TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-29c-5p
miRNA Sequence: UGACCGAUUUCUCCUGGUGUUC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001004342chr165968 5883 4260 1741 1724 516 25850 4498 ----
NM_003861chr1432215 1872 1034 ----11026
NM_004171chr1178186 7902 6402 2950 1410 1357 835 --29354 1851 --
NM_012262chr134620 4494 812 ----13619
NM_015313chr1123505 1576 13229 --13878
NM_017813chr842296 806 361 77 12147 --15851
NM_020177chr531221 158 41 1589 --13190
NM_024947chr389190 8700 6744 2562 863 849 198 77 ------
NM_032505chr331714 1000 795 ----12608
NM_033161chr951710 1612 1495 640 364 ----1620
NM_052885chr1274264 3971 1402 1328 1058 802 62 11824 ----
NM_152556chr721645 555 ----1433
NM_172071chr136510 6397 5891 ----12902
NM_173552chr3--11775 1410 1950
NM_194314chr165673 3730 3583 3467 2207 662 15055 ----