TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-302b-5p
miRNA Sequence: ACUUUAACAUGGAAGUGCUUUC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000112chr5135543 5355 4844 4784 4774 4761 4632 4325 3838 3639 571 135 41 --24618 4096 --
NM_000168chr782756 2666 1350 1272 901 884 630 353 11341 --2817 50
NM_000217chr12115101 5072 4389 4256 3951 3290 3242 1579 1340 944 856 55377 5364 4749 4509 456 --15189
NM_000240chrX72131 2094 1729 716 708 276 71 --21993 143 11745
NM_000248chr393070 2805 2313 2288 1999 1176 1156 647 608 2547 495 --12185
NM_000259chr1595595 5184 3964 1745 1615 1548 1443 567 492 35107 4347 93 --14791
NM_000314chr1083289 3079 2728 2627 2015 1315 670 190 22134 1140 --12031
NM_000332chr676853 5259 5206 5103 2014 1319 136 54478 4391 1519 1092 703 25923 2827 --
NM_000408chr2103048 2913 2863 2581 1120 1076 966 902 276 142 12100 13292 --
NM_000430chr1763629 3214 3156 3115 2628 275 13142 23537 3224 13512
NM_000489chrX72595 2484 2418 552 470 416 31 33325 2528 2120 --11334
NM_000618chr12136405 5767 5704 5248 5147 4638 4512 4359 2236 1992 1964 1535 73 15105 14571 --
NM_000618chr12136405 5767 5704 5248 5147 4638 4512 4359 2236 1992 1964 1535 73 15105 14571 --
NM_000793chr14123965 3950 3824 3358 3193 1920 1778 1695 1038 626 482 382 11594 2514 496 23540 1356
NM_000809chr4128977 8470 8032 8007 7870 7083 2973 1826 1295 878 475 226 63630 2756 2391 1227 280 124 18083 --
NM_000813chr595090 4889 3694 1780 1700 1151 994 378 209 44948 963 644 452 1722 --
NM_000910chr451707 1626 1432 1377 1347 199 --11794
NM_000926chr11119378 7024 6304 6179 5807 3322 2680 2453 2381 1283 597 69021 8351 2814 1512 222 23 38839 6048 258 27614 6693
NM_000963chr192304 1970 968 789 753 690 601 416 195 22256 1765 ----
NM_001001395chr12102380 2248 2169 1969 1063 740 687 647 314 186 22374 202 1602 --
NM_001001419chr554605 4158 3858 3453 1064 74807 4618 4411 3825 3164 1704 55 14629 --
NM_001001420chr554605 4158 3858 3453 1064 74807 4618 4411 3825 3164 1704 55 14629 --
NM_001001664chr2114125 3718 3455 3045 3038 1491 1392 1011 782 691 21 13472 ----
NM_001001668chr19124071 3895 3833 3820 3798 3756 3728 2987 2702 1584 378 303 23857 3660 24013 3879 --
NM_001002257chr283327 3102 2966 2833 2639 832 798 303 22233 2198 12664 1127
NM_001002860chr14103609 3553 3467 3105 1820 1410 1153 768 364 344 24519 3043 --12994
NM_001003652chr18208676 8526 8477 8468 8103 7929 7275 7220 7183 7168 6877 6774 6145 5662 5264 2874 2168 1573 1227 137 87321 6057 6011 3258 2134 1989 234 214 ----
NM_001003674chr18136835 6694 6028 5874 5173 5004 2697 1813 1533 1374 1102 599 533 46985 5311 2711 284 14749 --
NM_001003675chr18136835 6694 6028 5874 5173 5004 2697 1813 1533 1374 1102 599 533 46985 5311 2711 284 14749 --
NM_001003712chr1293914 3748 3528 2621 2518 866 504 212 196 23696 3516 ----
NM_001004065chr983941 3297 2718 2622 2602 909 874 95 32776 1013 376 --23734 3705
NM_001004419chr1273607 3287 1456 1290 884 801 679 23734 1610 2890 765 --
NM_001007023chr14123965 3950 3824 3358 3193 1920 1778 1695 1038 626 482 382 11594 2514 496 23540 1356
NM_001007097chr9104686 4623 3852 1527 1428 1190 684 418 406 253 34411 3479 1779 1560 1673
NM_001007278chr13104970 4445 4344 1713 1387 1009 976 787 690 35 13391 --23483 47
NM_001008925chr4113366 3266 2886 2539 2426 2373 2220 2214 613 579 278 13060 ----
NM_001009899chr3126467 6445 6086 5976 5935 5798 5468 4962 1221 732 675 476 25662 4241 25926 507 --
NM_001010891chr5126767 6572 6479 4960 4584 4490 4416 4268 2099 1292 854 608 34351 1901 101 24710 1105 --
NM_001011666chr796436 5552 4340 4133 1275 1045 913 343 64 25450 719 --12168
NM_001012420chr15112717 2520 2386 2017 1952 1075 907 885 546 536 162 32492 2081 1138 12407 --
NM_001012423chr15112717 2520 2017 1952 1075 907 885 546 536 371 162 32492 2081 1138 12407 --
NM_001012755chrX94245 4115 3819 3659 3586 3294 3220 1098 841 24495 289 13652 --
NM_001013659chr1984877 4785 4099 3402 3336 2108 1107 890 21992 1931 23742 3518 --
NM_001014797chr10167901 6269 6133 6084 6057 5690 5454 5065 3291 3241 2299 1318 807 742 561 161 38105 6006 3203 22640 2243 1120
NM_001018067chr185283 4758 4453 4314 3838 3650 478 345 45243 5103 377 69 14435 --
NM_001018068chr185283 4758 4453 4314 3838 3650 478 345 45243 5103 377 69 14435 --
NM_001018069chr185283 4758 4453 4314 3838 3650 478 345 45243 5103 377 69 14435 --
NM_001024649chr5132277 2265 2048 2004 1947 1841 1185 989 658 507 487 429 135 ----1802
NM_001024956chr11164676 4549 4271 4257 4018 3683 2290 2235 2220 2075 1985 1749 1597 1186 874 845 35739 4836 1508 24011 3662 --
NM_001025077chr10106226 5819 5220 5135 2940 2053 1147 1020 714 484 32421 700 316 ----
NM_001025252chr872940 2830 2795 2548 805 745 148 33040 2707 2219 --1555
NM_001025253chr872940 2830 2795 2548 805 745 148 33040 2707 2219 --1555
NM_001025580chrX114329 3677 3566 3423 3277 3270 2765 1578 1222 911 188 24149 1231 11359 --
NM_001029955chr4123472 2777 2413 1081 714 560 502 340 240 183 141 51 2370 44 13420 1794
NM_001030007chr1694005 3925 3905 2996 2924 908 836 688 159 12941 --21176 171
NM_001031804chr1684205 4030 3883 3609 3288 1513 532 411 23137 1276 11628 14446
NM_001033047chr411640 11962 12068 21733 598
NM_001034841chr16125186 5159 3643 3619 3423 2115 1580 1046 617 528 501 85 33352 1268 305 11630 1655
NM_001039538chr292782 2551 2494 2296 1265 1258 482 421 343 13164 12572 --
NM_001039547chr3158079 7998 7762 7077 6853 6591 6002 5912 4998 3084 2958 1693 660 506 434 2908 604 16794 --
NM_001039577chr164553 3660 1819 1219 600 205 21006 320 33563 1633 616 11108
NM_001039618chr11114899 4571 4548 1917 1050 1022 985 718 643 489 132 35631 5531 862 ----
NM_001039693chr223179 72 61344 1322 1241 1132 162 62 --11077
NM_001039840chrX95485 5321 4846 4684 2241 1777 741 467 452 34061 992 264 ----
NM_001039937chr1354171 654 639 600 560 34100 2555 475 33089 1640 338 --
NM_001040142chr272268 1675 678 500 304 287 129 21839 741 11528 --
NM_001040143chr272268 1675 678 500 304 287 129 21839 741 11528 --
NM_001040152chr795155 4826 4694 3939 3790 3780 3342 2023 1877 34778 3390 1660 --13743
NM_001040157chr4112656 2609 2129 2098 2020 1902 1002 658 553 458 325 1867 ----
NM_001040202chr492295 2230 2030 1961 1770 1626 1606 282 36 22201 154 ----
NM_001040284chr16125616 5496 5368 5064 4222 3892 3646 2235 2174 1884 1559 277 34783 3866 2156 --14016
NM_001040429chr1393601 3515 3277 3149 3009 2851 1392 673 117 53326 2961 751 734 241 ----
NM_001040441chr1125468 4519 4319 3994 3903 3674 1547 1505 1206 690 637 444 41982 552 458 113 13938 13518
NM_001040665chr7114741 4145 3814 3747 3600 3307 1229 530 322 115 105 54554 4267 4239 3357 1948 ----
NM_001042355chr16165342 4867 4454 4397 4263 4086 3669 3474 1656 1428 1322 1043 748 665 326 269 25353 475 1703 14145
NM_001042412chr16165342 4867 4454 4397 4263 4086 3669 3474 1656 1428 1322 1043 748 665 326 269 25353 475 1703 14145
NM_001042533chr383311 3197 2957 2914 2307 1226 606 581 32402 993 338 ----
NM_001042599chr2146999 6655 6610 5455 4825 2752 2188 1864 1846 1798 607 388 376 171 11881 23090 2773 17231
NM_001042603chr12145198 5074 5064 4988 4907 4790 3736 3292 1743 1631 1575 1043 532 261 11814 23801 365 --
NM_001042604chr3194861 4707 4493 4245 4118 3905 3858 3491 3476 3249 3068 2994 1841 1730 1689 1653 1332 1120 336 34885 3938 1220 14340 --
NM_001046chr551156 1010 536 528 227 52874 2722 2555 1032 735 12573 --
NM_001099678chr3115747 5513 5076 4450 4337 4157 4032 2322 1428 73 53 21077 294 ----
NM_001100108chr1138277 8017 6677 6323 3034 2279 2049 2039 1731 1545 1325 1168 651 25401 2251 26894 2363 12707
NM_001106chr3119342 9104 8413 8385 8185 7464 7376 6525 6290 1209 998 38353 7862 436 --18772
NM_001128chr1694005 3925 3905 2996 2924 908 836 688 159 12941 --21176 171
NM_001167chrX196738 6529 5247 5226 5152 5118 4824 2511 2347 2319 1431 1373 923 758 646 557 520 477 390 14711 ----
NM_001186chr21113285 3260 3035 2985 2833 2716 2645 2187 1291 1124 994 21195 254 ----
NM_001201chr483924 3865 3225 3030 2550 2501 1580 204 23485 1005 --1291
NM_001204chr2147728 6575 6409 6400 5487 5451 2618 2214 1877 1686 1408 1015 620 357 27788 6982 16581 --
NM_001259chr7135844 5757 5447 5415 5328 4931 4450 4050 4020 2501 1779 1763 471 55808 5533 5252 5054 513 16125 --
NM_001412chrX63696 2373 2285 945 818 192 23545 322 1112 31496 1102 463
NM_001432chr493835 3736 3605 3476 3351 2709 1081 832 526 23697 3667 ----
NM_001609chr1053954 3553 3090 3056 254 23974 870 --23893 2905
NM_001616chr2113531 3482 2710 2371 2213 1330 958 936 844 141 121 23103 693 ----
NM_001746chr5132277 2265 2048 2004 1947 1841 1185 989 658 507 487 429 135 ----1802
NM_001759chr1275232 5098 4064 1519 1430 340 205 45275 3745 1571 135 --21621 306
NM_001806chr19102856 2738 2691 2324 2239 2214 969 589 405 25 22070 1030 2239 46 --
NM_001858chr6105059 4510 4354 4017 1936 1560 1053 882 480 388 34251 3235 1080 ----
NM_002006chr454828 3570 1883 1873 1159 44548 4462 4397 3803 1907 --
NM_002025chrX178517 7180 7009 6834 6193 5774 3492 3204 2792 1781 1719 1653 1208 869 752 526 178 56763 3640 2561 2017 802 28628 3460 --
NM_002137chr781714 1655 1563 929 678 575 471 333 11485 --2556 102
NM_002223chr1282920 2806 1548 1438 1393 712 108 100 33242 1199 952 23450 2650 --
NM_002270chr5185490 5426 4821 4710 3639 3525 2014 1895 1646 1541 1349 1022 898 865 853 610 556 471 25567 1437 14401 --
NM_002310chr5146385 6162 6003 5985 5757 5189 5174 5155 4419 2640 1947 1541 1403 131 --14796 --
NM_002336chr12124851 4722 4661 4646 4460 3775 3508 3310 3161 1886 919 119 21911 91 --11190
NM_002374chr292782 2551 2494 2296 1265 1258 482 421 343 13164 12572 --
NM_002395chr651482 1226 1137 375 62 21240 1211 21336 1295 --
NM_002519chr1161209 1039 991 306 294 34 11075 --21291 1138
NM_002581chr9125666 5391 5189 5138 4604 4213 3881 2129 1503 1145 1117 1020 ------
NM_002645chr11102809 2497 2278 1987 1901 804 571 506 227 139 12655 12770 --
NM_002655chr884062 3929 3230 1522 1262 1075 526 190 1613 --13514
NM_002677chr892903 2078 1928 597 542 526 465 279 21 13005 ----
NM_002709chr2133433 3288 2812 2787 2673 2578 2207 1303 312 294 273 243 217 2585 125 --141
NM_002731chr193172 2829 2688 2671 2332 2246 1079 935 369 4847 807 508 432 23052 86 --
NM_002760chrY75647 4375 1264 1253 988 860 346 44785 4760 3725 1886 --14969
NM_002886chr344555 4081 4048 3831 34958 1600 1475 23390 3161 24942 4370
NM_002906chr1182173 1989 1857 1526 866 343 164 144 12225 --1278
NM_003016chr172645 285 21349 430 11642 21918 411
NM_003034chr12127813 7662 7211 6808 5918 5410 2978 2224 2049 1959 1854 1159 37784 7068 2858 15508 --
NM_003112chr7112919 2841 2074 2025 836 740 694 682 543 525 161 ------
NM_003262chr3135106 5085 5026 4987 4294 3414 1938 1378 1309 959 332 283 192 31808 1371 839 14866 --
NM_003298chr3115985 5889 5854 5825 5547 5402 5314 4696 3885 2016 1620 46261 6110 4154 319 ----
NM_003392chr384160 3915 3821 3058 2810 2750 749 396 24040 3191 --11695
NM_003410chrX92817 2661 2628 2123 1900 1139 347 61 42 22828 1087 ----
NM_003489chr2182759 2745 2160 804 425 412 398 148 23138 2441 ----
NM_003574chr18125550 5349 4068 3558 2174 2064 1967 1781 1034 779 644 159 35754 5123 1851 --1756
NM_003583chr12123896 3729 3335 3314 3035 1184 1158 1091 1005 963 389 63 23400 537 --13044
NM_003615chr3133979 3593 3204 3137 3085 2837 1368 1303 1163 919 793 231 187 23398 3389 ----
NM_003617chr194774 4179 3788 3717 1979 1445 1419 1069 333 24234 3035 13062 --
NM_003663chr3133087 2938 2593 2306 2230 1296 792 598 438 420 383 218 48 21116 369 ----
NM_003672chr161949 1528 1410 1244 263 248 1232 ----
NM_003774chr1252235 890 874 859 529 42114 1224 550 315 13274 --
NM_003913chr693861 3215 3000 2967 1358 1151 911 820 500 23433 158 --33886 2791 1415
NM_004109chr1162313 2186 2093 2076 503 64 ----1328
NM_004171chr11148784 8632 7160 7132 6225 3695 1322 1093 810 682 615 597 410 139 79400 8924 8579 7623 1339 630 271 --12274
NM_004232chr18112616 2548 2423 2376 1527 1464 1045 646 440 373 217 23005 825 --13046
NM_004293chr9143735 3405 3296 3286 3166 3050 2888 1055 721 527 459 441 358 75 33710 2936 714 12838 11043
NM_004338chr18136835 6694 6028 5874 5173 5004 2697 1813 1533 1374 1102 599 533 46985 5311 2711 284 14749 --
NM_004458chrX92578 1967 994 666 569 487 309 87 79 11706 12011 12379
NM_004537chr12101534 1469 1461 1071 1018 974 592 562 458 233 --31109 548 404 1265
NM_004612chr984847 4779 4288 4144 1923 1535 707 332 24873 4760 23296 1293 13827
NM_004622chr272459 2339 1801 1754 1519 632 517 ----22216 899
NM_004681chrY4594 254 187 140 2563 227 --1645
NM_004719chr12102466 2427 2338 2092 1938 969 520 441 390 238 --12249 1729
NM_004726chrX135771 5694 5126 4361 4246 4050 3980 3700 3495 1592 1404 1244 316 45005 4272 1615 333 --15720
NM_004731chr1291896 754 730 553 411 277 262 188 73 2621 117 ----
NM_004745chr8136993 6944 6637 6356 6333 5591 4446 2043 1772 1759 1726 1164 374 26365 1494 12281 16647
NM_004748chr15104090 3642 3590 3483 3441 3296 1339 889 800 214 33527 2656 991 ----
NM_004834chr272439 2207 2161 2140 1200 1134 1066 12353 32975 856 638 12815
NM_004866chr5154472 3702 3677 3642 3561 3492 3282 3257 3150 1675 1463 1414 1212 998 955 53977 3598 3549 1924 361 ----
NM_004904chr796436 5552 4340 4133 1275 1045 913 343 64 25450 719 --12168
NM_004956chr773641 1481 839 794 779 641 513 21784 1680 ----
NM_004985chr12124183 4014 3839 3633 3327 3256 3135 2912 2836 1593 1353 26 33966 3376 914 23394 717 1982
NM_004992chrX97201 6772 5555 5472 3400 2381 1930 1130 140 38437 7501 511 18074 2360 216
NM_004992chrX97201 6772 5555 5472 3400 2381 1930 1130 140 38437 7501 511 18074 2360 216
NM_004999chr651798 1497 1444 510 154 52743 1792 1257 1141 357 23295 95 --
NM_005056chr12145442 5318 5308 5232 5151 5034 3980 3536 1987 1875 1819 1287 776 505 22058 234 24045 609 --
NM_005065chr1484293 1937 1538 1521 1305 1248 476 371 11612 23636 907 1666
NM_005079chr872940 2830 2795 2548 805 745 148 33040 2707 2219 --1555
NM_005105chr182205 1951 1659 1496 1402 1355 597 528 ----21877 1490
NM_005160chr22106308 6069 5463 5185 5132 4224 1665 668 487 252 66500 5669 4954 2664 1733 328 --2525 496
NM_005188chr11108024 7922 7712 7697 6216 2990 2101 850 218 29 45602 2526 1240 486 23237 2291 1355
NM_005197chr1494563 1721 1666 1572 1559 1438 1083 213 203 36233 5127 1267 14103 1959
NM_005235chr2146999 6655 6610 5455 4825 2752 2188 1864 1846 1798 607 388 376 171 11881 23090 2773 17231
NM_005339chr474299 4183 3494 3442 1463 1384 335 44292 3208 2861 542 11281 11579
NM_005359chr18156443 6240 5673 5592 4819 4545 2536 2452 1320 976 753 444 382 314 121 22400 220 16493 --
NM_005504chr12146361 6169 5848 5010 4975 4599 4586 4257 4187 4171 2559 2408 1566 507 66061 5902 5698 4719 959 888 1529 12224
NM_005665chr1134942 4500 3782 3773 3700 3519 3486 3342 1930 1801 1165 1158 36 13573 14722 11546
NM_005748chr1273236 2501 506 236 215 153 143 32332 1370 1180 13394 --
NM_005798chr13104970 4445 4344 1713 1387 1009 976 787 690 35 13391 --23483 47
NM_005840chrX147695 6950 6664 6432 6138 4928 4773 4730 4649 3081 3047 2731 2473 769 25549 1551 37363 5279 1152 --
NM_005901chr18208676 8526 8477 8468 8103 7929 7275 7220 7183 7168 6877 6774 6145 5662 5264 2874 2168 1573 1227 137 87321 6057 6011 3258 2134 1989 234 214 ----
NM_005903chr554605 4158 3858 3453 1064 74807 4618 4411 3825 3164 1704 55 14629 --
NM_006007chr993411 3297 1384 1338 1269 908 669 560 441 21681 66 ----
NM_006095chr4114189 4074 3726 3623 3615 3599 3430 1747 1448 905 211 1458 2754 396 14248
NM_006141chr1632573 2269 561 ----32319 549 205
NM_006154chr1582909 2805 2446 2315 809 737 267 221 4870 835 143 118 ----
NM_006203chr585539 4683 3930 1986 1805 1464 1385 118 65602 4937 3945 3415 1868 1819 ----
NM_006241chr382374 2168 1594 934 865 642 312 35 1150 12351 12368
NM_006252chr1147409 7282 7239 5780 4631 2724 2320 2006 1740 1648 1528 1120 850 489 12674 ----
NM_006283chr8104176 3743 3485 3234 1647 1412 1231 1106 334 306 2673 433 ----
NM_006380chr1794151 3906 3200 2975 2888 2717 1646 1503 1397 34248 2685 124 13816 11448
NM_006420chr2092871 2674 1378 1149 976 791 666 643 584 53102 2842 540 523 389 23007 619 1469
NM_006482chr12123896 3729 3335 3314 3035 1184 1158 1091 1005 963 389 63 23400 537 --13044
NM_006544chr1495607 5429 4370 3882 2054 1697 1682 772 175 36056 5914 4343 14220 15014
NM_006599chr16108205 6351 6239 5370 3229 3175 3145 2697 1627 1208 25673 895 22312 1573 17706
NM_006609chr282863 2777 2177 1906 927 751 215 146 32452 1174 497 11857 --
NM_006620chr6104802 4687 3846 3026 1440 1318 1023 942 212 128 34382 3558 390 --13830
NM_006646chr1373005 2982 2312 1954 1904 487 457 12877 --143
NM_006722chr393070 2805 2313 2288 1999 1176 1156 647 608 2547 495 --12185
NM_006750chr16168058 7666 6374 6293 5717 5653 5243 5132 2596 2391 1362 1328 1270 1093 827 702 2732 153 17350 15264
NM_006756chr891544 1371 1202 1041 951 418 286 119 105 --11115 11424
NM_006918chr11164676 4549 4271 4257 4018 3683 2290 2235 2220 2075 1985 1749 1597 1186 874 845 35739 4836 1508 24011 3662 --
NM_006924chr17134326 3604 3459 3318 3130 3000 2993 2863 1769 1308 1185 555 116 43557 3550 3173 406 ----
NM_007007chr12174155 3958 3941 3930 3613 3596 1894 1754 1722 1710 1646 1480 1473 1066 544 351 214 44274 3878 1152 909 --11444
NM_007038chr21105920 5831 5655 5505 5123 4555 4129 3686 1975 1402 35747 1123 282 --11604
NM_007106chr1392714 2577 2390 2177 2105 1889 1022 923 636 22425 1093 --12066
NM_007114chr343178 2463 231 168 4791 580 392 217 22497 487 --
NM_007203chr983941 3297 2718 2622 2602 909 874 95 32776 1013 376 --23734 3705
NM_007249chr13169377 8844 8814 8716 8120 8048 7651 7581 7572 6224 3335 3327 3019 1931 774 337 21188 279 25839 718 --
NM_007345chr1862000 1749 1558 861 97 83 ----12044
NM_007350chr12114286 3592 3543 2950 1670 1348 1321 1048 716 628 533 13650 --1692
NM_012081chr5123616 3397 3220 3025 3001 2839 1383 843 706 642 524 103 52851 2790 2602 1133 1086 ----
NM_012082chr84712 624 265 137 1335 --1130
NM_012096chr3113728 3473 2609 2432 2287 1257 1222 927 746 437 81 13616 1540 --
NM_012120chr6102897 2597 2259 1989 1920 1854 1194 750 732 370 1323 ----
NM_012129chr762314 2253 2217 2006 598 472 --12332 3526 306 25
NM_012141chr1354171 654 639 600 560 34100 2555 475 33089 1640 338 --
NM_012164chr9116337 5825 5377 5273 5083 2658 2003 484 406 375 319 21733 1485 2412 259 34992 1065 756
NM_012214chr296423 6282 5191 5139 4137 1935 705 644 57 76138 5900 5388 2270 1031 720 49 11925 --
NM_012249chr253490 3284 1080 596 166 23598 617 23302 1319 1943
NM_012252chr795197 5117 3355 2060 1349 1125 542 349 106 24163 3314 ----
NM_012262chr1114172 4071 3448 1819 1638 1596 1490 1093 927 727 593 24887 3947 14431 --
NM_012287chr383847 3204 2806 1208 855 810 295 223 34373 3868 917 12869 --
NM_012388chr15113050 2939 2578 2161 2052 975 611 499 434 300 108 12528 ----
NM_013255chr7137678 7410 7125 6660 6559 5661 3434 3401 2998 2652 2196 1806 237 47235 6831 2786 1036 1549 25945 5624
NM_013269chr1273534 3214 1383 1217 811 728 606 23661 1537 2817 692 --
NM_013374chr353169 3059 2699 863 570 42961 2803 2765 1025 --12128
NM_013989chr14123965 3950 3824 3358 3193 1920 1778 1695 1038 626 482 382 11594 2514 496 23540 1356
NM_014011chr292608 2353 2063 2007 1975 1958 1843 914 591 12229 ----
NM_014106chr15102967 2948 2744 2684 2303 1989 511 321 196 50 32793 2104 1884 ----
NM_014112chr8104914 2159 2103 1707 1594 1188 1132 1019 481 243 25015 1449 33683 1281 590 --
NM_014155chr11126474 5881 5639 5412 5019 4928 2655 2175 1868 1816 559 488 22997 511 16459 --
NM_014423chr565665 5472 4920 4425 1939 383 54445 4045 1915 1298 589 33702 982 803 --
NM_014616chr383483 3238 2988 2234 2137 463 451 207 ----12148
NM_014701chr1573158 2637 2434 2293 1155 1090 489 22458 270 --1317
NM_014721chr6147461 7016 6072 5599 5476 5457 2751 2475 1760 1720 1072 503 472 453 46363 4807 2817 1635 26677 1266 12353
NM_014739chr693736 3464 1573 1455 1326 1255 1219 486 178 23803 1366 --13357
NM_014765chr182710 2033 996 456 388 308 280 35 --11730 12054
NM_014803chr1072645 2492 2405 2029 958 611 514 32621 1897 578 --2751 630
NM_014819chr5132391 2373 2290 2146 1998 1855 1827 1764 1704 850 797 784 226 ------
NM_014827chr161619 1301 667 502 484 176 3532 513 433 ----
NM_014839chr162501 2384 2025 2005 907 580 1834 --22127 538
NM_014873chr174443 3909 3677 3542 1104 1002 964 34358 3757 1514 1346 14122
NM_014877chr1787234 6857 5263 4742 1307 939 165 62 22596 1064 36959 2267 625 16341
NM_014904chr1094069 2760 1513 1495 1359 1224 907 867 179 22629 786 13750 --
NM_014906chr1794105 3732 3710 3266 3112 2784 1268 379 362 43758 2717 1542 976 13590 --
NM_014912chr1053397 2916 1241 650 521 73243 2691 2432 2373 2153 415 119 12350 --
NM_014924chr1472820 2611 890 759 407 397 86 --23092 113 12953
NM_014936chr6112685 2483 2373 2351 1920 1902 1888 1132 937 682 127 2671 588 12289 --
NM_014946chr2103081 2865 2779 2316 2208 2133 2025 710 203 111 1141 1249 --
NM_015026chr12144504 4332 4110 3987 3864 3426 1859 1770 1720 1673 1350 580 571 285 23310 918 24773 2962 13394
NM_015068chr784007 3678 3546 2791 2642 2632 875 729 33630 1198 512 --12595
NM_015071chr596049 5656 2611 2406 1645 1022 835 537 489 55964 5923 5517 2240 1617 ----
NM_015076chr6134537 4493 4191 3863 3846 3099 1419 1152 1126 1117 916 460 296 34118 1375 180 ----
NM_015092chr16104565 4457 4328 3742 3212 3041 2918 1084 806 30 34214 3400 1853 --13861
NM_015206chr15103860 3699 3528 3419 3393 3160 1525 1227 132 92 1917 --1888
NM_015247chr16165342 4867 4454 4397 4263 4086 3669 3474 1656 1428 1322 1043 748 665 326 269 25353 475 1703 14145
NM_015275chr1291624 1423 1335 727 253 191 147 133 49 12056 1750 --
NM_015310chr8166555 6161 6113 5586 5150 5104 2409 2360 2241 2231 1456 1335 711 651 351 338 38073 7055 1617 28063 1557 1358
NM_015344chr84712 704 689 320 --2770 596 21844 1509
NM_015365chrX114329 3677 3566 3423 3277 3270 2765 1578 1222 911 188 24149 1231 11359 --
NM_015409chr1252735 2521 2271 2204 826 12472 12278 11903
NM_015436chr4113185 3085 2705 2358 2245 2192 2039 1323 432 398 97 12879 ----
NM_015553chr685143 4366 3829 2065 1682 951 225 141 23753 1424 14131 23810 1457
NM_015564chr583394 2914 2552 2436 1310 1082 185 135 12743 1143 13486
NM_015569chr1134874 4805 4490 4175 3913 3731 3204 1846 1682 1252 1176 819 207 44775 4636 4030 1053 ----
NM_015640chr185283 4758 4453 4314 3838 3650 478 345 45243 5103 377 69 14435 --
NM_015879chr18128564 7899 7840 7481 7396 6157 2327 1757 1460 610 262 189 68018 2552 2504 2432 1937 685 11077 --
NM_015886chr8115734 5079 5042 4580 4301 4132 3964 3947 1759 1163 855 15476 11352 --
NM_015888chr1143053 2959 2940 2900 2826 2757 2719 2434 2209 1359 1117 832 707 306 1988 12763 --
NM_015906chr1124458 4152 3897 3507 1931 1912 1557 1274 1223 714 469 289 54302 3912 1820 1488 127 ----
NM_016009chr194505 4048 1506 1433 1189 1059 276 100 76 44946 4594 1671 1180 2681 186 --
NM_016132chr15123312 3284 3196 2453 2385 2179 1059 905 859 689 147 71 1192 11005 --
NM_016206chr3189016 8918 8905 8641 8271 7705 6448 5909 5894 3415 3339 3016 2896 2302 2204 1962 1059 24 47296 1554 496 184 ----
NM_016260chr2147179 7127 6856 6825 6504 6261 6213 6034 4613 2501 2239 1961 1586 883 56953 5690 2272 2133 763 36356 5211 637 --
NM_016271chr18162316 2229 2006 1988 1944 1914 1866 1818 1763 1462 785 450 429 208 179 50 21654 554 ----
NM_016531chr454231 4167 3184 2849 1562 11541 33382 1356 1134 11426
NM_016953chr2116153 5338 5176 4814 4732 4722 3819 981 914 747 147 24127 1895 --14598
NM_017420chr14123570 3222 3168 2966 2645 1299 1252 853 460 433 160 87 22996 361 ----
NM_017447chr2184249 4223 3975 3109 1569 1519 1445 670 53966 3232 2891 75 65 ----
NM_017637chr9198985 7598 6813 6521 3623 3461 3340 2975 2643 2484 2375 2074 1980 1538 1160 729 621 506 482 79471 8997 7674 7540 6859 2229 1917 ----
NM_017644chr3165089 5033 4968 4205 4152 3578 3327 1961 1913 1870 1633 1621 1600 1262 724 513 1237 34644 1159 206 1419
NM_017650chr796069 4570 4395 4317 2388 1576 1542 1179 141 53934 3896 1241 1101 906 26109 1075 15411
NM_017658chr14124661 4611 4586 3838 3394 2961 2941 1656 1370 1283 521 112 43528 1410 1355 1142 --24319 3889
NM_017694chr262081 1836 568 542 530 306 --1550 1270
NM_017769chr1482674 2422 2169 2125 841 811 446 418 23229 3097 1185 --
NM_017813chr8115271 4525 4513 4290 3680 3547 2307 2289 1186 811 118 13649 31149 365 98 24607 2125
NM_018036chr14103551 1336 1234 1050 1005 487 363 271 231 130 24471 1646 13927 --
NM_018084chr293161 3048 2069 1010 962 578 318 269 236 32158 333 134 ----
NM_018177chr45832 704 367 265 44 ----1202
NM_018247chr682944 2728 2634 2202 748 686 504 100 --21190 1066 11904
NM_018254chr182060 1823 1792 1561 921 796 717 580 22247 2239 --1419
NM_018313chr371893 1852 948 924 755 740 319 3937 831 480 11718 --
NM_018364chr1104056 4048 3143 1591 1510 1466 623 241 176 80 1850 12583 1731
NM_018373chr14165252 4883 4467 4317 4192 4057 2289 2250 2222 2203 1794 1270 563 365 189 106 55373 4895 4511 1057 632 15176 12194
NM_018374chr7104307 4271 4076 3713 3573 3218 1580 1018 530 132 2424 25 ----
NM_018429chr572633 2505 2324 1967 1912 144 80 32828 2470 1148 22091 830 1893
NM_018440chr8158675 8421 8351 7051 6888 6817 6450 5263 3382 3038 2578 2538 1476 719 433 47081 5495 2101 1264 36935 3373 1700 --
NM_018444chr852375 2249 698 222 46 22113 948 1359 1705
NM_018452chr6_random123416 3366 3196 2717 2703 2611 1288 1225 1048 589 393 204 43874 3778 2745 2661 23059 292 --
NM_018566chr1165001 4874 4611 4386 4298 4165 4122 3567 1539 1208 1186 1178 983 871 541 155 33559 1677 1640 124 14780
NM_018638chr12165510 5144 4724 4682 4429 3485 1856 1764 1668 1641 1571 1329 1293 591 222 85 25654 3450 ----
NM_018640chr12102380 2248 2169 1969 1063 740 687 647 314 186 22374 202 1602 --
NM_018947chr7114889 4881 4693 3158 1465 1386 1208 795 655 444 165 31522 587 241 --1458
NM_018999chr10134863 4146 4061 4012 3790 3782 3647 3430 3059 1780 1614 1071 352 14090 1900 --
NM_019001chr3194861 4707 4493 4245 4118 3905 3858 3491 3476 3249 3068 2994 1841 1730 1689 1653 1332 1120 336 34885 3938 1220 14340 --
NM_019027chr462621 2490 2454 1592 567 505 2458 307 --11666
NM_019050chr4112001 1852 1634 1494 1450 821 813 751 369 203 185 ------
NM_019610chr192136 1992 1646 874 760 412 238 229 131 --11865 --
NM_020205chr193345 2626 1243 1151 762 654 529 505 43 11020 --23162 1279
NM_020336chr20103174 1534 1300 1063 870 809 738 317 273 26 43878 3259 844 437 13498 1364
NM_020390chr3124816 4802 4052 3320 3226 1394 1343 869 814 386 368 317 ------
NM_020405chr1763832 1342 874 420 358 315 31731 172 25 154 1457
NM_020673chr20117150 6677 6434 5845 5788 5350 4788 3104 1421 1085 361 47494 7182 6491 917 1421 --
NM_020727chr21103828 3230 1391 1223 1164 1139 821 669 397 247 23649 2786 ----
NM_020739chr15104090 3642 3590 3483 3441 3296 1339 889 800 214 33527 2656 991 ----
NM_020772chr17248696 8681 8110 8090 7861 7571 7560 7161 6928 6585 6269 6023 2394 2336 2226 2189 2162 2065 1468 1353 689 609 553 42 67687 7399 6806 1210 791 207 28352 2675 --
NM_020774chr18126220 5931 5622 5575 5367 5185 4913 4849 4625 4396 1760 571 1272 25723 498 15431
NM_020782chr1284713 2939 1935 1507 1489 1294 915 887 44464 3749 3438 763 1105 --
NM_020810chr1463439 2458 1150 1043 1011 508 43548 2331 1461 1369 --11377
NM_020841chr1293914 3748 3528 2621 2518 866 504 212 196 23696 3516 ----
NM_020844chr8167460 6891 6448 6427 5178 4793 4648 2536 2503 1795 1412 1345 1261 656 520 353 45336 5307 2884 1782 14684 --
NM_020918chr1083530 3074 2986 2619 2427 2325 1310 943 33000 319 291 31101 745 80 --
NM_020921chr1493470 3432 3143 1084 865 763 755 659 360 12434 ----
NM_020948chr193471 2670 2627 1420 1043 953 197 178 95 22829 502 1893 --
NM_021007chr272268 1675 678 500 304 287 129 21839 741 11528 --
NM_021038chr373181 2775 2238 2094 1235 691 619 --22541 57 1653
NM_021090chr22104897 4682 4401 3964 3853 3738 3697 2017 1021 1001 21752 1204 33799 1895 1576 14594
NM_021255chr14103995 3721 3442 3373 2907 2575 1601 1543 959 211 33120 3079 1040 13953 --
NM_021629chr3104979 4970 4964 4830 4628 4219 4052 3827 1228 1195 23103 649 14857 21311 1238
NM_021911chr595090 4889 3694 1780 1700 1151 994 378 209 44948 963 644 452 1722 --
NM_021964chr3116663 5463 4915 4542 2038 1939 876 798 582 268 119 --1693 --
NM_022058chr251886 1765 709 640 326 21526 383 --1684
NM_022459chr13115469 5287 5162 4816 4146 3865 2285 1850 1711 1143 189 46390 5326 4620 4011 ----
NM_022473chr15114243 3789 3606 3389 3271 3208 2863 1015 803 763 38 1293 13217 1221
NM_022977chrX92578 1967 994 666 569 487 309 87 79 11706 12011 12379
NM_024007chr5103174 3106 2704 1115 964 752 685 543 503 390 --32581 1138 206 13080
NM_024345chr9136152 5785 4634 4397 3884 2100 1932 1499 618 578 518 473 189 13742 25221 4806 --
NM_024423chr18124210 4043 3906 3845 3690 3524 3065 1326 1238 444 401 359 23350 3236 1739 --
NM_024524chr3123211 2482 2405 2374 2110 2020 1284 1189 944 757 388 186 12160 ----
NM_024646chr1113614 3536 3431 3324 3205 3110 1525 1180 992 868 25 13398 --21041 798
NM_024665chr353957 3519 3457 1818 1493 53425 1634 1457 857 597 14089 14482
NM_024817chr15116004 5897 5760 5529 5172 3886 2216 1609 1561 1503 973 12063 25565 2140 13815
NM_024947chr3299432 9177 9129 9086 8566 8531 8397 8364 7851 6616 6538 6202 6112 6012 3772 3575 3565 3307 3123 2924 2671 2293 1994 1573 1258 937 780 656 298 57746 7129 6049 3784 1751 27899 7397 --
NM_024949chr474807 4651 1718 1560 1474 1425 1137 51644 1443 1405 1190 125 ----
NM_024989chr2188224 7715 7414 7321 6982 6640 6427 6017 5886 5805 5586 3271 2879 2490 1695 867 735 489 32776 2595 721 21581 171 --
NM_025073chr173338 1900 1735 1338 1201 875 115 33776 3613 1358 13214 14752
NM_025146chr3112703 2469 2435 2345 2197 1776 1018 645 329 225 94 22055 1861 1263 --
NM_025191chr1123186 2677 2550 2299 2207 2156 1373 1122 1037 890 384 172 --1417 --
NM_030621chr14103771 3553 3498 2601 1566 356 123 110 84 49 34132 3733 2566 ----
NM_030627chr5174151 3982 3966 3706 3625 3489 3341 3329 2703 1451 1411 1339 1225 1187 1131 998 289 13323 24055 578 --
NM_030647chr7166296 6167 5730 5413 4827 4618 4513 3947 2390 2072 1359 1351 1339 965 385 356 26010 3819 1544 --
NM_030648chr464842 4133 3559 3407 1876 425 25571 4425 --15264
NM_030674chr12105494 5002 4909 4468 4298 4130 4039 2277 1789 1605 25170 4334 11895 --
NM_030762chr1261535 1420 107 98 86 48 161 --1691
NM_030816chr183441 3354 3184 2915 2857 1477 1204 320 31404 1273 823 11056 --
NM_031243chr781714 1655 1563 929 678 575 471 333 11485 --2556 102
NM_031427chr14115228 3735 2158 2058 2027 1149 1136 985 807 702 361 183 --15396
NM_031461chr862119 807 731 697 596 225 ----11604
NM_031469chr6103250 2939 2868 1532 1313 1247 942 549 423 38 14123 --1477
NM_031845chr292782 2551 2494 2296 1265 1258 482 421 343 13164 12572 --
NM_031847chr292782 2551 2494 2296 1265 1258 482 421 343 13164 12572 --
NM_032012chr9125304 4514 4502 4471 3459 3453 1776 950 823 416 368 241 --33275 784 698 11751
NM_032208chr283324 3293 3174 2784 2744 2524 856 51 13231 --172
NM_032228chr1173533 3509 3403 1158 1147 822 529 43553 2495 2189 1409 22924 468 --
NM_032321chr262851 2838 2457 1320 1222 1144 21164 639 1340 13039
NM_032373chr1095907 5625 5109 4346 3744 1225 963 699 583 15758 11112 --
NM_032446chr583795 3622 3517 3426 3335 2609 2458 1426 32834 2623 1062 --1200
NM_032778chr383311 3197 2957 2914 2307 1226 606 581 32402 993 338 ----
NM_032833chr192640 2402 2340 2329 2275 537 354 176 104 32554 2358 743 1810 --
NM_032873chr1163600 3184 1241 927 751 135 44386 1626 1408 585 --1898
NM_033020chr1124458 4152 3897 3507 1931 1912 1557 1274 1223 714 469 289 54302 3912 1820 1488 127 ----
NM_033224chr7107376 7089 6295 5877 5537 4877 3067 2475 2029 143 37695 5693 1055 17841 27665 594
NM_033360chr12124304 4135 3960 3754 3448 3377 3256 3033 2957 1714 1474 147 34087 3497 1035 23515 838 11103
NM_033430chr4114067 3970 3799 3780 3714 3653 2838 895 819 445 167 22941 960 2535 26 13563
NM_033437chr4114067 3970 3799 3780 3714 3653 2838 895 819 445 167 22941 960 2535 26 13563
NM_033505chr2116501 5558 4829 4660 4613 4344 4292 2143 1980 1397 234 11034 --24713 303
NM_033656chr21165196 5163 4847 4424 4402 4162 4063 4054 2167 1785 1538 1428 1187 988 278 68 32401 1733 625 24596 3767 11581
NM_052811chr13104970 4445 4344 1713 1387 1009 976 787 690 35 13391 --23483 47
NM_052879chr12154044 3860 3730 3661 3366 3350 2894 2540 1635 1506 1169 1138 1011 553 447 3701 460 401 --21328 1106
NM_052885chr1284986 4899 4460 4454 4419 4326 3799 779 14089 14557 --
NM_052927chr541565 658 121 85 11498 1110 12224
NM_052937chr872706 2375 2180 1828 1720 354 73 12001 --22473 1989
NM_053016chr986997 6938 6149 2269 1199 774 597 124 36440 6061 2902 16465 21901 1864
NM_057175chr482583 2402 1030 929 871 766 236 214 1715 --1878
NM_078487chr993365 3281 3193 3169 3020 2933 2682 2658 1310 ----13180
NM_080867chr14105038 4678 4298 3177 3150 1831 1504 1026 565 172 34147 1637 1331 13290 --
NM_133646chr2154950 4793 4600 4512 4438 4148 3455 3449 1555 1438 1073 992 949 853 281 21479 1121 ----
NM_138270chrX72595 2484 2418 552 470 416 31 33325 2528 2120 --11334
NM_138286chr1964332 4053 3444 2835 1685 1495 34413 3762 318 1627 23521 952
NM_138288chr1492178 1691 1683 1622 1568 896 726 632 592 11554 11859 --
NM_138348chr5115758 4526 2545 2365 2326 1875 1780 1671 1664 1561 631 1707 ----
NM_138459chr6103450 3209 3154 2952 2753 1477 1140 527 483 311 12718 ----
NM_138713chr16108205 6351 6239 5370 3229 3175 3145 2697 1627 1208 25673 895 22312 1573 17706
NM_138714chr16108205 6351 6239 5370 3229 3175 3145 2697 1627 1208 25673 895 22312 1573 17706
NM_138731chr14104004 3984 3793 3690 3105 2995 1655 1483 1433 106 33894 3336 3272 33051 963 324 --
NM_138959chr1116300 4461 4154 2596 2393 2201 2080 1845 1274 1013 660 22704 2142 --12612
NM_139207chr12142208 2143 2135 1745 1692 1648 1547 1364 536 497 386 376 196 120 2346 144 21783 305 --
NM_144571chr4126683 5906 5274 4989 4918 2767 2369 2300 1252 1168 1083 917 25997 576 22565 1927 16204
NM_144578chr14135144 4672 4365 3901 3802 2130 1826 1742 1307 1123 339 95 40 24061 3450 1249 --
NM_144949chr292608 2353 2063 2007 1975 1958 1843 914 591 12229 ----
NM_145259chr286954 5266 2731 2650 1980 1809 412 162 46185 5806 4706 1501 ----
NM_145307chr10134708 4100 3963 3834 3614 3266 3155 2962 1834 1299 1080 588 361 34421 3132 690 --13422
NM_145686chr272439 2207 2161 2140 1200 1134 1066 12353 32975 856 638 12815
NM_145687chr272439 2207 2161 2140 1200 1134 1066 12353 32975 856 638 12815
NM_147150chr983941 3297 2718 2622 2602 909 874 95 32776 1013 376 --23734 3705
NM_152263chr1126013 5521 5215 4581 4499 4108 2441 2113 1833 1696 546 180 15966 --13789
NM_152556chr762243 1741 1616 883 407 185 ----21809 920
NM_152624chr5217427 7336 7078 6737 6645 6223 6084 6058 6028 4946 4748 2739 2193 2182 2065 1566 1499 1241 402 291 47 66552 5220 2857 1449 1161 96 32208 1776 1203 --
NM_152754chr793828 3474 2388 1326 1284 991 838 700 577 22534 2474 ----
NM_152758chr892885 2718 2707 2475 1174 332 102 85 23 12587 ----
NM_152787chrX103793 3379 3345 2998 1390 1284 786 528 340 27 23090 2962 22820 310 --
NM_152793chr7115085 4627 4547 4533 3610 889 869 826 750 696 260 25201 350 11916 --
NM_152999chr7114741 4145 3814 3747 3600 3307 1229 530 322 115 105 54554 4267 4239 3357 1948 ----
NM_153050chr22104897 4682 4401 3964 3853 3738 3697 2017 1021 1001 21752 1204 33799 1895 1576 14594
NM_153051chr22104897 4682 4401 3964 3853 3738 3697 2017 1021 1001 21752 1204 33799 1895 1576 14594
NM_153182chr383311 3197 2957 2914 2307 1226 606 581 32402 993 338 ----
NM_153188chr5185490 5426 4821 4710 3639 3525 2014 1895 1646 1541 1349 1022 898 865 853 610 556 471 25567 1437 14401 --
NM_153207chr12124058 3996 3936 3663 3381 3252 1281 1197 1166 455 293 90 34096 3496 1551 --1666
NM_153235chr692419 2276 1849 1758 1601 799 281 192 82 21911 328 ----
NM_153686chr482435 2334 2273 2248 1891 1796 741 82 --1747 --
NM_153810chr10124701 4580 4428 4136 4024 4007 3793 3603 1570 1504 1463 1215 --1532 --
NM_172071chr1127362 7296 6828 6728 6276 6022 4797 2553 1119 887 718 643 57006 1823 1053 739 203 ----
NM_172193chr144432 128 102 88 11225 --11146
NM_173214chr16108205 6351 6239 5370 3229 3175 3145 2697 1627 1208 25673 895 22312 1573 17706
NM_173468chr4155648 5201 4824 4782 4025 3943 2162 1774 1643 1532 1507 1238 1073 713 650 116056 5393 4739 4582 4550 4493 4191 1121 1037 877 553 15617 15086
NM_173470chrX42581 2462 2234 978 11129 --2770 759
NM_173536chr4114089 4056 3414 1935 1479 1289 931 218 140 111 76 53933 3885 1860 1411 310 11186 11170
NM_173582chr1155630 4635 2507 2491 511 25661 1897 --2902 415
NM_173642chr1198964 8933 7100 6843 6753 5882 5843 5690 3648 2600 2011 1981 1828 1815 1767 1565 1524 1381 467 26808 2692 ----
NM_173808chr1103513 3314 3157 1478 1439 892 715 375 251 79 43779 3599 2765 30 ----
NM_174911chr8114010 3892 3799 3327 3235 3005 2787 2585 1310 803 626 13457 13786 13510
NM_175921chr5104222 3948 3932 3795 3666 3231 2983 1554 408 384 13479 33646 3040 788 13732
NM_177438chr14103771 3553 3498 2601 1566 356 123 110 84 49 34132 3733 2566 ----
NM_178539chr1281655 1518 1438 1361 722 556 253 242 187 1571 1306
NM_180989chr13102071 1921 1556 1544 825 535 486 366 240 39 42423 2097 459 215 ----
NM_181077chr1582281 1967 1639 915 888 549 539 162 12035 1103 --
NM_181481chr18136835 6694 6028 5874 5173 5004 2697 1813 1533 1374 1102 599 533 46985 5311 2711 284 14749 --
NM_181482chr18136835 6694 6028 5874 5173 5004 2697 1813 1533 1374 1102 599 533 46985 5311 2711 284 14749 --
NM_181483chr18136835 6694 6028 5874 5173 5004 2697 1813 1533 1374 1102 599 533 46985 5311 2711 284 14749 --
NM_181521chr16147152 5895 5802 5700 5446 4988 4597 2657 2595 2530 1969 1138 869 98 56920 6014 2908 2670 1234 ----
NM_181705chr5105513 5378 4854 4468 4422 4398 3696 730 393 150 54519 4201 1398 658 541 ----
NM_181787chr883562 3534 3444 3121 2652 935 758 611 23292 547 21421 1260 --
NM_182485chr473600 3369 3334 2780 2349 1155 275 22287 953 13513 1659
NM_182515chr19116629 6219 6029 5827 5763 4846 2624 2497 2306 1476 1361 35044 1253 1119 --12476
NM_182551chr283327 3102 2966 2833 2639 832 798 303 22233 2198 12664 1127
NM_182646chr473600 3369 3334 2780 2349 1155 275 22287 953 13513 1659
NM_182898chr796436 5552 4340 4133 1275 1045 913 343 64 25450 719 --12168
NM_182899chr796436 5552 4340 4133 1275 1045 913 343 64 25450 719 --12168
NM_182948chr193172 2829 2688 2671 2332 2246 1079 935 369 4847 807 508 432 23052 86 --
NM_194247chr2124163 4062 3896 3826 3528 1547 1540 1044 954 797 559 101 1370 ----
NM_194283chr5114138 4119 4097 3805 3532 3275 3218 3032 2555 975 80 43955 3722 3476 1625 13547 --
NM_194291chr892956 2905 2516 2401 2337 2081 781 608 213 --21102 925 1429
NM_194314chr1135384 5190 5017 4199 3938 3773 3707 3533 3454 2130 1768 980 199 75444 5005 4980 4434 1321 1246 224 14554 --
NM_194434chr18125550 5349 4068 3558 2174 2064 1967 1781 1034 779 644 159 35754 5123 1851 --1756
NM_198128chr18162316 2229 2006 1988 1944 1914 1866 1818 1763 1462 785 450 429 208 179 50 21654 554 ----
NM_198158chr393070 2805 2313 2288 1999 1176 1156 647 608 2547 495 --12185
NM_198159chr393070 2805 2313 2288 1999 1176 1156 647 608 2547 495 --12185
NM_198177chr393070 2805 2313 2288 1999 1176 1156 647 608 2547 495 --12185
NM_198178chr393070 2805 2313 2288 1999 1176 1156 647 608 2547 495 --12185
NM_198273chr5112991 2883 2798 2770 2648 2596 2529 2274 2056 1990 336 197 --11047
NM_198400chr1582909 2805 2446 2315 809 737 267 221 4870 835 143 118 ----
NM_198465chrX82440 2193 2097 1907 1150 1092 810 501 21945 475 11086 1597
NM_198468chr6124364 4296 4203 4054 3809 1840 1699 1582 1331 1231 984 246 33560 1714 258 ----
NM_198484chr366356 6004 4667 4183 2198 990 76202 6090 5703 5604 2444 632 451 24958 769 --
NM_198581chr2116195 6070 2946 2646 2582 2394 1674 1659 1517 595 524 67420 2981 2850 2442 2023 865 ----
NM_199188chr12154044 3860 3730 3661 3366 3350 2894 2540 1635 1506 1169 1138 1011 553 447 3701 460 401 --21328 1106
NM_199190chr12154044 3860 3730 3661 3366 3350 2894 2540 1635 1506 1169 1138 1011 553 447 3701 460 401 --21328 1106
NM_199421chr14105038 4678 4298 3177 3150 1831 1504 1026 565 172 34147 1637 1331 13290 --
NM_199436chr2103081 2865 2779 2316 2208 2133 2025 710 203 111 1141 1249 --
NM_201437chr891544 1371 1202 1041 951 418 286 119 105 --11115 11424
NM_203282chr1961678 1549 1239 579 568 442 1123 --11528
NM_203446chr2182968 2842 2824 2535 2416 2281 1939 343 52221 2021 476 68 52 12762 --
NM_203458chr143866 3680 775 234 21132 1125 22620 1254 11350
NM_203463chr2104588 4286 3706 3590 1800 1637 1596 828 778 416 44004 3449 1739 585 ----
NM_206853chr6133906 3687 3564 3535 3174 2853 2772 2659 1520 1416 977 369 358 43610 3269 2864 2685 1539 --
NM_206854chr6135167 4948 4825 4796 4435 4114 4033 3920 3532 1630 1619 470 183 54871 4530 4125 3946 3453 11800 13290
NM_206855chr6136132 5913 5790 5761 5400 5079 4998 4885 4497 1435 1148 829 791 65836 5495 5090 4911 4418 65 --14255
NM_206866chr21113285 3260 3035 2985 2833 2716 2645 2187 1291 1124 994 21195 254 ----
NM_206876chr2133433 3288 2812 2787 2673 2578 2207 1303 312 294 273 243 217 2585 125 --141
NM_206909chr8166555 6161 6113 5586 5150 5104 2409 2360 2241 2231 1456 1335 711 651 351 338 38073 7055 1617 28063 1557 1358
NM_207292chr373181 2775 2238 2094 1235 691 619 --22541 57 1653
NM_207293chr373181 2775 2238 2094 1235 691 619 --22541 57 1653
NM_207294chr373181 2775 2238 2094 1235 691 619 --22541 57 1653
NM_207295chr373181 2775 2238 2094 1235 691 619 --22541 57 1653
NM_207296chr373181 2775 2238 2094 1235 691 619 --22541 57 1653
NM_207297chr373206 2800 2263 2119 1260 716 644 --22566 82 1678
NM_207304chr1382411 1063 1005 660 632 544 306 169 22544 142 ----
NM_212558chr9114090 3265 3150 2763 2658 992 520 463 416 272 98 11325 --2564 202
NM_213589chr265174 4796 4652 4052 3770 544 34599 4458 4398 35035 4379 2078 --
NM_213590chr13104970 4445 4344 1713 1387 1009 976 787 690 35 13391 --23483 47