TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-301a-5p
miRNA Sequence: GCUCUGACUUUAUUGCACUACU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000259chr1585653 5184 5084 4560 4287 2325 1745 1360 15107 1927 --
NM_000813chr562238 2092 1780 1001 994 288 2963 644 14460 --
NM_000959chr143524 2758 1598 136 23442 751 --1912
NM_001001928chr2288326 7522 6522 3058 2938 2208 898 112 47603 6584 3219 2590 13080 16914
NM_001002257chr263327 2966 2833 2429 865 598 32233 2198 649 11327 --
NM_001003674chr18126525 6453 6193 5874 5493 5420 4581 2540 2388 2320 2224 533 --25541 4749 24819 1474
NM_001003675chr18126525 6453 6193 5874 5493 5420 4581 2540 2388 2320 2224 533 --25541 4749 24819 1474
NM_001004065chr953941 2718 1077 909 461 21013 376 --13705
NM_001004317chr633441 942 523 33834 981 198 23937 1368 --
NM_001009899chr375803 5567 5475 4163 2207 175 154 25662 4464 12319 --
NM_001014797chr10157620 7275 7184 6269 6133 5690 5402 3241 2299 1867 1715 1423 1318 1069 479 26006 111 12243 --
NM_001039580chr495004 4666 3421 3407 3262 1910 1401 1158 506 21468 1337 188 --
NM_001039585chr133781 3015 393 23699 1008 --11169
NM_001040441chr155004 3923 3674 1211 847 11982 178 13518
NM_001042599chr2107844 6488 5455 2520 2498 2474 1846 996 240 171 22540 1881 ----
NM_001100108chr1138179 7172 7024 6122 5881 5480 2679 2543 2384 2049 857 545 475 36560 3136 1344 ----
NM_001201chr453865 2550 1156 1096 1074 --1132 1291
NM_001259chr7106389 6060 5844 5415 4450 2161 1779 1763 1746 988 15054 16368 --
NM_001609chr1033085 2807 585 33974 3459 696 1137 23893 2905
NM_002264chr3104979 4454 3811 1698 1557 717 655 465 276 33 ------
NM_002336chr1284460 3887 3775 1814 1605 1509 919 413 191 --11190
NM_003298chr365889 5825 5446 4288 837 729 ----24552 306
NM_003320chr11124395 4291 3381 3259 3172 3018 1744 1355 802 727 608 404 11339 23706 3031 --
NM_003930chr722368 1761 1397 --12439
NM_004171chr11129128 8784 8763 8528 8361 7160 7132 6149 3695 3351 3078 139 18579 38673 6289 1888 --
NM_004293chr973694 3405 642 459 441 358 75 33710 2936 598 ----
NM_004338chr18126525 6453 6193 5874 5493 5420 4581 2540 2388 2320 2224 533 --25541 4749 24819 1474
NM_004612chr943265 1923 1737 418 --43926 3296 1712 1293 --
NM_004734chr1343185 2630 937 542 2881 697 --12619
NM_004866chr574165 3702 3561 3492 1754 1414 667 33598 1924 361 ----
NM_004992chrX147633 7262 6447 3204 2898 2590 2381 1930 1822 873 827 209 156 140 1511 15940 1360
NM_004992chrX147633 7262 6447 3204 2898 2590 2381 1930 1822 873 827 209 156 140 1511 15940 1360
NM_005036chr2288326 7522 6522 3058 2938 2208 898 112 47603 6584 3219 2590 13080 16914
NM_005235chr2107844 6488 5455 2520 2498 2474 1846 996 240 171 22540 1881 ----
NM_005359chr1886371 5953 4545 4194 4137 314 212 200 14940 25663 5585 --
NM_005504chr1296169 5921 5843 5275 4875 4784 4187 4171 648 35698 1716 888 --12224
NM_005966chr211524 --22244 438 1971
NM_006323chr4------2653 62
NM_006420chr2052674 2251 1378 643 532 2540 389 --1469
NM_006620chr674545 3892 3625 3603 3026 1440 1023 14625 --13830
NM_007038chr2165655 4767 4555 2290 1402 270 12423 15544 --
NM_007203chr953941 2718 1077 909 461 21013 376 --13705
NM_007249chr1389179 9095 7142 7058 6224 6039 3335 313 29207 7257 13522 --
NM_012243chr13949 326 231 ----1591
NM_012252chr735197 1125 886 ----11468
NM_012262chr154143 3973 3762 3448 1638 13947 --11670
NM_012382chr5114285 3864 3740 3734 3313 2894 1508 1415 1024 456 443 13054 --21494 1290
NM_013231chr1453140 2972 409 378 358 1758 --21516 728
NM_014721chr677461 7016 2284 1760 1720 1513 823 36363 5382 555 --12353
NM_014732chr16115868 5536 4647 4429 4077 3967 2346 2265 1634 1377 144 24141 1814 35123 1824 1732 --
NM_014877chr1787400 6857 6542 5432 4780 2894 1879 1360 15423 26938 2157 16341
NM_015046chr962760 1936 915 531 276 192 --1468 1231
NM_016260chr2107149 4613 2760 2642 2593 1961 1586 1460 1175 379 25902 482 ----
NM_016531chr454167 2849 2822 1389 202 11312 43382 1356 712 353 --
NM_017637chr9116792 6521 2975 2860 2643 2275 1980 1221 729 621 251 17125 18568 23059 1591
NM_018429chr542324 2166 1967 80 12470 12091 12146
NM_018689chr1542604 2359 869 799 2961 155 11061 22711 2050
NM_020673chr2087116 6677 6613 5845 5617 3018 2590 1553 22843 1377 35941 5889 421 --
NM_020956chr1954605 3720 3579 1490 1034 24538 154 33293 1888 1498 64419 2883 1865 1787 1709 1631
NM_021116chr7118139 7745 7214 6308 6032 5852 5772 3298 712 521 350 1858 37709 3483 1611 11367
NM_021629chr374964 4219 4116 3630 3257 1785 266 33959 3103 649 14122 11238
NM_021911chr562238 2092 1780 1001 994 288 2963 644 14460 --
NM_031427chr14105463 5228 4724 4606 4202 3706 2158 1149 1136 361 21303 567 11267 15396
NM_031453chr1052196 1898 930 427 70 2817 245 --11591
NM_031469chr6123626 3594 3519 2875 1364 1313 1247 1139 1086 942 549 423 --13691 1313
NM_032446chr543622 2609 2458 548 32834 1062 301 --1200
NM_032873chr1153600 1241 997 927 181 11626 --11083
NM_033505chr266508 4596 4344 2143 949 234 ----24713 1694
NM_033656chr2145850 5358 5028 2167 21733 96 1734 11581
NM_080872chr833864 2635 1522 --1409 21555 442
NM_133646chr275216 4733 4600 4148 3449 1712 1073 13526 23857 612 --
NM_138286chr1934332 2835 1314 1224 --22749 1664
NM_138959chr166300 5253 2596 2201 1845 1013 36354 5770 539 11941 26415 4371
NM_144578chr1473901 3774 1113 545 474 339 95 24022 133 --15200
NM_147150chr953941 2718 1077 909 461 21013 376 --13705
NM_173468chr465951 4610 4025 2162 1507 800 11037 11822 15086
NM_177972chr11124395 4291 3381 3259 3172 3018 1744 1355 802 727 608 404 11339 23706 3031 --
NM_181077chr1531967 888 539 --2921 103 11524
NM_181481chr18126525 6453 6193 5874 5493 5420 4581 2540 2388 2320 2224 533 --25541 4749 24819 1474
NM_181482chr18126525 6453 6193 5874 5493 5420 4581 2540 2388 2320 2224 533 --25541 4749 24819 1474
NM_181483chr18126525 6453 6193 5874 5493 5420 4581 2540 2388 2320 2224 533 --25541 4749 24819 1474
NM_181489chr355435 4993 2279 1656 1146 1844 46632 5054 2176 543 1904
NM_182551chr263327 2966 2833 2429 865 598 32233 2198 649 11327 --
NM_194314chr165017 4992 4199 3938 3843 980 --14554 --
NM_206853chr653906 3789 2772 1416 291 23249 2864 13024 --
NM_206854chr655167 5050 4033 1552 415 24510 4125 14285 --
NM_206855chr656132 6015 4998 2517 1380 35475 5090 65 15250 --