240 1158 22914 287 12770 13112
NM_016338chr561185 1158 1064 296 176 119 --2416 95 --
NM_016353chr871683 1598 966 864 483 345 153 11716 ----
NM_016356chr672678 2531 2349 2239 753 152 138 --12864 11117
NM_016376chr1763889 3674 1074 574 317 231 12655 ----
NM_016395chr1521685 1460 41546 697 503 73 --1651
NM_016396chr1552085 1123 798 730 21 42353 2251 2238 744 ----
NM_016433chr122515 59 1290 21353 493 21574 1218
NM_016442chr562131 1967 1880 1601 1502 682 21762 496 1886 --
NM_016472chr142974 397 ----11014
NM_016513chr693718 3510 3382 3253 3040 2946 2480 1392 1355 32453 886 107 13494 32429 775 723
NM_016530chr15104140 3909 3892 3483 3321 2712 2516 2507 1018 686 24038 1303 21366 700 13743
NM_016531chr4103766 3478 3420 3296 1626 1301 1112 983 865 852 1305 14007 --
NM_016559chr321025 65 41163 244 96 59 ----
NM_016575chr12105275 5145 5097 4128 3885 1970 1927 858 519 22 24018 765 1294 --
NM_016577chr3134317 4273 3995 3889 3828 3384 1591 1058 966 929 416 283 86 1542 --1639
NM_016605chr531824 404 136 22264 2143 22514 606 11095
NM_016613chr461842 598 564 363 337 197 165 1669 --
NM_016626chr1841662 1538 1401 1212 21546 1495 ----
NM_016653chr251118 1018 960 217 162 31241 1202 349 --1818
NM_016824chr1041923 1609 1265 610 11403 11235 --
NM_016836chr21152 1659 --1143
NM_016839chr21152 1659 --1143
NM_016952chr1184119 4085 3974 3619 3593 3409 106 96 11419 22763 1225 2969 759
NM_017412chr84953 516 349 24 11200 --11273
NM_017415chr594162 3431 2867 1717 1493 827 811 435 326 2888 423 --11615
NM_017420chr1493624 3360 2519 1302 1244 883 622 374 56 12802 ----
NM_017423chr462182 1516 587 119 72 63 11741 11957 11760
NM_017522chr13956 519 344 ----11325
NM_017540chr583104 2794 2763 2064 1295 1193 1069 836 12282 13158 --
NM_017594chr963312 2811 2459 2322 2271 172 32840 1234 220 --1406
NM_017628chr455275 5229 4379 1831 1696 35096 3456 2076 13979 --
NM_017633chr643014 2466 1401 255 23494 3270 22420 32 23486 1238
NM_017637chr9219093 8809 8284 7835 7461 7311 6680 6348 5881 5732 3652 3626 3478 3247 2697 2090 1791 1519 1341 1076 879 56074 5827 2952 2330 1435 12356 11616
NM_017643chr1762964 2780 2096 2032 962 629 21006 939 ----
NM_017644chr384113 3489 3440 3174 1797 821 456 159 11626 34266 3797 27 --
NM_017650chr7104329 4233 2352 1872 1231 1126 1081 760 225 203 22333 1263 41951 911 533 450 192
NM_017651chr651477 612 585 211 153 41219 294 180 58 ----
NM_017658chr14114376 3808 3664 3530 3460 2944 1805 1795 1090 79 38 1193 21662 655 --
NM_017661chr151803 1163 1420 1881
NM_017662chr93662 586 566 22042 1768 ----
NM_017694chr231733 1637 584 1757 1310 11922
NM_017709chr174249 3684 3502 2994 2690 984 33 2596 590 11268 --
NM_017719chr362398 2187 2158 554 392 275 31562 435 258 11689 --
NM_017736chr1683152 2407 2301 1974 805 785 576 323 13195 1889 --
NM_017738chr92285 239 11188 1375 1168
NM_017740chr1631492 104 24 31807 1245 116 --2709 230
NM_017742chr1851765 1567 1462 697 688 1532 --1745
NM_017752chrX32094 738 218 22006 668 21680 1312 --
NM_017754chr6105073 5042 4693 4134 4126 3323 1915 1809 557 212 1753 11893 21749 588
NM_017761chr151051 987 596 409 115 21453 169 11331 1224
NM_017762chr1542245 951 799 532 12400 21662 556 12259
NM_017769chr1482963 2884 2605 2542 2457 2229 463 96 ------
NM_017770chr6122678 2657 2468 2387 2366 2332 2188 1953 1912 898 553 119 42607 2435 2235 97 12957 --
NM_017776chrX101603 1296 1266 636 513 486 404 321 237 153 1530 ----
NM_017798chr2011113 --1380 1438
NM_017799chr1461738 1598 1229 634 307 83 2405 104 1582 --
NM_017801chr362286 756 604 270 216 99 --12328 31789 971 486
NM_017811chr952845 2423 863 707 392 --52975 2538 910 688 647 --
NM_017813chr8125290 5274 5134 4317 4157 1920 1751 1717 1305 1293 1285 169 14589 1477 --
NM_017824chr1062712 2493 2138 1027 234 173 11043 1154 --
NM_017845chr43809 276 81 1616 --1610
NM_017847chr162173 2046 2017 1608 838 249 32275 1503 1393 31479 440 154 --
NM_017848chrX134658 4554 4295 3940 3611 3526 3057 2888 1472 1251 1175 643 27 12898 22830 1585 --
NM_017849chr282958 2858 2560 2144 1993 1105 1063 987 12136 32976 2151 768 --
NM_017919chr9205292 5202 4828 4734 4686 4602 4451 4432 4142 4007 3897 3859 3743 2031 1617 1301 950 673 429 367 13733 23689 452 14063
NM_017964chr22181 137 1908 1147 --
NM_018017chr10102546 2310 2063 1101 1079 997 878 841 792 35 --1858 22113 1042
NM_018027chr1053229 3127 2919 2410 976 21118 86 1396 11182
NM_018036chr1433616 1650 1138 43524 1391 1384 1340 2418 42 --
NM_018045chr1112683 2082 1959 1916 882 876 779 400 270 248 141 ----12315
NM_018046chr54745 714 156 55 2190 171 11279 --
NM_018048chr1241981 1597 1310 219 11872 22072 2015 --
NM_018084chr252647 2467 947 748 71 73339 3318 3141 3105 2445 2364 582 12320 11170
NM_018085chr1238013 7658 7642 7603 7088 6202 5696 5274 5215 2791 2783 2189 2047 1866 1696 1483 1464 1273 1156 830 669 155 48 37561 7506 1820 37822 1674 1642 17974
NM_018100chr673109 2911 2686 1266 864 426 356 --12137 1148
NM_018121chr1062382 1938 1279 992 536 319 42844 2197 424 31 ----
NM_018126chr41568 1167 --11571
NM_018133chr362183 1595 1432 599 551 416 --12067 --
NM_018155chr372870 2688 2642 2373 2241 1140 320 22917 39 172 --
NM_018167chr142327 278 1805 --1966
NM_018169chr121498 ----175
NM_018201chr962533 951 122 86 76 36 --32147 396 104 1962
NM_018211chr152219 2165 1455 695 81 22102 385 11551 1255
NM_018225chr9105320 5054 4709 4363 4245 4010 3540 1836 1376 22 24463 1194 ----
NM_018227chr4103234 2840 2208 2038 1267 1054 920 601 144 78 1829 ----
NM_018243chr493486 2952 2676 2654 2551 2513 1166 686 626 33927 2989 483 ----
NM_018247chr673123 2902 2360 834 703 456 23 --12299 --
NM_018254chr182448 2403 2354 2348 1777 1653 645 453 ------
NM_018257chr2082393 2239 2163 2121 1967 1842 747 563 ----1390
NM_018260chr1951109 496 329 120 76 11032 1162 --
NM_018263chr272617 2360 2080 2008 1814 960 245 12002 1952 --
NM_018287chr1051337 1137 1056 985 453 1269 ----
NM_018293chr3102648 1856 1059 993 655 529 496 400 316 228 32936 2132 764 22590 1017 --
NM_018299chr843007 1293 1035 957 12262 ----
NM_018351chr1273352 3204 1377 1254 1209 965 281 34599 2974 110 21355 272 --
NM_018362chr1153875 3660 2754 896 566 12470 ----
NM_018371chr821338 299 21088 1069 21017 526 1171
NM_018374chr7124894 4850 3597 1891 1718 1668 1645 1057 848 687 360 85 24297 597 34689 3555 1399 --
NM_018383chr271863 1835 835 440 412 135 84 ----11877
NM_018388chrX41107 1002 212 41 21048 179 ----
NM_018398chr33348 295 55 174 --1307
NM_018403chr353351 3212 2852 896 67 14136 --13548
NM_018416chr1262129 1774 716 400 324 46 --3682 345 141 --
NM_018425chr1072382 1949 416 309 84 76 50 22486 2277 1549 12515
NM_018429chr532341 2234 982 --22221 2079 --
NM_018440chr8117912 7058 6241 6218 6106 5711 3281 2529 1664 900 542 25427 312 37040 6485 1886 16666
NM_018448chr123923 411 216 2801 389 11023 1259
NM_018482chr872302 2255 822 464 444 227 106 --21836 1783 1762
NM_018490chr1171808 1740 1723 1599 1483 150 41 11294 ----
NM_018566chr174850 3431 407 300 129 110 26 13961 14396 --
NM_018590chr1081550 1346 1323 1284 1089 521 231 31 ------
NM_018638chr12145195 4940 4727 4649 4310 3951 3786 3714 3539 2024 1727 1671 1485 62 24624 74 --11777
NM_018660chr882894 2547 2401 974 929 824 585 261 --12192 22511 88
NM_018695chr562357 2158 1808 1503 836 167 12410 1438 --
NM_018698chrX81725 1664 1637 1568 1540 771 455 186 ----2786 101
NM_018704chr182099 1777 1634 1603 1386 1364 634 163 31529 1426 496 52087 1350 734 207 108 --
NM_018717chr452029 1911 1823 849 274 ----21936 1105
NM_018718chr782039 1596 1571 766 269 207 104 86 --22018 586 11563
NM_018898chr582176 2134 726 640 613 121 112 23 21644 700 ----
NM_018899chr582176 2134 726 640 613 121 112 23 21644 700 ----
NM_018900chr582176 2134 726 640 613 121 112 23 21644 700 ----
NM_018901chr582176 2134 726 640 613 121 112 23 21644 700 ----
NM_018902chr582176 2134 726 640 613 121 112 23 21644 700 ----
NM_018903chr582176 2134 726 640 613 121 112 23 21644 700 ----
NM_018904chr582176 2134 726 640 613 121 112 23 21644 700 ----
NM_018905chr582176 2134 726 640 613 121 112 23 21644 700 ----
NM_018906chr582176 2134 726 640 613 121 112 23 21644 700 ----
NM_018907chr582176 2134 726 640 613 121 112 23 21644 700 ----
NM_018908chr582176 2134 726 640 613 121 112 23 21644 700 ----
NM_018909chr582176 2134 726 640 613 121 112 23 21644 700 ----
NM_018910chr582176 2134 726 640 613 121 112 23 21644 700 ----
NM_018911chr582176 2134 726 640 613 121 112 23 21644 700 ----
NM_018945chr683463 3333 2877 2541 1330 1244 1190 1116 22330 1079 53374 2855 1140 678 180 --
NM_018947chr7114578 4400 4261 4234 4098 3958 3589 3424 3266 1513 865 44493 693 397 147 24212 3402 --
NM_018958chr1563485 2963 1375 1241 554 416 13523 33926 3160 627 13675
NM_018963chr2171412 1270 563 513 453 420 127 21335 1258 ----
NM_018970chr773004 2626 1983 969 537 260 227 2401 37 32426 2105 1092 1883
NM_018976chr1262634 2246 747 294 218 180 22138 613 21758 363 11915
NM_018993chr2041272 1252 127 49 21201 1048 1938 11120
NM_018999chr1073556 1756 1508 1378 983 355 276 23527 713 44361 3836 638 300 --
NM_019000chr531580 1292 1255 1301 --11132
NM_019001chr333861 1314 723 43633 3180 1371 249 23731 1257 14249
NM_019041chr662505 2125 942 936 501 178 22425 2150 1640 --
NM_019050chr472033 2004 1593 1409 457 329 151 21892 427 --12259
NM_019071chr71605 ----1525
NM_019072chr573949 3553 3205 3146 3107 891 778 34318 2714 96 1862 1540
NM_019094chr1283593 2967 2954 2676 2408 1163 907 447 33515 1124 195 ----
NM_019106chr2282951 2922 2762 2388 952 920 912 396 12897 ----
NM_019593chr2063036 2204 1950 603 580 364 1248 --12579
NM_019596chr2162831 1167 740 529 507 208 42457 2424 2076 145 --1137
NM_019610chr152195 1774 633 465 290 1690 2497 62 --
NM_019862chr162534 217 31697 117 83 21452 619 1103
NM_019898chr162534 217 31697 117 83 21452 619 1103
NM_019899chr162534 217 31697 117 83 21452 619 1103
NM_019900chr162534 217 31697 117 83 21452 619 1103
NM_019903chr1041923 1609 1265 610 11403 11235 --
NM_020116chr471718 1651 1536 1318 1216 411 285 1298 1223 --
NM_020119chr763674 3341 2662 1476 919 757 23105 2477 33644 3311 213 --
NM_020122chr2105092 4800 4514 4334 4007 3915 1761 1596 566 295 24157 2395 35540 5471 5166 --
NM_020132chr2155148 5102 4316 1812 405 85198 5142 3593 3320 1726 1541 1433 61 64994 4809 1734 1464 1036 95 11745
NM_020133chr6126309 6152 5073 4495 4444 4187 2471 2323 1461 1219 1007 31 56490 4852 4630 2052 1471 24859 4117 21176 682
NM_020141chr182182 2006 1977 1786 926 225 199 66 --3874 677 99 --
NM_020148chr1842532 2444 954 236 1982 32745 1887 267 12150
NM_020177chr583350 3026 3008 2944 2574 2417 1076 1021 33183 2863 2602 ----
NM_020182chr20123568 3317 3307 3250 3141 2627 2452 1210 901 660 427 220 ------
NM_020198chr1751305 1006 304 263 121 2427 390 --21490 1038
NM_020205chr162906 2546 2126 1154 639 127 32658 935 400 ----
NM_020245chr644090 3912 1287 659 34751 3527 3423 11077 21698 108
NM_020336chr2053832 2694 1443 568 96 13506 33612 3359 2436 --
NM_020337chr453064 2497 838 543 411 21936 1030 12676 --
NM_020338chr1083626 3149 2919 2892 2711 992 910 269 23536 622 43470 1144 519 287 --
NM_020341chr2072039 1876 1857 1427 265 150 104 21694 581 ----
NM_020342chr26863 633 490 353 311 238 21867 344 --1972
NM_020346chr1121604 454 ----21176 344
NM_020390chr374715 4280 3417 1647 493 327 298 21876 341 --14056
NM_020416chr462667 2361 2078 1069 976 251 22223 1992 ----
NM_020420chrY4371 248 195 185 ------
NM_020429chr742410 2336 1979 905 43004 935 802 46 23051 1919 --
NM_020443chr1106683 5503 4939 4862 4290 1729 1559 1237 1102 723 24305 547 22299 631 --
NM_020455chr622483 724 --12726 1156
NM_020473chrX92033 1583 1530 1496 737 466 261 228 187 ------
NM_020474chr1861713 1322 511 264 200 174 1299 1465 --
NM_020546chr542738 2141 1070 307 --23011 1253 1789
NM_020638chr1261981 1677 1540 422 250 235 21734 162 ----
NM_020647chr81157 --11431 12286
NM_020648chr1872770 2721 2402 2383 2012 1066 843 12523 12061 --
NM_020651chr241612 1555 347 174 21822 622 21521 1327 --
NM_020673chr20117743 7588 7545 6926 6813 6266 5856 5552 4843 1580 1566 21538 1280 55791 5498 1853 1729 1142 12886
NM_020686chr1682950 2620 2491 2322 1978 1965 791 331 22220 1907 12153 --
NM_020698chr1283136 2743 2705 1124 948 571 294 114 12193 12529 --
NM_020699chr195278 5067 4684 4375 4335 3609 1790 1510 1282 65270 5264 4514 4296 1263 1249 24555 821 13991
NM_020704chr772368 2321 2120 1960 1777 480 209 1437 1494 --
NM_020711chr262596 2300 2181 2166 2151 910 1187 32099 2022 1627 12491
NM_020715chr1462297 2026 1433 724 215 145 22132 1521 --12060
NM_020717chrX124785 4763 4708 4350 3910 3658 3628 3200 1946 1193 234 175 1287 34915 585 187 21321 1186
NM_020718chr1685086 4102 3987 2464 797 698 354 345 21066 204 22259 1735 --
NM_020727chr2152813 1621 1168 811 596 21495 628 11412 13667
NM_020734chr1263086 2989 2959 2588 515 154 21002 68 12268 13186
NM_020739chr1573845 2761 2637 2585 1027 576 208 33863 2922 499 23532 1193 13353
NM_020742chrX61936 1828 656 554 365 106 --22244 989 --
NM_020752chr1092854 2842 2680 2550 2354 2189 329 320 33 --1714 --
NM_020760chr241901 1364 651 340 1365 --1556
NM_020766chrX44288 4045 3504 677 11548 34166 3128 31 --
NM_020771chr63473 438 207 ----11064
NM_020772chr1797849 7441 7281 6604 5697 2365 1844 1133 458 98096 6384 6154 6134 5706 5343 5272 3051 1061 1105 12556
NM_020774chr1875969 4736 4386 4262 4241 4149 1752 --26256 5192 --
NM_020776chr1853086 1022 667 633 181 32713 2629 2095 2286 148 --
NM_020782chr1264038 3917 3394 1631 1340 549 23018 1776 --2186 78
NM_020783chr1862411 2047 843 777 724 146 11593 --31950 421 92
NM_020796chr572648 2434 2084 808 794 393 31 31006 481 99 ----
NM_020809chr1172222 1920 918 865 627 578 518 1344 1402 --
NM_020830chr242914 2826 2764 488 32092 313 118 1482 --
NM_020841chr1273589 3309 3223 1579 1151 508 89 1982 13333 --
NM_020844chr896430 6002 5745 2877 2492 2448 2334 476 38 22894 1141 ----
NM_020850chr1643228 2824 654 387 12537 31128 968 97 12179
NM_020858chr1532433 1818 125 31996 1695 110 21617 1582 --
NM_020859chr483882 3696 2876 2656 2547 256 150 79 13868 33042 2619 2499 33777 3059 1388
NM_020870chr44625 535 251 30 --11711 1573
NM_020872chr351327 1284 1254 587 256 21144 203 ----
NM_020918chr10123502 3381 3370 2895 2820 2556 2458 2332 1135 886 722 261 23673 3421 --12803
NM_020921chr1493511 3304 3007 2783 2730 971 835 789 744 33387 3265 408 ----
NM_020935chr251786 1690 1508 546 182 43766 3646 1190 131 34289 1428 1326 --
NM_020940chr1042791 1103 428 132 22832 1802 1514 21941 1885
NM_020948chr153299 3239 570 506 400 11450 ----
NM_020956chr19104765 4595 1872 1794 1716 1638 1147 223 214 199 1858 ----
NM_020980chr1531394 610 440 --1662 1640
NM_020987chr1051383 1338 1131 373 169 11217 2275 216 --
NM_021003chr147772 583 538 337 240 221 69 ------
NM_021007chr262177 2026 1851 960 593 155 12194 --1280
NM_021033chr1362883 2841 2544 2422 923 862 11039 2890 346 --
NM_021061chr8104459 4389 3724 3405 2794 1815 1764 530 318 37 --64228 3182 2844 2781 1076 50 11754
NM_021069chr452004 1379 766 274 139 12172 --11720
NM_021072chr572617 2468 2035 1800 1043 877 248 22323 2304 ----
NM_021079chr1773077 2856 275 138 59 47 31 12458 32977 2230 932 --
NM_021083chrX82690 2585 2342 2306 1140 983 882 287 12388 23504 174 --
NM_021090chr22105063 4208 3111 1903 958 936 469 413 393 229 31282 975 274 1109 --
NM_021097chr292387 2304 2279 2235 2150 638 450 158 77 23100 2442 22828 413 --
NM_021101chr352209 1624 945 730 24 32490 710 40 ----
NM_021132chr1041126 494 306 130 11164 31299 1173 114 --
NM_021159chr451069 589 402 354 331 11184 --1695
NM_021163chr7113565 3038 2795 2691 2462 2392 2346 1475 812 382 363 33325 3064 2782 12488 --
NM_021167chr772485 1874 1066 728 423 253 120 22729 2349 42466 1017 706 401 --
NM_021183chrX22360 963 11901 --1556
NM_021201chr1151754 1578 766 434 74 1106 1744 --
NM_021205chr171821 646 542 519 472 460 41 22773 1159 12752 --
NM_021229chr1241059 775 479 82 1789 1824 --
NM_021255chr14124117 4089 3561 3511 3445 3244 3157 3092 913 540 335 228 53583 2623 1357 1078 967 13035 --
NM_021572chr631024 895 499 1918 2107 84 --
NM_021629chr3124998 4989 4109 3842 3734 3291 3269 1819 1588 963 401 143 11199 --147
NM_021635chr671817 1434 666 481 324 263 101 41525 1419 1390 306 11795 1468
NM_021647chr484721 3793 3668 3487 3264 1518 720 37 54234 4216 4045 2938 1354 --13230
NM_021813chr675745 5305 4921 4422 4134 1642 526 24505 3546 12047 21258 96
NM_021814chr631227 519 28 31390 1075 513 31625 1347 573 1535
NM_021815chr252933 2378 1962 1107 982 22402 156 21884 1208 --
NM_021911chr5104826 4779 3641 3529 2000 1448 1426 1034 757 47 45026 3837 3619 3566 --24473 577
NM_021912chr1554198 3652 3614 938 442 11692 --11176
NM_021949chrX62702 2289 1942 1795 889 664 22883 2149 22086 28 12424
NM_021954chr1362950 2834 2814 2332 571 282 161 12626 155
NM_021961chr11177464 7067 6968 6757 5982 5592 5470 5234 4835 4809 2797 2745 2132 1889 954 607 573 22191 489 46520 5771 3002 1944 25068 596
NM_021964chr376046 5841 5436 4894 4460 1312 242 46444 6018 1220 503 25309 510 11141
NM_021999chr134826 779 279 153 1684 1737 --
NM_022041chr1672153 1972 952 812 578 193 87 32054 1885 411 ----
NM_022048chr1585772 4993 4917 4389 4269 4215 2507 864 35596 5226 117 35785 5453 2485 21423 939
NM_022103chr1951311 960 801 334 182 41072 893 125 25 2934 324 --
NM_022114chr1154698 4556 4312 3839 3801 3794 3636 3571 3027 1541 1252 1011 739 603 156 2682 515 14600 14272
NM_022121chr661245 990 773 299 115 60 11160 ----
NM_022133chr871819 1734 1293 581 448 344 315 180 ----
NM_022166chr16135500 4530 4418 4177 3987 3980 1255 1104 1095 954 932 878 393 1544 34543 4262 2382 --
NM_022351chr883795 3322 3304 2906 2571 985 417 354 33591 2372 1299 33647 3066 1162 12933
NM_022444chr761743 433 247 219 143 101 ----31640 473 386
NM_022456chr12287470 7383 6979 6765 6518 6478 6225 5910 5859 5812 5583 5405 5239 5216 5053 2804 2708 2484 2357 2325 2201 2073 2012 1772 1475 905 794 357 55451 2566 2439 2347 1626 22827 1894 --
NM_022459chr1375546 4028 2034 1487 1448 1378 126 45778 5463 5026 2055 22314 945 15806
NM_022473chr1563961 3283 2817 1661 1359 648 13275 54345 4081 3220 3170 225 --
NM_022474chr1432423 1980 394 11838 --1483
NM_022476chr162351 163 2698 308 1734 --
NM_022491chr12103292 3076 2720 2670 2508 2329 2249 2237 1377 1272 23542 2844 13120 11410
NM_022716chr163055 2888 2565 1143 342 44 22745 495 32501 1218 360 138
NM_022735chr141440 1290 612 399 1628 11587 --
NM_022753chr142746 1932 302 291 32408 2239 1795 1377 --
NM_022763chr333052 1971 172 1567 --1650
NM_022780chr261854 1466 1405 1246 126 36 --11289 1484
NM_022781chr973191 3125 2105 2070 1269 1056 390 12035 ----
NM_022787chr162628 2509 1033 780 758 231 3905 433 101 1209 --
NM_022802chr1041543 456 387 263 21437 1365 1143 --
NM_022841chr1552320 1871 1744 402 346 --22701 1098 --
NM_022898chr14114269 4077 3452 3338 3058 3022 1723 1065 761 169 40 34808 4157 3658 44352 3766 3737 1010 21715 486
NM_022977chrX2865 693 2522 136 --1804
NM_023000chr1441323 1113 587 327 --11551 --
NM_023001chr1441323 1113 587 327 --11551 --
NM_023016chr232265 1996 949 22087 1028 42722 1756 430 79 --
NM_023923chr193657 2345 1495 1248 830 808 457 390 276 --12323 12301
NM_023929chr862171 2078 2031 1962 945 404 1559 ----
NM_024007chr5102584 2223 2115 2085 2007 1176 1144 813 326 146 2928 520 12291 12020
NM_024090chr441603 1342 399 289 31494 1417 669 123 1524
NM_024306chr1641167 1056 1041 913 1944 --11229
NM_024341chr19123832 3505 3108 1408 1359 1167 1138 978 896 792 401 344 13940 33601 583 559 --
NM_024416chr92346 265 ----11257
NM_024512chr363295 2865 2683 2567 2444 461 1307 33084 2843 114 --
NM_024594chr531775 1212 54 ----192
NM_024613chr841753 1628 1406 118 21724 340 11188 21811 48
NM_024639chr662766 2403 1029 448 281 198 12868 2872 505 --
NM_024665chr384451 3799 3721 3471 3028 2900 1738 95 ------
NM_024674chr182902 2533 2511 2068 1247 961 400 381 32977 1276 1125 ----
NM_024713chr1551629 649 636 158 134 61168 611 605 569 502 389 2379 147 1109
NM_024744chr252652 2494 632 575 106 22434 2409 --1727
NM_024761chr994439 4352 3975 3934 2018 1530 1255 277 215 25282 5270 15323 --
NM_024770chr2166371 4743 4694 2560 2521 2453 2258 2015 1993 1154 1036 989 913 725 372 29 11176 25789 4084 --
NM_024780chr167948 921 899 447 385 343 131 11146 ----
NM_024812chr842078 1624 1591 1575 1523 --12133
NM_024817chr15105891 5716 4840 4603 4304 2051 996 861 671 192 44989 4121 3940 1905 54972 4101 4010 1923 1008 11064
NM_024834chr1061959 1872 1749 705 547 108 21317 586 --1128
NM_024854chr1251488 1408 1366 345 54 --2508 169 11026
NM_024884chr1474470 4345 3979 3104 2888 1639 649 23124 1334 13087 22960 376
NM_024920chr42500 129 31555 179 105 11273 --
NM_024930chr542014 974 559 28 1100 32363 2133 424 12170
NM_024944chr2141145 1124 837 496 --21050 89 1896
NM_024947chr398747 8668 6811 6559 6251 3753 1466 1354 883 28889 8423 2785 476 --
NM_024949chr4134580 4488 4451 4278 4256 4218 3982 1756 1684 1409 1328 620 211 45036 4520 3736 609 54203 4089 3694 3158 1038 --
NM_024953chr1282715 2518 2486 2394 2171 1729 740 188 --1442 --
NM_024989chr297850 6301 5980 5853 5642 5528 3291 1987 894 37094 6713 6290 26707 5470 --
NM_025073chr174219 3393 3296 880 327 306 267 44263 4243 3194 1691 13758 --
NM_025074chr482418 2015 1986 683 622 173 99 35 --11027 --
NM_025160chr173774 3035 2742 739 569 136 125 34182 3829 1378 23620 2648 --
NM_025179chr1103406 3285 1832 1808 1461 1010 966 758 728 117 33614 3473 1159 33023 1544 1267 11507
NM_025191chr182659 2515 1074 867 832 762 296 212 23099 628 33451 1377 639 --
NM_025222chr332770 2357 55 --32335 2102 592 22013 392
NM_025235chr1041574 646 91 41 --11913 1860
NM_025263chr651896 1852 625 468 301 21602 1364 11215 --
NM_030582chr2161044 1009 342 304 197 51 --11247 21286 162
NM_030621chr1493592 3514 3304 2644 2578 1257 857 676 257 34070 4060 3748 23819 3501 --
NM_030625chr1032190 1755 565 1370 1711 12474
NM_030627chr553764 3161 1453 874 837 31619 1288 1089 11648 23539 255
NM_030647chr7105953 5576 5377 4840 4551 2416 1917 1864 601 232 15385 34464 4013 39 --
NM_030648chr4135368 4596 4508 4043 4021 3921 3781 3630 3447 1916 852 40 27 44232 1795 1152 1082 35275 4482 4011 --
NM_030650chr274278 3758 3510 3501 3157 3114 394 --14090 11287
NM_030674chr12135513 5464 5154 5147 4869 4767 4608 3846 3717 3688 1470 1410 829 23857 2006 ----
NM_030759chr10183 1264 1516 2788 606
NM_030761chr162556 2409 1854 962 817 696 11977 32364 495 152 22351 1971
NM_030773chr2061868 1799 1575 1395 1126 625 1686 ----
NM_030786chr131643 1306 109 31496 723 379 1603 11634
NM_030791chr1441314 512 362 75 21876 384 --11648
NM_030806chr1198952 8926 8794 8225 7847 6637 6155 5872 3137 3113 2779 2257 2209 2100 1680 1438 1008 65 23 58311 8276 7830 5891 1164 1973 18188
NM_030816chr1123635 3212 3129 3100 2554 2301 1446 1406 1147 1105 493 50 33468 2240 582 ----
NM_030817chr12103620 2722 1389 1357 1107 1030 666 657 483 39 ----11234
NM_030918chr1105273 5215 4768 4669 4353 4241 1764 580 530 179 2949 277 13465 --
NM_030920chr152122 1834 848 839 712 ----11653
NM_030964chr561266 942 825 323 225 38 13055 32539 846 154 1867
NM_030972chr195693 581 497 245 161 --139 --
NM_031216chr1842256 2194 1955 211 1797 1827 1287
NM_031268chr16155233 4708 4264 4100 3885 3514 3465 2130 1143 1042 766 360 188 123 84 --1886 --
NM_031271chr831383 272 120 31558 1196 365 ----
NM_031296chr452773 2711 2514 2459 738 11748 12630 11790
NM_031411chr582176 2134 726 640 613 121 112 23 21644 700 ----
NM_031418chr1192645 2168 1837 772 757 363 250 103 76 1627 1230 --
NM_031426chr972812 2463 2307 1725 914 634 266 42650 866 362 260 1327 --
NM_031427chr14195292 5234 5031 4985 4866 4727 4236 3940 3701 2354 2199 1952 1893 1627 1605 1356 944 569 299 25821 5012 22061 221 23825 507
NM_031435chr12113438 3244 3221 2886 2472 2280 2150 1385 656 630 275 12373 1950 --
NM_031445chr293451 3414 3152 3088 2381 2307 822 606 587 13359 12486 1434
NM_031461chr852250 1733 413 369 215 11931 12199 --
NM_031468chr7187927 7576 7514 6593 6577 6045 5371 2813 2367 2221 2170 1732 1505 1000 717 552 527 123 35691 1894 1783 13043 --
NM_031469chr684048 3845 3253 2561 1548 619 579 95 32751 2499 184 23318 2953 13557
NM_031476chr1682866 2390 1921 1762 902 580 375 101 12532 11115 12072
NM_031844chr173883 3450 3198 2771 1438 1400 527 42743 2604 2573 602 43579 3428 2724 1426 --
NM_031845chr263248 3229 2675 2395 1448 96 23497 430 --32906 1270 1207
NM_031847chr263248 3229 2675 2395 1448 96 23497 430 --32906 1270 1207
NM_031849chr582176 2134 726 640 613 121 112 23 21644 700 ----
NM_031857chr582176 2134 726 640 613 121 112 23 21644 700 ----
NM_031858chr1771401 1382 318 292 248 175 78 1169 ----
NM_031860chr582176 2134 726 640 613 121 112 23 21644 700 ----
NM_031862chr1771401 1382 318 292 248 175 78 1169 ----
NM_032041chr8102714 2688 2524 2179 2115 1992 1830 1774 693 331 31805 1795 765 11672 --
NM_032042chr582754 2666 2329 2319 2199 2168 1033 311 32098 2023 757 12125 --
NM_032102chr1183120 2348 2120 2098 2008 1976 1893 1037 12885 12218 --
NM_032116chr1374255 2346 1901 1755 1218 1086 251 35480 3835 1438 35054 4418 1266 --
NM_032145chr63748 538 66 1310 ----
NM_032160chr1854321 2649 1204 619 354 ----11182
NM_032182chr1051638 1483 516 500 275 1357 11108 --
NM_032189chr13115097 5041 4851 4283 4261 3919 1874 1783 1529 1415 1317 14923 ----
NM_032199chr1093433 3305 2830 2801 2672 2658 1017 553 465 ------
NM_032208chr2133586 3339 2990 2950 2678 2535 1417 1023 884 528 317 266 36 42748 2484 862 808 2694 305 --
NM_032217chr451299 929 532 505 86 --150 --
NM_032221chr2021659 1586 21862 1603 --1440
NM_032228chr1143494 628 226 102 12692 23292 3234 --
NM_032229chr135983 386 233 150 118 11185 1172 --
NM_032291chr121605 456 31864 1408 93 2575 468 11805
NM_032321chr253027 908 772 630 445 12252 22998 658 --
NM_032329chr2124149 4047 3501 1744 1248 1207 1123 966 843 701 153 83 --33690 3362 3211 13549
NM_032373chr10105613 3994 2154 2002 1870 1627 1379 1051 257 204 1182 13973 35162 1516 425
NM_032433chr1911441 1185 --11388
NM_032434chr241424 1398 414 299 2401 293 1390 --
NM_032435chr152361 1879 1540 574 256 1475 31910 1804 767 --
NM_032440chr1032694 884 443 32659 516 504 22096 399 --
NM_032445chr1572562 2508 2351 2231 1898 1768 984 ----12457
NM_032446chr583406 2876 2517 2401 1429 934 129 32 43737 3417 3200 3156 11067 --
NM_032457chr473436 3385 3066 1034 904 802 340 22616 2420 22959 193 --
NM_032458chrX32451 1279 1135 53324 3250 1049 412 242 ----
NM_032509chr882619 1861 1844 1817 648 577 246 162 12012 12162 21681 665
NM_032521chr2032634 2352 1187 23196 2839 --22715 2090
NM_032547chr43528 355 245 ----11198
NM_032646chr1751799 1516 1466 1106 540 11094 11743 21711 86
NM_032682chr353649 3300 3195 2699 1260 22886 399 --11182
NM_032689chr1941559 402 388 165 --31622 1511 322 --
NM_032711chr1763855 3752 3029 1482 887 843 21050 616 13479 13450
NM_032717chr441073 1025 932 795 ------
NM_032737chr1972709 2464 2361 2251 367 257 52 22124 418 22214 976 --
NM_032778chr32220 125 13107 --22701 974
NM_032801chr1191826 1638 1023 632 587 440 229 167 59 --22326 346 --
NM_032804chr1042286 1619 487 285 21702 554 12404 --
NM_032818chr951951 379 286 260 172 12172 11929 21892 349
NM_032826chr7104208 2047 1929 1593 1305 1074 849 183 126 24 45082 3855 828 504 --13957
NM_032859chr1353818 3151 1312 850 350 1172 12748 --
NM_032866chr1552418 1116 1026 914 417 --1390 2927 101
NM_032873chr1174577 4410 3267 983 843 528 377 21808 1279 11527 --
NM_032932chr1796050 5880 4829 4589 4414 4399 4370 4241 3963 26453 4475 35019 4567 930 --
NM_032968chrX73350 2677 1282 1121 1058 963 945 33299 2839 1510 23673 349 13625
NM_032969chrX73350 2677 1282 1121 1058 963 945 33299 2839 1510 23673 349 13625
NM_032973chrY73345 2672 1282 1121 1058 963 945 23294 1510 23665 349 13617
NM_032975chr18103601 3564 3357 2903 2515 2495 2281 2241 936 868 23339 698 22587 152 1632
NM_032980chr18103601 3564 3357 2903 2515 2495 2281 2241 936 868 23339 698 22587 152 1632
NM_033012chr134879 417 281 245 164 --1824
NM_033014chr92346 265 ----11257
NM_033020chr194817 4133 4088 3427 2957 1592 1289 907 771 11390 --11535
NM_033083chr3113198 2880 2508 2189 1256 1211 1018 997 978 460 436 13233 22486 845 12136
NM_033143chr4113972 3705 3458 3115 1855 1811 1646 1532 886 507 241 43629 3538 260 120 23740 358 --
NM_033181chr683577 3463 2951 2595 2468 2409 1332 266 --13222 --
NM_033211chr552062 1961 1857 1526 735 125 1168 --
NM_033222chr941406 1211 934 889 11066 1950 --
NM_033224chr7107789 6940 5178 3020 2710 2362 1332 1042 672 370 77465 7329 6299 6104 4890 2385 631 47773 2279 612 472 27632 3238
NM_033225chr873198 2465 2333 2246 933 545 188 --12369 1249
NM_033272chr23327 279 261 ----1370
NM_033285chr843174 3130 1697 151 13942 --13685
NM_033300chr13956 519 344 ----11325
NM_033331chr993102 3014 2395 1312 1239 807 698 625 594 13437 12318 --
NM_033360chr12104048 4024 3875 3737 3190 3175 2941 2913 532 358 11294 23220 768 11109
NM_033389chr1784645 3617 3334 3071 1748 1480 763 682 34424 4023 234 ----
NM_033425chr11103521 3514 2743 2577 1370 913 544 204 77 32 2484 273 22542 1045 --
NM_033426chr1472967 2483 2270 1152 653 510 417 22160 591 42611 2463 1915 134 --
NM_033428chr931694 1311 809 21506 425 --1208
NM_033429chr1583296 2890 2706 2485 2452 896 456 321 11269 2741 492 --
NM_033430chr464059 3487 1044 719 681 568 --12696 --
NM_033437chr464059 3487 1044 719 681 568 --12696 --
NM_033503chr1593886 3675 3358 2795 2755 2560 1213 1142 382 1683 11079 11349
NM_033505chr2136681 6635 6604 6192 5847 5114 4593 4583 4540 1163 368 237 200 15760 --15055
NM_033551chr573110 2358 2267 2227 1250 822 335 2805 411 --1598
NM_033637chr1083453 3045 2812 2740 2717 1104 427 103 ----23885 3579
NM_033656chr2175581 4554 3902 3820 1710 1146 142 34876 4333 306 15528 --
NM_052818chr1322004 1446 --1663 1253
NM_052832chr852917 2361 1916 377 223 42091 1022 651 535 ----
NM_052869chr1751799 1516 1466 1106 540 11094 11743 21711 86
NM_052879chr1231570 1432 974 12675 --1557
NM_052885chr1243742 969 890 318 34626 3927 496 23235 1029 --
NM_052898chr851920 1704 1611 711 557 1746 1539 11798
NM_052900chr851773 1514 1451 330 37 ------
NM_052906chr22124904 4565 3917 3730 3527 1976 1717 992 740 615 523 413 1182 24385 252 1331
NM_052917chr263348 2300 1213 650 613 218 32368 2112 586 --1755
NM_052918chr1093322 3155 2902 2794 2445 2330 637 509 178 12311 --13356
NM_052928chr1781253 1156 1124 471 449 202 174 152 11723 11480 --
NM_052966chr153341 3281 2995 955 127 21059 41 23071 1105 12416
NM_052996chr1641772 1574 407 324 21417 27 31477 1465 1445 11458
NM_053016chr9157683 7554 7448 6664 6558 6083 5852 5290 4884 3089 3067 2926 2720 2008 1366 37946 2895 1384 37129 6687 6409 --
NM_053023chr1172745 2570 2402 1164 1096 1066 838 --11014 --
NM_053064chr1441983 1157 123 112 12788 --12671
NM_057169chr1262736 2679 835 784 527 402 12888 3896 715 342 --
NM_057170chr1262736 2679 835 784 527 402 12888 3896 715 342 --
NM_057175chr441032 588 552 523 42590 1801 785 285 1679 --
NM_057178chr17112713 2193 1955 1888 1790 925 904 638 570 219 118 22654 1762 ----
NM_057749chr841153 1038 907 326 11263 11211 1259
NM_058170chr121666 1564 ----11412
NM_058172chr451775 1414 1264 1175 213 180 ----
NM_078487chr972586 2502 2372 1195 919 910 620 --13117 12941
NM_080546chr941935 154 144 24 1426 1531 11781
NM_080645chr6112209 1901 1686 1657 1520 1361 798 638 440 313 106 31785 626 394 ----
NM_080666chr1481625 1492 1335 1307 1146 391 198 104 --11176 --
NM_080717chr1231252 553 542 11303 21084 178 --
NM_080743chr662398 1778 1608 1033 923 786 12605 31867 1766 1011 --
NM_080759chr1362687 2619 1808 339 203 21 2666 593 1433 --
NM_080760chr1362687 2619 1808 339 203 21 2666 593 1433 --
NM_080764chr2242712 1283 835 75 140 1110 21024 879
NM_080867chr1474096 3455 3428 3342 1455 924 766 34905 4350 579 ----
NM_080872chr8103766 3400 1496 1313 1240 1189 915 803 622 615 23148 2698 11169 1143
NM_130387chr32485 297 21268 310 --1128
NM_130391chr963563 3084 2748 2305 699 303 32884 1428 275 1290 --
NM_130392chr963563 3084 2748 2305 699 303 32884 1428 275 1290 --
NM_130393chr963563 3084 2748 2305 699 303 32884 1428 275 1290 --
NM_130434chr1551198 1094 1047 947 225 21001 202 11080 --
NM_130435chr1072913 1997 1132 802 785 721 57 12112 22183 1181 --
NM_130436chr2152394 2131 2101 2076 1886 22374 2357 12783 --
NM_130438chr2172971 2708 2678 2653 2463 590 28 22951 2934 23360 2159 --
NM_130439chr1081872 1446 602 515 448 423 235 124 22327 932 12080 --
NM_130439chr1081872 1446 602 515 448 423 235 124 22327 932 12080 --
NM_130445chr2161044 1009 342 304 197 51 --11247 21286 162
NM_130809chr563117 2414 1986 1062 749 617 --11008 12992
NM_130831chr372925 2774 2615 2253 460 442 285 --1496 1646
NM_130832chr372925 2774 2615 2253 460 442 285 --1496 1646
NM_130833chr372925 2774 2615 2253 460 442 285 --1496 1646
NM_130834chr372925 2774 2615 2253 460 442 285 --1496 1646
NM_130835chr372925 2774 2615 2253 460 442 285 --1496 1646
NM_130836chr372925 2774 2615 2253 460 442 285 --1496 1646
NM_130837chr372925 2774 2615 2253 460 442 285 --1496 1646
NM_130847chr11115213 4826 4103 4090 2320 2300 1664 834 425 266 166 25046 2220 31787 777 95 --
NM_133170chr20267877 7344 7235 7133 6894 6605 6539 6139 6064 5966 5654 5338 5148 4893 4887 2693 2481 2085 1767 1692 1572 1464 1438 1170 904 298 37861 1535 339 11948 27750 1297
NM_133264chr1773881 3863 3661 3417 1040 687 80 23686 2488 11523 --
NM_133265chrX103463 3123 3041 2996 2916 2860 2637 1362 1112 790 1889 11475 --
NM_133330chr472688 2558 2202 965 887 486 387 12314 12594 --
NM_133331chr472688 2558 2202 965 887 486 387 12314 12594 --
NM_133334chr476351 5336 4758 4155 2101 930 609 32556 408 163 12071 --
NM_133335chr472688 2558 2202 965 887 486 387 12314 12594 --
NM_133372chr51522 42640 2618 729 258 --21152 48
NM_133445chr983819 3518 2864 2791 2643 2314 1385 994 11078 13372 --
NM_133476chr1231124 1085 781 11191 11132 --
NM_133478chr2132396 2026 2004 1892 1607 1028 848 831 723 616 487 178 95 --2809 191 --
NM_133496chr174514 4134 3983 3575 3449 490 451 43728 3671 2786 578 1428 --
NM_133631chr371582 1446 1225 555 499 234 39 31478 1432 1156 --1533
NM_133646chr2125522 5150 5055 4268 3890 3602 2108 923 596 526 356 26 54650 1442 1405 200 100 13868 1878
NM_133647chr1583053 2709 1350 1292 1200 1178 242 99 21323 484 11440 --
NM_138270chrX103309 3083 2605 2598 2131 1380 979 556 514 35 21197 892 12383 --
NM_138286chr19103719 3490 3369 3059 2981 1499 768 657 404 189 1690 13966 --
NM_138288chr1472232 2044 1819 780 360 149 85 --32160 1932 66 --
NM_138348chr5156630 6426 6104 5564 5198 4737 4464 2024 1584 1510 1190 1089 741 294 252 25147 334 --31773 1676 955
NM_138423chr1542313 2298 2105 832 2260 227 21983 49 1841
NM_138444chr13174679 4406 4347 4014 3898 3736 3722 3569 3534 1784 1707 1644 772 418 293 238 137 1607 ----
NM_138459chr683621 3614 3404 2756 2701 2418 1377 85 22779 818 11308 151
NM_138468chr2136262 5366 5170 4460 4162 2289 1853 1460 571 497 346 226 153 24410 4114 42267 1438 561 251 --
NM_138473chr12124645 4034 3784 1946 1893 1778 1555 1448 1080 843 486 349 15183 22052 1491 23378 2077
NM_138494chr772796 2012 1985 1779 357 238 158 --42731 1757 373 77 --
NM_138576chr14114269 4077 3452 3338 3058 3022 1723 1065 761 169 40 34808 4157 3658 44352 3766 3737 1010 21715 486
NM_138621chr283818 3114 2995 2755 1440 443 352 253 33247 2783 54 11395 12561
NM_138713chr16127274 6825 6785 6285 6097 5408 5327 2813 2322 2061 1868 528 57101 6808 5253 2548 1129 16362 15839
NM_138714chr16127274 6825 6785 6285 6097 5408 5327 2813 2322 2061 1868 528 57101 6808 5253 2548 1129 16362 15839
NM_138959chr1106656 6237 5995 5384 5110 5058 4421 1736 773 113 21625 272 46362 1813 410 239 11039
NM_138971chr1183333 3326 3052 2611 1078 890 551 280 13524 13571 23635 421
NM_138971chr1183333 3326 3052 2611 1078 890 551 280 13524 13571 23635 421
NM_138972chr1183333 3326 3052 2611 1078 890 551 280 13524 13571 23635 421
NM_138972chr1183333 3326 3052 2611 1078 890 551 280 13524 13571 23635 421
NM_138973chr1183333 3326 3052 2611 1078 890 551 280 13524 13571 23635 421
NM_138973chr1183333 3326 3052 2611 1078 890 551 280 13524 13571 23635 421
NM_139182chr461770 731 517 401 361 316 21632 1516 31609 623 371 --
NM_139276chr1782418 2012 1761 899 692 670 584 239 11811 196 --
NM_139321chr2084057 3908 3139 2733 696 449 421 116 11359 ----
NM_144498chr2062225 2111 730 694 608 414 --1282 192
NM_144567chr172848 2703 1105 627 426 383 136 ----12584
NM_144571chr4116648 5610 5407 5145 4695 2770 2504 2325 977 531 391 46442 6430 6309 61 14421 34940 2804 188
NM_144578chr14105555 4888 3973 3748 2216 1400 1044 828 295 208 13674 25079 303 21733 666
NM_144609chr1751190 1080 1018 957 507 21131 140 ----
NM_144618chr131174 173 112 2438 89 11070 --
NM_144664chr115792 749 655 499 65 11748 11991 1811
NM_144718chr322003 214 21906 647 11997 12565
NM_144726chr53317 284 109 --11105 1800
NM_144949chr262627 2509 2243 2236 1035 598 1443 11780 --
NM_144963chr842666 1922 569 457 31736 835 255 --12321
NM_144973chr12105111 4674 4012 3787 3389 1734 1711 1429 1174 425 23624 1237 34453 2095 359 13330
NM_145049chr51764 2712 421 2437 71 --
NM_145055chr1863835 3626 3499 3433 837 290 13116 11063 13555
NM_145117chr1183120 2336 2132 1313 672 605 587 130 22419 1267 --22715 368
NM_145165chr1492845 2827 2550 2419 1102 951 716 535 426 22865 564 31917 1094 312 --
NM_145176chr643287 597 461 174 22303 1190 --13554
NM_145207chr454099 3262 1655 1585 1039 35140 4356 4018 15024 --
NM_145244chr471358 1093 408 342 274 105 47 21513 1477 ----
NM_145259chr276484 2505 1643 1619 893 627 27 67084 5317 4574 1548 1437 331 --14325
NM_145307chr10104430 4176 4052 3880 3621 1618 1369 1212 429 370 13030 ----
NM_145320chr793403 3381 3355 2942 2739 2580 2215 1224 237 42867 2353 1328 370 ----
NM_145321chr793403 3381 3355 2942 2739 2580 2215 1224 237 42867 2353 1328 370 ----
NM_145322chr793403 3381 3355 2942 2739 2580 2215 1224 237 42867 2353 1328 370 ----
NM_145686chr263057 1375 1320 1090 940 723 1214 21166 1022 --
NM_145687chr263057 1375 1320 1090 940 723 1214 21166 1022 --
NM_145799chrX62888 2230 2130 1165 180 31 23024 1903 12377 22242 223
NM_145808chr742484 2365 2305 1155 --32093 721 193 --
NM_147147chr664130 4027 3707 2772 2627 1061 33601 3157 1620 11461 --
NM_147150chr963671 3065 2756 2645 800 128 2698 301 42629 2581 2534 330 252 44
NM_147175chrX42155 1947 1822 235 21527 245 ----
NM_148170chr11125246 4621 4457 3990 1954 1660 1587 1124 943 510 373 30 64899 4880 4192 4023 1223 1146 35215 4663 4218 --
NM_148174chr861566 743 415 291 153 120 1837 ----
NM_148955chr15115969 5680 5425 5338 5281 5066 4547 4343 2043 936 386 26587 5039 24525 4242 26273 6205
NM_148957chr1372569 2033 1865 188 172 143 41 21717 124 ----
NM_152261chr1262160 2115 1870 1568 967 382 1791 --22358 160
NM_152263chr1136079 5338 4913 4876 4111 4089 3974 3750 1063 472 317 192 54 25896 817 35237 1041 540 46019 5954 5139 4334
NM_152277chr562068 1792 1731 1540 495 84 --2811 411 1167
NM_152330chr1452619 2197 762 602 538 21878 557 ----
NM_152352chr185944 784 449 284 170 22982 813 154 12179
NM_152381chr221668 1259 5771 762 212 175 38 11209 --
NM_152388chr293697 3532 2894 1034 958 876 733 457 320 13414 21356 234 --
NM_152400chr431481 558 107 3510 336 159 ----
NM_152409chr562304 2292 1220 1000 729 234 33401 2901 419 1333 --
NM_152420chr92257 104 171 --157
NM_152423chrX31481 1443 1264 11166 1198 11369
NM_152450chr1561943 1683 1405 709 638 236 --21923 1698 1382
NM_152529chr2123707 3620 3505 3367 3160 2815 1296 1274 1184 898 451 429 33285 1443 222 34315 3923 3138 --
NM_152542chr491649 1623 1484 1391 683 661 372 118 60 22208 2190 12114 12088
NM_152556chr71344 22222 43 1221 1888
NM_152609chr131193 966 895 --2987 833 2770 113
NM_152622chr54853 709 578 371 23109 2712 33255 1214 644 --
NM_152624chr5136986 6727 6662 6347 6266 6175 6135 4836 4794 1371 909 397 40 12024 35038 4867 1841 27342 2401
NM_152629chr9113505 3489 2896 2843 2784 2676 2664 845 508 469 451 23140 1012 1694 --
NM_152641chr12102684 2611 2456 2258 2252 2000 970 425 287 96 --22087 533 --
NM_152678chr382514 2476 2442 2423 2183 2076 879 857 12735 11794 --
NM_152680chr442404 2363 472 381 22248 106 1692 --
NM_152694chrX2224 89 --1298 1778
NM_152699chr363519 2443 1348 1290 816 330 23778 1327 ----
NM_152704chr135999 850 423 411 388 --2785 62 --
NM_152737chr641761 1537 829 549 11609 11418 --
NM_152754chr733005 428 180 23452 1443 --23354 2945
NM_152756chr574131 3985 3950 3601 3285 2658 738 43437 3197 1090 695 ----
NM_152774chr772759 2534 2525 2435 2410 1761 893 ------
NM_152780chrX51119 917 900 194 186 ------
NM_152787chrX93690 3468 2887 1369 1099 919 232 64 36 33973 3134 434 13865 11054
NM_152793chr7145028 4537 4350 4221 4017 3958 3939 3901 3629 3141 900 829 687 574 --23482 872 13893
NM_152826chr15115969 5680 5425 5338 5281 5066 4547 4343 2043 936 386 26587 5039 24525 4242 26273 6205
NM_152829chr71101 2980 401 1253 1115
NM_152835chr132760 1802 387 12497 1589 1997
NM_152836chr871819 1734 1293 581 448 344 315 180 ----
NM_152837chr871819 1734 1293 581 448 344 315 180 ----
NM_152838chr2043037 2807 839 739 --32500 846 250 13434
NM_152873chr1031498 1135 434 2346 62 11688 1214
NM_152877chr1031498 1135 434 2346 62 11688 1214
NM_152903chr1382071 1997 1051 938 849 725 628 606 1196 ----
NM_152924chr1586601 5485 5463 4266 2476 2410 2265 1777 32096 547 287 21332 572 12468
NM_152996chr142130 1767 1738 1389 1650 --1360
NM_152999chr7114610 4527 4192 3937 3916 3708 3310 3110 1345 338 108 --14557 --
NM_153013chr572538 2433 2315 2073 2003 673 324 2432 203 ----
NM_153015chr84949 674 647 173 2659 120 1194 --
NM_153018chr1763206 2421 2110 2051 1080 369 12667 12975 --
NM_153042chr651848 1138 405 395 92 21838 1392 11703 1365
NM_153050chr22105063 4208 3111 1903 958 936 469 413 393 229 31282 975 274 1109 --
NM_153051chr22105063 4208 3111 1903 958 936 469 413 393 229 31282 975 274 1109 --
NM_153182chr32220 125 13107 --22701 974
NM_153188chr575251 4860 3563 1898 416 355 115 33711 750 546 11843 14329
NM_153207chr12103799 3232 3140 3093 2630 2554 1622 1523 1467 964 12964 31409 991 849 --
NM_153261chr1641279 588 331 68 1349 11186 --
NM_153262chr173159 3065 2869 2159 1006 348 208 2324 238 --1698
NM_153331chr32250 73 2704 548 --1556
NM_153332chr833205 3152 692 21306 1004 42926 2805 2708 388 --
NM_153365chr462638 2478 2207 613 386 176 22390 827 ----
NM_153456chr13135914 5840 5547 2164 1840 1556 1491 1242 651 613 542 388 335 45618 5448 2470 360 11984 34623 4507 4002
NM_153499chr12102794 2365 2211 2133 1981 1070 909 564 422 189 12301 21007 571 --
NM_153500chr12102794 2365 2211 2133 1981 1070 909 564 422 189 12301 21007 571 --
NM_153607chr592874 2455 2356 2328 2063 620 343 231 194 12963 ----
NM_153616chr1532433 1818 125 31996 1695 110 21617 1582 --
NM_153617chr1532433 1818 125 31996 1695 110 21617 1582 --
NM_153618chr1532433 1818 125 31996 1695 110 21617 1582 --
NM_153619chr1573671 3056 2658 1363 1217 702 431 33234 2933 1348 22855 2820 --
NM_153634chr1221521 81 2163 36 21414 591 --
NM_153645chr2222149 177 33246 2819 267 1827 --
NM_153649chr151881 930 841 530 498 --12230 1689
NM_153689chr252013 1781 1495 874 224 1359 --11756
NM_153810chr1075028 5003 4463 4239 739 311 296 2437 171 24931 4262 --
NM_170606chr751480 1461 1260 652 351 21653 714 1424 --
NM_170665chr1294140 3850 3696 3676 3413 2870 1741 1719 1574 54025 2981 1617 464 387 24429 3179 --
NM_170706chr133481 823 153 --1532 14259
NM_170707chr11276 2958 297 --3781 320 103
NM_170708chr11276 2958 297 --3781 320 103
NM_170709chr8102428 1831 1625 1536 866 477 423 274 126 57 --42056 678 457 22 --
NM_170750chrX--1208 --1893
NM_170751chr61520 21474 529 --11239
NM_170752chr61520 21474 529 --11239
NM_171998chrX72402 2245 1832 1737 1624 1596 1011 32386 996 554 --11772
NM_172037chr851395 1288 1179 963 526 21470 122 1237 --
NM_172069chr241948 1468 491 380 ----12212
NM_172070chr272218 2015 1782 1686 1413 910 130 1728 --1789
NM_172071chr1107325 6988 6703 5874 5810 5412 2694 2556 2101 110 34893 556 472 16659 --
NM_172103chr652672 2529 2341 814 190 22613 1026 1112 --
NM_172105chr652672 2529 2341 814 190 22613 1026 1112 --
NM_172216chr12102696 2267 2113 2035 1883 972 811 466 324 91 12203 2909 473 --
NM_172226chr12102794 2365 2211 2133 1981 1070 909 564 422 189 12301 21007 571 --
NM_173075chr431641 1325 651 1672 --1563
NM_173198chr962192 1001 563 497 174 78 12342 42850 2842 1890 800 --
NM_173200chr962192 1001 563 497 174 78 12342 42850 2842 1890 800 --
NM_173214chr16127274 6825 6785 6285 6097 5408 5327 2813 2322 2061 1868 528 57101 6808 5253 2548 1129 16362 15839
NM_173354chr2151954 1748 1668 750 198 21471 83 11875 1562
NM_173355chr24412 307 219 132 ----1350
NM_173463chr4104483 4408 3906 3778 3063 1136 331 138 128 107 2544 118 64422 4079 3754 3553 1396 391 23429 830
NM_173468chr4136063 5843 5827 5607 4993 3829 2299 1693 1463 1395 700 508 189 14047 35663 4645 159 1183
NM_173469chr1571578 1388 1212 959 509 476 450 11000 ----
NM_173470chrX112299 2287 2275 2237 1847 993 901 876 813 264 131 22875 2094 12674 1455
NM_173473chr10112707 2367 2329 2177 2159 1861 1839 802 646 249 45 1293 12137 --
NM_173495chrX92305 2279 2264 1697 1691 863 578 564 277 3741 295 46 ----
NM_173496chr1032783 2750 2006 22570 2564 22490 2153 2195 53
NM_173531chr19113736 3601 2974 2428 880 726 626 426 234 219 166 22457 913 ----
NM_173562chr6153186 3140 2994 2819 2610 2582 2540 2267 2067 1240 852 758 726 668 618 22620 2099 23164 800 --
NM_173576chr1041953 873 463 219 31788 1446 809 1385 --
NM_173582chr11165365 5199 4961 4845 4665 4525 4485 4379 4202 4158 2409 1957 1720 1701 1339 1106 15466 11468 --
NM_173595chr12104506 4166 3711 3692 2124 1891 1798 923 460 128 31969 1302 683 14995 11099
NM_173602chr1273669 3046 2933 2562 2341 1257 478 32904 871 768 21231 924 --
NM_173642chr1189004 8521 8354 7781 7739 7146 5722 3415 3248 3147 3074 2982 1832 1536 1262 1021 919 108 130 78604 7549 2786 1384 1203 857 102 --
NM_173808chr194436 4248 3467 3160 1565 1467 1328 718 699 64275 3950 1794 1319 1249 990 1909 --
NM_173829chr585611 5532 5424 5292 4244 4078 192 99 26191 4889 11438 14467
NM_173832chr8143622 2780 2529 1424 1340 1315 1265 1240 1190 1165 1140 1062 887 181 1973 2306 234 --
NM_173851chr883051 2911 1541 1438 1412 1036 1009 727 14023 43772 2605 906 368 190
NM_175607chr371604 1586 1489 1201 527 422 201 ------
NM_175612chr371604 1586 1489 1201 527 422 201 ------
NM_175623chr12287470 7383 6979 6765 6518 6478 6225 5910 5859 5812 5583 5405 5239 5216 5053 2804 2708 2484 2357 2325 2201 2073 2012 1772 1475 905 794 357 55451 2566 2439 2347 1626 22827 1894 --
NM_175624chr12287565 7478 7074 6860 6613 6573 6320 6005 5954 5907 5678 5500 5334 5311 5148 2899 2803 2579 2452 2420 2296 2168 2107 1867 1570 1000 889 452 55546 2661 2534 2442 1721 22922 1989 --
NM_175625chr12287565 7478 7074 6860 6613 6573 6320 6005 5954 5907 5678 5500 5334 5311 5148 2899 2803 2579 2452 2420 2296 2168 2107 1867 1570 1000 889 452 55546 2661 2534 2442 1721 22922 1989 --
NM_175634chr831215 1068 321 1362 --152
NM_175635chr831215 1068 321 1362 --152
NM_175636chr831215 1068 321 1362 --152
NM_175861chr12145682 5087 4057 2193 1900 972 950 940 777 706 487 440 310 64 11500 25743 5716 1663
NM_175876chr121704 948 1143 2783 450 12070
NM_175907chr1882498 2106 2028 1149 935 504 445 354 42319 2163 71 24 1739 12733
NM_175910chr1982279 1703 947 702 618 366 282 114 11883 1866 --
NM_176081chr1085909 4591 1727 1665 1462 1069 596 238 42403 945 499 292 35825 1745 1028 --
NM_176083chr1085909 4591 1727 1665 1462 1069 596 238 42403 945 499 292 35825 1745 1028 --
NM_177398chr171911 1849 1842 1832 1620 1476 285 ------
NM_177399chr171911 1849 1842 1832 1620 1476 285 ------
NM_177424chr13682 482 424 11346 --1129
NM_177438chr1493592 3514 3304 2644 2578 1257 857 676 257 34070 4060 3748 23819 3501 --
NM_177452chr1452492 2396 974 205 189 ------
NM_177538chr2248882 8317 8234 7854 6614 3224 3092 2959 2793 2771 2511 2120 1952 1892 1784 1606 1306 896 760 623 487 218 86 21 45716 3424 3133 304 77139 5429 1930 1584 1405 1284 465 --
NM_177952chr147772 583 538 337 240 221 69 ------
NM_177966chr321928 151 --21481 1227 11460
NM_177968chr232000 444 131 1292 1267 1695
NM_177972chr1164275 3965 1108 957 946 715 23778 3157 43220 1393 1377 1278 --
NM_177974chr1542313 2298 2105 832 2260 227 21983 49 1841
NM_177985chr252248 1496 726 383 137 12199 ----
NM_177990chr2072039 1876 1857 1427 265 150 104 21694 581 ----
NM_177996chr2093457 3251 3092 2473 2110 1085 380 51 43 --42724 2590 2311 850 --
NM_178011chr1042943 2909 1109 501 32177 2147 681 22470 2399 --
NM_178037chr1293241 2755 2436 2269 1256 444 385 313 129 23173 2964 1732 12548
NM_178038chr1293241 2755 2436 2269 1256 444 385 313 129 23173 2964 1732 12548
NM_178140chr562502 725 190 144 68 49 21975 968 --1983
NM_178151chrX77603 7320 7190 3000 1985 1800 1322 37090 2376 578 16418 46611 3061 1579 942
NM_178152chrX77603 7320 7190 3000 1985 1800 1322 37090 2376 578 16418 46611 3061 1579 942
NM_178153chrX77603 7320 7190 3000 1985 1800 1322 37090 2376 578 16418 46611 3061 1579 942
NM_178426chr132342 1763 141 --12178 11740
NM_178427chr132242 1663 41 --12078 11640
NM_178498chr11103682 3408 3095 2491 2467 1475 1450 1335 1156 874 24054 218 12523 --
NM_178509chr1763773 3654 1477 1169 1096 566 32763 2739 187 22861 239 --
NM_178539chr1241995 1969 1889 58 21984 633 1843 1159
NM_178554chr393263 2972 2900 2667 2421 2377 1367 1067 108 13365 1614 --
NM_178585chr432821 670 482 32493 491 357 22265 26 33119 2449 2352
NM_178586chr1482229 1727 1690 1576 1537 920 905 636 1381 --12070
NM_178818chr16102220 1897 961 940 838 672 507 372 241 200 --1904 --
NM_180989chr1342518 2388 1529 395 --1412 11840
NM_181332chrX61936 1828 656 554 365 106 --22244 989 --
NM_181349chr742410 2336 1979 905 43004 935 802 46 23051 1919 --
NM_181351chr1162127 1011 402 372 355 273 42511 1193 308 163 1296 --
NM_181354chr83517 486 166 21738 1369 --11131
NM_181358chr193295 3242 3087 2694 1536 862 446 377 162 22951 1429 11056 --
NM_181443chr2062920 2459 2219 2074 2063 796 2864 776 12466 --
NM_181481chr18117075 7062 6665 6020 5555 5532 2729 1328 1276 429 170 52785 1817 1551 760 114 17025 34885 4506 39
NM_181482chr18117075 7062 6665 6020 5555 5532 2729 1328 1276 429 170 52785 1817 1551 760 114 17025 34885 4506 39
NM_181483chr18117075 7062 6665 6020 5555 5532 2729 1328 1276 429 170 52785 1817 1551 760 114 17025 34885 4506 39
NM_181486chr1231252 553 542 11303 21084 178 --
NM_181504chr564217 3703 3311 2877 1002 257 13923 1110 13371
NM_181521chr16207001 6678 5742 5721 5619 5453 5288 5153 5022 4981 4739 4477 2746 2726 2674 2388 2042 1919 1401 783 --25685 613 12135
NM_181523chr564217 3703 3311 2877 1002 257 13923 1110 13371
NM_181524chr564217 3703 3311 2877 1002 257 13923 1110 13371
NM_181672chrX51649 1604 1292 548 190 21352 722 --11985
NM_181673chrX51649 1604 1292 548 190 21352 722 --11985
NM_181705chr5145096 4120 4085 3919 3525 2111 1942 1920 1628 1539 786 684 646 442 1236 23897 1517 13580
NM_181714chr631590 1518 442 --1615 1212
NM_181787chr843411 2771 990 866 1473 12749 13925
NM_181789chr1582775 2710 2310 2016 1281 1275 603 71 --22194 975 12855
NM_181838chr551539 1522 1434 236 174 ----11165
NM_181861chr1262756 2321 2241 2183 411 67 11924 ----
NM_181868chr1262756 2321 2241 2183 411 67 11924 ----
NM_181869chr1262841 2406 2326 2268 496 152 12009 ----
NM_181876chr462667 2361 2078 1069 976 251 22223 1992 ----
NM_181897chr332005 575 386 32708 2548 1776 11733 --
NM_182314chrX41864 1740 480 201 31776 1320 585 --11732
NM_182485chr463757 3354 3104 2354 1365 1226 21173 483 ----
NM_182487chr9104283 4172 3834 3427 3210 2944 2931 2918 1199 470 13260 23390 693 --
NM_182515chr19216085 5817 5742 5648 4649 4545 4122 4102 4089 2461 1451 1302 1260 897 690 506 497 423 413 329 165 --66714 6676 6515 6288 4627 875 --
NM_182551chr272693 1401 869 677 604 557 516 22778 1045 --1535
NM_182646chr463757 3354 3104 2354 1365 1226 21173 483 ----
NM_182662chr4--1701 --2491 198
NM_182757chr6103456 3441 3246 3157 2535 2487 1336 631 472 435 ------
NM_182762chr7176036 5579 5440 5248 5139 2081 2004 1848 1535 1387 996 981 822 678 587 421 199 36290 4827 1825 22059 1754 15664
NM_182765chr1042083 1710 762 192 31920 666 139 21766 836 11483
NM_182830chr1481460 908 892 755 405 337 235 87 22258 2145 --2816 782
NM_182898chr7176019 5695 5077 4901 4873 4609 4540 4153 2426 2143 1730 1704 1561 1299 1165 417 346 35641 5059 2076 15669 12420
NM_182899chr7176019 5695 5077 4901 4873 4609 4540 4153 2426 2143 1730 1704 1561 1299 1165 417 346 35641 5059 2076 15669 12420
NM_182907chr662364 2018 1716 1578 943 166 22136 2112 ----
NM_182918chr2131373 432 130 --11072 2550 368
NM_182948chr152546 2412 2003 223 73 2952 746 ----
NM_182964chr1183120 2336 2132 1313 672 605 587 130 22419 1267 --22715 368
NM_182970chr20133441 3167 3126 3077 2978 2918 2780 1282 791 734 294 186 133 13730 21443 42 12757
NM_183075chr443028 1854 1838 925 ----12939
NM_183238chr1293422 3402 2590 1531 1471 1325 1232 1223 86 21443 1171 --11381
NM_183416chr141699 1366 1333 799 2545 539 31970 1294 27 --
NM_183419chr81179 --1403 11040
NM_183421chr841016 888 754 100 --2729 196 1382
NM_194071chr785282 5105 5001 4553 4482 3713 1066 57 --33768 3699 139 --
NM_194247chr2134563 4225 3977 3801 3715 3040 2867 1369 1123 989 587 428 175 34066 1741 1454 1959 11196
NM_194283chr522615 1164 --21142 66 2541 48
NM_194285chr1192809 2593 2260 1133 1055 902 435 187 74 33321 993 986 22785 2771 23122 1240
NM_194286chr1275487 4541 3832 2454 1910 1072 238 25172 5060 --25597 479
NM_194292chr161744 1372 1235 440 74 42 21773 345 21208 1194 --
NM_194314chr173416 1556 1497 1373 939 596 140 43777 1684 1290 132 44604 4167 1952 1048 --
NM_194318chr13122416 2352 2279 2079 2054 2015 930 713 575 561 471 205 --11937 12342
NM_194328chr973191 3125 2105 2070 1269 1056 390 12035 ----
NM_194329chr973191 3125 2105 2070 1269 1056 390 12035 ----
NM_194330chr973191 3125 2105 2070 1269 1056 390 12035 ----
NM_194332chr973191 3125 2105 2070 1269 1056 390 12035 ----
NM_197941chr563004 2652 2641 2461 1975 649 2849 551 22252 825 --
NM_198123chr851773 1514 1451 330 37 ------
NM_198124chr851773 1514 1451 330 37 ------
NM_198128chr1871917 1869 1821 1611 801 788 445 --159 --
NM_198158chr351180 634 539 438 324 32523 855 651 --1365
NM_198159chr351180 634 539 438 324 32523 855 651 --1365
NM_198177chr351180 634 539 438 324 32523 855 651 --1365
NM_198178chr351180 634 539 438 324 32523 855 651 --1365
NM_198181chr1542763 2013 1890 1031 32879 2381 2346 ----
NM_198268chr193295 3242 3087 2694 1536 862 446 377 162 22951 1429 11056 --
NM_198269chr193295 3242 3087 2694 1536 862 446 377 162 22951 1429 11056 --
NM_198270chrX63505 3223 3183 2226 2208 683 42835 1085 773 417 12336 1339
NM_198320chr12153912 3777 3684 3410 3397 3347 3317 3167 1892 1386 1364 1205 515 493 106 --23965 3662 24305 3513
NM_198321chr583104 2794 2763 2064 1295 1193 1069 836 12282 13158 --
NM_198400chr1562919 2830 484 369 242 124 11030 12454 --
NM_198465chrX102829 2567 2371 1963 1935 1029 724 600 526 325 22088 444 --12908
NM_198468chr6134220 4188 4130 4114 3989 3528 3038 1549 1496 1011 865 712 48 1250 ----
NM_198503chr121694 154 --279 50 21570 636
NM_198513chr831307 518 496 ----11419
NM_198549chr133156 2968 895 12408 23134 873 22647 277
NM_198569chr632350 1090 591 --12593 123
NM_198581chr277188 2675 1818 1677 1413 1084 132 26761 473 22430 1340 --
NM_198793chr394187 4023 3634 3477 3224 2925 719 404 135 23858 3800 ----
NM_198844chr1741039 205 133 94 2406 104 ----
NM_198859chr354512 4089 3190 610 58 ----23749 810
NM_198889chr451299 929 532 505 86 --150 --
NM_198904chr552095 1746 1672 480 443 1256 ----
NM_198947chr112192 108 2845 386 1140 1681
NM_198968chr1383740 3514 2937 2917 1556 1484 599 176 --32686 463 32 13425
NM_199000chr762135 1943 1486 1476 279 243 31994 1722 374 --11409
NM_199040chr1283593 2967 2954 2676 2408 1163 907 447 33515 1124 195 ----
NM_199044chr192990 2660 2638 2284 681 553 342 68 61 --1277 --
NM_199050chr2173776 3566 3448 3233 2832 1496 26 43585 1557 1509 1462 ----
NM_199072chr772960 2338 2227 975 781 760 524 23188 3152 2815 502 --
NM_199132chr1991819 769 685 602 518 434 332 163 79 1208 1249 --
NM_199138chr135999 850 423 411 388 --2785 62 --
NM_199168chr1041352 1065 1053 991 2363 50 31095 1038 624 --
NM_199169chr20123568 3317 3307 3250 3141 2627 2452 1210 901 660 427 220 ------
NM_199170chr20123568 3317 3307 3250 3141 2627 2452 1210 901 660 427 220 ------
NM_199171chr20123568 3317 3307 3250 3141 2627 2452 1210 901 660 427 220 ------
NM_199188chr1231570 1432 974 12675 --1557
NM_199190chr1231570 1432 974 12675 --1557
NM_199229chr261201 546 526 92 76 36 11317 ----
NM_199320chr472870 2038 675 396 159 85 24 22779 2213 32459 459 376 --
NM_199320chr472870 2038 675 396 159 85 24 22779 2213 32459 459 376 --
NM_199321chr1741039 205 133 94 2406 104 ----
NM_199324chr462833 2540 1431 721 87 33 12405 23585 3012 --
NM_199355chr1661740 1124 593 481 313 99 11249 31176 78 62 1501
NM_199421chr1474096 3455 3428 3342 1455 924 766 34905 4350 579 ----
NM_199436chr292976 2366 2258 1983 1895 1034 795 525 148 22955 2706 ----
NM_199454chr1154698 4556 4312 3839 3801 3794 3636 3571 3027 1541 1252 1011 739 603 156 2682 515 14600 14272
NM_199461chr1093644 3398 3369 2730 2342 1217 1133 512 197 13019 33379 2441 2320 13504
NM_199478chrX41960 1686 1472 632 ----11751
NM_199482chr23740 693 358 11656 --11699
NM_199511chr37815 659 560 520 182 174 54 ------
NM_199512chr37815 659 560 520 182 174 54 ------
NM_201278chr1151719 1711 1526 445 331 31705 766 386 12002 --
NM_201281chr1151719 1711 1526 445 331 31705 766 386 12002 --
NM_201432chr17166448 5882 5810 5477 5430 5318 2560 2410 2268 2214 1910 1793 1464 874 420 340 35661 1943 1681 15405 11579
NM_201433chr17166448 5882 5810 5477 5430 5318 2560 2410 2268 2214 1910 1793 1464 874 420 340 35661 1943 1681 15405 11579
NM_201545chr161396 976 505 381 223 190 21088 29 1997 --
NM_203329chr11146975 6289 6162 5151 5050 4653 4313 2136 1719 1697 1433 275 191 171 45826 5198 1878 1263 36608 4469 2459 16909
NM_203330chr11146975 6289 6162 5151 5050 4653 4313 2136 1719 1697 1433 275 191 171 45826 5198 1878 1263 36608 4469 2459 16909
NM_203331chr11146975 6289 6162 5151 5050 4653 4313 2136 1719 1697 1433 275 191 171 45826 5198 1878 1263 36608 4469 2459 16909
NM_203349chr15102169 1504 1449 1427 864 597 430 191 127 39 1591 11680 21691 736
NM_203350chr141765 474 247 184 11288 1383 11168
NM_203372chr251355 1343 1241 481 109 11433 ----
NM_203391chrX51741 603 521 429 117 11200 --11334
NM_203446chr2142669 2538 1097 334 12074 ----
NM_203451chr1362194 1714 1661 1618 565 389 22207 400 --1372
NM_203453chr961717 1478 1368 1275 1260 69 51970 1579 1269 742 353 ----
NM_203458chr173816 3523 3369 3266 2888 1483 252 33362 805 515 ----
NM_203459chr161966 1780 1595 746 699 151 22447 1976 11627 --
NM_203463chr284542 4472 4266 3685 3227 1561 1347 527 53847 3330 2999 1426 1090 54955 4845 4656 3196 820 --
NM_203504chr482629 2027 1769 1035 999 725 451 250 2974 443 1660 --
NM_203505chr482629 2027 1769 1035 999 725 451 250 2974 443 1660 --
NM_203506chr1742191 2147 1382 735 11763 11443 2714 357
NM_205848chr152572 2462 2278 1069 644 --2675 108 21125 828
NM_206594chr163442 3019 2504 2347 634 76 32925 675 106 1577 --
NM_206595chr163442 3019 2504 2347 634 76 32925 675 106 1577 --
NM_206853chr683348 3099 3076 3049 2855 666 614 301 22521 1357 --12868
NM_206854chr6124609 4360 4337 4310 4116 3457 1927 1875 1562 859 390 293 33782 3302 889 --14129
NM_206855chr6125574 5325 5302 5275 5081 4422 2527 1824 1355 1258 844 805 44747 4267 1854 103 --15094
NM_206866chr2193137 3038 3011 2999 1173 1080 921 573 25 --13170 --
NM_206876chr283407 3365 3302 2580 2255 315 297 78 33130 3003 2926 22463 25 --
NM_206909chr8197951 7896 7590 7149 6851 6423 6243 6018 5935 5787 5264 3169 2814 2068 1635 1436 1405 853 447 37749 6154 6036 18352 --
NM_206933chr162721 2679 2385 2286 2151 95 22848 766 32415 883 802 --
NM_206938chr1151754 1578 766 434 74 1106 1744 --
NM_206939chr1151754 1578 766 434 74 1106 1744 --
NM_206940chr1151754 1578 766 434 74 1106 1744 --
NM_207012chr1093101 2811 2642 918 865 729 543 422 184 --23079 1118 --
NM_207015chr361661 950 876 702 494 259 11526 11715 11972
NM_207303chr1084056 3962 3699 3560 3489 3071 1349 595 34143 2560 314 ----
NM_207306chr184307 4114 3998 3970 3288 3234 1805 1583 13980 1187 13964
NM_207325chr1941504 541 58 42 21613 443 11549 11691
NM_207361chr1396126 5402 4804 4514 4419 3820 2495 81 60 31319 676 543 13959 --
NM_207406chr4186399 6176 5625 5584 5514 5475 5298 5137 5117 1260 1169 1015 766 708 612 299 221 144 21685 848 34798 1778 542 --
NM_207577chr1162451 2085 2038 1986 887 670 276 68 ----
NM_207578chr15789 499 281 209 138 2176 123 ----
NM_207647chr942159 634 166 92 22471 1688 1471 --
NM_212460chr751611 1482 1385 1342 360 --11805 1243
NM_212471chr1741957 1944 1664 517 --12080 1714
NM_212472chr1741957 1944 1664 517 --12080 1714
NM_213589chr2125506 4765 4462 4389 4294 3764 3601 3517 1762 1064 594 480 13496 11625 --
NM_213606chr1072628 2404 2004 1874 1852 577 74 ----1734
NM_213651chr171170 455 441 328 274 187 36 11380 ----
NM_213662chr1782512 2106 1855 993 786 764 678 333 11905 1190 --