TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-302a-5p
miRNA Sequence: ACUUAAACGUGGAUGUACUUGCU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000052chrX83424 3189 3045 2638 2487 512 128 28 1369 22173 644 --
NM_000176chr563819 3702 2754 2731 2718 1302 12680 --1608
NM_000259chr1586394 5728 4345 2185 1442 825 466 342 25290 1517 24634 2146 --
NM_000267chr17103494 2990 2879 2505 2376 2357 2341 2322 1018 481 11157 ----
NM_000332chr6127115 6834 5537 5187 5116 4738 4389 2276 2207 1317 1116 110 45437 5078 4804 1505 ----
NM_000393chr282013 1975 1658 704 568 506 497 75 1819 1232 1239
NM_000408chr2103425 3308 3297 2474 2130 2098 829 618 210 141 32663 2303 896 13061 --
NM_000555chrX107042 6769 6046 5888 2496 2213 2183 1472 1271 1092 47402 7312 2361 1401 ----
NM_000618chr12106629 6540 5029 4892 4561 1776 1339 716 700 104 1173 15389 --
NM_000618chr12106629 6540 5029 4892 4561 1776 1339 716 700 104 1173 15389 --
NM_000633chr1864944 3703 1775 1676 1377 723 55073 5058 3894 964 267 --21904 108
NM_000809chr4169019 8750 8589 8388 8303 8088 7770 6265 5614 3521 2320 1825 1587 1300 1294 646 29216 5664 ----
NM_000813chr5125248 5203 5147 5014 4738 4118 2199 1546 930 539 377 270 ------
NM_000912chr862819 2536 2334 1274 648 64 12799 13039 1358
NM_000926chr11209394 8973 8349 7871 6823 6425 6194 3589 3481 3389 2999 2811 2804 2747 2734 2452 2389 1191 541 192 39098 8362 6108 26042 3395 16486
NM_001001323chr1262817 1287 1154 1093 967 674 12658 --177
NM_001001419chr584776 4242 3584 3162 1956 1938 1661 64 13366 --11374
NM_001001420chr584776 4242 3584 3162 1956 1938 1661 64 13366 --11374
NM_001001974chr1061982 1728 1500 666 318 310 31966 1527 929 --1918
NM_001003652chr18108717 6573 6055 5284 3280 3207 2742 1490 1114 1104 16444 17182 --
NM_001003674chr18106742 6320 5748 5415 2778 1996 1680 1070 886 152 14501 16693 --
NM_001003675chr18106742 6320 5748 5415 2778 1996 1680 1070 886 152 14501 16693 --
NM_001003712chr1273805 3792 3451 3191 3162 1215 1099 33124 2795 1164 --11291
NM_001007278chr1364981 4443 3910 1377 1092 202 75299 4141 3739 3649 3250 899 380 11851 --
NM_001008539chr8125283 4546 4150 3533 3494 2103 1437 1245 1051 901 592 459 44475 3302 1575 1294 1480 13620
NM_001009899chr396443 5032 4230 1669 1007 971 857 565 492 46530 4789 4360 1894 ----
NM_001010846chr164503 4188 3627 3473 3378 1349 21787 1660 13845 2991 155
NM_001010888chrX74419 4376 3978 1371 1110 817 126 23914 429 --1999
NM_001010891chr5146584 6474 6187 5910 5606 2459 2366 2097 1414 1388 1356 1331 585 451 46163 6026 2514 473 ----
NM_001011666chr7126424 6278 6221 4537 2559 2509 2342 2129 891 840 716 63 46056 5702 4359 1348 --25941 2372
NM_001012423chr1582164 2078 2068 1129 1028 544 428 94 32245 1022 737 1142 --
NM_001013620chr12238503 8337 8244 8186 8070 7285 7178 7113 7054 6812 6802 6210 6102 3138 2839 2650 2434 2371 2181 2044 1610 1044 97 78305 5710 5640 3341 3255 2701 1222 --13161
NM_001014380chr13105296 5229 5172 4865 4805 4526 1432 1114 1010 994 42263 1799 1025 297 14262 --
NM_001014797chr10147954 7539 7395 7378 6788 6770 6082 5874 5409 5366 5128 1952 1163 522 16928 12920 16127
NM_001015877chrX62952 714 345 336 326 185 22618 752 ----
NM_001018065chr995605 5448 5379 5353 4464 2078 1434 1187 327 25047 1563 13809 14080
NM_001018066chr995605 5448 5379 5353 4464 2078 1434 1187 327 25047 1563 13809 14080
NM_001018067chr1105281 5058 4786 4640 4251 3851 3519 1830 800 343 35219 1621 1415 --13640
NM_001018068chr1105281 5058 4786 4640 4251 3851 3519 1830 800 343 35219 1621 1415 --13640
NM_001018069chr1105281 5058 4786 4640 4251 3851 3519 1830 800 343 35219 1621 1415 --13640
NM_001018074chr563819 3702 2754 2731 2718 1302 12680 --1608
NM_001018075chr563819 3702 2754 2731 2718 1302 12680 --1608
NM_001018076chr563819 3702 2754 2731 2718 1302 12680 --1608
NM_001018077chr563819 3702 2754 2731 2718 1302 12680 --1608
NM_001018089chr1552529 1515 645 611 52 23393 799 33780 199 68 --
NM_001024094chr563819 3702 2754 2731 2718 1302 12680 --1608
NM_001024948chr1103362 2999 2811 2767 2507 2464 948 671 581 439 --1192 23207 654
NM_001025076chr10136178 5580 5526 3806 3785 1805 1561 1493 853 710 567 497 190 11795 --1476
NM_001025077chr10207536 6938 6884 5164 5143 5114 4905 4749 4738 4697 4617 2919 2851 2211 2068 1925 1855 1548 727 591 14960 --11834
NM_001025780chr941490 1302 517 424 ----11539
NM_001029863chr683205 3101 2962 2746 1203 1112 862 234 12369 ----
NM_001030055chr14164769 4578 4526 4479 4306 4251 3462 3194 3082 2960 2894 1777 1441 1164 520 202 21815 1380 ----
NM_001031732chr4123490 3441 3146 2683 1326 1160 1051 1020 892 651 455 28 1871 --13401
NM_001033045chr2104404 3900 3462 3432 2954 2911 2878 1746 1684 712 24265 3766 1789 --
NM_001033578chr841993 1962 485 210 22356 584 --1449
NM_001037165chr7108840 8491 8096 7417 6675 5983 1610 711 652 589 38772 6996 5690 --38780 7867 181
NM_001039538chr283353 3306 2780 2629 1284 758 612 37 22901 2734 --11137
NM_001039580chr464096 3178 1908 824 471 316 54991 4026 1819 1595 568 --1997
NM_001039618chr11125528 5165 4602 4316 4165 3936 3849 1017 939 691 222 139 34663 1634 472 14547 --
NM_001039840chrX125651 5376 4562 4191 1986 1601 1548 1488 1214 990 859 288 21105 1003 --11084
NM_001039937chr1363778 3155 3083 1602 1571 1337 54031 3992 3396 1075 485 12553 1543
NM_001040284chr1695829 5650 4423 4300 1534 1448 1403 616 582 45744 5267 1626 270 --14927
NM_001040441chr1135072 4907 4763 4447 4032 3902 3842 3621 1614 854 578 456 423 34177 3457 507 1550 11711
NM_001042355chr1681093 1070 940 747 489 324 264 144 35279 626 228 11536 --
NM_001042412chr1681093 1070 940 747 489 324 264 144 35279 626 228 11536 --
NM_001042492chr17103494 2990 2879 2505 2376 2357 2341 2322 1018 481 11157 ----
NM_001042599chr2107318 7197 6116 5717 4823 1878 1178 796 755 21 27643 5781 25682 2955 --
NM_001042601chr393228 2991 2884 2550 1201 777 566 118 93 31273 295 211 --13088
NM_001042604chr3134843 4461 4443 4402 4307 1941 1409 1218 709 691 192 162 135 13027 1945 --
NM_001046chr582880 2802 2719 2311 1845 1096 1044 944 32854 2231 872 ----
NM_001099678chr365760 5529 5206 4571 854 187 16389 1398 15981
NM_001106chr3129624 9312 9103 9053 8196 7890 6808 3120 2371 1626 1565 1398 27349 2467 16458 --
NM_001167chrX116496 4822 4630 4432 2694 2604 2509 1813 1622 1566 73 46621 2595 1870 498 11216 11722
NM_001173chr14164769 4578 4526 4479 4306 4251 3462 3194 3082 2960 2894 1777 1441 1164 520 202 21815 1380 ----
NM_001186chr2192618 2473 2179 2152 690 582 425 393 139 ----11302
NM_001204chr2237740 7727 7538 7099 7041 6566 6177 5884 5871 5470 5462 4779 2838 2423 2239 1653 1277 995 505 391 219 201 65 56798 5402 2146 944 303 14689 --
NM_001356chrX82424 2292 2174 1857 825 662 205 140 1856 21965 768 --
NM_001396chr2142841 1829 488 180 22790 2684 --22273 1931
NM_001438chr173296 3102 2960 2662 870 415 86 11450 32871 2699 903 --
NM_001455chr6124823 4528 4259 4231 3540 3009 1976 1339 946 939 544 376 24540 4348 11829 --
NM_001616chr283053 3003 2788 1247 901 691 499 310 43170 2286 1412 1089 12444 --
NM_001858chr6135110 4978 4778 3960 3573 3472 3412 3209 1669 1559 1489 418 147 1957 ----
NM_001918chr169053 8037 7619 3471 930 31 56914 6143 6127 1071 776 11386 21560 374
NM_001981chr172261 2183 1913 1809 1528 886 775 1140 --1112
NM_002006chr485200 4884 4364 2322 1254 699 360 303 33842 2274 1477 14546 --
NM_002025chrX98102 7794 7416 6464 2923 2637 1774 711 296 12200 23472 1780 --
NM_002040chr2172736 2518 658 627 255 173 46 42854 1176 1034 711 11283 --
NM_002069chr761668 1291 735 462 351 322 2685 330 ----
NM_002092chr474465 3780 3476 3169 1699 233 169 24544 2020 14957 14170
NM_002126chr17114088 3991 3596 3320 2565 1628 1415 845 598 466 230 1442 ----
NM_002190chr671255 840 422 413 258 249 213 --1440 --
NM_002203chr5103919 3068 3049 3018 2892 2619 1108 743 696 361 31495 835 131 ----
NM_002267chr13102372 2336 2317 2185 2054 1873 1791 1690 588 298 1715 1839 --
NM_002268chr3111836 1713 1629 1529 1448 1438 1351 1215 711 273 102 --11323 --
NM_002270chr5105710 5238 4709 4595 4418 4246 4109 3862 1590 609 44377 3472 1118 1035 32042 1447 864 --
NM_002310chr5126205 6161 6012 5427 5333 4178 4024 2067 1613 1426 1402 573 25731 5515 ----
NM_002374chr283353 3306 2780 2629 1284 758 612 37 22901 2734 --11137
NM_002451chr9113923 3907 2448 1192 1132 1120 1112 1008 978 545 245 23717 2550 ----
NM_002481chr1167918 7904 7843 6870 6862 6488 6301 5109 4816 2013 1908 1883 1646 1622 1342 1295 16152 17789 --
NM_002577chr393356 3231 2977 1478 1340 949 449 200 88 11319 1955 --
NM_002703chr451839 1726 1429 586 384 3741 612 133 --11218
NM_002709chr2113567 3044 2922 2229 1302 949 836 648 535 383 373 1773 ----
NM_002740chr3102526 2305 2111 2038 1728 975 530 474 398 282 22246 2170 --1671
NM_002886chr385053 4696 2001 1853 1425 1277 1187 920 33425 1447 86 1277 14056
NM_002977chr292914 2627 2147 1136 1009 948 540 476 70 1196 13394 13212
NM_002998chr871890 897 878 841 675 563 264 31843 1629 769 ----
NM_003034chr12106289 5767 5014 2562 2487 2092 2062 1729 1039 755 27403 737 17650 --
NM_003046chr8125283 4546 4150 3533 3494 2103 1437 1245 1051 901 592 459 44475 3302 1575 1294 1480 13620
NM_003099chr1575035 4756 2053 2026 2004 615 216 44522 4428 2501 1909 --1314
NM_003107chr6102420 2382 2338 2300 2163 2132 1840 1721 962 93 22627 1991 ----
NM_003108chr2136983 6275 6191 6147 4863 2201 1715 1409 1356 1272 1158 1106 451 35041 4888 4419 --16596
NM_003262chr375011 3219 1363 1340 1161 569 190 34234 492 421 1853 14424
NM_003342chr1762882 2418 2391 2366 435 420 43319 2703 2175 2008 --11194
NM_003468chr262820 2813 1481 913 822 530 54263 3721 2923 1714 1681 11580 --
NM_003478chr1193334 3260 2792 2550 2263 1033 998 762 644 11280 --12634
NM_003489chr2172957 2891 2428 2237 784 676 219 1813 13097 11095
NM_003566chr1283470 2842 2794 2786 2115 1265 986 247 32737 1314 887 ----
NM_003574chr1885752 4886 3944 2252 1427 1294 1205 778 45335 5099 4660 2295 12196 12082
NM_003590chr283897 3875 3335 3180 1433 1357 536 503 32798 649 154 --12904
NM_003615chr393738 3728 3412 3396 3386 3183 3135 597 366 12690 ----
NM_003617chr174473 3654 3293 1247 1068 825 521 23769 3558 --13665
NM_003774chr1263153 2866 2741 2112 294 188 52897 2626 2296 2126 990 33177 582 413 --
NM_003941chr782479 1839 1643 802 781 419 278 33 11930 ----
NM_003966chr5117861 7083 6531 6041 5931 4897 2792 2376 2044 1702 285 27515 1373 --16076
NM_004060chr571266 867 476 429 319 179 88 ----11002
NM_004124chr1473581 3468 3432 2969 2572 1399 582 --23089 2652 23348 827
NM_004136chr1553192 2919 970 471 345 ----22926 389
NM_004171chr11209397 8667 8476 8421 8317 7870 7717 7499 7347 6965 6681 6491 3313 2789 2321 2292 1337 897 799 570 49236 7207 3197 3124 11321 12310
NM_004293chr961305 1118 694 482 367 248 11153 13365 11137
NM_004338chr18106742 6320 5748 5415 2778 1996 1680 1070 886 152 14501 16693 --
NM_004432chr952099 1901 647 507 200 32372 836 734 --1467
NM_004458chrX82651 2602 2150 2112 1643 993 395 68 1699 1346 --
NM_004464chr493608 3232 2933 2772 1507 1143 1079 650 628 43558 3060 2943 2862 ----
NM_004501chr173820 3250 2945 2883 1635 1185 184 23537 2566 23693 1654 13425
NM_004586chrX74584 4498 3948 2043 1115 1027 523 23392 953 --11561
NM_004612chr9124791 4434 4077 3914 3806 1897 1327 1309 903 722 331 300 34107 3479 1118 ----
NM_004660chrY82113 1787 1475 815 737 727 658 198 11967 2765 524 --
NM_004685chr1361158 885 731 666 110 104 12877 22079 1051 12838
NM_004703chr1742353 1963 1589 1557 ----21672 491
NM_004726chrX135245 4796 4269 4209 4008 3767 1771 1729 1613 1211 923 692 93 21846 1312 ----
NM_004745chr8106636 6354 5871 4956 2233 2118 1735 1063 997 864 36972 6815 1452 --25414 1027
NM_004815chr1104880 4759 4722 4339 4306 3095 1913 1901 1889 994 31096 1043 508 11328 13550
NM_004834chr2103210 3187 3016 2838 2170 1160 1071 1033 873 862 12850 12244 1549
NM_004904chr7126424 6278 6221 4537 2559 2509 2342 2129 891 840 716 63 46056 5702 4359 1348 --25941 2372
NM_004956chr783182 1781 1467 745 505 332 303 183 24242 978 --24555 4318
NM_004985chr12114208 4056 4012 4004 3727 3480 3296 3255 3217 1560 1022 32891 1792 1547 13123 --
NM_004999chr684128 3826 1104 960 794 736 554 355 33408 931 755 1153 --
NM_005045chr76750 629 383 333 303 284 1319 ----
NM_005056chr12105366 4514 4166 3979 2247 1959 1942 1765 1018 485 --23478 2109 --
NM_005065chr1485219 4099 1811 1758 1609 471 432 370 34394 2056 75 14900 13737
NM_005121chr1793657 3403 2537 1486 1176 1063 1016 868 667 22461 199 23561 918 --
NM_005156chr994857 3994 3621 3478 2060 1193 1092 921 117 34973 4111 651 14026 --
NM_005164chr1282663 2646 2596 1977 1074 608 439 402 31864 985 824 ----
NM_005188chr11118236 8203 5414 2553 2317 2092 2064 1611 1238 795 27 48186 7229 1073 898 15670 25883 467
NM_005235chr2107318 7197 6116 5717 4823 1878 1178 796 755 21 27643 5781 25682 2955 --
NM_005339chr4143789 3440 3282 3114 2995 2967 2732 1433 1225 858 721 499 356 290 53215 1338 928 508 71 ----
NM_005359chr18156298 6239 5913 5703 4533 2416 2398 1971 1917 1367 1332 1217 1098 1072 513 44077 2577 2094 1341 25591 5369 --
NM_005398chr1041480 461 114 107 51466 976 557 123 78 ----
NM_005436chr1064046 3459 1580 903 543 334 43186 1594 1534 1393 --13784
NM_005497chr1785203 4730 4658 4177 3878 2132 1376 910 45946 4061 2347 1628 --14301
NM_005504chr12126059 5663 5017 4791 4584 2462 2368 2317 2274 1905 1746 381 36283 4089 395 24326 2558 21553 914
NM_005578chr3105163 4988 4899 3522 3262 3166 1493 765 559 396 11912 --11555
NM_005596chr9116436 4405 4112 2444 2427 1092 1007 761 697 464 68 35542 4787 2438 --1142
NM_005665chr1124709 4498 4412 3652 3604 3431 3396 1362 965 947 283 35 63624 3404 3364 1188 939 512 ----
NM_005668chr594361 3839 3612 2971 1787 1514 613 238 198 24191 4166 1430 --
NM_005798chr1364981 4443 3910 1377 1092 202 75299 4141 3739 3649 3250 899 380 11851 --
NM_005840chrX77518 7078 5166 4894 2331 896 279 16700 25214 319 11914
NM_005901chr18108717 6573 6055 5284 3280 3207 2742 1490 1114 1104 16444 17182 --
NM_005903chr584776 4242 3584 3162 1956 1938 1661 64 13366 --11374
NM_005935chr4115242 5118 4910 4533 4243 3482 3241 1429 970 500 477 --33582 1821 953 --
NM_006007chr983957 3536 3295 3071 2941 1521 906 834 33228 1726 146 --13648
NM_006047chr2053144 803 790 775 413 13268 --1867
NM_006080chr782839 2663 2221 1871 1030 996 935 381 11165 --12495
NM_006166chr1272329 2099 2028 1851 749 716 449 31886 730 699 1550 12114
NM_006203chr554935 4411 3826 1599 36 35593 3633 1488 --12079
NM_006212chr184972 4791 2084 1911 1755 1020 868 196 21664 243 41919 1486 1380 1059 1890
NM_006252chr1146759 6663 6649 6215 6062 5778 5714 4676 3022 2617 1745 1209 1073 1022 67024 2802 2203 2123 1730 1263 25382 1739 --
NM_006256chr182370 2145 2108 1904 1780 1100 446 142 12763 22741 231 --
NM_006306chrX104602 4007 2068 1808 1649 1623 1564 868 754 123 41684 1472 1297 712 ----
NM_006315chr493825 3817 3326 3295 2852 2757 1655 372 357 --34344 3623 1681 --
NM_006380chr1774113 3690 1689 1675 1644 1614 344 53847 3740 3044 1303 338 ----
NM_006393chr1094353 4097 3008 2785 1273 1001 433 342 22 34452 4306 80 11667 --
NM_006520chrX41505 1432 439 202 11659 11647 11477
NM_006534chr2072573 2289 1251 168 151 137 116 22533 985 ----
NM_006544chr14155498 4706 4575 4537 4292 3691 2380 2273 1721 1696 1472 887 719 482 162 86129 5229 5216 2102 1799 1535 976 907 21906 1436 14852
NM_006561chr10136178 5580 5526 3806 3785 1805 1561 1493 853 710 567 497 190 11795 --1476
NM_006572chr17123473 3049 2945 2360 2302 2245 1193 1172 886 768 526 117 23316 1085 13012 --
NM_006599chr16167975 7932 7598 7513 6671 3018 2985 2902 2659 2182 1542 1206 786 693 309 243 11977 25425 113 16358
NM_006620chr684602 3922 3556 3536 716 608 559 388 34119 3837 3329 1643 11641
NM_006624chr1091944 1890 842 651 522 342 276 150 83 21970 1706 ----
NM_006628chr1564177 4073 2844 1619 1448 176 54125 3453 1537 1321 100 --1427
NM_006682chr752785 996 956 886 679 11066 12035 1406
NM_006750chr16137877 7869 7859 7745 6685 6428 6372 5100 5002 2644 1008 948 150 11977 1752 15813
NM_006924chr17134107 3988 3794 3680 3457 3232 2999 2922 1791 1026 977 214 189 33843 909 435 23450 3171 --
NM_007007chr12114764 4745 4710 4495 4272 3748 3445 3420 3111 1644 426 21411 1394 11150 --
NM_007011chr1576635 6313 6074 1202 1186 536 283 16272 --26712 1075
NM_007038chr2195871 5140 5122 4953 4237 2319 1508 1393 472 11895 31640 1377 1319 --
NM_007172chr2283147 3017 2901 2649 2379 2329 1201 753 42706 2167 1233 1056 --12411
NM_007231chrX82108 1575 822 695 558 534 358 137 12013 ----
NM_007249chr13109323 8623 8118 7861 7221 3226 3183 2523 1212 1109 38420 3192 1875 19011 17660
NM_012141chr1363778 3155 3083 1602 1571 1337 54031 3992 3396 1075 485 12553 1543
NM_012214chr2136409 6262 5738 5277 5190 4426 4177 4136 3981 3961 540 353 174 32552 615 310 --14986
NM_012431chr763335 3267 3164 1457 1028 475 11247 1500 1832
NM_013255chr7147969 7025 6521 6299 6247 3432 3012 2996 2987 2775 2448 2185 2133 745 68713 3420 946 860 794 278 48326 8027 6020 3184 15857
NM_013257chr841993 1962 485 210 22356 584 --1449
NM_013396chr2161520 1467 1459 1250 1008 356 --1582 11098
NM_014048chr16115277 5152 5024 4746 4580 4438 4027 3601 3252 199 158 34698 4570 375 11765 24827 40
NM_014112chr864675 3927 1853 959 950 725 24902 3553 --14082
NM_014155chr11137537 7503 7403 7383 7334 7208 7004 5638 5382 2995 2170 1953 807 26344 3028 ----
NM_014423chr5115635 5490 5470 5235 5079 4919 4453 3750 3581 1555 322 14990 --21802 347
NM_014456chr1091427 1317 1302 1231 1199 683 379 145 93 ----11735
NM_014504chr7101858 1805 1786 723 649 590 512 216 193 30 1627 1702 --
NM_014721chr697062 6360 6339 5256 5110 2756 2362 732 108 46566 6191 1196 512 12408 --
NM_014730chr1284615 3407 3281 1658 1651 1152 1124 350 11686 34512 3306 606 23215 1798
NM_014730chr1284615 3407 3281 1658 1651 1152 1124 350 11686 34512 3306 606 23215 1798
NM_014739chr693552 3462 3218 2942 2822 944 534 447 139 1631 24130 745 --
NM_014864chr183310 3081 2751 1489 1156 984 587 348 44158 3500 1193 708 23796 2675 1539
NM_014877chr1766560 5652 5411 1971 1580 938 56508 5192 5185 5045 796 11049 15096
NM_014905chr252007 1905 1389 478 446 --1439 1594
NM_014934chr1383795 2752 2576 857 818 724 513 358 ----2656 217
NM_014982chr14105344 4942 4054 3949 3688 3569 2024 1879 476 216 31426 952 424 15064 --
NM_015092chr1684353 4016 3716 3398 3046 1210 847 804 22859 1229 23231 1829 --
NM_015200chr472385 2096 1902 1687 936 724 322 22355 958 --11588
NM_015208chr18123550 3501 3466 3420 3374 2971 2828 2800 2581 2481 1105 1044 ------
NM_015247chr1681093 1070 940 747 489 324 264 144 35279 626 228 11536 --
NM_015286chr1552011 1775 431 322 216 3540 380 76 --12424
NM_015310chr8108070 7233 6347 6197 5680 5638 5424 2948 1393 350 37587 6683 6484 25607 5506 --
NM_015349chr683056 2318 1903 1087 1079 706 563 490 11233 --1172
NM_015355chr1771957 1658 1469 1389 1302 226 48 11380 --1633
NM_015455chr574017 3100 3000 2890 2771 1027 356 54044 3375 2847 1296 914 23815 2738 --
NM_015460chr33831 799 716 31711 1664 324 --22029 278
NM_015550chr793216 2420 1118 939 923 887 851 441 137 22313 1429 ----
NM_015569chr174633 4129 4002 3172 1681 1232 182 44163 3601 3453 1912 --1416
NM_015640chr1105281 5058 4786 4640 4251 3851 3519 1830 800 343 35219 1621 1415 --13640
NM_015879chr18146690 5884 5677 3403 3170 2429 2272 2010 1590 1523 540 260 202 35 58059 2820 1636 1191 154 26429 609 --
NM_015886chr8165324 5296 5246 4949 4475 4199 3879 3837 3483 1967 1693 1445 1298 1256 622 165 25468 2299 13493 13686
NM_015888chr1103382 3232 3031 2756 2397 968 865 831 698 392 23324 266 ----
NM_015906chr1144811 4157 3910 3689 3608 3066 1904 1622 1481 1122 1035 250 84 29 1852 13883 1629
NM_016009chr194913 4713 3920 3727 3211 3168 1956 1800 263 33838 732 626 14143 --
NM_016083chr673059 2751 2590 1317 839 483 47 --43446 978 221 168 --
NM_016206chr3148564 7294 5459 2956 1791 1413 1371 1269 1224 1027 532 493 447 426 33555 3310 1906 22696 2682 --
NM_016248chr1343726 3637 3158 593 44029 3882 2917 2809 13981 170
NM_016260chr2157540 7178 7081 6716 6447 6022 5687 5482 2841 2420 2270 2238 1624 761 407 33000 2151 255 25014 2811 1868
NM_016422chr1142670 2316 2101 1009 --1416 22877 1024
NM_016530chr15103950 3883 3358 3254 2972 999 948 860 754 494 --14034 13051
NM_017447chr21113963 3902 3522 2889 1632 1484 1463 1303 472 437 72 22675 353 13851 --
NM_017633chr673873 3755 1534 1442 1133 870 139 22781 381 --1448
NM_017637chr9139044 7342 7253 3748 3676 3096 2836 2827 1854 594 581 481 54 17629 18292 --
NM_017644chr3155149 5127 4272 4217 4204 4011 3857 3290 1776 1520 1491 1261 1064 628 412 1307 ----
NM_017650chr7125767 5754 4385 3932 3719 2404 2383 2301 1561 1228 904 240 34960 1316 1053 11178 --
NM_017658chr1484685 4484 1420 1282 830 820 581 399 43053 889 650 607 1752 --
NM_017769chr1472647 2505 2421 2167 791 532 288 12109 --13076
NM_018036chr1483871 3421 3009 2960 1400 819 368 86 1754 23539 1494 23894 558
NM_018133chr352000 1762 689 639 77 ----2595 228
NM_018155chr3103242 3106 2904 2856 2661 2447 982 905 607 402 ------
NM_018159chrX31708 1309 1211 51471 1192 1105 575 280 1515 11669
NM_018313chr392535 2453 2384 2183 809 601 587 435 238 22266 2170 1829 --
NM_018361chr8103565 3196 1438 1269 1129 886 749 688 545 326 34064 3755 485 ----
NM_018362chr1154044 3518 3024 1316 703 83901 3180 3129 3012 2836 1306 1167 1036 ----
NM_018373chr1476405 5371 1805 1793 1475 984 187 55433 5316 2538 1838 1675 --24013 2162
NM_018374chr744830 4030 3360 1678 44552 3761 3310 356 --14052
NM_018403chr383253 3098 2622 1402 1154 764 609 505 21204 493 --192
NM_018440chr8188580 8395 7322 7207 7116 7049 6134 5493 3275 3079 2872 2811 2193 1619 1481 1243 779 432 45423 2991 2525 529 28389 842 16216
NM_018566chr184142 4098 3916 3872 3137 1793 1699 1675 ----24475 735
NM_018638chr12125404 5350 5009 4322 4232 4018 3793 1231 1029 384 252 99 24963 518 35591 4076 941 1545
NM_018979chr1262413 2383 2253 1054 741 574 1721 --11776
NM_019001chr3134843 4461 4443 4402 4307 1941 1409 1218 709 691 192 162 135 13027 1945 --
NM_019044chr273310 3250 1707 1697 963 345 43 ----23942 3877
NM_020122chr295204 4329 2245 2096 2064 1663 989 800 774 21306 420 ----
NM_020205chr1113242 2805 2765 2495 1345 1018 760 608 594 411 133 --2873 240 1700
NM_020337chr483116 2761 2315 642 634 596 310 301 --22904 621 --
NM_020390chr3104629 4471 3621 3225 1542 1509 1404 1389 812 381 33889 1904 935 ----
NM_020432chr742326 1620 800 208 52178 1943 1851 1763 1677 1516 11970
NM_020718chr16156530 6186 5919 5626 4893 4802 4179 2567 2452 2434 2265 2199 2143 810 103 36504 4846 1784 ----
NM_020742chrX62638 2314 1697 646 409 292 32046 605 266 --11959
NM_020772chr17118040 7569 7205 6583 6149 5954 3276 1632 1587 1208 295 35644 2598 980 17916 17738
NM_020774chr18116171 4427 4143 3880 3831 2487 2063 1641 1552 648 270 25646 529 --16088
NM_020841chr1273805 3792 3451 3191 3162 1215 1099 33124 2795 1164 --11291
NM_020844chr897455 6718 5334 5272 2685 2584 1468 1381 59 57704 6553 2184 2021 1207 36633 5278 4849 --
NM_020859chr4113443 3320 3299 3210 3176 3094 2538 1268 1215 280 87 13932 1569 --
NM_020871chrX52449 2421 998 408 327 22027 925 --11589
NM_020918chr1083411 3302 3265 2998 1126 317 304 280 1617 1648 --
NM_020921chr1453379 2462 1078 415 165 42643 2585 2571 2361 --1367
NM_020948chr182837 1247 1059 847 560 383 196 103 2968 131 1487 --
NM_021038chr353142 2828 2249 1209 636 11358 --1521
NM_021622chr1061982 1728 1500 666 318 310 31966 1527 929 --1918
NM_021629chr364033 1078 769 616 382 220 23081 336 --23547 518
NM_021814chr6111500 1402 1244 1199 1185 1128 1065 679 647 503 455 ------
NM_021911chr5125248 5203 5147 5014 4738 4118 2199 1546 930 539 377 270 ------
NM_021954chr1383725 3451 3384 2736 2708 2455 1036 548 33265 2533 260 13097 --
NM_021961chr1166194 6134 1539 1520 1387 1263 66482 6355 5919 5889 5081 437 27136 158 25016 1400
NM_021964chr395949 5775 4212 2246 1951 1890 1082 982 446 21928 96 11442 --
NM_022080chr2072040 1974 1952 1104 1088 421 298 --1133 1428
NM_022459chr13125761 4644 4510 4182 3872 2329 2229 1819 1699 1272 1073 349 46090 5544 4726 904 1973 15456
NM_022473chr1583321 865 570 442 412 391 322 178 24263 631 23627 428 13982
NM_022763chr3122950 2390 2374 2253 2086 1150 988 976 888 853 553 350 1724 ----
NM_022898chr1474470 4149 1736 1626 1026 453 294 23670 306 --14620
NM_022977chrX82651 2602 2150 2112 1643 993 395 68 1699 1346 --
NM_024345chr9106036 5790 4122 2252 2131 1322 1280 1249 606 40 45965 5375 5145 4318 ----
NM_024511chr462431 1060 768 703 202 92 32685 1180 333 --21412 1002
NM_024524chr363063 2480 2276 975 969 939 31963 344 60 12080 --
NM_024611chr1552529 1515 645 611 52 23393 799 33780 199 68 --
NM_024624chr22321 240 2202 185 1367 11171
NM_024744chr2102676 2623 2597 2486 2454 2034 1013 994 421 112 ------
NM_024770chr276459 4367 4321 4202 4123 224 152 45935 2285 1432 308 1360 11846
NM_024947chr3178499 7719 6615 6537 6525 6269 6135 6023 5893 3080 3024 2900 2886 2292 1818 1018 614 68069 7319 7113 3161 2748 1509 11385 --
NM_024949chr4124870 4639 4373 3702 1965 1953 1860 1717 1316 1221 1187 1060 ----15009
NM_024953chr1292836 2482 1014 1007 949 719 488 214 146 12102 11047 11743
NM_024989chr2148106 7320 6890 5638 2593 2105 1888 1862 1650 1622 1613 1127 1080 796 12195 48087 7654 157 42 25198 1750
NM_025054chr8103983 3337 3185 2950 2566 1368 981 917 882 334 33703 3618 3050 ----
NM_025073chr164477 3069 1466 512 395 311 54298 3880 1445 571 378 23611 994 --
NM_025191chr183566 2821 2398 1318 1202 946 187 104 12667 --12608
NM_030621chr1464130 1307 1237 1192 329 253 11073 --23744 1573
NM_030674chr1275748 4841 4515 3944 1048 575 203 24540 193 --24659 3842
NM_030755chr14103113 2897 646 612 518 265 205 187 174 71 32455 602 337 --11991
NM_030806chr1108147 7699 7019 3058 2293 2227 2220 1809 1342 629 59460 8453 3611 960 810 16180 17785
NM_031427chr1495226 4851 3903 3870 3861 1991 805 633 356 1971 11073 --
NM_031844chr173820 3250 2945 2883 1635 1185 184 23537 2566 23693 1654 13425
NM_031845chr283353 3306 2780 2629 1284 758 612 37 22901 2734 --11137
NM_031847chr283353 3306 2780 2629 1284 758 612 37 22901 2734 --11137
NM_032012chr995032 4564 4500 4296 3626 3473 1844 1352 464 54397 4361 1499 535 345 13968 23850 402
NM_032047chr362412 2033 1611 706 636 160 --31881 1733 848 --
NM_032116chr13105296 5229 5172 4865 4805 4526 1432 1114 1010 994 42263 1799 1025 297 14262 --
NM_032228chr1183563 2888 2824 2241 1406 1156 488 243 23261 2196 --1677
NM_032446chr593620 3425 3111 3102 3053 3003 2831 723 623 22676 1025 --13499
NM_032458chrX73282 1044 675 666 656 515 110 32948 2174 1082 ----
NM_032682chr353539 2732 1356 637 419 23260 2989 --12238
NM_032873chr11104065 4029 3820 3622 3542 1759 1522 1305 749 58 21798 476 ----
NM_032968chrX73969 2880 1528 1197 825 783 182 156 23643 3541 --
NM_032969chrX73969 2880 1528 1197 825 783 182 156 23643 3541 --
NM_032973chrY83961 3536 2875 1528 1197 825 783 182 156 13635 --
NM_033020chr1144811 4157 3910 3689 3608 3066 1904 1622 1481 1122 1035 250 84 29 1852 13883 1629
NM_033143chr493939 3563 3264 3103 1838 1474 1410 981 959 43889 3391 3274 3193 ----
NM_033181chr673059 2751 2590 1317 839 483 47 --43446 978 221 168 --
NM_033224chr7167650 6949 6275 6038 6021 5996 3181 3167 2877 2474 2317 2285 2194 1724 1166 391 47865 6605 5073 1243 27382 878 --
NM_033360chr12114329 4177 4133 4125 3848 3601 3417 3376 3338 1681 1143 23012 1668 13244 --
NM_033389chr1794712 4484 3922 3609 3589 1353 1074 968 866 33561 1620 1252 ----
NM_033430chr443969 1237 1227 1024 33574 489 144 --13826
NM_033437chr443969 1237 1227 1024 33574 489 144 --13826
NM_033505chr2156720 5938 5924 5775 5422 5356 5324 4828 4215 2660 2602 1979 704 619 325 46322 1807 1560 658 ----
NM_033656chr21105845 5504 4401 4341 4046 2399 1386 932 695 267 25961 28 12069 13850
NM_052811chr1364981 4443 3910 1377 1092 202 75299 4141 3739 3649 3250 899 380 11851 --
NM_053016chr9126697 6458 6438 6059 5890 2940 2632 2310 1477 1107 772 704 16491 ----
NM_053064chr1492725 2682 2640 2493 2261 1950 761 441 142 22855 2831 1592 --
NM_080743chr672405 2117 2078 904 453 422 78 22578 662 --21864 688
NM_080867chr1474145 4023 3143 1440 1329 1021 481 13577 24664 171 --
NM_080927chr363361 2700 2076 775 224 169 32460 2137 2100 33198 1195 713 12611
NM_130436chr2142841 1829 488 180 22790 2684 --22273 1931
NM_130438chr2143418 2406 1065 757 23367 3261 --22850 2508
NM_130847chr11135666 5457 4851 4839 4385 4354 4237 4025 3698 1322 921 811 401 1408 14338 --
NM_133370chr4123490 3441 3146 2683 1326 1160 1051 1020 892 651 455 28 1871 --13401
NM_133477chr482912 2870 2845 2597 2433 2071 1315 957 33104 2097 548 12754 11181
NM_133493chr663889 3583 3208 3042 1292 558 54343 4237 3808 3664 1075 ----
NM_133646chr285294 4921 3385 1476 1344 1206 948 116 --14943 24679 3654
NM_138348chr5126678 5600 5265 2544 1502 1485 1118 973 864 641 515 374 44883 4151 1980 1368 46256 5726 4625 2132 12464
NM_138444chr1384578 4376 3116 3051 1860 1830 1467 1210 14821 11097 1453
NM_138459chr6113455 3336 2447 1401 1270 1129 1060 993 912 267 29 32518 442 290 ----
NM_138554chr952155 1071 1049 844 495 --12342 22563 698
NM_138576chr1474470 4149 1736 1626 1026 453 294 23670 306 --14620
NM_138713chr16167975 7932 7598 7513 6671 3018 2985 2902 2659 2182 1542 1206 786 693 309 243 11977 25425 113 16358
NM_138714chr16167975 7932 7598 7513 6671 3018 2985 2902 2659 2182 1542 1206 786 693 309 243 11977 25425 113 16358
NM_144567chr162699 2331 536 522 501 370 21067 762 11080 12769
NM_144571chr4136549 6542 6472 6391 6229 6158 5008 4362 2714 1367 1211 661 294 25898 2275 --24588 805
NM_144578chr14115143 4948 4667 2044 2021 1671 1611 1396 1305 461 291 54851 4798 4694 4400 1653 11039 14740
NM_144973chr1264641 4416 3514 1263 784 535 23595 242 23467 3363 11942
NM_145207chr4115158 4951 4791 4660 3607 1732 401 246 231 129 107 44160 713 602 72 1312 --
NM_145259chr2156915 6183 5966 5803 5021 4976 2729 2554 2526 2450 835 457 427 206 122 54662 2610 2394 1110 1021 ----
NM_145320chr793216 2420 1118 939 923 887 851 441 137 22313 1429 ----
NM_145321chr793216 2420 1118 939 923 887 851 441 137 22313 1429 ----
NM_145322chr793216 2420 1118 939 923 887 851 441 137 22313 1429 ----
NM_145341chr1091427 1317 1302 1231 1199 683 379 145 93 ----11735
NM_145686chr2103210 3187 3016 2838 2170 1160 1071 1033 873 862 12850 12244 1549
NM_145687chr2103210 3187 3016 2838 2170 1160 1071 1033 873 862 12850 12244 1549
NM_145728chr1552011 1775 431 322 216 3540 380 76 --12424
NM_147175chrX72202 1676 825 673 640 273 126 2631 284 ----
NM_148955chr1575035 4756 2053 2026 2004 615 216 44522 4428 2501 1909 --1314
NM_152409chr593542 3383 3368 3275 2326 888 642 554 29 --1560 --
NM_152529chr2104404 3900 3462 3432 2954 2911 2878 1746 1684 712 24265 3766 1789 --
NM_152608chr192332 2261 2211 2028 1600 1582 973 266 249 31677 498 371 ----
NM_152622chr5123456 3330 2935 2876 2515 2201 1262 1136 1056 965 242 89 13026 ----
NM_152624chr5147189 6402 5987 5673 5458 2271 2251 2054 1897 1447 1159 668 243 53 66660 5701 5558 2516 2462 2374 42393 2176 1270 229 12763
NM_152641chr1292775 2444 2407 2305 1784 1076 527 440 184 12680 1431 11996
NM_152787chrX103088 3080 2894 2862 2723 2536 2492 764 649 41 43873 3708 3227 1155 ----
NM_152793chr7134964 4868 4646 4286 1994 1540 1480 1336 1185 949 580 437 361 13591 13157 --
NM_152826chr1575035 4756 2053 2026 2004 615 216 44522 4428 2501 1909 --1314
NM_152835chr1101841 954 906 804 716 638 484 307 114 47 2514 261 ----
NM_152838chr2053144 803 790 775 413 13268 --1867
NM_152924chr1576635 6313 6074 1202 1186 536 283 16272 --26712 1075
NM_153184chr342014 1835 1465 363 21639 439 --11298
NM_153188chr5105710 5238 4709 4595 4418 4246 4109 3862 1590 609 44377 3472 1118 1035 32042 1447 864 --
NM_153207chr1273661 3341 2899 1349 862 593 317 43966 3527 3034 138 172 --
NM_153456chr13105924 4801 4014 2161 2144 1530 1138 1058 922 674 1746 11538 --
NM_153607chr5103132 2946 2530 2511 2239 2222 2199 1995 701 386 1129 1241 --
NM_153645chr2283147 3017 2901 2649 2379 2329 1201 753 42706 2167 1233 1056 --12411
NM_170709chr841993 1962 485 210 22356 584 --1449
NM_170710chr472950 2597 2272 1257 1183 623 543 23089 745 ----
NM_172071chr1127108 7091 6639 6403 5776 1821 1602 1287 1273 1117 786 342 67223 6323 5216 4871 4717 2962 37361 7165 2512 --
NM_173054chr76750 629 383 333 303 284 1319 ----
NM_173214chr16167975 7932 7598 7513 6671 3018 2985 2902 2659 2182 1542 1206 786 693 309 243 11977 25425 113 16358
NM_173362chr52554 112 2546 131 --2258 140
NM_173468chr4175931 5912 5563 5435 5391 5145 4781 4731 4694 4580 4531 4325 3889 1236 1119 1093 380 45132 4174 1196 1050 14189 --
NM_173469chr1571494 1252 1078 437 405 328 76 11188 --1429
NM_173582chr11145910 5608 4947 4187 3953 2480 2454 2334 1932 1778 1566 1085 548 175 34255 2269 2249 35659 1666 1585 11314
NM_173808chr194289 3926 3216 2983 2795 1579 1521 374 28 53136 3119 1703 1001 223 --1792
NM_173822chr252103 2075 1836 1484 386 --1123 11618
NM_173829chr576213 5035 4183 4005 3880 1743 1691 65956 5932 5779 4155 1128 846 ----
NM_175624chr12117600 6809 5182 4844 1787 1365 1018 834 814 617 416 27582 2069 17356 27719 2271
NM_175625chr12117600 6809 5182 4844 1787 1365 1018 834 814 617 416 27582 2069 17356 27719 2271
NM_177438chr1464130 1307 1237 1192 329 253 11073 --23744 1573
NM_177538chr288867 6487 6464 5912 3170 2997 1842 1170 68315 8204 7608 6114 2274 1927 18184 57829 6589 5426 1281 462
NM_178151chrX107042 6769 6046 5888 2496 2213 2183 1472 1271 1092 47402 7312 2361 1401 ----
NM_178152chrX107042 6769 6046 5888 2496 2213 2183 1472 1271 1092 47402 7312 2361 1401 ----
NM_178153chrX107042 6769 6046 5888 2496 2213 2183 1472 1271 1092 47402 7312 2361 1401 ----
NM_178815chr1072739 2323 1742 1694 1682 389 91 22311 764 1602 --
NM_181265chr472950 2597 2272 1257 1183 623 543 23089 745 ----
NM_181332chrX62638 2314 1697 646 409 292 32046 605 266 --11959
NM_181481chr18106742 6320 5748 5415 2778 1996 1680 1070 886 152 14501 16693 --
NM_181482chr18106742 6320 5748 5415 2778 1996 1680 1070 886 152 14501 16693 --
NM_181483chr18106742 6320 5748 5415 2778 1996 1680 1070 886 152 14501 16693 --
NM_181504chr5104162 3559 3277 3174 2553 1564 1551 626 446 247 21626 1203 23533 3527 --
NM_181521chr16137290 6917 5971 5801 5647 5444 5052 4761 4548 2549 1344 926 736 11832 14994 15001
NM_181523chr5104162 3559 3277 3174 2553 1564 1551 626 446 247 21626 1203 23533 3527 --
NM_181524chr5104162 3559 3277 3174 2553 1564 1551 626 446 247 21626 1203 23533 3527 --
NM_181659chr2072573 2289 1251 168 151 137 116 22533 985 ----
NM_181659chr2072573 2289 1251 168 151 137 116 22533 985 ----
NM_181705chr585780 5511 5338 5287 4198 1199 895 655 42255 1420 1113 322 --13894
NM_181836chr552348 2219 2196 819 64 2719 317 --11642
NM_182515chr1946628 5526 5386 2288 54984 4584 1731 1510 221 --26711 872
NM_182762chr775130 4856 4231 3849 1899 752 388 106049 5757 5511 4939 4919 4129 4083 4041 3998 3958 --25436 1966
NM_182898chr7126424 6278 6221 4537 2559 2509 2342 2129 891 840 716 63 46056 5702 4359 1348 --25941 2372
NM_182899chr7126424 6278 6221 4537 2559 2509 2342 2129 891 840 716 63 46056 5702 4359 1348 --25941 2372
NM_182976chr17766 739 550 243 191 161 150 1634 ----
NM_194272chr154971 857 850 345 --1863 1928
NM_194291chr8122435 2332 2080 2055 935 757 607 565 556 416 278 189 32568 2274 75 --12209
NM_194314chr1144680 4521 4050 3850 3609 3524 3453 2144 2003 1695 1534 1437 1035 557 1403 1384 14353
NM_194434chr1885752 4886 3944 2252 1427 1294 1205 778 45335 5099 4660 2295 12196 12082
NM_198181chr15112511 1908 1835 1150 1045 516 210 180 152 122 42 11039 --11990
NM_198270chrX133479 3400 2843 2426 2317 2237 2177 2124 1059 979 238 199 170 1366 ----
NM_198273chr562328 2142 1035 307 291 154 31256 815 686 --22200 243
NM_198484chr395602 5099 4952 4665 4551 4024 2197 731 366 41590 1174 799 72 14032 36068 5224 4697
NM_198549chr162580 2564 502 475 47 26 22925 2177 32837 658 486 13131
NM_198581chr2157332 6931 6063 5867 5331 2978 2876 2347 2185 2134 2034 1914 1056 352 318 76442 5483 5157 4698 1006 385 192 26784 523 37140 6826 4854
NM_198715chr194315 3825 2400 1706 1329 783 635 471 71 34145 2141 1998 24919 572 16229
NM_198968chr1383795 2752 2576 857 818 724 513 358 ----2656 217
NM_199246chr571266 867 476 429 319 179 88 ----11002
NM_199421chr1474145 4023 3143 1440 1329 1021 481 13577 24664 171 --
NM_201559chr6124823 4528 4259 4231 3540 3009 1976 1339 946 939 544 376 24540 4348 11829 --
NM_206594chr173296 3102 2960 2662 870 415 86 11450 32871 2699 903 --
NM_206595chr173296 3102 2960 2662 870 415 86 11450 32871 2699 903 --
NM_206853chr6124084 3915 2770 2653 1307 976 834 553 410 342 296 163 33239 3125 320 ----
NM_206854chr6155345 5176 4031 3914 3481 3265 2095 1814 1671 1603 1557 1424 1236 386 182 64500 4386 3667 3582 1581 167 1512 --
NM_206855chr6126310 6141 4996 4879 4446 4230 2522 2389 2201 1351 1147 275 75465 5351 4632 4547 2546 1132 332 11477 --
NM_206866chr2192618 2473 2179 2152 690 582 425 393 139 ----11302
NM_206876chr2113567 3044 2922 2229 1302 949 836 648 535 383 373 1773 ----
NM_206909chr8108070 7233 6347 6197 5680 5638 5424 2948 1393 350 37587 6683 6484 25607 5506 --
NM_207292chr353142 2828 2249 1209 636 11358 --1521
NM_207293chr353142 2828 2249 1209 636 11358 --1521
NM_207294chr353142 2828 2249 1209 636 11358 --1521
NM_207295chr353142 2828 2249 1209 636 11358 --1521
NM_207296chr353142 2828 2249 1209 636 11358 --1521
NM_207297chr353167 2853 2274 1234 661 ----1546
NM_207359chr381967 1613 1436 665 338 268 210 50 ----1538
NM_207406chr486373 6072 4772 4393 1562 972 606 153 34239 2021 1637 15952 12061
NM_207647chr9101880 1752 1671 1024 792 737 707 308 250 115 --12039 12399
NM_213589chr2104480 4051 3760 2234 2130 1951 1907 1874 1087 976 34986 890 755 22053 1980 --
NM_213590chr1364981 4443 3910 1377 1092 202 75299 4141 3739 3649 3250 899 380 11851 --