TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-29b-3p
miRNA Sequence: UAGCACCAUUUGAAAUCAGUGUU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000044chrX----1273 --
NM_000052chrX23005 584 ------
NM_000061chrX2403 378 ------
NM_000080chr171136 ------
NM_000081chr111157 --11281 --
NM_000084chrX45102 4507 1293 1180 24988 2391 26468 940 --
NM_000088chr17--21062 887 --1930
NM_000089chr71576 ----1527
NM_000090chr21614 ----2689 249
NM_000093chr932529 2257 558 --11800 --
NM_000114chr202893 229 ------
NM_000138chr1511912 --1677 1423
NM_000163chr5--1275 ----
NM_000165chr6156 178 ----
NM_000176chr522390 399 --22748 684 --
NM_000192chr12------1400
NM_000208chr1953835 3617 1642 1620 363 ------
NM_000210chr222238 1925 11576 11966 --
NM_000212chr171329 --11535 --
NM_000216chrX32630 824 275 ------
NM_000217chr1244870 3880 1847 1492 ------
NM_000237chr82765 100 ----11803
NM_000245chr731451 574 480 ------
NM_000255chr61152 ------
NM_000264chr932132 1296 1052 1970 ----
NM_000272chr211186 ------
NM_000276chrX31843 1585 1546 --1223 --
NM_000280chr111252 ------
NM_000310chr1----21208 194 --
NM_000314chr1012356 ----1683
NM_000332chr636997 767 167 --17062 --
NM_000345chr431033 827 178 ------
NM_000368chr923764 781 --44404 1353 742 263 --
NM_000378chr1131197 268 143 ------
NM_000379chr21343 --21605 1484 --
NM_000390chrX22941 558 ------
NM_000408chr21146 --13095 --
NM_000411chr212604 555 --1170 --
NM_000421chr171238 ------
NM_000426chr6------1139
NM_000430chr1732927 2915 368 --1882 --
NM_000480chr1121217 663 ------
NM_000484chr211741 --11088 --
NM_000495chrX--2435 394 --1113
NM_000520chr153475 145 24 ------
NM_000533chrX31344 735 448 ------
NM_000554chr192805 137 --1294 --
NM_000555chrX27739 1678 26868 6432 2620 95 --
NM_000582chr42449 406 ------
NM_000615chr1122966 2745 ----1384
NM_000617chr12----21424 669 12250
NM_000618chr121320 ----1908
NM_000618chr121320 ----1908
NM_000663chr1642844 2085 509 210 --1181 --
NM_000682chr231373 1278 32 --21867 394 --
NM_000693chr1511758 ------
NM_000721chr12749 604 --22389 698 --
NM_000801chr202841 60 --1376 --
NM_000806chr52481 405 ------
NM_000811chr5----1572 --
NM_000813chr525245 488 ------
NM_000817chr2----11018 --
NM_000818chr101181 --1377 --
NM_000826chr4------1799
NM_000829chr1112329 11601 ----
NM_000833chr162985 429 ------
NM_000841chr61883 --1128 --
NM_000857chr41463 ------
NM_000868chrX11933 ------
NM_000876chr6----21290 1206 --
NM_000899chr1243843 1766 1743 1028 ------
NM_000919chr51554 ------
NM_000921chr122635 437 ------
NM_000933chr201302 ------
NM_000944chr431684 1610 843 --12306 --
NM_000945chr221556 1550 1508 ----
NM_001001323chr122861 474 --33102 2073 1015 --
NM_001001331chr3----12275 --
NM_001001342chr1011256 ------
NM_001001396chr11165 --12923 --
NM_001001419chr521898 1443 11099 --14705
NM_001001420chr521898 1443 11099 --14705
NM_001001438chr211268 187 ----
NM_001001549chr71988 12496 ----
NM_001001550chr71988 12496 ----
NM_001001552chr11326 --137 --
NM_001001555chr71988 12496 ----
NM_001001701chr442005 1931 1767 1571 ------
NM_001001706chr621060 196 ------
NM_001001787chr1------1405
NM_001001938chr943294 1506 784 163 --43152 2645 761 365 --
NM_001002243chr21294 ------
NM_001002259chr12----136 --
NM_001002295chr101167 ------
NM_001002814chr843752 1159 929 577 --1439 --
NM_001002838chrX2641 564 ------
NM_001002909chr1721694 65 ------
NM_001003406chr2233203 2376 1327 ------
NM_001003652chr1858336 8202 7620 5781 5586 ----12482
NM_001003674chr1856943 6168 4990 4315 1247 --14944 --
NM_001003675chr1856943 6168 4990 4315 1247 --14944 --
NM_001003688chr4----1344 --
NM_001003698chr62361 261 --11383 --
NM_001003699chr62361 261 --11383 --
NM_001003712chr1222849 709 ------
NM_001003800chr953146 2828 2677 1336 978 178 ----
NM_001004051chrX----167 --
NM_001004065chr943340 977 467 398 13295 133 --
NM_001004317chr622979 1567 --24236 4089 --
NM_001004342chr145706 5520 1804 429 ------
NM_001004419chr1234154 739 495 ----1255
NM_001005353chr12456 278 --166 --
NM_001005353chr12456 278 --166 --
NM_001005360chr191225 ------
NM_001005361chr191225 ------
NM_001005362chr191225 ------
NM_001005366chr121208 --2869 167 --
NM_001005386chr222033 139 --1896 --
NM_001005404chr1711138 --24507 3181 --
NM_001005463chr1022069 1787 ------
NM_001005473chr546537 4647 4252 1578 ----14948
NM_001005476chr21454 1205 ----
NM_001005505chr341513 1428 297 187 ------
NM_001005609chrX32822 1310 498 11495 1101 --
NM_001005782chr211021 --175 --
NM_001005910chr31145 ------
NM_001005911chr31145 ------
NM_001006115chr352734 2222 381 231 117 --12300 --
NM_001006600chr511997 --1525 --
NM_001006617chr911142 ------
NM_001006619chr911142 ------
NM_001006620chr911142 ------
NM_001006621chr911142 ------
NM_001006684chrX1385 ------
NM_001007097chr954453 4212 3221 1967 143 --140 14058
NM_001007156chr151163 --11413 --
NM_001007237chr152693 2510 2297 981 705 --11150 --
NM_001007257chr1----11397 --
NM_001007466chr634311 684 106 --12032 --
NM_001007471chr91655 1137 ----
NM_001007565chr3------1136
NM_001008225chr72478 39 ------
NM_001008239chr1833782 1511 742 ------
NM_001008392chr343438 3238 3010 553 ----13096
NM_001008539chr845391 5103 3719 513 --24509 309 --
NM_001008541chr1012282 11904 ----
NM_001008541chr1012282 11904 ----
NM_001008564chr131364 ------
NM_001008660chr1111168 11007 ----
NM_001009552chr81585 ------
NM_001009899chr31210 --11146 --
NM_001009993chr234079 3436 3063 --23670 65 --
NM_001010861chr11243 --1629 --
NM_001010867chr152567 2424 1648 1213 410 --26262 2694 16505
NM_001010891chr546589 6196 5822 1167 --11251 --
NM_001010924chr101235 ------
NM_001010971chr11846 --1992 --
NM_001010984chr132110 1710 77 11946 ----
NM_001011537chr332291 2248 1876 --22313 644 --
NM_001011553chr71187 ------
NM_001011645chrX----1273 --
NM_001011666chr756267 5107 1811 1388 457 --21817 227 --
NM_001011722chr12408 377 ------
NM_001011722chr12408 377 ------
NM_001012393chr1144882 4582 3500 235 ------
NM_001012420chr1512918 ------
NM_001012423chr1512918 ------
NM_001012755chrX53535 3338 1719 1654 1241 --13449 1711
NM_001012968chrX1298 1229 1710 --
NM_001012977chrX21093 460 --1564 --
NM_001013031chr1033076 2449 204 --33363 2617 1208 --
NM_001013399chr61844 ------
NM_001013438chr3----1148 --
NM_001013620chr121790 13283 ----
NM_001013635chr122899 764 ----21190 988
NM_001014434chr11141 ------
NM_001014794chr111204 ------
NM_001014795chr111204 ------
NM_001014797chr1046971 6346 2964 2687 --18125 --
NM_001014809chr41171 --2236 98 --
NM_001015508chr8----1644 1621
NM_001015877chrX12060 --11044 --
NM_001015887chr311163 11152 ----
NM_001017523chr1211887 ------
NM_001018057chr111144 --1197 --
NM_001018067chr135010 3778 2028 15063 11665 11705
NM_001018068chr135010 3778 2028 15063 11665 11705
NM_001018069chr135010 3778 2028 15063 11665 11705
NM_001018072chr1211887 ------
NM_001018074chr522390 399 --22748 684 --
NM_001018075chr522390 399 --22748 684 --
NM_001018076chr522390 399 --22748 684 --
NM_001018077chr522390 399 --22748 684 --
NM_001018111chr713191 --13838 --
NM_001020658chr11244 ------
NM_001020658chr11244 ------
NM_001023567chr1512310 ------
NM_001024094chr522390 399 --22748 684 --
NM_001024226chr121070 74 ------
NM_001024227chr121070 74 ------
NM_001024228chr121070 74 ------
NM_001024401chr1622546 2310 --12257 --
NM_001024460chr61852 --1192 --
NM_001024660chr321266 1063 --11515 --
NM_001024688chr81587 --11612 --
NM_001024736chr1511193 ----11346
NM_001024808chr1222777 671 --1971 --
NM_001024948chr142629 2335 1090 204 --22690 1162 --
NM_001025076chr1035012 4232 1509 --1789 --
NM_001025077chr1056370 5590 2867 479 408 --12147 --
NM_001025079chr313183 ------
NM_001025105chr52235 125 ------
NM_001025201chr21213 ------
NM_001025366chr61463 ----11749
NM_001025366chr61463 ----11749
NM_001025367chr61463 ----11749
NM_001025367chr61463 ----11749
NM_001025368chr61463 ----11749
NM_001025368chr61463 ----11749
NM_001025369chr61479 ----11765
NM_001025369chr61479 ----11765
NM_001025370chr61463 ----11749
NM_001025370chr61463 ----11749
NM_001025389chr1121217 663 ------
NM_001025390chr1121217 663 ------
NM_001025579chr1711122 ------
NM_001025580chrX12677 12659 ----
NM_001025595chr4----1489 --
NM_001025596chr11----1422 --
NM_001029863chr621016 378 ------
NM_001029875chr531003 839 760 ------
NM_001029882chr11507 ------
NM_001029882chr11507 ------
NM_001030007chr1623284 2816 --32852 1205 728 --
NM_001030272chr11----1348 --
NM_001030273chr11----1348 --
NM_001031684chr22976 351 ----1528
NM_001031690chr742348 1237 1055 238 --12467 --
NM_001031695chr22----23696 422 --
NM_001031700chr4--127 ----
NM_001031710chr7----194 --
NM_001031717chr3----291 22 --
NM_001031748chr12------1569
NM_001031804chr1613937 --23428 468 --
NM_001033045chr22669 341 ------
NM_001033047chr43404 317 237 ------
NM_001033059chr631991 662 389 --12016 --
NM_001033081chr11413 ----11774
NM_001033082chr11413 ----11774
NM_001033117chr344872 4225 1192 986 --13162 --
NM_001033507chr11147 11581 1704 --
NM_001033561chr17185 ------
NM_001033723chr822002 67 --12415 --
NM_001033756chr61397 ----11683
NM_001033756chr61397 ----11683
NM_001034850chr5----11587 --
NM_001034852chr1431470 305 115 --12029 --
NM_001035003chr411310 ------
NM_001035004chr411310 ------
NM_001037132chr712191 11583 ----
NM_001037133chr712191 11583 ----
NM_001037164chr71678 ------
NM_001037172chr311247 ----11302
NM_001037174chr212000 ------
NM_001037317chr11243 --1629 --
NM_001037872chr2----1631 --
NM_001037954chr1122483 833 --1559 --
NM_001038707chr111707 --12219 --
NM_001038707chr111707 --12219 --
NM_001039457chr1----199 --
NM_001039467chr202585 64 ------
NM_001039479chr1451678 1571 983 604 338 ------
NM_001039538chr21633 --1880 --
NM_001039570chr2254168 4160 4098 1790 1316 --14046 --
NM_001039571chr2254168 4160 4098 1790 1316 --14046 --
NM_001039590chrX21486 975 ------
NM_001039591chrX21486 975 ------
NM_001039618chr1122030 1256 15269 ----
NM_001039690chr1622343 563 --1266 --
NM_001039693chr263807 2944 2659 1308 879 122 ----13646
NM_001039802chr1135 --1950 11004
NM_001039840chrX----1285 --
NM_001039916chr1251199 797 276 223 48 ------
NM_001039917chr1251199 797 276 223 48 ------
NM_001039918chr1251199 797 276 223 48 ------
NM_001039919chr1251199 797 276 223 48 ------
NM_001039920chr1251199 797 276 223 48 ------
NM_001039937chr1323471 2535 ------
NM_001039960chr122159 39 --11745 --
NM_001040020chr71108 --11447 --
NM_001040058chr42449 406 ------
NM_001040060chr42449 406 ------
NM_001040101chr421202 1015 ----11423
NM_001040110chr751491 1336 1321 1211 714 ------
NM_001040144chr1622343 563 --1266 --
NM_001040146chr1622343 563 --1266 --
NM_001040152chr744303 3363 1900 310 --1140 --
NM_001040159chr41976 --1561 --
NM_001040167chr721206 841 ------
NM_001040179chr61251 ------
NM_001040280chr621451 511 11054 11034 --
NM_001040284chr1625640 4587 ------
NM_001040402chr4----1133 --
NM_001040441chr154528 4073 2194 1779 395 --14282 --
NM_001040458chr52603 206 ------
NM_001040624chr812632 --1230 --
NM_001040625chr812632 --1230 --
NM_001040626chr812632 --1230 --
NM_001040627chr812632 --1230 --
NM_001040628chr812632 --1230 --
NM_001040629chr812632 --1230 --
NM_001040630chr812632 --1230 --
NM_001040875chr821893 668 --12426 --
NM_001042355chr1634559 4321 3531 14002 1600 --
NM_001042388chr18----1722 --
NM_001042406chr61943 --1916 --
NM_001042412chr1634559 4321 3531 14002 1600 --
NM_001042413chr913317 --23608 940 --
NM_001042453chrX21444 640 --11414 --
NM_001042473chr101819 --2583 70 --
NM_001042498chrX2675 53 ------
NM_001042506chrX21103 460 --1564 --
NM_001042510chr811999 ------
NM_001042511chr811999 ------
NM_001042555chr121611 --21871 864 --
NM_001042576chr202498 472 ------
NM_001042599chr257474 6796 6726 6601 510 ------
NM_001042603chr1244583 4233 1682 314 1402 11533 --
NM_001042604chr3----1589 14757
NM_001043318chr1432663 298 43 --13160 --
NM_001043351chr1------12270
NM_001048183chr133695 3588 2649 ------
NM_001050chr1721359 149 ------
NM_001079874chr11651 --11881 --
NM_001083620chr4------1798
NM_001083621chr174541 4397 2931 1897 1213 1207 870 --11691 --
NM_001087chr22303 263 --132 --
NM_001099678chr325402 4883 15672 ----
NM_001106chr386093 3905 2976 2906 2748 2211 583 258 12227 27557 6268 --
NM_001116chr1642181 925 815 29 ----1112
NM_001128chr1623284 2816 --32852 1205 728 --
NM_001144chr16----1248 --
NM_001146chr811539 1449 ----
NM_001149chr101309 --11083 --
NM_001167chrX45804 5324 5159 1015 ------
NM_001178chr11----1348 --
NM_001199chr81217 ------
NM_001204chr247768 7423 7248 403 ------
NM_001206chr922692 400 ------
NM_001220chr7----138 --
NM_001222chr1021586 205 --21592 691 --
NM_001241chr2------12306
NM_001241chr2------12306
NM_001256chr1722359 1847 --1454 --
NM_001257chr162356 294 ------
NM_001294chr191431 ------
NM_001304chr1721251 804 ------
NM_001313chr41171 --2236 98 --
NM_001351chr3------11581
NM_001379chr19----1109 --
NM_001383chr171279 ------
NM_001387chr553025 3016 2658 1094 482 --1818 --
NM_001396chr211395 --151 --
NM_001397chr142270 2113 1815 245 --1153 --
NM_001399chrX32822 1310 498 11495 1101 --
NM_001406chr1721502 48 --11629 --
NM_001409chr152144 2039 1583 870 174 ----1390
NM_001431chr62395 376 --11049 --
NM_001438chr133271 2626 2328 ------
NM_001440chr842353 2225 2218 1950 ------
NM_001463chr2--1689 ----
NM_001494chr10----1577 --
NM_001495chr81244 --1293 --
NM_001542chr152693 2510 2297 981 705 --11150 --
NM_001543chr544136 3682 988 966 14760 1729 11408
NM_001554chr13511 171 90 ------
NM_001564chr41123 ------
NM_001587chrX31843 1585 1546 --1223 --
NM_001604chr111252 ------
NM_001608chr21265 ------
NM_001616chr221173 815 --12550 --
NM_001620chr112528 61 --1590 --
NM_001621chr721216 222 --1493 --
NM_001621chr721216 222 --1493 --
NM_001634chr631991 662 389 --12016 --
NM_001635chr711023 ------
NM_001642chr1111184 ------
NM_001649chrX22070 293 --22309 412 12291
NM_001656chr521757 1577 ------
NM_001658chr121070 74 ------
NM_001659chr1232476 1959 953 --12351 12605
NM_001663chr1411912 ----1922
NM_001677chr1----1857 11043
NM_001681chr123618 493 38 ------
NM_001682chr122575 188 --32816 1787 729 --
NM_001683chr3----12275 --
NM_001684chr1----22640 1610 --
NM_001695chr82547 357 ----13144
NM_001704chr61596 --1135 --
NM_001718chr61340 ----1916
NM_001731chr121841 ----1648
NM_001755chr16--11584 21855 1774 --
NM_001759chr1234417 1295 195 --21128 912 --
NM_001761chr1611803 --1321 11605
NM_001777chr313183 ------
NM_001788chr71187 ------
NM_001791chr1135 --1950 11004
NM_001795chr1621558 404 --1233 --
NM_001822chr21213 ------
NM_001826chr11359 ------
NM_001830chrX13888 --13938 --
NM_001839chr1----1596 --
NM_001844chr121268 ----1368
NM_001851chr6--1175 1487 --
NM_001854chr12203 48 --2328 280 --
NM_001855chr92894 615 ----1218
NM_001858chr61842 --33409 1806 415 11905
NM_001880chr2--1326 1307 --
NM_001892chr52235 125 ------
NM_001895chr2011240 ------
NM_001904chr31760 1970 ----
NM_001918chr178583 8343 6955 3289 1940 923 182 --1243 --
NM_001933chr141508 11073 ----
NM_001938chr11416 --1237 --
NM_001945chr521370 957 ----11145
NM_001946chr1211119 ------
NM_001969chr1433440 3184 1168 ------
NM_001986chr172533 37 --2477 68 --
NM_001987chr1223182 753 --1313 13887
NM_001999chr52976 505 --1952 --
NM_002015chr1333296 2142 317 ------
NM_002025chrX29244 2040 --19144 --
NM_002032chr111168 ------
NM_002051chr101167 ------
NM_002063chrX1931 ------
NM_002072chr9----1956 --
NM_002077chr922124 400 --1811 --
NM_002087chr172260 238 ------
NM_002107chr1----1379 --
NM_002126chr1731319 1195 135 --23143 1340 --
NM_002128chr131274 11713 12112 --
NM_002136chr121492 ------
NM_002137chr732245 2000 416 ------
NM_002140chr91146 ------
NM_002182chr3138 ----1818
NM_002203chr513167 --13916 --
NM_002214chr7--15711 ----
NM_002222chr31437 ------
NM_002223chr1223427 1179 ------
NM_002224chr61713 ------
NM_002247chr1021699 395 --161 --
NM_002254chr242307 2069 145 83 --1466 --
NM_002264chr335070 3518 1013 11447 --14585
NM_002267chr1331567 360 267 --11943 --
NM_002270chr524195 169 ------
NM_002336chr1233891 1741 606 --44894 4863 4788 3740 --
NM_002355chr121306 --11386 --
NM_002356chr64796 486 448 64 --11791 --
NM_002359chr1764177 3500 3203 2857 1692 1159 --53183 1712 1205 550 291 --
NM_002371chr21166 ----140
NM_002373chr15----1856 --
NM_002374chr21633 --1880 --
NM_002381chr2142 1663 ----
NM_002399chr15--11430 ----
NM_002425chr11131 ------
NM_002442chr1211389 --11686 --
NM_002449chr521218 200 ------
NM_002451chr931511 1109 542 ------
NM_002473chr221160 ------
NM_002478chr112532 37 ----1541
NM_002480chr121174 ------
NM_002485chr81587 --11612 --
NM_002490chr221612 --1184 --
NM_002499chr15----1452 --
NM_002500chr221268 270 ------
NM_002501chr1933864 1159 746 --12798 --
NM_002515chr141244 ------
NM_002519chr1111441 132 ----
NM_002545chr1144882 4582 3500 235 ------
NM_002547chrX94154 4040 3877 3466 3328 2922 1478 536 183 --1556 --
NM_002581chr922013 1843 ------
NM_002586chr621272 1016 1160 ----
NM_002588chr531500 521 411 ------
NM_002594chr2012155 ------
NM_002595chr12--21804 1429 ----
NM_002607chr751097 1087 464 413 100 ------
NM_002618chr21119 ------
NM_002641chrX1309 1505 ----
NM_002648chr611191 ------
NM_002657chr2033501 3371 1103 ----1731
NM_002670chr321610 372 ------
NM_002709chr222497 1104 ------
NM_002710chr121383 ----1252
NM_002715chr51895 ------
NM_002716chr1143261 3135 2399 2385 --12771 --
NM_002717chr8----1184 --
NM_002721chr91169 ------
NM_002729chr101142 1639 ----
NM_002731chr122782 1111 --1332 --
NM_002742chr141550 ------
NM_002745chr2273595 3385 2929 1289 960 925 51 --13361 14351
NM_002748chr152899 100 ------
NM_002752chr51452 ------
NM_002787chr72595 489 ------
NM_002816chr17166 ------
NM_002829chr92364 176 ------
NM_002844chr6----21392 272 --
NM_002855chr1143655 3445 3100 537 --1218 --
NM_002868chr1242357 1699 1564 613 ------
NM_002880chr31212 ------
NM_002886chr331344 906 885 14810 ----
NM_002890chr51251 ------
NM_002892chr14--1319 ----
NM_002897chr2124 --1484 --
NM_002906chr11----3701 604 225 --
NM_002911chr1921210 538 ------
NM_002912chr61243 130 171 --
NM_002922chr1--1469 --1581
NM_002923chr12247 103 --1569 --
NM_002948chr32321 168 170 ----
NM_002955chr62361 261 --11383 --
NM_002968chr16----1379 --
NM_002970chrX1235 ------
NM_002996chr1611573 21547 466 1548 --
NM_003010chr171765 --31735 353 123 --
NM_003015chr10192 ------
NM_003016chr1721959 1446 ----12033
NM_003017chr641395 1275 101 26 ------
NM_003027chr15174 ------
NM_003042chr312206 ------
NM_003043chr334143 1171 425 --11351 --
NM_003046chr845391 5103 3719 513 --24509 309 --
NM_003070chr91164 --2853 847 --
NM_003074chr331580 1426 267 --1554 --
NM_003075chr121276 ------
NM_003079chr171342 ----171
NM_003099chr15105693 5139 4593 4422 4012 2427 1414 1071 728 350 ------
NM_003105chr11132 ------
NM_003107chr612045 11768 ----
NM_003108chr211797 --1110 --
NM_003112chr7----13090 --
NM_003155chr8153 --11721 --
NM_003156chr11148 11305 ----
NM_003161chr1731051 605 173 ------
NM_003174chr10--1599 186 --
NM_003178chr342138 1972 616 94 --11902 --
NM_003199chr1824419 1644 ------
NM_003201chr101396 ------
NM_003203chr2174 --1196 --
NM_003211chr1231423 422 112 --1549 --
NM_003215chr4----11083 --
NM_003216chr2233056 2301 2070 --1951 --
NM_003217chr1221968 80 ------
NM_003222chr201913 ----1297
NM_003234chr31768 12216 1919 --
NM_003239chr14--1892 1875 --
NM_003253chr21----21786 1370 --
NM_003291chr13----1200 --
NM_003304chr311151 ------
NM_003320chr1123212 2792 ------
NM_003330chr12------1392
NM_003337chr52259 186 --11738 --
NM_003340chr411278 ------
NM_003347chr22----1262 --
NM_003348chr1221609 339 ------
NM_003352chr211021 --175 --
NM_003371chr91141 ------
NM_003376chr61463 ----11749
NM_003376chr61463 ----11749
NM_003390chr112265 99 ------
NM_003392chr342965 1397 1258 464 ------
NM_003410chrX----22142 2036 --
NM_003418chr3--1209 ----
NM_003452chr91276 1637 ----
NM_003453chr131609 ------
NM_003463chr612896 ----12223
NM_003471chr321786 871 168 ----
NM_003474chr1042347 1923 1646 750 --2838 165 --
NM_003477chr11----2258 25 --
NM_003478chr1112398 --12208 --
NM_003488chr171937 ------
NM_003489chr2121081 548 --13295 --
NM_003498chr1632266 1790 577 --1956 --
NM_003505chr731962 482 427 ------
NM_003507chr21787 ------
NM_003566chr1222112 562 --11199 --
NM_003574chr1843767 1411 1044 450 ------
NM_003575chr711212 11060 --11108
NM_003583chr1232759 472 324 ------
NM_003591chr10254 24 ------
NM_003597chr222115 708 --1402 --
NM_003607chr124115 1385 ----13092
NM_003615chr31370 --21611 1134 --
NM_003622chr12------12643
NM_003628chr21454 1205 ----
NM_003629chr133216 2484 2456 --2905 894 --
NM_003631chr101731 --1823 --
NM_003651chr12------1441
NM_003663chr3----13036 1790
NM_003671chr932505 2187 303 ------
NM_003692chr9----2881 796 --
NM_003701chr132915 196 ------
NM_003711chr5190 ------
NM_003714chr552035 533 527 399 373 --1415 --
NM_003735chr531500 521 411 ------
NM_003736chr531500 521 411 ------
NM_003750chr102221 29 ------
NM_003758chr152428 21 1152 ----
NM_003758chr152428 21 1152 ----
NM_003759chr423543 1319 --13348 --
NM_003766chr17----1555 --
NM_003768chr111175 ------
NM_003816chr81326 ------
NM_003818chr20173 ------
NM_003831chr181282 --1112 --
NM_003850chr13--132 ----
NM_003861chr1431164 854 442 1819 11083 --
NM_003870chr151763 --1330 --
NM_003872chr222620 562 --12050 --
NM_003873chr102610 549 --1244 --
NM_003877chr122669 166 ------
NM_003884chr321510 546 ------
NM_003887chr221734 776 ----11857
NM_003913chr621590 436 --1561 --
NM_003927chr18--1816 ----
NM_003930chr72683 351 12103 ----
NM_003934chr91889 ------
NM_003936chr221070 177 ------
NM_003941chr731760 1587 945 ------
NM_003947chr31116 ------
NM_003958chr61499 ------
NM_003968chr3----2178 172 1528
NM_003972chr1021262 283 ------
NM_003983chr1643811 3120 2802 1193 --11396 11100
NM_003994chr1243843 1766 1743 1028 ------
NM_004035chr1785066 4747 3566 3341 3255 1949 1580 393 ------
NM_004036chr2----1475 --
NM_004040chr2------1534
NM_004047chr1----199 --
NM_004061chr51421 ------
NM_004080chr721264 245 ------
NM_004093chr1312615 12797 ----
NM_004094chr14----12785 12251
NM_004119chr131663 ------
NM_004133chr81127 --1112 --
NM_004136chr151949 ----1195
NM_004156chr81585 ------
NM_004161chr2----11090 --
NM_004171chr1168189 8112 1659 1359 851 175 --27329 2328 --
NM_004229chrX12205 ------
NM_004233chr621451 511 11054 11034 --
NM_004242chr6----2343 284 --
NM_004272chr5----1644 --
NM_004273chr1044574 1349 1318 976 ----1402
NM_004274chr14----1637 --
NM_004295chr1721024 274 1316 1167 --
NM_004302chr1241839 756 717 358 1987 ----
NM_004311chr1022434 1080 --23088 463 --
NM_004321chr263220 2778 2762 2753 692 662 ------
NM_004326chr111225 ------
NM_004330chr15----11036 --
NM_004331chr832057 736 47 ------
NM_004338chr1856943 6168 4990 4315 1247 --14944 --
NM_004349chr8----11122 11086
NM_004360chr1631932 520 450 ------
NM_004369chr2----1260 1173
NM_004370chr631453 1400 199 --1673 --
NM_004380chr16----12629 --
NM_004381chr61152 ------
NM_004393chr321974 583 --3896 724 58 --
NM_004420chr113655 646 514 1753 ----
NM_004430chr822681 754 ------
NM_004432chr91819 ------
NM_004436chr12472 154 ------
NM_004447chr122766 397 ------
NM_004461chr191196 ------
NM_004469chrX--187 ----
NM_004472chr52465 74 ------
NM_004474chr121041 669 ------
NM_004475chr1741067 865 366 98 ------
NM_004483chr16------1485
NM_004491chr1984325 4253 2764 1703 1543 1260 1157 1147 ----14131
NM_004498chr151384 ------
NM_004499chr52196 179 ------
NM_004501chr133665 3142 325 --11629 --
NM_004506chr6--1180 ----
NM_004514chr1732768 2222 43 --12545 --
NM_004517chr111204 ------
NM_004520chr51789 ------
NM_004521chr10--126 ----
NM_004535chr2021761 396 ------
NM_004538chrX--1660 --1269
NM_004540chr211829 ------
NM_004575chr4----21565 1155 --
NM_004586chrX33308 723 34 --13855 --
NM_004587chr202498 472 ------
NM_004593chr31805 1697 1187 --
NM_004595chrX1182 --2429 388 --
NM_004598chr532024 620 197 --11122 --
NM_004612chr923803 3142 ------
NM_004622chr21133 ------
NM_004626chr111268 ------
NM_004630chr11--11149 ----
NM_004643chr141681 ------
NM_004654chrY1934 ------
NM_004667chr152555 84 ------
NM_004690chr6157 ------
NM_004698chr1----1169 --
NM_004705chr11--1320 ----
NM_004715chr182274 163 1214 ----
NM_004718chr21609 --1216 --
NM_004726chrX34384 4253 478 15764 ----
NM_004730chr51195 --22164 1696 --
NM_004734chr1383253 2885 2671 2422 2099 990 785 536 --12764 --
NM_004739chr11------1158
NM_004742chr32473 377 ------
NM_004744chr411573 12894 ----
NM_004745chr8--1452 25765 1231 --
NM_004747chr101575 --1424 --
NM_004748chr1532672 837 678 ------
NM_004761chr6----137 --
NM_004772chr52639 33 ----1561
NM_004774chr1722456 538 ------
NM_004775chr181832 ------
NM_004796chr1422002 739 --1714 1898
NM_004805chr221346 353 ------
NM_004822chr1723108 3019 ------
NM_004824chr611107 ------
NM_004834chr2--1260 32619 2489 235 --
NM_004846chr2------1188
NM_004856chr151540 ------
NM_004859chr1711902 --1799 12527
NM_004863chr1414121 --23935 3410 --
NM_004884chr15----11515 --
NM_004902chr201587 ------
NM_004904chr756267 5107 1811 1388 457 --21817 227 --
NM_004911chr71486 --1140 --
NM_004938chr92951 92 ------
NM_004945chr191225 ------
NM_004956chr71730 ----13691
NM_004976chr1165001 3799 3533 439 338 177 14790 --13345
NM_004985chr1241266 977 322 273 13133 ----
NM_004992chrX22246 1918 --17101 --
NM_004992chrX22246 1918 --17101 --
NM_004999chr614384 --11623 --
NM_005010chr712191 11583 ----
NM_005011chr751491 1336 1321 1211 714 ------
NM_005029chr101111 ------
NM_005056chr1244827 4477 1926 558 1646 11777 --
NM_005066chr1------1568
NM_005077chr91387 ------
NM_005078chr151368 11410 ----
NM_005080chr222939 310 ------
NM_005088chrX----1872 --
NM_005096chrX1780 ------
NM_005109chr321926 666 --1577 --
NM_005113chr141461 ------
NM_005116chr2021661 162 --14110 --
NM_005119chr11267 ------
NM_005121chr1711265 --13377 --
NM_005134chr18----1722 --
NM_005156chr921766 1241 --24929 1235 --
NM_005180chr1021392 1357 ------
NM_005188chr1122476 966 --26439 647 --
NM_005190chr61844 ------
NM_005194chr20------1226
NM_005197chr1454795 2432 1567 1067 559 --36058 5191 4851 --
NM_005207chr2233288 2810 1084 --11396 --
NM_005235chr257474 6796 6726 6601 510 ------
NM_005241chr3----1936 --
NM_005261chr8----1254 --
NM_005277chr4----21262 43 --
NM_005281chr11135 ------
NM_005311chr71988 12496 ----
NM_005329chr161740 --21713 566 1704
NM_005330chr11124 ------
NM_005338chr743453 2669 1416 767 --1748 --
NM_005339chr424018 2756 --34006 1061 386 --
NM_005358chr13----1328 --
NM_005375chr6------1739
NM_005397chr713191 --13838 --
NM_005402chr721288 566 11766 1340 --
NM_005407chr1421598 279 ------
NM_005418chr112710 254 ------
NM_005433chr1811884 ------
NM_005455chr11174 --11854 --
NM_005461chr2021567 1513 --11761 --
NM_005465chr111469 ----11674
NM_005475chr1242296 1109 1019 871 ------
NM_005488chr22------183
NM_005497chr1735999 5274 4958 --23922 2453 --
NM_005504chr1276502 5153 4446 4356 1966 1471 1297 --24322 189 --
NM_005520chr5----1671 --
NM_005521chr101803 1781 ----
NM_005523chr711346 --11248 --
NM_005539chr1021238 924 ------
NM_005542chr71419 --1397 --
NM_005544chr21844 ------
NM_005561chr131262 2818 180 ----
NM_005563chr11268 ------
NM_005578chr344611 4128 3800 390 ------
NM_005585chr151380 ------
NM_005594chr12127 ------
NM_005596chr936318 1310 543 --21766 1328 --
NM_005602chr331290 448 30 --1236 --
NM_005610chr11151 --1635 --
NM_005613chr12641 604 --1175 --
NM_005626chr11120 ------
NM_005627chr6----1737 1228
NM_005638chrX21201 440 --1499 --
NM_005665chr123866 553 13484 ----
NM_005668chr523512 1014 ------
NM_005688chr311175 ------
NM_005715chr611096 --12797 --
NM_005717chr131226 1100 806 ------
NM_005722chr222033 139 --1896 --
NM_005724chr15----1116 --
NM_005736chr1021334 1092 ------
NM_005737chr232520 953 931 --22829 721 --
NM_005738chr71678 ------
NM_005754chr52494 150 11215 ----
NM_005759chr221634 886 --24024 3414 13785
NM_005776chr14----1250 --
NM_005786chr18------1237
NM_005789chr1731853 1681 399 ------
NM_005796chr161147 ------
NM_005808chr343438 3238 3010 553 ----13096
NM_005819chr1--1667 1331 --
NM_005822chr631764 801 97 ------
NM_005840chrX66645 3053 2241 1898 1473 160 --16593 --
NM_005859chr521439 1260 ----11292
NM_005871chr102952 310 ------
NM_005873chr202585 64 ------
NM_005880chr161641 ------
NM_005898chr1122510 2181 --11161 --
NM_005900chr4----1344 --
NM_005901chr1858336 8202 7620 5781 5586 ----12482
NM_005902chr15----14007 --
NM_005903chr521898 1443 11099 --14705
NM_005904chr18--11451 11434 --
NM_005907chr621686 1300 ------
NM_005909chr5----14109 --
NM_005911chr241347 1313 1008 199 ----11288
NM_005920chr132691 987 664 ------
NM_005934chr1921958 677 --1262 --
NM_005955chr144914 4793 3727 411 --45429 1512 574 546 --
NM_005962chr1012282 11904 ----
NM_005962chr1012282 11904 ----
NM_005986chr1342773 2540 2502 238 ------
NM_006010chr31193 ------
NM_006011chr1534294 1004 853 --1196 --
NM_006030chr341513 1428 297 187 ------
NM_006037chr244900 3382 1909 1313 --1416 --
NM_006047chr201363 --12773 --
NM_006049chr151150 ----1270
NM_006054chr11----1134 --
NM_006064chrX------1427
NM_006070chr3------1136
NM_006076chr733167 1284 607 1116 ----
NM_006080chr71762 --11893 --
NM_006089chrX11871 --1517 11578
NM_006094chr81381 --139 --
NM_006113chr11651 --11881 --
NM_006116chr2231393 1315 500 --11580 --
NM_006136chr71979 ------
NM_006141chr16----12661 --
NM_006148chr1732057 1849 1046 --12333 --
NM_006154chr1512037 --12749 --
NM_006156chr14--1193 ----
NM_006157chr111146 ------
NM_006166chr1232183 782 630 1153 ----
NM_006201chrX21013 902 1200 ----
NM_006203chr5----14810 --
NM_006206chr442834 2059 1908 228 --12264 --
NM_006211chr8----175 --
NM_006212chr175186 5164 4448 1594 541 345 31 --13667 --
NM_006224chr1722307 191 --22094 886 --
NM_006239chr41165 ------
NM_006241chr312335 ----12273
NM_006245chr62964 189 ------
NM_006252chr134767 939 363 1927 16789 --
NM_006255chr14----1744 --
NM_006267chr23443 203 178 ------
NM_006279chr11317 ------
NM_006283chr811813 --21973 1692 --
NM_006306chrX31104 222 107 14236 ----
NM_006310chr1721230 426 ------
NM_006315chr443862 3056 1324 49 ------
NM_006328chr11------1605
NM_006352chr122052 210 ------
NM_006364chr14------11128
NM_006379chr721929 206 ------
NM_006393chr1024337 1005 13603 1230 --
NM_006400chr121284 ------
NM_006403chr621545 646 ------
NM_006415chr921021 131 ------
NM_006420chr2023162 1199 1789 ----
NM_006459chr1021938 138 ------
NM_006482chr1232759 472 324 ------
NM_006489chr141244 ------
NM_006496chr121330 289 --11988 --
NM_006517chrX2666 157 1360 ----
NM_006534chr2033196 2495 847 --32320 522 225 --
NM_006538chr243754 3346 1351 83 --2890 291 --
NM_006540chr811382 ------
NM_006544chr141861 --11260 --
NM_006546chr1724330 362 --12197 --
NM_006547chr711907 --1527 --
NM_006548chr321317 1165 ------
NM_006549chr1243004 2959 2373 2290 12723 ----
NM_006560chr11----1422 --
NM_006561chr1035012 4232 1509 --1789 --
NM_006575chr141499 ------
NM_006587chr41572 1314 ----
NM_006599chr1621364 1055 16696 47341 5667 2350 1647 --
NM_006606chr2033156 2852 1277 --13068 --
NM_006614chr333281 2800 220 --13609 --
NM_006621chr11467 ----1742
NM_006624chr1032018 1756 1517 ------
NM_006625chr12435 60 11049 ----
NM_006625chr12435 60 11049 ----
NM_006625chr12435 60 11049 ----
NM_006626chr932362 2085 844 ------
NM_006629chr1842142 1992 1970 1735 ------
NM_006634chr2----171 --
NM_006646chr1311070 ----1360
NM_006654chr121611 --21871 864 --
NM_006675chr1243086 2466 918 793 13041 ----
NM_006698chr2031445 913 177 ------
NM_006703chr6------1162
NM_006706chr51750 ------
NM_006726chr42965 859 ------
NM_006729chrX14003 --25164 3431 --
NM_006738chr1521341 724 13304 11510 --
NM_006749chr82917 252 --146 --
NM_006750chr1627589 5883 27251 438 ----
NM_006751chr2----1710 --
NM_006769chr12752 166 ------
NM_006772chr621100 216 1294 ----
NM_006802chr111046 ------
NM_006805chr51156 ------
NM_006806chr21124 ------
NM_006807chr171424 1901 ----
NM_006813chr61269 ------
NM_006816chr51232 ------
NM_006824chr1184 ------
NM_006827chr1422862 139 13187 ----
NM_006838chr12----1382 11428
NM_006852chr1732280 1057 116 --1491 --
NM_006854chr741693 784 722 40 ------
NM_006874chr4------1451
NM_006885chr1612995 --24029 854 13462
NM_006888chr1422844 2733 12489 --1902
NM_006892chr2021074 237 ----11209
NM_006892chr2021074 237 ----11209
NM_006897chr12----1201 --
NM_006898chr21283 --1641 --
NM_006914chr9--1242 ----
NM_006916chr21173 ------
NM_006922chr22940 503 ------
NM_006924chr174949 814 794 302 12974 34186 4144 2844 --
NM_006930chr51683 --1534 --
NM_006931chr123761 656 409 --11591 --
NM_006939chr14------1405
NM_006943chr2053323 3149 2614 2480 2086 --12788 11125
NM_006988chr2121121 55 ------
NM_007005chr911415 ------
NM_007007chr1223430 1316 ------
NM_007011chr1546707 5816 5065 1379 ------
NM_007026chr171129 ------
NM_007034chr111035 ----1918
NM_007050chr2077817 6793 6745 6692 1954 691 352 ------
NM_007064chr321266 1063 --11515 --
NM_007067chr17----11181 --
NM_007118chr5------1367
NM_007124chr611761 ------
NM_007129chr131403 ------
NM_007137chrX35056 459 257 --11733 --
NM_007162chr62523 406 ----1501
NM_007166chr1111168 11007 ----
NM_007175chr811387 ----1583
NM_007192chr142329 221 ------
NM_007200chr1521341 724 13304 11510 --
NM_007203chr943340 977 467 398 13295 133 --
NM_007212chr122089 1628 ------
NM_007214chr61956 ------
NM_007217chr3----1304 --
NM_007232chr201294 --1322 --
NM_007236chr151166 ------
NM_007246chr42806 706 ------
NM_007249chr1359264 9242 8485 8063 763 11505 --11346
NM_007260chr11756 ------
NM_007271chr641792 1729 585 264 ------
NM_007274chr1124 --1114 --
NM_007275chr32883 173 ------
NM_007292chr1785066 4747 3566 3341 3255 1949 1580 393 ------
NM_007347chr1532621 2284 1978 --11099 --
NM_007349chr71317 ------
NM_007358chr11747 ----1289
NM_007373chr101589 ------
NM_007375chr141119 869 806 447 ------
NM_012081chr552769 1154 871 779 646 13614 ----
NM_012083chr102981 217 ----1459
NM_012092chr211723 --21676 125 --
NM_012093chr14955 470 304 187 ------
NM_012096chr322975 1212 ----12430
NM_012097chr212000 ------
NM_012104chr112720 518 11058 ----
NM_012104chr112720 518 11058 ----
NM_012110chr4152 --2111 65 --
NM_012137chr11304 ----12774
NM_012141chr1323471 2535 ------
NM_012155chr191213 --1199 --
NM_012156chr2012384 --22287 1156 --
NM_012158chr1321390 421 ------
NM_012180chr41293 ------
NM_012193chr1145015 3307 1252 530 --23406 1334 1581
NM_012199chr134308 281 145 13504 24109 2827 --
NM_012207chr102990 327 ------
NM_012210chr9----21402 1057 1239
NM_012214chr232246 994 765 14760 14421 15676
NM_012215chr102747 249 ------
NM_012238chr10------21091 642
NM_012244chr1441812 1491 724 134 ------
NM_012247chr102356 306 ------
NM_012249chr212197 ----11439
NM_012252chr745307 3822 317 205 ----152
NM_012257chr7----1965 2719 290
NM_012262chr154496 3706 3381 3224 909 ------
NM_012272chr12----1168 --
NM_012279chr531818 762 301 ----1649
NM_012281chr71851 ------
NM_012288chr685484 5229 4776 4496 3782 2258 1299 670 --21076 543 --
NM_012293chr211521 --31728 515 134 1286
NM_012301chr71653 1594 ----
NM_012308chr112438 309 --1534 --
NM_012324chr222768 285 ------
NM_012325chr2021080 616 ----11538
NM_012329chr1711304 --11266 --
NM_012330chr102669 98 ------
NM_012347chr622709 242 ------
NM_012399chr2211753 --1585 --
NM_012448chr1712203 12090 1235 --
NM_012464chr41665 --1540 11100
NM_012479chr711065 22295 1088 12520 --
NM_013233chr211359 ------
NM_013253chr111144 --1197 --
NM_013261chr41334 --13187 --
NM_013269chr1234081 666 422 ----1182
NM_013357chr81826 1896 ----
NM_013368chr191437 ------
NM_013377chr12------1531
NM_013381chr121209 --12275 --
NM_013390chr91223 ------
NM_013399chr162643 256 1528 ----
NM_013410chr12456 278 --166 --
NM_013446chr731145 113 65 ------
NM_013450chr2--1271 ----
NM_014011chr22204 169 ------
NM_014023chr1032343 2123 114 --32219 1170 892 --
NM_014028chr61979 ------
NM_014038chr71342 ------
NM_014048chr1644918 4382 4335 3715 --23279 589 --
NM_014056chr322007 1701 --1257 1929
NM_014071chr20----1190 --
NM_014089chr131364 ------
NM_014112chr835443 1526 1286 ------
NM_014117chr1611866 1584 12016 --
NM_014141chr72647 313 ------
NM_014155chr1156855 6108 5453 1860 1452 12036 ----
NM_014157chr1643791 3540 2885 874 --21307 103 --
NM_014181chr212874 12417 ----
NM_014186chr1141696 1661 1476 788 1568 ----
NM_014232chr1731584 1549 1230 ------
NM_014232chr1731584 1549 1230 ------
NM_014245chr31239 ------
NM_014268chr1821073 347 --1431 --
NM_014289chrX11109 ------
NM_014292chr2231833 1362 126 2708 349 ----
NM_014299chr1921892 601 ----1345
NM_014309chr22----23686 412 --
NM_014325chr1231629 769 69 --1601 --
NM_014331chr437691 7421 4950 --17580 --
NM_014333chr11----12355 --
NM_014342chr112135 129 ------
NM_014344chr111866 ------
NM_014350chr5----11081 --
NM_014392chr421202 1015 ----11423
NM_014393chr8------1349
NM_014405chr171233 --1599 --
NM_014423chr511417 --14768 --
NM_014426chr201715 --1483 --
NM_014431chr1031647 93 64 --11162 --
NM_014447chr4----1489 --
NM_014488chr111466 ----1631
NM_014489chr11----1650 1266
NM_014494chr161472 ------
NM_014496chrX1229 ------
NM_014498chr31347 ------
NM_014517chr311303 ------
NM_014574chr1411298 --1397 --
NM_014606chr41229 --11568 --
NM_014607chr21152 ------
NM_014612chr921504 1061 ------
NM_014615chr161771 ----13418
NM_014620chr121260 ------
NM_014630chr1551543 1532 460 245 37 --12576 --
NM_014636chr923761 100 1733 ----
NM_014646chr1843241 2593 878 112 ------
NM_014647chr162902 373 --31657 423 300 --
NM_014665chr832691 2518 820 ------
NM_014676chr11244 ------
NM_014677chr8--1415 ----
NM_014682chr852333 1778 1441 937 879 ------
NM_014683chr1712050 ------
NM_014686chr1932394 2347 1866 ------
NM_014689chr2------1106
NM_014690chr742348 1237 1055 238 --12467 --
NM_014711chr16----11945 --
NM_014717chr191706 ------
NM_014720chr1021190 120 1606 ----
NM_014726chr171944 1364 ----
NM_014729chr81351 ------
NM_014730chr1224774 1357 ------
NM_014730chr1224774 1357 ------
NM_014732chr1665821 5644 4558 4182 1652 1573 --14787 --
NM_014733chr521553 669 ------
NM_014738chr171677 --1943 1956
NM_014739chr624136 2619 --13913 --
NM_014754chr83873 836 595 ------
NM_014755chr234075 1604 724 ------
NM_014757chr512075 --1235 --
NM_014760chr321406 576 11826 ----
NM_014773chr531366 1046 27 --1288 --
NM_014779chr31268 --164 --
NM_014781chr81130 ------
NM_014803chr10----11891 --
NM_014820chr331710 1587 154 --1120 --
NM_014826chr124115 1385 ----13092
NM_014827chr11325 ------
NM_014830chr1251034 953 544 285 67 1409 ----
NM_014832chr13----21951 119 --
NM_014839chr11520 --1457 --
NM_014840chr1253263 3249 2916 1360 900 --22532 1252 --
NM_014850chr344872 4225 1192 986 --13162 --
NM_014870chr174541 4397 2931 1897 1213 1207 870 --11691 --
NM_014888chr71108 --11447 --
NM_014900chr211192 --11036 --
NM_014903chr1232346 1539 447 11944 1813 11838
NM_014904chr1033209 995 263 ------
NM_014906chr1723892 2560 --23707 719 --
NM_014909chr1423571 355 --12724 13683
NM_014912chr1032888 2822 1165 --22569 364 --
NM_014920chr623780 1102 --168 --
NM_014924chr143954 915 366 ------
NM_014943chr811106 1462 ----
NM_014962chr2012711 ------
NM_014969chr13434 266 152 ----1163
NM_014982chr1434876 1383 1088 --14215 --
NM_014988chr411773 ------
NM_014990chr14----1934 --
NM_014991chr412192 --12389 --
NM_014997chr72893 666 --11154 --
NM_015000chr12----22950 107 1473
NM_015017chr1------1282
NM_015020chr1633164 2992 982 13207 1322 --
NM_015024chr811441 ------
NM_015025chr232725 2112 615 ------
NM_015026chr121310 --1383 --
NM_015027chr1631859 1734 1249 ------
NM_015032chr131469 1573 ----
NM_015035chr2065414 4406 2622 2100 1328 1197 --11609 16282
NM_015042chr152873 67 --33312 765 101 --
NM_015051chr912521 --12304 11141
NM_015057chr131237 ------
NM_015064chr1231082 1074 815 11135 ----
NM_015091chr14--1731 ----
NM_015092chr1613032 ----13343
NM_015093chr61304 --1123 --
NM_015094chr2254283 1426 1083 464 364 ------
NM_015110chr911584 ------
NM_015115chr4----1133 --
NM_015116chr13------11647
NM_015149chr131865 135 86 ------
NM_015155chr1013091 --2962 220 --
NM_015156chr142851 28 12935 1831 --
NM_015170chr812369 ------
NM_015176chr1188 ------
NM_015192chr2021934 355 ------
NM_015206chr151817 --23756 1314 --
NM_015215chr122089 2027 --1951 --
NM_015225chr922185 113 --1307 --
NM_015231chr11137 --1203 1186
NM_015234chr621360 1118 ------
NM_015238chr5------179
NM_015247chr1634559 4321 3531 14002 1600 --
NM_015250chr921448 470 ------
NM_015252chr21287 ------
NM_015263chr151431 ------
NM_015268chr31236 ------
NM_015271chr421202 974 ------
NM_015282chr2146 1394 ----
NM_015284chr131553 1503 749 ------
NM_015285chr182428 306 ------
NM_015291chr133451 2868 2510 1222 ----
NM_015296chr1311098 ------
NM_015313chr1153145 1578 1355 1166 659 ------
NM_015317chr2----12053 --
NM_015326chr122771 2561 --22311 767 --
NM_015335chr1232021 413 248 ------
NM_015344chr82247 123 ------
NM_015347chr121710 ------
NM_015349chr622849 1990 ------
NM_015355chr1711332 ------
NM_015365chrX12677 12659 ----
NM_015375chr121658 839 --2267 115 --
NM_015397chr91770 11677 ----
NM_015435chr8------11275
NM_015443chr171409 1939 ----
NM_015455chr533940 3346 217 1161 ----
NM_015458chr834100 1939 1931 1233 15261 --
NM_015460chr311624 ------
NM_015469chr9--1106 161 --
NM_015534chr1----1451 --
NM_015535chr253430 2786 2546 594 55 --1434 --
NM_015542chr101367 ------
NM_015548chr6171 ------
NM_015560chr31387 --12489 --
NM_015568chr2054024 3721 3637 3352 1591 --21474 962 --
NM_015570chr711621 ------
NM_015571chr612191 --12332 --
NM_015576chr31757 --1538 --
NM_015577chr521446 1239 ----11529
NM_015601chr101305 --1876 --
NM_015630chr22914 36 --11092 --
NM_015640chr135010 3778 2028 15063 11665 11705
NM_015690chr22688 218 --1679 --
NM_015695chr621612 647 ------
NM_015719chr191162 --2669 58 --
NM_015866chr1----11397 --
NM_015878chr841833 1575 1432 858 ------
NM_015879chr1856024 5737 5661 3046 935 ------
NM_015881chr111144 --1197 --
NM_015886chr845638 5453 3589 1227 14204 25400 3901 24021 4007
NM_015888chr1--11057 12157 --
NM_015898chr1931947 1558 748 ------
NM_015904chr21548 ------
NM_015912chr842203 2181 1019 149 ------
NM_015948chr6------1383
NM_015980chr541623 1580 617 156 ------
NM_015981chr532939 2694 344 --13185 --
NM_015995chr1545026 3652 2183 2175 13858 ----
NM_016025chr1631924 1471 1257 ------
NM_016040chr122592 2548 ------
NM_016041chr171337 ------
NM_016061chr2----1615 11184
NM_016096chr811999 ------
NM_016107chr521156 999 ------
NM_016141chr31614 ------
NM_016201chr3--1556 ----
NM_016205chr4------1944
NM_016219chr91190 --1458 --
NM_016231chr1731633 1518 1332 ------
NM_016248chr131812 --11038 22903 2793
NM_016263chr1942716 2626 2193 1300 ------
NM_016271chr18----11662 --
NM_016308chr111760 --1217 --
NM_016316chr2----1631 --
NM_016322chr912423 --22609 861 --
NM_016339chr1731503 622 614 ----1585
NM_016376chr1732746 341 141 11272 24118 3728 --
NM_016424chr1711246 --1645 --
NM_016431chr222768 285 ------
NM_016436chr2022343 943 --1430 --
NM_016441chr211938 --1324 --
NM_016512chr82242 101 ------
NM_016513chr623780 1102 --168 --
NM_016542chrX21444 640 --11414 --
NM_016577chr354180 2826 1045 832 807 ------
NM_016603chr52777 133 --1871 --
NM_016605chr521904 670 --12531 --
NM_016656chrX------1427
NM_016836chr2124 --1484 --
NM_016839chr2124 --1484 --
NM_016936chr1612172 --21812 101 12162
NM_016937chrX1624 ------
NM_016946chr11835 150 22930 996 --
NM_016950chr41976 --1561 --
NM_017409chr122260 223 ------
NM_017415chr554344 3652 1677 198 43 1788 54432 3258 333 268 148 --
NM_017420chr1412912 ------
NM_017548chr3--11977 ----
NM_017551chr1011039 ----12437
NM_017553chr153984 382 151 ------
NM_017558chr161343 ------
NM_017582chr111280 11626 --1732
NM_017590chr2221701 1693 --11796 --
NM_017602chrX1908 ------
NM_017610chr151633 ------
NM_017629chr121717 599 --1329 --
NM_017633chr623760 595 ------
NM_017634chr831764 1289 151 ------
NM_017635chr1111423 ------
NM_017637chr968916 8451 8013 1192 749 189 --12476 --
NM_017643chr17------12682
NM_017644chr344708 3984 322 127 --23974 1082 --
NM_017649chr10182 ------
NM_017650chr734532 4028 557 --35614 1915 353 --
NM_017651chr61343 ------
NM_017657chr21294 ------
NM_017658chr1434123 765 403 --24049 3763 1929
NM_017667chr7----1158 --
NM_017679chr171703 ------
NM_017699chr321209 678 --145 --
NM_017709chr164015 3933 3717 3419 3350 501 --14043 --
NM_017715chr72673 180 --1295 --
NM_017719chr322071 420 --22574 1964 --
NM_017730chr31104 ------
NM_017738chr931244 835 50 ------
NM_017749chr112837 21 ------
NM_017754chr614263 14752 23749 1416 --
NM_017768chr11214 ------
NM_017772chr611785 ------
NM_017778chr8----1598 --
NM_017787chr101682 ----12715
NM_017799chr1421893 1356 ------
NM_017824chr10----1555 --
NM_017831chr1814176 --13977 --
NM_017864chr81103 ------
NM_017896chr2021087 925 --22154 630 --
NM_017902chr1045024 4346 1762 144 ------
NM_017913chr9185 --1454 --
NM_017919chr955653 4100 1231 170 26 --35821 3809 1136 25720 1238
NM_017966chr1121361 458 1243 21026 102 --
NM_017988chr12------1336
NM_018011chr131462 ------
NM_018014chr2----1426 --
NM_018027chr1021156 830 12990 ----
NM_018030chr18122 ------
NM_018036chr141216 13924 12903 --
NM_018061chr1----1177 --
NM_018078chr41701 --1129 --
NM_018125chr12408 377 ------
NM_018126chr4--185 ----
NM_018133chr321485 531 ------
NM_018150chr13859 599 590 ------
NM_018155chr342527 1310 1266 597 ------
NM_018157chr1232568 1043 937 12914 ----
NM_018179chr121268 ------
NM_018181chr1821576 607 11415 ----
NM_018182chr1742027 1695 458 376 ------
NM_018192chr311040 --1819 --
NM_018195chr1111516 11452 1472 --
NM_018214chr631271 1201 450 ------
NM_018221chr21162 ------
NM_018223chr122131 85 ------
NM_018237chr10------132
NM_018244chr201334 ------
NM_018245chr101163 ------
NM_018312chr1111520 --1550 --
NM_018313chr31764 12006 12523 --
NM_018325chr93648 403 64 11112 ----
NM_018330chr1031372 566 343 --11241 --
NM_018334chr71421 ------
NM_018351chr1231509 1125 168 ------
NM_018362chr1133645 3221 2727 ------
NM_018369chr5--126 1309 --
NM_018375chr1411862 --1455 11220
NM_018388chrX----1534 --
NM_018403chr32687 271 --22545 1151 --
NM_018416chr121643 ----1544
NM_018440chr826751 523 18339 17272 15792
NM_018486chrX142 --1487 --
NM_018490chr111109 ------
NM_018566chr134656 4134 3319 --13657 --
NM_018584chr12412 402 ------
NM_018638chr1235301 4820 2278 ------
NM_018644chr1111442 --1277 --
NM_018650chr111708 --11622 --
NM_018657chr3----1711 --
NM_018667chr1622813 86 --12832 --
NM_018689chr152259 214 --1165 11646
NM_018695chr511997 --1525 --
NM_018697chr742079 1816 673 400 --1242 --
NM_018700chr511207 --1300 --
NM_018704chr131967 1356 662 --11703 --
NM_018708chr1921597 1283 1163 21666 610 1180
NM_018841chr11449 ----13534
NM_018846chr7----194 --
NM_018898chr5------22362 197
NM_018899chr5------22362 197
NM_018900chr5------22362 197
NM_018901chr5------22362 197
NM_018902chr5------22362 197
NM_018903chr5------22362 197
NM_018904chr5------22362 197
NM_018905chr5------22362 197
NM_018906chr5------22362 197
NM_018907chr5------22362 197
NM_018908chr5------22362 197
NM_018909chr5------22362 197
NM_018910chr5------22362 197
NM_018911chr5------22362 197
NM_018912chr531500 521 411 ------
NM_018913chr531500 521 411 ------
NM_018914chr531500 521 411 ------
NM_018915chr531500 521 411 ------
NM_018916chr531500 521 411 ------
NM_018917chr531500 521 411 ------
NM_018918chr531500 521 411 ------
NM_018919chr531500 521 411 ------
NM_018920chr531500 521 411 ------
NM_018921chr531500 521 411 ------
NM_018922chr531500 521 411 ------
NM_018923chr531500 521 411 ------
NM_018924chr531500 521 411 ------
NM_018925chr531500 521 411 ------
NM_018926chr531500 521 411 ------
NM_018927chr531500 521 411 ------
NM_018928chr531500 521 411 ------
NM_018929chr531500 521 411 ------
NM_018945chr631435 709 297 --11425 --
NM_018948chr111223 --11162 --
NM_018972chr821893 668 --12426 --
NM_018977chrX1965 --1356 --
NM_018979chr1222564 1832 ----12307
NM_018999chr10------24272 1550
NM_019000chr5----11587 --
NM_019001chr3----1589 14757
NM_019036chr61943 --1916 --
NM_019041chr632131 878 325 ------
NM_019042chr721134 240 ------
NM_019058chr101312 ------
NM_019063chr22621 273 --2544 189 --
NM_019071chr71206 1791 ----
NM_019084chr10------12559
NM_019091chr221116 252 ------
NM_019096chr63347 168 117 ------
NM_019116chr1623628 446 --1736 --
NM_019556chrX----1469 --
NM_019593chr20--21224 767 --1817
NM_019594chr921088 428 ------
NM_019605chr11678 1658 1491 --
NM_019843chr221140 ------
NM_019884chr191230 ------
NM_019891chr11413 ------
NM_020116chr41402 ------
NM_020122chr211502 --13836 11860
NM_020123chr1021510 1027 ------
NM_020151chr2131 --11379 --
NM_020177chr542877 925 318 287 12648 ----
NM_020204chr11141 ------
NM_020239chr111707 --12219 --
NM_020245chr624217 590 --11938 --
NM_020309chr1921112 1024 ------
NM_020311chr2----1599 --
NM_020338chr1033641 2474 1163 13318 ----
NM_020341chr201706 ------
NM_020342chr232592 1800 728 11633 2720 153 --
NM_020346chr1111496 ------
NM_020403chr1321711 681 ------
NM_020416chr452635 2554 1061 899 651 --1756 --
NM_020443chr125782 1303 --46610 2502 2292 160 --
NM_020466chr655012 1048 717 445 437 ------
NM_020473chrX1309 1505 ----
NM_020474chr1821746 691 ------
NM_020640chr322261 627 --1507 --
NM_020644chr111730 ------
NM_020651chr23653 489 475 ------
NM_020672chr12563 30 ------
NM_020686chr1642844 2085 509 210 --1181 --
NM_020697chr831259 180 87 ------
NM_020699chr12646 96 --14807 --
NM_020727chr2133628 2474 293 --13586 13008
NM_020739chr1532672 837 678 ------
NM_020740chr171338 ------
NM_020742chrX2580 329 --2694 188 --
NM_020747chr5------179
NM_020755chr611324 ------
NM_020760chr221758 508 ------
NM_020766chrX23035 186 --22950 648 14519
NM_020772chr1736033 913 625 15403 16573 15496
NM_020774chr1835497 4469 1373 --1170 --
NM_020782chr1234476 3373 58 --24504 3513 11901
NM_020783chr1812358 ------
NM_020791chr1711064 ------
NM_020795chr1731668 1446 467 11638 ----
NM_020796chr521986 1201 ----12706
NM_020801chr5--11725 22560 1795 --
NM_020807chr1621567 118 ------
NM_020808chr12453 224 ------
NM_020814chr221281 159 ------
NM_020819chr611037 ----11215
NM_020825chr1693760 2832 2367 1533 1295 974 600 526 366 ------
NM_020841chr1222849 709 ------
NM_020845chr1222148 316 ----137
NM_020871chrX1539 11827 ----
NM_020873chr31778 ------
NM_020888chr121469 710 --1161 --
NM_020918chr1012338 --22790 741 --
NM_020920chr141256 ------
NM_020922chrX2641 564 ------
NM_020948chr1142 ------
NM_020952chr91655 1137 ----
NM_020960chr954450 4195 3522 1652 1608 ------
NM_020981chr22746 60 ------
NM_020987chr101309 --11083 --
NM_020993chr1222777 671 --1971 --
NM_021033chr1322895 1269 ----198
NM_021072chr521902 521 ------
NM_021083chrX11438 1742 12764 --
NM_021096chr2233203 2376 1327 ------
NM_021136chr141297 ------
NM_021168chr162529 377 11307 21173 215 --
NM_021192chr2----1354 --
NM_021202chr2022926 2029 1983 12680 --
NM_021215chr2031981 1776 892 --12480 --
NM_021216chr1921398 1003 11103 ----
NM_021222chr131394 1058 971 --1550 --
NM_021249chr1411676 ------
NM_021255chr1432814 407 176 1415 ----
NM_021269chr1921991 1977 ------
NM_021620chr61707 --2308 166 --
NM_021629chr313763 --24737 3143 14626
NM_021630chr81329 ------
NM_021638chr474992 4559 3822 1556 1431 858 256 --13647 --
NM_021643chr2--1525 21868 1764 --
NM_021644chr102990 327 ------
NM_021728chr141364 ------
NM_021738chr10--1599 186 --
NM_021784chr20195 ------
NM_021813chr655516 5213 4265 745 111 ----1200
NM_021911chr525245 488 ------
NM_021943chr6------1375
NM_021945chr643525 3460 3363 127 ------
NM_021946chrX--11463 1595 --
NM_021958chr11257 ------
NM_021961chr1167388 4822 2806 2781 1286 115 --12406 --
NM_021964chr336052 2306 728 --26499 1799 --
NM_021970chr42579 186 ------
NM_021976chr62996 718 --122 --
NM_021999chr131188 ------
NM_022048chr1535375 5122 4621 --21652 1519 --
NM_022058chr2172 ------
NM_022072chr31212 --1222 --
NM_022079chr101305 --1876 --
NM_022118chr131551 ------
NM_022130chr521401 1348 ------
NM_022137chr1431470 305 115 --12029 --
NM_022153chr1053030 2261 1382 696 222 --23539 750 --
NM_022157chr11169 ------
NM_022166chr1665341 1718 1624 1076 615 384 ------
NM_022371chr13271 142 91 ------
NM_022373chr71115 1247 ----
NM_022451chr10--1591 ----
NM_022459chr1335178 4406 1823 1979 25619 1895 14924
NM_022461chr321329 257 ------
NM_022462chr1913429 ----23647 3533
NM_022465chr1222863 2575 22362 2064 ----
NM_022474chr1432521 839 537 ------
NM_022483chr531800 1207 95 ------
NM_022491chr1233486 3084 2727 ------
NM_022497chr32759 34 --21382 1108 --
NM_022566chr151475 ------
NM_022648chr244548 3972 3252 778 ------
NM_022650chr51251 ------
NM_022652chr1211119 ------
NM_022726chr621242 1180 --1605 21204 427
NM_022728chr71104 ------
NM_022735chr121518 224 ------
NM_022749chr821438 1280 --1947 --
NM_022758chr643192 3148 2937 968 --1210 --
NM_022763chr332231 1168 150 --11147 --
NM_022771chr122891 803 ------
NM_022780chr22751 652 ----11451
NM_022781chr943089 2526 565 34 --12760 --
NM_022817chr241863 588 547 400 12097 150 --
NM_022832chr432434 2204 340 12568 1602 --
NM_022845chr16--11538 21809 1728 --
NM_022893chr2----12778 12045
NM_022898chr1443500 3007 1018 897 --34427 776 435 --
NM_022912chr222516 903 --12522 --
NM_023000chr14--1319 ----
NM_023001chr14--1319 ----
NM_023012chr12199 ----1165
NM_023074chr1911279 --1240 --
NM_023923chr133695 3588 2649 ------
NM_023925chr12----136 --
NM_023940chr41809 ------
NM_024007chr51198 ------
NM_024034chr2031017 371 22 ------
NM_024046chr321264 484 ------
NM_024076chr19--1390 11638 --
NM_024090chr421194 88 ------
NM_024111chr151218 ------
NM_024117chr911142 ------
NM_024293chr22831 174 ------
NM_024294chr643192 3148 2937 968 --1210 --
NM_024308chr172208 70 ------
NM_024337chr5196 ------
NM_024345chr926031 367 --21689 37 --
NM_024415chr5------1208
NM_024423chr1823786 1182 ------
NM_024424chr1131197 268 143 ------
NM_024425chr1131197 268 143 ------
NM_024426chr1131197 268 143 ------
NM_024490chr151576 ------
NM_024524chr322076 670 12931 3732 579 314 --
NM_024539chrX1420 --1982 11297
NM_024545chr21718 --1301 --
NM_024548chr321431 487 11275 ----
NM_024551chr1241869 1658 896 656 11831 ----
NM_024551chr1241869 1658 896 656 11831 ----
NM_024554chr1197 ------
NM_024569chr122096 54 --22572 2379 --
NM_024590chr421519 1305 1193 11541 --
NM_024617chr92812 337 ------
NM_024636chr722181 2014 ------
NM_024639chr612701 ------
NM_024645chr811106 --11547 --
NM_024646chr123294 3260 ----1938
NM_024665chr343256 3237 1250 649 ------
NM_024674chr142578 2395 537 490 12896 ----
NM_024686chr1----1497 --
NM_024692chr221832 43 ------
NM_024700chr11413 1393 2299 98 --
NM_024744chr212630 --1830 --
NM_024749chr121463 571 --139 --
NM_024753chr2122 --1173 --
NM_024757chr92806 795 ------
NM_024771chr1132027 2021 687 --1989 --
NM_024824chr1421128 197 ------
NM_024875chr1011525 ------
NM_024884chr1434158 693 465 --23835 3586 --
NM_024887chr121627 620 --1106 --
NM_024900chr431681 554 436 1627 ----
NM_024900chr431681 554 436 1627 ----
NM_024947chr379289 7358 7348 6494 3381 2564 768 15975 59193 8910 7238 6160 5852 --
NM_024953chr12--1151 11095 --
NM_024971chr91655 1137 ----
NM_024989chr248098 5140 1737 192 16351 28195 8166 --
NM_025057chr141145 ------
NM_025073chr133026 1706 552 11420 --21873 526
NM_025074chr411097 12005 13011 --
NM_025090chr173183 166 157 ------
NM_025099chr173823 357 155 --2896 148 11150
NM_025106chr151584 453 436 327 40 ------
NM_025133chr21202 --1293 --
NM_025146chr332696 2614 924 ------
NM_025160chr121038 72 --11275 --
NM_025191chr123384 2165 --11305 --
NM_025196chr42738 23 ------
NM_025221chr411310 ------
NM_025222chr352964 2699 764 659 201 ----12923
NM_025230chr1441529 1250 473 291 ------
NM_025248chr1733066 2669 2062 --1174 --
NM_025250chr752281 2078 1192 1128 739 ------
NM_025263chr63724 512 177 --2312 164 --
NM_030594chr1511355 --1523 --
NM_030625chr1041671 1004 456 57 --2406 289 --
NM_030627chr51157 --13514 --
NM_030634chr111531 ----11679
NM_030640chr121123 --1308 --
NM_030647chr755998 5173 4768 4241 1286 12043 ----
NM_030650chr234155 1331 486 --12879 --
NM_030670chr1221883 721 --21760 226 --
NM_030671chr1221883 721 --21760 226 --
NM_030674chr1225824 3920 14092 ----
NM_030795chr8----2458 147 --
NM_030802chr17------1890
NM_030808chr1711036 ------
NM_030816chr143385 2980 2920 945 ----1698
NM_030820chr61113 --137 --
NM_030918chr121537 302 --13831 13797
NM_030920chr11332 --11614 --
NM_030927chr1021515 621 --1162 11038
NM_030937chr111000 ----1334
NM_030939chr61928 ------
NM_030949chr631394 1142 132 ------
NM_030962chr111172 --1502 --
NM_030963chr6--1197 1562 --
NM_030964chr52957 728 11424 ----
NM_030981chr1111144 ------
NM_030984chr7134 ------
NM_031157chr121492 ------
NM_031216chr18----11585 1765
NM_031243chr732245 2000 416 ------
NM_031244chr6--11111 ----
NM_031262chr9189 ------
NM_031263chr91146 ------
NM_031266chr52196 179 ------
NM_031292chr12--1662 ----
NM_031411chr5------22362 197
NM_031438chr5--1566 ----
NM_031442chrX1656 --12150 11077
NM_031445chr213017 13179 11063 --
NM_031469chr653194 2609 762 472 136 ------
NM_031844chr133665 3142 325 --11629 --
NM_031845chr21633 --1880 --
NM_031847chr21633 --1880 --
NM_031849chr5------22362 197
NM_031857chr5------22362 197
NM_031860chr5------22362 197
NM_031866chr101958 ------
NM_032012chr934542 1579 382 --11257 --
NM_032041chr812632 --1230 --
NM_032042chr511128 ------
NM_032047chr3----12185 1592
NM_032088chr531500 521 411 ------
NM_032092chr531500 521 411 ------
NM_032102chr1122822 442 ----11010
NM_032104chr1199 152 ----
NM_032105chr156860 5829 2713 961 99 152 12922 --
NM_032156chr12----136 --
NM_032181chr21738 --1228 --
NM_032208chr233037 647 517 ------
NM_032217chr41560 ------
NM_032242chr31249 --198 13089
NM_032268chr1622490 978 12402 22426 348 --
NM_032288chr332291 2248 1876 --22313 644 --
NM_032321chr2173 138 ----
NM_032345chr121375 ------
NM_032364chr121165 ------
NM_032373chr1021864 806 --25308 364 --
NM_032403chr531500 521 411 ------
NM_032436chr132107 35 ------
NM_032439chr10----1348 --
NM_032440chr1012521 ------
NM_032458chrX12390 --11374 --
NM_032482chr1952259 1835 1788 1693 68 1373 62310 1818 1763 819 703 415 --
NM_032503chr61251 ------
NM_032505chr31797 --11717 1723
NM_032514chr201391 ------
NM_032523chr21478 ------
NM_032547chr431306 1013 459 ------
NM_032552chr911225 --11910 --
NM_032558chr921293 471 --181 --
NM_032575chr1641875 800 221 26 --11267 1143
NM_032590chr121380 --21041 339 --
NM_032632chr141494 ------
NM_032646chr1731497 1448 234 --11362 --
NM_032682chr331204 1009 722 ------
NM_032689chr191143 ------
NM_032701chr19------2567 556
NM_032711chr1764177 3500 3203 2857 1692 1159 --53183 1712 1205 550 291 --
NM_032727chr101479 1300 ----
NM_032765chr52292 35 ------
NM_032786chr121160 ------
NM_032800chr152536 1852 1078 1048 53 --11981 --
NM_032804chr1042450 2396 2204 1827 ------
NM_032810chr103340 226 42 ------
NM_032812chr10--144 ----
NM_032833chr11932 --12418 --
NM_032867chr111255 1556 ----
NM_032876chr1421383 695 ------
NM_032900chr1063015 2765 2588 1326 1270 862 160 ----
NM_032932chr1766043 5939 5900 3993 2277 1868 35984 4276 1847 24295 4289 --
NM_032961chr411043 ------
NM_032982chr732465 1990 775 ------
NM_032983chr743279 2804 312 291 --169 --
NM_033012chr132915 196 ------
NM_033018chrX21013 902 1200 ----
NM_033023chr751073 1063 440 389 76 ------
NM_033030chr211341 ------
NM_033055chr11332 ------
NM_033081chr20----11221 --
NM_033132chr13----21865 155 --
NM_033136chr521236 201 ------
NM_033137chr521236 201 ------
NM_033150chr121268 ----1368
NM_033198chr17--155 1544 --
NM_033225chr822545 69 ------
NM_033228chr51147 ------
NM_033259chr31638 ------
NM_033267chr5----2726 44 --
NM_033331chr932505 2187 303 ------
NM_033360chr1241387 1098 443 394 13254 ----
NM_033380chrX--2435 394 --1113
NM_033381chrX--2435 394 --1113
NM_033389chr1784685 4185 3872 3007 1308 568 143 125 --14352 --
NM_033394chr211250 11158 ----
NM_033425chr1122483 833 --1559 --
NM_033430chr4142 13373 ----
NM_033437chr4142 13373 ----
NM_033480chr622709 242 ------
NM_033481chr622709 242 ------
NM_033505chr235545 958 751 ------
NM_033656chr2125369 4191 ----12346
NM_048368chr181282 ------
NM_052834chr182428 306 ------
NM_052840chr1531261 1224 134 --11335 --
NM_052869chr1731497 1448 234 --11362 --
NM_052874chr162583 145 ------
NM_052879chr1214016 14094 ----
NM_052880chr22139 ----11341
NM_052885chr1234128 1882 417 --11061 --
NM_052898chr821693 1469 11719 11412 --
NM_052907chr1222858 347 ------
NM_052913chr6----160 --
NM_052918chr1033275 2648 403 --33562 2816 1407 --
NM_052927chr511991 ------
NM_052950chr131294 ------
NM_052962chr611253 ----11759
NM_052978chr1421649 255 1442 ----
NM_053002chr321081 156 --1289 --
NM_053016chr916483 17406 11010 --
NM_053064chr142611 251 --1735 --
NM_054025chr1111442 --1277 --
NM_057089chr71157 150 ----
NM_057161chr61132 --1221 --
NM_057164chr2----1260 1173
NM_057165chr2----1260 1173
NM_057166chr2----1260 1173
NM_057167chr2----1260 1173
NM_057175chr432244 1962 599 --1648 12477
NM_058172chr411688 ------
NM_058241chr2------12206
NM_058241chr2------12206
NM_058243chr191843 ------
NM_078485chr6--1175 1487 --
NM_078625chr61915 --1255 --
NM_080546chr91918 --11616 --
NM_080552chr201632 ------
NM_080597chr18122 ------
NM_080599chr101367 ------
NM_080629chr12203 48 --2328 280 --
NM_080630chr12203 48 --2328 280 --
NM_080645chr631453 1400 199 --1673 --
NM_080671chr232137 1577 268 ------
NM_080679chr61624 ------
NM_080680chr61624 ------
NM_080681chr61624 ------
NM_080717chr12------1400
NM_080738chr141705 1623 1613 1386 --1632 --
NM_080764chr2221135 236 ------
NM_080792chr2022036 1460 1836 1857 --
NM_080867chr1444837 593 213 101 --13751 --
NM_080872chr823336 3045 ----13940
NM_080927chr31679 1175 ----
NM_130436chr211395 --151 --
NM_130438chr211972 --1628 --
NM_130439chr1012282 11904 ----
NM_130439chr1012282 11904 ----
NM_130831chr31387 --12489 --
NM_130832chr31387 --12489 --
NM_130833chr31387 --12489 --
NM_130834chr31387 --12489 --
NM_130835chr31387 --12489 --
NM_130836chr31387 --12489 --
NM_130837chr31387 --12489 --
NM_133170chr2077817 6793 6745 6692 1954 691 352 ------
NM_133264chr1721494 1009 1775 ----
NM_133334chr476404 6014 5001 1598 1549 1177 747 --15012 --
NM_133457chr731486 1264 263 --11199 --
NM_133468chr731678 535 277 ------
NM_133474chr411537 ------
NM_133476chr1251199 797 276 223 48 ------
NM_133477chr42591 409 ----1514
NM_133494chr1------183
NM_133496chr1--11149 ----
NM_133638chr51421 1321 1153 --
NM_133646chr255533 3931 3633 1930 233 --34539 3649 1255 --
NM_134428chr91344 ------
NM_138357chr101302 ------
NM_138391chr1------1259
NM_138396chr122898 90 ------
NM_138426chr72839 412 --1745 --
NM_138437chrX----167 --
NM_138459chr611267 12529 ----
NM_138473chr1244813 3978 3430 227 23552 3174 35102 4799 118 13591
NM_138492chr53383 342 318 ------
NM_138555chr151540 ------
NM_138559chr2----1416 --
NM_138569chr6------157
NM_138576chr1443500 3007 1018 897 --34427 776 435 --
NM_138621chr243754 3346 1351 83 --2890 291 --
NM_138694chr61299 ------
NM_138713chr1621364 1055 16696 47341 5667 2350 1647 --
NM_138714chr1621364 1055 16696 47341 5667 2350 1647 --
NM_138730chr6----2368 309 --
NM_138766chr51554 ------
NM_138782chr512155 ------
NM_138804chr21571 ------
NM_138821chr51554 ------
NM_138822chr51554 ------
NM_138927chr21----11066 --
NM_138970chr1422002 739 --1714 1898
NM_138971chr112720 518 11058 ----
NM_138971chr112720 518 11058 ----
NM_138972chr112720 518 11058 ----
NM_138972chr112720 518 11058 ----
NM_138973chr112720 518 11058 ----
NM_138973chr112720 518 11058 ----
NM_139014chr631848 914 881 ------
NM_139015chr1251691 1265 1146 533 169 ------
NM_139045chr91164 --2853 847 --
NM_139067chr121276 ------
NM_139070chr51452 ------
NM_139157chr112710 254 ------
NM_139283chr122491 275 --12225 --
NM_139316chr711023 ------
NM_139319chr122691 438 ------
NM_139321chr20--14083 33416 2846 1540 --
NM_144571chr466865 6570 6319 6039 5681 5250 ------
NM_144579chr242584 2193 2047 1810 --42758 2571 1954 806 --
NM_144580chr1----1238 --
NM_144590chr1012151 12829 1407 --
NM_144599chr1524941 3877 --23933 3417 199
NM_144628chr2022728 1870 --1267 --
NM_144632chr211878 ------
NM_144635chr311243 11050 ----
NM_144636chr31547 ------
NM_144642chr31409 ------
NM_144657chrX----1586 --
NM_144664chr1132340 506 117 ------
NM_144671chr1221713 166 21808 588 1694 --
NM_144723chr51666 ------
NM_144767chr1521341 724 13304 11510 --
NM_144778chr13----1630 --
NM_144949chr22204 169 ------
NM_144967chrX--1243 1744 --
NM_145005chr9------1185
NM_145049chr521080 1047 ------
NM_145055chr1833782 1511 742 ------
NM_145068chr172227 22 ------
NM_145113chr1411051 ------
NM_145117chr111539 --1631 1528
NM_145185chr1921292 697 ------
NM_145203chr132234 124 ------
NM_145206chr1013173 ------
NM_145284chrX12136 ----1793
NM_145287chr18--1173 146 --
NM_145296chr191156 ------
NM_145686chr2--1260 32619 2489 235 --
NM_145687chr2--1260 32619 2489 235 --
NM_145698chr101819 --2583 70 --
NM_145727chr6------2391 49
NM_145739chr21478 ------
NM_145753chr321605 668 ------
NM_145808chr721916 433 --11227 --
NM_145859chr3----1304 --
NM_145860chr3----1304 --
NM_145861chr141705 1623 1613 1386 --1632 --
NM_145909chr61212 ------
NM_147127chr4167 ------
NM_147128chr711426 ------
NM_147150chr943340 977 467 398 13295 133 --
NM_147175chrX22141 2003 ------
NM_147181chr411310 ------
NM_147182chr411310 ------
NM_147183chr411310 ------
NM_147189chr821436 696 ------
NM_147223chr2135 ------
NM_148174chr841833 1575 1432 858 ------
NM_148571chr1721820 1697 --1229 --
NM_148955chr15105693 5139 4593 4422 4012 2427 1414 1071 728 350 ------
NM_152227chr201715 --1483 --
NM_152233chr1411676 ------
NM_152253chr2233668 121 30 ----1556
NM_152265chr13286 234 220 ------
NM_152267chr22----169 --
NM_152282chr311247 ----11302
NM_152380chr141503 1438 1415 492 ------
NM_152390chr21447 ------
NM_152400chr411673 ----21928 710
NM_152410chr61414 --140 --
NM_152414chr811313 ------
NM_152422chr91220 --1284 --
NM_152423chrX----11579 1544
NM_152447chr141107 ------
NM_152455chr1512056 12198 1265 --
NM_152462chr171101 ------
NM_152470chr1843013 2584 1547 537 --24107 459 --
NM_152495chr12396 264 --11146 --
NM_152515chr2130 ------
NM_152522chr21863 ------
NM_152529chr22669 341 ------
NM_152538chr311163 11152 ----
NM_152553chr61199 ----1435
NM_152556chr71724 ----12012
NM_152608chr121870 258 ------
NM_152622chr533493 398 233 --12810 --
NM_152624chr585298 5251 4982 4596 2624 1925 1266 89 --26942 2005 11543
NM_152629chr913317 --23608 940 --
NM_152636chr1112151 --22452 2286 --
NM_152641chr1222593 681 ------
NM_152671chr21106 ------
NM_152678chr332544 2394 2288 --1343 --
NM_152699chr333228 592 317 13642 1109 --
NM_152744chr731393 661 259 13575 ----
NM_152756chr513979 13256 14103 --
NM_152758chr82849 618 --11910 --
NM_152780chrX21048 31 ------
NM_152826chr15105693 5139 4593 4422 4012 2427 1414 1071 728 350 ------
NM_152835chr1----12464 12626
NM_152838chr201363 --12773 --
NM_152857chr6------1969
NM_152858chr6------1969
NM_152896chr91640 --1565 --
NM_152910chr13------151
NM_152924chr1546707 5816 5065 1379 ------
NM_152988chr1921213 737 --31480 366 139 --
NM_153029chr1644155 3034 1150 583 --14029 13218
NM_153188chr524195 169 ------
NM_153207chr1224113 2870 ------
NM_153262chr112857 --22169 429 --
NM_153273chr352734 2222 381 231 117 --12300 --
NM_153333chrX1385 ------
NM_153347chr1132472 1700 890 --1296 --
NM_153367chr1043685 1590 1128 1033 --22466 861 --
NM_153437chr9199 ------
NM_153453chr61325 ------
NM_153619chr1522420 1452 --1977 --
NM_153633chr121260 ------
NM_153649chr1------12270
NM_153675chr20195 ------
NM_153689chr2----11634 --
NM_153757chr411103 2299 224 --11267
NM_153810chr1043952 1447 999 396 --24915 3128 --
NM_153812chr142063 798 383 98 --1930 --
NM_153819chr111151 ------
NM_153836chr21613 --127 --
NM_170665chr1234453 4328 3873 --11287 --
NM_170674chr15--11430 ----
NM_170675chr15--11106 ----
NM_170676chr15--11106 ----
NM_170677chr15--11430 ----
NM_170750chrX2691 42 ------
NM_170751chr611107 ------
NM_170752chr611107 ------
NM_170768chr1121305 457 ----11135
NM_171825chr532939 2694 344 --13185 --
NM_172070chr232130 1911 148 ------
NM_172071chr126512 6345 --2852 504 --
NM_172078chr7----138 --
NM_172079chr7----138 --
NM_172080chr7----138 --
NM_172081chr7----138 --
NM_172082chr7----138 --
NM_172083chr7----138 --
NM_172084chr7----138 --
NM_172127chr41506 --11929 --
NM_172128chr41462 --11885 --
NM_172159chr321786 871 168 ----
NM_172160chr321786 871 168 ----
NM_172169chr1021586 205 --21592 691 --
NM_172170chr1021586 205 --21592 691 --
NM_172171chr1021586 205 --21592 691 --
NM_172173chr1021586 205 --21592 691 --
NM_172216chr1243004 2959 2373 2290 12723 ----
NM_172315chr15--11430 ----
NM_172316chr15--11430 ----
NM_172337chr141364 ------
NM_173078chrX1110 ------
NM_173156chr11717 --32034 1730 755 --
NM_173214chr1621364 1055 16696 47341 5667 2350 1647 --
NM_173354chr2131543 285 122 ------
NM_173468chr426040 479 ----12273
NM_173500chr1511313 ------
NM_173510chr22----12376 12926
NM_173515chr61197 --1686 --
NM_173552chr32676 505 ------
NM_173562chr61793 --22553 251 --
NM_173576chr10144 ------
NM_173595chr1235271 4719 1807 ----15007
NM_173602chr1221278 754 --23314 2679 --
NM_173618chr16186 ------
NM_173642chr198740 7982 6938 6711 6358 2622 2161 1876 966 --1534 --
NM_173667chr51497 --21892 23 --
NM_173683chr831686 1335 481 --21284 405 --
NM_173808chr123112 2996 ------
NM_173809chr1011256 ------
NM_173812chr1221380 502 ------
NM_173822chr222012 347 --1857 --
NM_173829chr555132 4780 2459 1372 583 --11863 --
NM_174858chr14955 470 304 187 ------
NM_174934chr1131421 1316 258 --11322 --
NM_174938chr91102 ------
NM_174963chr11317 ------
NM_174964chr11317 ------
NM_174965chr11336 ------
NM_174966chr11317 ------
NM_174967chr11336 ------
NM_174968chr11317 ------
NM_174969chr11317 ------
NM_174970chr11336 ------
NM_174971chr11317 ------
NM_175069chr92795 217 ------
NM_175634chr8----11122 11086
NM_175635chr8----11122 11086
NM_175636chr8----11122 11086
NM_175848chr2021074 237 ----11209
NM_175848chr2021074 237 ----11209
NM_175849chr2021074 237 ----11209
NM_175849chr2021074 237 ----11209
NM_175850chr2021074 237 ----11209
NM_175850chr2021074 237 ----11209
NM_175854chr1322383 2283 ------
NM_175856chr51160 ------
NM_175866chr11260 ------
NM_175921chr523002 2921 --24249 3924 --
NM_176812chr20191 --1623 --
NM_176814chr7------166
NM_176863chr1731853 1681 399 ------
NM_176895chr5190 ------
NM_177398chr11147 11581 1704 --
NM_177399chr11147 11581 1704 --
NM_177559chr2011240 ------
NM_177560chr2011240 ------
NM_177972chr1123212 2792 ------
NM_177985chr212000 ------
NM_177990chr201706 ------
NM_177995chr91220 --1284 --
NM_177996chr2012384 --22287 1156 --
NM_178037chr1231082 1074 815 11135 ----
NM_178038chr1231082 1074 815 11135 ----
NM_178039chr123717 709 450 1770 ----
NM_178040chr123717 709 450 1770 ----
NM_178123chr21423 ----1312
NM_178126chr1732200 490 308 ------
NM_178148chr61103 --1442 --
NM_178151chrX27739 1678 26868 6432 2620 95 --
NM_178152chrX27739 1678 26868 6432 2620 95 --
NM_178153chrX27739 1678 26868 6432 2620 95 --
NM_178313chr232165 1964 429 ------
NM_178539chr121486 ------
NM_178565chr8182 ------
NM_178585chr412192 --12389 --
NM_178812chr8--11542 ----
NM_178831chr712131 ----1891
NM_178860chr171192 --11026 --
NM_180976chr62964 189 ------
NM_180977chr62964 189 ------
NM_181332chrX2580 329 --2694 188 --
NM_181336chr6186 1520 1390 --
NM_181351chr1122966 2745 ----1384
NM_181357chr1441529 1250 473 291 ------
NM_181358chr113753 --11239 --
NM_181443chr2012711 ------
NM_181481chr1856943 6168 4990 4315 1247 --14944 --
NM_181482chr1856943 6168 4990 4315 1247 --14944 --
NM_181483chr1856943 6168 4990 4315 1247 --14944 --
NM_181486chr12------1400
NM_181509chr201391 ------
NM_181532chrX----1229 --
NM_181656chr171957 ------
NM_181659chr2033196 2495 847 --32320 522 225 --
NM_181659chr2033196 2495 847 --32320 522 225 --
NM_181672chrX4769 749 522 239 ------
NM_181673chrX4769 749 522 239 ------
NM_181702chr8----1254 --
NM_181782chr612053 ------
NM_181783chr121270 --1679 --
NM_181864chr1124 --1114 --
NM_181865chr1124 --1114 --
NM_181866chr1124 --1114 --
NM_181876chr452635 2554 1061 899 651 --1756 --
NM_181886chr411278 ------
NM_181887chr411278 ------
NM_181888chr411278 ------
NM_181889chr411278 ------
NM_181890chr411278 ------
NM_181891chr411278 ------
NM_181892chr411325 ------
NM_181893chr411278 ------
NM_182485chr4--23510 615 ----
NM_182526chr1452578 2538 438 182 161 --23142 619 --
NM_182557chr1111496 --11744 --
NM_182603chr112923 94 ------
NM_182643chr81381 --139 --
NM_182645chr61325 ------
NM_182646chr4--23510 615 ----
NM_182663chr122037 28 ------
NM_182664chr122167 158 ------
NM_182665chr122037 28 ------
NM_182728chr1441812 1491 724 134 ------
NM_182729chr12------1392
NM_182742chr12------1392
NM_182743chr12------1392
NM_182758chr15--23439 2931 ----
NM_182797chr201322 ------
NM_182894chr1421719 1669 --161 --
NM_182898chr756267 5107 1811 1388 457 --21817 227 --
NM_182899chr756267 5107 1811 1388 457 --21817 227 --
NM_182948chr122782 1111 --1332 --
NM_182964chr111539 --1631 1528
NM_182970chr2064018 3904 1670 882 834 395 ------
NM_182972chr122493 801 --22153 1093 --
NM_182975chr1--2390 139 ----
NM_182976chr1------1271
NM_183004chr1433440 3184 1168 ------
NM_183057chr82217 204 ------
NM_183078chr61405 ------
NM_183079chr20188 ------
NM_183237chr31301 ------
NM_183380chr6171 ------
NM_183397chr2074597 4098 4028 3900 3750 1469 75 --44881 3196 3184 88 1331
NM_183419chr8------11275
NM_184234chr201587 ------
NM_194247chr223049 455 ------
NM_194272chr152342 50 ------
NM_194278chr1432663 298 43 --13160 --
NM_194285chr1112803 --13363 --
NM_194286chr1235942 4870 4298 --16249 --
NM_194301chr14----1762 --
NM_194314chr1--14008 13586 --
NM_194328chr943089 2526 565 34 --12760 --
NM_194329chr943089 2526 565 34 --12760 --
NM_194330chr943089 2526 565 34 --12760 --
NM_194332chr943089 2526 565 34 --12760 --
NM_194434chr1843767 1411 1044 450 ------
NM_194463chrX1420 --1982 11297
NM_197941chr5------12084
NM_197968chr131609 ------
NM_197970chr211341 ------
NM_197977chr91276 1637 ----
NM_198042chr81433 ------
NM_198086chr1421383 695 ------
NM_198128chr18----11662 --
NM_198195chr3----2178 172 1528
NM_198243chr151794 ------
NM_198261chr12199 ----1165
NM_198262chr12199 ----1165
NM_198268chr113753 --11239 --
NM_198269chr113753 --11239 --
NM_198336chr71331 --1309 --
NM_198337chr72466 23 --1444 --
NM_198395chr52494 150 11215 ----
NM_198400chr1512037 --12749 --
NM_198446chr1------1153
NM_198465chrX22501 211 ------
NM_198513chr8----1396 --
NM_198563chr3149 ------
NM_198581chr214897 --32359 2106 1051 --
NM_198595chr474992 4559 3822 1556 1431 858 256 --13647 --
NM_198700chr11----1422 --
NM_198715chr145782 5703 4994 1192 ------
NM_198793chr313179 ------
NM_198794chr141499 ------
NM_198859chr355061 4323 3233 1370 917 --1972 --
NM_198880chr31104 ------
NM_198889chr41560 ------
NM_198902chr15----1116 --
NM_198935chr2023245 197 --22628 212 12454
NM_198990chr71645 ------
NM_199050chr2143410 3294 2986 2744 ------
NM_199076chr10182 ------
NM_199129chr2011173 --1911 --
NM_199131chr1042678 2308 987 619 --1448 --
NM_199188chr1214016 14094 ----
NM_199190chr1214016 14094 ----
NM_199229chr22587 173 ------
NM_199262chr1722132 132 ------
NM_199290chr17127 ------
NM_199320chr412725 ------
NM_199320chr412725 ------
NM_199324chr453728 2953 2613 778 764 --12654 --
NM_199342chr1149 ------
NM_199421chr1444837 593 213 101 --13751 --
NM_199461chr1012381 --1794 --
NM_199462chr121658 839 --2267 115 --
NM_199478chrX31344 735 448 ------
NM_199487chr201334 ------
NM_201266chr222620 562 --12050 --
NM_201279chr222620 562 --12050 --
NM_201280chr611228 --1566 --
NM_201413chr211741 --11088 --
NM_201414chr211741 --11088 --
NM_201428chr11----1134 --
NM_201429chr11----1134 --
NM_201430chr11----160 --
NM_201520chr1721595 1532 ------
NM_201568chr11717 --32034 1730 755 --
NM_201569chr11717 --32034 1730 755 --
NM_201591chr4----21262 43 --
NM_201592chr4----21262 43 --
NM_201599chrX1780 ------
NM_201624chr1------1282
NM_201995chr11--1720 ----
NM_201998chr11--1785 ----
NM_201999chr4------1451
NM_203327chr2021661 162 --14110 --
NM_203344chr191437 ------
NM_203350chr1169 --11749 --
NM_203394chr121212 22490 2035 --1477
NM_203399chr11268 ------
NM_203401chr11268 ------
NM_203403chr9276 27 ------
NM_203434chr9----2945 283 --
NM_203437chr21294 ------
NM_203446chr211563 ------
NM_203459chr132506 2162 666 --12263 1573
NM_203464chr12456 278 --166 --
NM_203487chr1321711 681 ------
NM_203494chr15----1133 --
NM_205768chr122052 210 ------
NM_205846chr53383 342 318 ------
NM_205848chr111881 ------
NM_205861chr121627 620 --1106 --
NM_206594chr133271 2626 2328 ------
NM_206595chr133271 2626 2328 ------
NM_206852chr141297 ------
NM_206855chr62884 543 --11107 --
NM_206857chr141297 ------
NM_206876chr222497 1104 ------
NM_206914chr1222080 845 --1132 --
NM_206944chr91655 1137 ----
NM_206945chr91655 1137 ----
NM_206946chr91655 1137 ----
NM_206947chr91655 1137 ----
NM_207042chr12472 154 ------
NM_207045chr12472 154 ------
NM_207046chr12472 154 ------
NM_207304chr13----1517 --
NM_207361chr1324184 1621 1319 1780 --
NM_207371chr1011517 ------
NM_207404chr32739 274 22121 224 ----
NM_207422chrX145 ------
NM_207578chr11611 ------
NM_207660chr1421128 197 ------
NM_207661chr1421128 197 ------
NM_207662chr1421128 197 ------
NM_212460chr71678 ------
NM_213589chr263562 1305 1045 496 274 80 24486 985 ----
NM_213618chr112710 254 ------