TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-302d-3p
miRNA Sequence: UAAGUGCUUCCAUGUUUGAGUGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000052chrX33161 464 52 ------
NM_000068chr1921424 46 ------
NM_000070chr153502 417 343 ------
NM_000081chr121290 1253 11452 133 --
NM_000084chrX65888 5161 1514 1065 758 555 14562 22021 1757 --
NM_000089chr72603 164 --1675 --
NM_000090chr21697 ------
NM_000096chr31864 1288 ----
NM_000103chr152811 116 --2465 33 --
NM_000109chrX52651 2597 2375 2129 358 ------
NM_000110chr121160 392 --21229 378 --
NM_000111chr71258 ------
NM_000114chr2031275 906 849 ------
NM_000115chr132640 536 --1252 1232
NM_000125chr674224 3759 3675 3326 890 884 45 21001 328 21030 385 --
NM_000129chr651449 1335 1016 234 33 --11408 --
NM_000135chr1621010 726 ------
NM_000138chr152390 130 ------
NM_000161chr1451626 1607 792 349 51 --11837 --
NM_000163chr532281 1823 294 ------
NM_000165chr631190 627 503 ------
NM_000170chr9--1518 153 --
NM_000173chr171346 --1407 --
NM_000176chr512593 22921 703 1430 --
NM_000188chr101473 --138 --
NM_000189chr222312 399 --2584 563 --
NM_000194chrX1142 ------
NM_000208chr1953653 3153 3144 1850 1565 --24187 867 --
NM_000214chr201720 11221 ----
NM_000217chr1254172 1872 1251 1113 1037 13271 12092 --
NM_000220chr11160 1206 1700 --
NM_000222chr441831 1821 1336 634 11329 1667 --
NM_000227chr18144 --1344 --
NM_000232chr431225 882 115 --12160 --
NM_000237chr821644 175 21892 1787 ----
NM_000245chr712200 ------
NM_000248chr333002 2126 800 11088 13075 --
NM_000259chr1585646 5030 4724 4014 1192 677 334 102 --21077 626 1316
NM_000266chrX2295 248 ------
NM_000267chr1753472 2663 2248 582 102 11192 ----
NM_000276chrX5759 570 562 419 374 --1734 --
NM_000277chr122536 278 ------
NM_000278chr1011465 ------
NM_000280chr111273 ------
NM_000282chr132211 80 --1262 --
NM_000297chr421399 137 --12052 --
NM_000314chr103660 419 276 11155 ----
NM_000329chr13832 580 149 ------
NM_000332chr6126930 6755 6445 6044 5107 5034 4635 2449 1389 1372 1178 1004 --35551 5467 2131 11122
NM_000333chr331022 193 70 --11094 --
NM_000337chr585059 2592 2263 2015 1935 1670 1161 493 ------
NM_000338chr1511184 --167 --
NM_000340chr331448 1386 501 --21435 79 --
NM_000346chr1711768 11851 1797 --
NM_000362chr2213529 --1118 --
NM_000368chr954453 3955 3599 2981 671 --24424 852 --
NM_000388chr331281 229 218 --11251 --
NM_000389chr661309 1291 1268 1153 472 230 ------
NM_000393chr231426 644 123 ------
NM_000396chr12531 67 ------
NM_000397chrX22367 1808 --1200 22336 2322
NM_000399chr102463 138 ----1771
NM_000401chr11168 ----11132
NM_000408chr263004 1329 1295 1013 695 177 13147 23251 2254 1827
NM_000411chr2152565 2317 2188 958 913 ------
NM_000430chr1742939 2875 1451 294 13237 ----
NM_000435chr191859 ------
NM_000444chrX1113 --1332 --
NM_000449chr12516 71 ------
NM_000451chrX1870 ------
NM_000461chr374296 3173 3040 510 187 172 36 13997 13523 --
NM_000480chr1121059 22 --21140 234 11290
NM_000489chrX62536 2454 1088 1031 1013 645 1451 1904 --
NM_000492chr741243 1010 522 227 ----1962
NM_000493chr62380 43 ------
NM_000503chr831240 583 202 --2635 323 --
NM_000509chr41177 ------
NM_000516chr201325 ------
NM_000522chr72908 130 ------
NM_000523chr21392 ------
NM_000527chr1952168 1512 859 820 90 --11634 --
NM_000533chrX2603 345 ------
NM_000538chr132160 137 ----11238
NM_000555chrX137771 7158 7110 6665 5907 5650 2620 2518 1901 1772 1570 243 63 --12677 1374
NM_000565chr11704 --22277 673 --
NM_000578chr241645 1594 1264 252 --1233 --
NM_000599chr232971 1436 1208 14495 24487 1143 14621
NM_000609chr1052531 2499 1145 1125 252 23129 2195 ----
NM_000610chr114868 733 682 190 12786 --13023
NM_000612chr1163859 3511 2616 2378 857 495 ------
NM_000615chr1162980 2887 2879 2700 1955 428 --164 --
NM_000618chr1292629 2199 1727 1618 1402 831 625 599 426 14198 11587 --
NM_000618chr1292629 2199 1727 1618 1402 831 625 599 426 14198 11587 --
NM_000624chr14----1868 --
NM_000627chr2--1336 1599 --
NM_000633chr1875182 4864 3698 2032 1933 1429 495 --1750 --
NM_000663chr1642897 2397 2273 1147 --1138 --
NM_000684chr101391 --11227 --
NM_000686chrX31213 528 463 --1431 --
NM_000701chr1174 ------
NM_000702chr162253 2232 2094 2015 1812 1703 1889 ----
NM_000719chr12116668 6206 5317 5020 4787 4132 2030 1508 1378 1065 699 --15092 --
NM_000721chr132586 1796 207 12697 ----
NM_000723chr173400 381 305 ------
NM_000726chr2--1290 11285 --
NM_000739chr7197 ------
NM_000756chr8180 134 ----
NM_000794chr51978 --1660 --
NM_000800chr541568 1215 1204 477 21521 530 ----
NM_000806chr531730 1410 1324 ------
NM_000807chr42191 159 ------
NM_000808chrX3757 279 31 --1815 --
NM_000810chr152531 95 ------
NM_000813chr574856 4528 4156 3669 1889 1590 330 1640 25222 3602 --
NM_000814chr1533392 2746 736 --11588 --
NM_000816chr51185 ------
NM_000817chr22822 51 --1902 --
NM_000824chr41108 --1623 --
NM_000826chr462413 2209 1886 1856 394 60 11950 21755 1667 --
NM_000827chr532368 901 642 ----1655
NM_000829chr1142000 1917 1486 785 22190 1513 ----
NM_000834chr12------11147
NM_000844chr33404 350 213 --1990 --
NM_000866chr321867 1706 --1710 --
NM_000868chrX32178 348 143 11905 --12251
NM_000875chr1597052 6745 5663 5347 4937 4860 1816 1602 1106 --22217 280 --
NM_000876chr621077 1071 --1367 --
NM_000877chr232783 1024 183 13081 1263 --
NM_000880chr83881 719 137 ------
NM_000885chr241801 1514 850 252 ------
NM_000891chr1753184 3029 2822 492 180 --11379 --
NM_000899chr1284317 3906 3823 3196 3012 1132 690 198 --24011 2820 --
NM_000901chr431679 1643 861 ----1230
NM_000902chr342470 1991 1175 585 ----13092
NM_000919chr51402 ------
NM_000921chr124526 502 138 121 ------
NM_000933chr2021745 172 ------
NM_000935chr3--1879 1909 --
NM_000944chr482053 1938 1914 1896 1808 1477 847 429 --11503 --
NM_000945chr2--1809 2564 198 --
NM_000950chrX33333 3071 372 23243 459 22587 64 --
NM_000958chr52870 25 11141 1146 --
NM_000965chr321199 1152 ------
NM_001001323chr1222917 2692 --12171 --
NM_001001344chrX32424 743 151 --1966 --
NM_001001389chr114868 733 682 190 12786 --13023
NM_001001390chr114868 733 682 190 12786 --13023
NM_001001391chr114868 733 682 190 12786 --13023
NM_001001392chr114914 779 728 236 12832 --13069
NM_001001394chr21575 1718 1567 --
NM_001001395chr1222507 36 1383 2692 564 12492
NM_001001396chr134279 4118 3236 13787 ----
NM_001001419chr574164 3609 3406 3291 853 740 417 --44081 3687 2004 1331 11667
NM_001001420chr574164 3609 3406 3291 853 740 417 --44081 3687 2004 1331 11667
NM_001001433chr2042488 2379 722 316 --23115 2509 --
NM_001001436chr16182 ------
NM_001001481chr832638 2624 136 22484 2436 156 --
NM_001001483chr111333 ------
NM_001001484chr1031930 1632 448 ------
NM_001001521chr2185 ------
NM_001001549chr731786 915 659 12582 ----
NM_001001550chr731786 915 659 12582 ----
NM_001001555chr731786 915 659 12582 ----
NM_001001556chr1511452 141 11162 --
NM_001001557chr822220 1999 ------
NM_001001664chr234108 844 143 --23616 442 --
NM_001001668chr1963752 3398 3352 3264 3122 1348 --2865 595 --
NM_001001740chr1127 ------
NM_001001740chr1127 ------
NM_001001890chr2154183 4122 1610 850 532 1827 ----
NM_001001924chr821400 1284 --137 1265
NM_001001925chr821400 1284 --137 1265
NM_001001928chr2257058 5871 3004 1814 52 --52725 1974 625 421 176 --
NM_001001931chr821400 1284 --137 1265
NM_001001933chr1----1112 --
NM_001001971chr10----1106 --
NM_001001974chr1042272 1583 332 242 ------
NM_001001995chrX11733 ------
NM_001002033chr172806 246 --1112 --
NM_001002233chr822135 1717 --32042 1610 822 --
NM_001002257chr242729 2186 415 77 33063 2215 140 1545 --
NM_001002295chr10164 ------
NM_001002296chr821351 1134 --1262 --
NM_001002838chrX31853 1481 300 ------
NM_001002843chr153526 427 44 ------
NM_001002857chr154307 292 153 121 ------
NM_001002858chr154307 292 153 121 ------
NM_001002860chr14114701 4577 4315 2869 1815 1674 858 392 300 260 237 11458 14473 21649 1605
NM_001002909chr1752129 1971 1931 1749 621 --1404 11396
NM_001003652chr1888699 8037 6789 6600 2268 2025 1588 60 --37738 6255 118 16091
NM_001003674chr1875763 4904 4518 4469 1647 1367 402 25952 941 1868 16732
NM_001003675chr1875763 4904 4518 4469 1647 1367 402 25952 941 1868 16732
NM_001003681chr2221852 1506 12124 11415 --
NM_001003688chr43383 351 50 --11166 --
NM_001003694chr32419 258 ------
NM_001003698chr62686 340 ------
NM_001003699chr62686 340 ------
NM_001003712chr1233829 2501 521 13652 43167 2663 862 749 --
NM_001003792chr331026 935 103 ------
NM_001003793chr331026 935 103 ------
NM_001003800chr963487 2465 1474 827 485 419 --23361 1170 --
NM_001003805chr14158 ------
NM_001003940chr1543733 3626 1541 910 11270 23694 3258 --
NM_001003942chr1543733 3626 1541 910 11270 23694 3258 --
NM_001003943chr1543737 3630 1545 914 11274 23698 3262 --
NM_001004065chr953759 2498 2416 1361 903 --175 12765
NM_001004304chr1232729 543 221 ------
NM_001004317chr684548 4418 4008 3103 3073 2881 1538 400 ----11172
NM_001004342chr135677 5410 292 --11511 11065
NM_001004346chr41163 ------
NM_001004360chr211498 --1150 --
NM_001004419chr1254444 3281 2810 532 26 ----1929
NM_001004439chr1531060 302 118 ------
NM_001004720chr22947 376 ------
NM_001004722chr221116 72 ------
NM_001005242chr12--21585 1411 11573 --
NM_001005366chr12--2842 690 ----
NM_001005386chr242408 928 472 453 22106 265 1666 11958
NM_001005404chr1744368 3367 3247 3042 --23580 3208 --
NM_001005463chr1031991 1981 778 --12510 --
NM_001005473chr536102 1556 741 --35695 4215 4200 11870
NM_001005474chr31408 ----11485
NM_001005476chr21625 ------
NM_001005732chr211206 --1248 --
NM_001005733chr211206 ------
NM_001005743chr143183 146 95 ------
NM_001005744chr143183 146 95 ------
NM_001005745chr143183 146 95 ------
NM_001005746chr2--1290 11285 --
NM_001005747chr2--1290 11285 --
NM_001005781chr23465 244 118 ------
NM_001005782chr23914 693 271 ------
NM_001005845chr811541 --11290 --
NM_001005849chr171196 ------
NM_001005909chr3----123 --
NM_001006600chr562292 1859 1747 1535 872 819 1695 11716 --
NM_001006605chr131173 352 63 ------
NM_001006605chr131173 352 63 ------
NM_001006612chrX----160 --
NM_001006613chrX----160 --
NM_001006614chrX----160 --
NM_001006618chr9173 1206 ----
NM_001006626chr7197 ------
NM_001006627chr7197 ------
NM_001006628chr7197 ------
NM_001006629chr7197 ------
NM_001006630chr7197 ------
NM_001006631chr7197 ------
NM_001006632chr7197 ------
NM_001006635chr2--1248 ----
NM_001006636chr2--1706 ----
NM_001006681chrX1127 ------
NM_001006682chrX1127 ------
NM_001006683chrX1127 ------
NM_001006684chrX1434 --155 --
NM_001007024chr1734376 4290 2944 24348 3211 14024 --
NM_001007025chr1734376 4290 2944 24348 3211 14024 --
NM_001007097chr955077 4882 3195 505 319 --33857 1747 1395 --
NM_001007102chr671647 1507 1329 1285 1223 335 30 ------
NM_001007226chr172298 154 ----1579
NM_001007227chr172298 154 ----1579
NM_001007228chr172298 154 ----1579
NM_001007229chr172298 154 ----1579
NM_001007230chr172298 154 ----1579
NM_001007237chr122218 635 12624 ----
NM_001007246chr2131437 1308 64 1127 11819 --
NM_001007257chr151517 1421 1355 242 70 1499 11098 --
NM_001007277chr11----1382 --
NM_001007466chr674780 4711 4087 3895 1691 633 328 14015 24444 577 --
NM_001007471chr9----1178 --
NM_001007553chr12417 359 1271 ----
NM_001007559chr1842043 1791 654 60 ------
NM_001007565chr3164 --1112 --
NM_001008222chrX51094 872 521 250 149 --11191 --
NM_001008225chr73598 590 268 ------
NM_001008239chr1883562 2386 1495 1162 886 716 422 110 1491 ----
NM_001008392chr353493 3293 2946 2852 216 --13081 --
NM_001008405chr731808 1457 697 --11498 --
NM_001008407chr721210 649 ------
NM_001008408chr712325 34478 2480 411 34812 4392 1621 --
NM_001008495chr81243 12040 22194 1956 --
NM_001008541chr1021705 685 --22206 889 --
NM_001008541chr1021705 685 --22206 889 --
NM_001008564chr1322145 1940 --1544 --
NM_001008660chr1121396 1262 ------
NM_001008701chr1911036 13014 ----
NM_001008707chr1421596 1253 ------
NM_001008738chr532105 2065 141 172 22139 247 --
NM_001008801chr1912115 --11362 --
NM_001008860chr153756 624 343 ------
NM_001008892chr153756 624 343 ------
NM_001008894chr153756 624 343 ------
NM_001008895chr131389 1220 11078 1450
NM_001008897chr61135 --1171 --
NM_001008925chr453313 2377 2150 214 198 22536 549 ----
NM_001009552chr8------1173
NM_001009555chr411570 --1543 --
NM_001009567chr102263 98 1654 ----
NM_001009571chr721431 389 41688 1293 1230 493 2546 321 --
NM_001009881chr1----1622 --
NM_001009882chr1----1622 --
NM_001009899chr366547 5230 2238 1502 765 214 24425 2614 14145 11041
NM_001009909chr1143728 3131 2882 374 --21415 314 --
NM_001009958chr71606 ------
NM_001009960chr712834 ------
NM_001009993chr284355 4334 3754 3007 1720 1691 1331 575 --11794 12926
NM_001010000chr1853528 3105 1020 619 105 --13326 --
NM_001010844chr6126 ------
NM_001010861chr12979 794 --1990 1215
NM_001010888chrX114165 3920 3331 3243 3189 2996 2857 2829 1749 471 97 ----1132
NM_001010891chr566099 5794 5611 5013 187 181 --12455 --
NM_001010971chr111013 --1896 --
NM_001010983chr3----129 --
NM_001010984chr112236 1974 21700 485 --
NM_001010986chrX12075 1911 --1136
NM_001011513chr463835 3746 3698 3061 2700 1307 21643 195 42989 2922 1173 559 23395 3022
NM_001011515chr421056 1003 ------
NM_001011516chr421056 1003 ------
NM_001011537chr312304 ------
NM_001011546chr201564 ----1336
NM_001011553chr72957 699 3935 807 196 ----
NM_001011663chr101943 ------
NM_001011666chr796602 6558 6225 5576 4682 1279 1251 689 70 --16322 26414 2601
NM_001011708chr222529 381 --1996 12492
NM_001011713chr141156 ------
NM_001011724chr131234 ------
NM_001011725chr131234 ------
NM_001012264chr141720 ------
NM_001012337chr3149 ------
NM_001012393chr1163442 3239 1621 1316 1296 716 14076 44755 4547 4221 1650 --
NM_001012398chr163331 226 30 --1421 --
NM_001012514chr22889 94 ------
NM_001012516chr22889 94 ------
NM_001012642chr1521936 391 12055 11746 --
NM_001012751chr1031520 1344 1246 2542 232 ----
NM_001012761chr5----1270 --
NM_001012968chrX52532 2389 2274 822 176 --1606 --
NM_001012977chrX1929 --1311 --
NM_001012979chrX170 ------
NM_001012989chrX--171 ----
NM_001013031chr1053508 3117 2340 1174 365 ------
NM_001013399chr61721 ------
NM_001013406chr721511 1119 1450 1123 --
NM_001013415chr41430 ------
NM_001013438chr31260 ------
NM_001013439chr32346 106 ------
NM_001013690chr1211786 ------
NM_001013699chr123175 98 24 2513 105 ----
NM_001013843chr151746 --1376 --
NM_001014286chr13145 ------
NM_001014431chr142656 98 --1774 --
NM_001014432chr142656 98 --1774 --
NM_001014434chr11571 ------
NM_001014797chr10127939 7721 7520 6152 5889 5443 5146 3182 2632 2417 1759 1302 16738 1374 --
NM_001015045chr442398 1825 884 206 1803 --1970
NM_001015053chr172582 320 ------
NM_001015508chr8----191 --
NM_001015877chrX42907 2826 1169 1117 --22746 2005 32543 2219 334
NM_001015887chr331839 1690 1228 ----21829 283
NM_001017369chr431091 916 909 ------
NM_001017371chr22559 209 11054 ----
NM_001017395chr363193 2949 2919 2351 1376 714 12589 13648 --
NM_001017396chr261844 578 423 354 298 146 --2785 414 1487
NM_001017405chr42818 179 --1243 --
NM_001017415chr1--1269 ----
NM_001017416chr1--1269 ----
NM_001017424chr11708 --31780 174 79 --
NM_001017425chr11708 --31780 174 79 --
NM_001017440chr766342 5604 3172 1433 671 167 --47098 5697 2312 710 --
NM_001017923chr1411569 ------
NM_001017964chr22123 --1238 --
NM_001017977chr1------124
NM_001018053chr141898 1619 695 369 1304 ----
NM_001018054chr121158 399 ------
NM_001018056chr91146 --1391 --
NM_001018057chr111152 11329 1574 11036
NM_001018064chr921663 163 ------
NM_001018065chr995732 5659 4686 4355 1536 1497 1383 715 213 11555 24742 1371 --
NM_001018066chr995732 5659 4686 4355 1536 1497 1383 715 213 11555 24742 1371 --
NM_001018067chr134206 1141 301 --1635 --
NM_001018068chr134206 1141 301 --1635 --
NM_001018069chr134206 1141 301 --1635 --
NM_001018074chr512593 22921 703 1430 --
NM_001018075chr512593 22921 703 1430 --
NM_001018076chr512593 22921 703 1430 --
NM_001018077chr512593 22921 703 1430 --
NM_001018108chr1542299 1911 1869 444 ------
NM_001020658chr111445 1528 ----
NM_001020658chr111445 1528 ----
NM_001020825chr5168 1396 ----
NM_001023567chr1531582 717 528 --31768 893 218 --
NM_001023587chr311141 ------
NM_001024094chr512593 22921 703 1430 --
NM_001024218chr142750 589 ------
NM_001024226chr121159 408 ------
NM_001024227chr121159 408 ------
NM_001024228chr121159 408 ------
NM_001024649chr552865 2219 1865 927 736 1746 ----
NM_001024660chr331339 1241 1163 --1642 --
NM_001024668chr121945 --169 --
NM_001024680chr221276 164 --11590 --
NM_001024808chr123924 816 718 22600 1821 ----
NM_001024847chr35642 573 466 273 181 1918 3608 473 224 12430
NM_001024948chr173351 3051 2643 2552 1208 954 180 ----1790
NM_001025068chr32709 183 31484 541 247 1719 --
NM_001025069chr32709 183 31484 541 247 1719 --
NM_001025076chr1066076 6021 2469 2382 1104 986 ----15532
NM_001025077chr1097434 7379 5101 5011 4806 4722 2462 2344 420 14799 1856 26890 530
NM_001025079chr363912 3623 1241 849 676 372 --33523 2608 1225 --
NM_001025100chr1863648 3323 3192 3079 1300 746 11556 11395 12805
NM_001025105chr551375 1215 1136 254 166 --150 --
NM_001025107chr141804 866 643 67 ------
NM_001025107chr141804 866 643 67 ------
NM_001025108chr253381 921 873 742 125 ----195
NM_001025201chr2----2628 540 --
NM_001025233chr1242669 929 553 162 156 --1649
NM_001025252chr832097 930 522 12746 ----
NM_001025253chr832097 930 522 12746 ----
NM_001025356chr1242986 2944 2158 696 --33014 794 25 --
NM_001025366chr61216 11233 21895 182 --
NM_001025366chr61216 11233 21895 182 --
NM_001025367chr61216 11233 21895 182 --
NM_001025367chr61216 11233 21895 182 --
NM_001025368chr61216 11233 21895 182 --
NM_001025368chr61216 11233 21895 182 --
NM_001025369chr61232 11249 21911 198 --
NM_001025369chr61232 11249 21911 198 --
NM_001025370chr61216 11233 21895 182 --
NM_001025370chr61216 11233 21895 182 --
NM_001025389chr1121059 22 --21140 234 11290
NM_001025390chr1121059 22 --21140 234 11290
NM_001025579chr171327 1994 ----
NM_001025580chrX64170 3710 3046 2608 655 182 ------
NM_001025595chr451241 1222 1046 1017 102 ----11406
NM_001025603chr12516 71 ------
NM_001025780chr92428 254 ------
NM_001029858chr632256 1132 921 --12977 --
NM_001029860chr82294 259 ------
NM_001029863chr652927 2871 1184 482 82 --12675 --
NM_001029875chr532992 998 630 ------
NM_001029884chr632578 2210 2153 --2949 924 --
NM_001029989chr151741 184 ----
NM_001029998chr4177 --1910 --
NM_001030006chr1731641 463 400 --11807 --
NM_001030007chr1693654 3127 2703 2697 1196 1151 471 253 163 --12619 --
NM_001030055chr1444668 4300 3881 1507 13674 14184 --
NM_001031677chr52536 160 ------
NM_001031679chr1233042 1153 667 23318 34 1709 --
NM_001031681chr1742246 920 597 28 --12175 --
NM_001031684chr221459 1279 ------
NM_001031695chr22115442 5410 4840 4392 3930 1806 1190 1182 808 284 234 --11559 13523
NM_001031700chr452349 1970 1766 161 44 2915 792 ----
NM_001031710chr71823 --1241 --
NM_001031711chr531696 1523 525 ------
NM_001031716chr2164 1218 ----
NM_001031740chr131283 120 71 --21446 313 --
NM_001031748chr121512 ------
NM_001031804chr1643999 3301 3187 737 14301 23857 2729 --
NM_001031812chr552247 2123 1604 1563 698 11544 --1725
NM_001032221chr931763 123 45 --11811 --
NM_001032279chr11----1396 --
NM_001032293chr17----1442 --
NM_001032296chr1322055 851 --22790 2219 --
NM_001032363chr12881 144 --22039 1784 --
NM_001032363chr12881 144 --22039 1784 --
NM_001032380chr1051547 761 467 120 68 21579 146 11355 --
NM_001033045chr244260 1529 1461 1171 --33092 1226 381 --
NM_001033047chr422571 1857 --11618 --
NM_001033049chr2121972 1962 --1247 --
NM_001033081chr111469 ------
NM_001033082chr111469 ------
NM_001033087chr2032873 1138 147 23190 856 ----
NM_001033117chr354548 3225 1890 1265 255 ----11678
NM_001033503chr51362 ------
NM_001033506chr111412 ------
NM_001033507chr11220 1530 1159 --
NM_001033551chr1763545 2999 2763 1529 1014 65 13862 23515 538 --
NM_001033557chr21911 ------
NM_001033561chr172698 196 ------
NM_001033578chr842221 1510 254 171 --32067 1783 630 --
NM_001033602chr1342522 2217 2150 492 1175 ----
NM_001033723chr862788 2566 1941 1879 1103 538 --22494 431 --
NM_001033756chr61150 11167 21829 116 --
NM_001033756chr61150 11167 21829 116 --
NM_001034837chr52731 637 ------
NM_001034838chr52731 637 ------
NM_001034841chr1645489 3787 1564 727 --22152 678 --
NM_001034845chr4----1297 --
NM_001034852chr1441688 782 438 132 ------
NM_001034954chr1042830 2366 2077 839 1829 12169 --
NM_001034955chr1042830 2366 2077 839 1829 12169 --
NM_001034956chr1042830 2366 2077 839 1829 12169 --
NM_001034957chr1042830 2366 2077 839 1829 12169 --
NM_001035chr11415 ----1425
NM_001035003chr42890 574 1411 ----
NM_001035004chr42890 574 1411 ----
NM_001035254chr931747 683 423 --21609 1600 --
NM_001035260chr1041400 1309 655 357 ----1235
NM_001035521chr2----1522 --
NM_001037132chr73854 748 740 --155 --
NM_001037133chr73854 748 740 --155 --
NM_001037164chr731906 1622 1402 --1785 --
NM_001037165chr768552 6519 2909 1874 1607 1246 --28937 7827 --
NM_001037172chr331390 1080 229 ------
NM_001037174chr232185 2177 1775 ------
NM_001037317chr12979 794 --1990 1215
NM_001037334chr1822111 1709 ------
NM_001037339chr111699 --1701 --
NM_001037340chr111699 --1701 --
NM_001037341chr111699 --1701 --
NM_001037341chr111699 --1701 --
NM_001037535chrX11386 ------
NM_001037536chrX11386 ------
NM_001037540chrX11386 ------
NM_001037582chr411318 --11602 --
NM_001037954chr1133252 3092 948 1181 32695 963 928 13207
NM_001038493chr221163 966 ------
NM_001038640chr1521042 784 --1286 1961
NM_001039199chr2064980 4939 4853 3340 1834 1698 11865 31706 1293 597 --
NM_001039348chr22918 64 2160 30 ----
NM_001039349chr22918 64 2160 30 ----
NM_001039479chr1472259 2024 900 828 639 559 436 --21923 624 --
NM_001039538chr253610 3342 3310 663 290 --1609 --
NM_001039547chr353219 3170 1461 646 134 --67712 7410 6670 6403 5513 2091 --
NM_001039570chr22104640 3893 3727 3106 2951 1727 1278 1131 1120 793 1212 11387 13919
NM_001039571chr22104640 3893 3727 3106 2951 1727 1278 1131 1120 793 1212 11387 13919
NM_001039574chr12816 655 ------
NM_001039577chr122965 2781 13464 131 11524
NM_001039590chrX43962 3152 2742 1077 12497 13832 --
NM_001039591chrX43962 3152 2742 1077 12497 13832 --
NM_001039618chr1135648 4832 1700 --24530 3911 --
NM_001039664chr11227 ------
NM_001039802chr12232 188 ------
NM_001039840chrX55455 4796 4308 504 487 24417 944 12197 --
NM_001039888chr13320 188 162 ------
NM_001039916chr12----11052 --
NM_001039917chr12----11052 --
NM_001039918chr12----11052 --
NM_001039919chr12----11052 --
NM_001039920chr12----11052 --
NM_001039937chr1384055 3986 3975 3603 3372 2578 1447 618 23687 1472 1494 --
NM_001039938chr1321489 1160 ------
NM_001040002chr1721241 147 ------
NM_001040101chr44435 330 197 190 ------
NM_001040102chr1042431 2309 67 34 --22639 815 --
NM_001040103chr1042431 2309 67 34 --22639 815 --
NM_001040110chr71161 ------
NM_001040142chr231969 1739 736 --21680 1664 --
NM_001040143chr231969 1739 736 --21680 1664 --
NM_001040152chr743869 3367 1979 401 14740 24636 3147 --
NM_001040153chr132866 649 2760 170 ----
NM_001040157chr422843 273 ------
NM_001040158chr52217 188 ------
NM_001040159chr421485 443 ----11182
NM_001040202chr432182 889 520 ----12155
NM_001040214chr642386 2324 1728 70 ------
NM_001040272chr932336 1566 811 ------
NM_001040273chr1051998 1745 766 437 37 ------
NM_001040284chr16105890 5601 5410 5018 4411 3888 1823 1612 819 697 --25053 4882 --
NM_001040402chr431091 915 353 --1411 12494
NM_001040409chr24640 330 186 31 ------
NM_001040429chr1333066 1274 30 --1774 --
NM_001040437chr6----189 --
NM_001040438chr6----189 --
NM_001040440chr5----1447 --
NM_001040441chr144254 3770 1988 1144 --55041 4887 4488 3318 1667 --
NM_001040445chr285313 4268 4095 3740 3726 3626 760 504 --34104 2089 337 --
NM_001040446chr522077 108 1497 1903 --
NM_001040450chr151251 1941 12680 --
NM_001040453chr151251 1941 12680 --
NM_001040455chr1131331 359 110 ------
NM_001040619chr131423 1404 90 --1329 --
NM_001040653chr342359 1722 872 827 --1493 --
NM_001040665chr744979 1626 1089 498 14605 21508 949 --
NM_001040666chr71681 ------
NM_001040708chr8--1782 ----
NM_001040709chr132382 938 772 --12578 --
NM_001040712chr943005 2490 2185 78 11403 12199 --
NM_001040715chr163361 291 129 --1410 --
NM_001040876chr4--21451 371 11628 --
NM_001042353chr201156 ------
NM_001042355chr1675194 5056 4846 3958 3899 1327 956 --24962 190 11903
NM_001042368chr9------143
NM_001042371chr1631695 1399 206 1707 ----
NM_001042388chr18----1306 --
NM_001042403chr1211040 ------
NM_001042404chr141746 776 498 467 11984 ----
NM_001042412chr1675194 5056 4846 3958 3899 1327 956 --24962 190 11903
NM_001042413chr933769 3382 621 --43468 3303 3290 1281 --
NM_001042414chr131255 ------
NM_001042424chr432155 1243 1105 --1715 13219
NM_001042453chrX------1604
NM_001042459chr32233 102 ------
NM_001042465chr103378 150 38 ------
NM_001042466chr103378 150 38 ------
NM_001042473chr1011533 --12045 --
NM_001042479chrX21942 511 --1675 --
NM_001042480chrX21942 511 --1675 --
NM_001042481chr1452451 2062 743 257 166 ------
NM_001042492chr1753472 2663 2248 582 102 11192 ----
NM_001042494chr1543622 2423 1013 360 --21392 1246 --
NM_001042495chr1543622 2423 1013 360 --21392 1246 --
NM_001042496chr1543622 2423 1013 360 --21392 1246 --
NM_001042497chr1543622 2423 1013 360 --21392 1246 --
NM_001042506chrX1929 --1311 --
NM_001042533chr323124 1213 --1745 --
NM_001042537chrX3908 751 533 12252 12336 --
NM_001042543chr421241 563 ------
NM_001042548chr23698 185 50 1882 1851 --
NM_001042555chr1264713 4059 1206 971 819 219 --34040 3187 1220 14482
NM_001042599chr277411 7248 6785 6620 6527 5501 1606 11088 --12575
NM_001042601chr343026 2406 601 351 ------
NM_001042603chr1264133 3893 3523 3465 3407 1362 1480 --13666
NM_001042604chr384169 3679 3274 1769 728 680 188 147 --1382 --
NM_001042632chr2022167 319 --11650 --
NM_001042633chr2022167 319 --11650 --
NM_001042663chr161060 1043 943 570 485 154 --11223 --
NM_001042664chr161060 1043 943 570 485 154 --11223 --
NM_001042665chr161060 1043 943 570 485 154 --11223 --
NM_001042729chr11219 --1540 --
NM_001042747chr11219 --1540 --
NM_001042749chrX31488 480 327 --11736 --
NM_001042750chrX31488 480 327 --11736 --
NM_001042751chrX31488 480 327 --11736 --
NM_001043318chr1462581 1466 1321 1178 673 367 11641 1881 --
NM_001043351chr122090 520 ------
NM_001044305chr631364 1066 454 ------
NM_001044385chr253745 3159 2536 304 195 ------
NM_001044722chr552247 2123 1604 1563 698 11544 --1725
NM_001044723chr552247 2123 1604 1563 698 11544 --1725
NM_001045478chr12987 40 ------
NM_001046chr542680 2148 490 38 --12022 12536
NM_001048183chr143704 1103 579 533 --4760 150 136 83 --
NM_001070chr171184 ------
NM_001076chr41164 ------
NM_001076chr41164 ------
NM_001077628chr11179 ------
NM_001078chr12613 542 ------
NM_001079874chr141900 1390 1362 104 --1774 --
NM_001083620chr462411 2207 1884 1854 393 60 11948 11666 --
NM_001083621chr154287 4071 3383 1824 372 ----11165
NM_001092chr1721794 104 --1357 --
NM_001094chr17123 1828 ----
NM_001096chr171286 ------
NM_001099678chr346171 6104 5833 4768 34587 4459 2584 34342 1319 1194 --
NM_001100108chr1108091 7867 6916 5915 3339 2713 1952 1659 861 852 16768 36086 5446 3239 --
NM_001106chr3129174 8695 8484 8172 7758 7454 7327 7119 3760 3213 2131 775 11693 ----
NM_001111chr141804 866 643 67 ------
NM_001113490chrX62715 2433 1121 1076 704 468 1879 ----
NM_001117chr1832145 827 175 --12284 --
NM_001121chr1021224 484 ------
NM_001124chr111538 ------
NM_001128chr1693654 3127 2703 2697 1196 1151 471 253 163 --12619 --
NM_001148chr461757 1441 1433 305 135 87 --41977 1850 1535 721 --
NM_001149chr1031343 1283 548 ------
NM_001152chrX166 ------
NM_001153chr23918 200 194 ------
NM_001156chr101425 ------
NM_001167chrX86630 6539 5416 5148 2643 2477 1757 536 --22682 101 --
NM_001172chr142700 221 ----1254
NM_001173chr1444668 4300 3881 1507 13674 14184 --
NM_001174chrX22126 151 12054 1635 --
NM_001177chr1242476 2376 1686 72 --21971 586 --
NM_001186chr2172393 2244 2183 2069 1109 835 769 --12145 --
NM_001187chr211116 --1127 --
NM_001194chr192677 515 ------
NM_001200chr2011160 ------
NM_001201chr441509 1078 858 102 ------
NM_001204chr267379 6585 3002 2218 2141 211 25542 4777 35948 4858 1528 11633
NM_001206chr952942 2499 795 775 53 ----12296
NM_001218chr1532606 2271 2051 --12678 --
NM_001222chr1021881 1794 ------
NM_001237chr41937 ------
NM_001237chr41937 ------
NM_001241chr23821 712 409 21805 936 12368 12359
NM_001241chr23821 712 409 21805 936 12368 12359
NM_001254chr172848 822 144 ----
NM_001257chr1621391 164 ------
NM_001259chr7115087 5046 4587 4179 2407 2151 2117 1133 1078 543 393 --55148 4776 4574 4496 612 --
NM_001260chr131280 --1336 --
NM_001261chr93185 162 77 ------
NM_001265chr131280 ------
NM_001268chr136969 943 902 429 399 185 --1113 --
NM_001271chr1563248 2190 1102 780 255 202 --33285 2453 142 --
NM_001280chr19------1247
NM_001282chr1731641 463 400 --11807 --
NM_001283chr7----1705 --
NM_001284chr51371 ------
NM_001289chrX31393 1057 636 --1548 --
NM_001290chr42733 240 ------
NM_001304chr1782997 2637 2563 2335 1303 827 571 184 --1461 --
NM_001310chr1242764 1158 799 77 --12332 --
NM_001315chr621660 893 ------
NM_001319chr192717 245 11060 ----
NM_001321chr121159 --1193 --
NM_001326chr11----1355 --
NM_001331chr1122602 38 ------
NM_001338chr213489 374 183 --1289 --
NM_001343chr511695 --11576 --
NM_001346chr342550 2377 1902 646 12085 ----
NM_001351chr331536 480 276 1430 --11731
NM_001356chrX32435 1896 716 1269 22289 1569 --
NM_001364chr1153629 1578 1021 688 372 198 11180 140
NM_001386chr811872 11927 12339 --
NM_001387chr522985 2707 ------
NM_001389chr211581 ------
NM_001390chr1873324 3153 2838 2580 2329 1109 837 --1406 --
NM_001391chr182939 373 --1151 --
NM_001400chr151132 926 418 284 31 --11007 --
NM_001412chrX63683 3349 3087 1476 700 675 13312 ----
NM_001418chr11160 ------
NM_001418chr11160 ------
NM_001420chr1933167 2086 159 ------
NM_001423chr1211975 --1207 --
NM_001427chr742083 1980 393 94 ------
NM_001430chr241845 1481 766 668 --11505 --
NM_001431chr61770 1200 ----
NM_001432chr443653 3069 738 125 ------
NM_001438chr122885 1281 13203 12781 --
NM_001447chr54889 551 234 211 ------
NM_001449chrX135 ----1184
NM_001451chr162927 169 --11204 --
NM_001452chr6--1671 ----
NM_001463chr22750 700 ------
NM_001482chr151880 ------
NM_001483chr71698 ------
NM_001489chr91254 --1108 --
NM_001493chrX1603 ------
NM_001494chr102188 119 ------
NM_001497chr911037 --22418 907 --
NM_001521chr2----1522 --
NM_001527chr674741 3706 3645 3072 1449 1347 338 24777 783 --14718
NM_001530chr1421025 963 ------
NM_001539chr9--134 ----
NM_001542chr122218 635 12624 ----
NM_001554chr11143 ------
NM_001564chr41142 ------
NM_001587chrX5759 570 562 419 374 --1734 --
NM_001604chr111273 ------
NM_001608chr2------1961
NM_001609chr1064173 4074 3856 3733 1129 107 --21498 735 --
NM_001610chr112613 178 ------
NM_001614chr171154 1551 126 --
NM_001614chr171154 1551 126 --
NM_001616chr253406 2973 2158 564 439 --1759 --
NM_001650chr1844087 3577 3417 522 ------
NM_001655chr1161826 1744 1703 1419 835 796 ------
NM_001656chr521393 1325 --2625 153 1452
NM_001658chr121159 408 ------
NM_001661chr171621 --1565 1727
NM_001663chr1422757 2087 --12717 --
NM_001665chr111507 ------
NM_001676chr131168 ------
NM_001677chr11343 1142 ----
NM_001681chr12--1642 ----
NM_001682chr1232631 2406 1086 --11885 --
NM_001684chr133996 3835 2953 13504 ----
NM_001690chr322486 412 --1464 --
NM_001695chr844274 2603 493 78 23848 893 13808 --
NM_001701chr931613 1586 1463 ------
NM_001707chr73904 213 91 ------
NM_001709chr111439 ------
NM_001714chr121428 ------
NM_001718chr61414 11092 ----
NM_001721chrX----152 --
NM_001729chr4------1362
NM_001730chr1311008 ------
NM_001730chr1311008 ------
NM_001731chr121952 1755 ----
NM_001742chr71584 166 ----
NM_001743chr2--1399 ----
NM_001744chr5248 39 ------
NM_001746chr552865 2219 1865 927 736 1746 ----
NM_001753chr7--11566 11175 --
NM_001754chr2154183 4122 1610 850 532 1827 ----
NM_001755chr1671746 1564 789 682 491 450 232 21903 1544 1549 --
NM_001759chr1253995 1401 1330 943 882 --2973 190 --
NM_001760chr62302 191 ------
NM_001777chr363912 3623 1241 849 676 372 --33523 2608 1225 --
NM_001788chr72957 699 3935 807 196 ----
NM_001791chr12232 188 ------
NM_001792chr1841030 396 228 66 ------
NM_001795chr1611570 ------
NM_001796chr16136 ------
NM_001798chr12--1211 11053 --
NM_001806chr1932879 542 140 ------
NM_001822chr2----2628 540 --
NM_001827chr91277 ------
NM_001830chrX61205 1178 1144 812 725 187 1487 22600 868 --
NM_001839chr16726 653 537 304 264 115 ------
NM_001844chr12----156 --
NM_001858chr644362 3506 1298 718 23868 3654 21750 181 --
NM_001859chr923873 1270 13185 1544 --
NM_001873chr41512 ------
NM_001885chr11123 ------
NM_001892chr551375 1215 1136 254 166 --150 --
NM_001894chr2221199 190 ------
NM_001895chr20--1346 ----
NM_001935chr21724 ------
NM_001938chr131628 356 350 ------
NM_001939chrX53871 2697 1030 692 415 --33290 2811 763 --
NM_001944chr1832299 359 200 1106 32101 752 456 --
NM_001949chr652460 2434 1989 1266 838 --1411 --
NM_001951chr8----1513 --
NM_001955chr6--1940 ----
NM_001957chr452172 2125 1967 236 190 ------
NM_001967chr31453 --1443 --
NM_001968chr43713 349 166 1100 ----
NM_001977chr441170 1090 227 123 --31639 411 58 1196
NM_001981chr142133 953 912 493 ------
NM_001982chr1231064 277 194 --1828 133
NM_001991chr1752212 852 830 358 40 ----127
NM_001992chr532083 570 346 12189 31727 1642 1535 --
NM_001993chr14902 736 177 157 1995 ----
NM_001999chr51287 1981 159 --
NM_002006chr474164 2284 1951 1811 914 658 263 --13787 --
NM_002009chr1542623 2275 907 734 1155 21099 487 --
NM_002010chr131405 1177 ----
NM_002015chr1333140 923 886 13220 32152 1012 33 --
NM_002017chr1121198 1111 ------
NM_002023chr1145 --1383 11291
NM_002024chrX22095 270 --2661 236 1364
NM_002025chrX39110 7036 235 --57761 7398 1880 331 224 --
NM_002031chr63650 544 162 ------
NM_002039chr41285 ------
NM_002040chr21--1721 1949 --
NM_002044chr1511452 141 11162 --
NM_002048chr931239 970 179 ------
NM_002051chr10164 ------
NM_002063chrX1250 --11280 --
NM_002069chr731424 665 28 ----148
NM_002076chr1223262 1011 --3447 433 356 --
NM_002077chr951987 1434 704 364 225 ----1312
NM_002080chr161759 --1139 --
NM_002083chr14198 ------
NM_002092chr453551 3288 1750 1519 1000 --34020 1022 44 1959
NM_002107chr1----2389 328 --
NM_002126chr1753698 2569 842 679 512 --196 --
NM_002129chr41337 ------
NM_002130chr541672 392 323 159 ------
NM_002136chr121234 ------
NM_002137chr742383 2018 1639 313 ------
NM_002140chr931178 830 154 ------
NM_002141chr7--2621 548 ----
NM_002146chr1731160 1020 268 21275 953 ----
NM_002148chr21429 --1447 --
NM_002149chr23791 759 720 ------
NM_002154chr5----1155 --
NM_002156chr21304 ------
NM_002160chr91107 --1619 --
NM_002163chr1631136 489 295 1124 ----
NM_002166chr2--1563 ----
NM_002176chr9148 ------
NM_002182chr322202 857 12291 ----
NM_002192chr72554 446 ------
NM_002193chr2----21253 1219 --
NM_002199chr42384 155 ------
NM_002202chr52696 261 --1324 --
NM_002203chr542899 2535 1448 1291 --33013 2628 439 11349
NM_002214chr784106 2275 2239 2095 2082 639 366 294 15677 55159 2215 2069 1014 236 --
NM_002222chr351339 1308 524 422 271 ------
NM_002226chr144928 897 649 247 ------
NM_002227chr151294 1007 848 483 258 ----1252
NM_002233chr111378 ------
NM_002234chr121247 --1717 --
NM_002235chr1261190 1104 643 421 182 34 ------
NM_002239chr23826 790 778 1255 ----
NM_002242chr221901 1754 --1606 --
NM_002247chr1012214 --31796 550 312 --
NM_002253chr42534 99 ----1251
NM_002264chr364962 3570 2000 1349 1341 1246 1268 1470 --
NM_002267chr1322312 2226 ------
NM_002268chr321805 35 ------
NM_002269chr61344 ------
NM_002270chr565316 5094 4657 4512 4204 1080 11019 12283 --
NM_002271chr1351906 1782 687 229 151 11873 22103 1795 --
NM_002285chr253381 921 873 742 125 ----195
NM_002293chr142741 2273 433 390 ----11999
NM_002294chrX----1132 --
NM_002310chr565181 2094 1966 1908 518 70 12601 36346 1414 278 14171
NM_002334chr1131931 1877 1841 --11788 --
NM_002336chr1244522 4346 1970 803 13143 44023 3994 1687 1632 --
NM_002349chr251413 1218 1036 478 452 11397 ----
NM_002351chrX3508 100 24 ----11419
NM_002356chr612802 ------
NM_002374chr253610 3342 3310 663 290 --1609 --
NM_002375chr322239 1422 --1254 --
NM_002382chr1411194 ------
NM_002387chr5104936 4627 3974 2005 935 886 729 284 124 79 14594 24488 870 1467
NM_002397chr52851 539 --3736 206 144 --
NM_002398chr2------11202
NM_002401chr1721523 484 ------
NM_002406chr51256 2136 108 ----
NM_002408chr141799 1284 ----
NM_002429chr1241148 1020 514 207 --11496 --
NM_002430chr2222341 865 ------
NM_002438chr102263 98 1654 ----
NM_002442chr1221505 1336 ------
NM_002444chrX21952 285 --11630 1129
NM_002446chr191262 ------
NM_002449chr5187 --11279 --
NM_002473chr2221151 173 ------
NM_002480chr1211060 ------
NM_002486chr92935 444 --11686 --
NM_002487chr151592 ------
NM_002493chr91131 ----1290
NM_002499chr1542042 1968 865 300 21937 371 198 --
NM_002500chr2----1404 --
NM_002501chr1944090 3850 3162 2878 11114 ----
NM_002505chr621154 1105 --11260 2416 301
NM_002515chr1462015 737 531 419 282 71 ------
NM_002519chr112477 103 --11228 --
NM_002526chr651462 1069 536 134 40 ------
NM_002537chr153973 907 361 ------
NM_002538chr5----1154 --
NM_002539chr2----1260 --
NM_002540chr9--1657 2548 180 --
NM_002544chr17133 ------
NM_002545chr1163442 3239 1621 1316 1296 716 14076 44755 4547 4221 1650 --
NM_002546chr8174 --1576 --
NM_002547chrX43907 1692 548 128 --33341 1558 1117 --
NM_002552chr241129 1031 373 30 ----11202
NM_002568chr81304 ------
NM_002569chr1541504 1250 1212 46 ------
NM_002570chr1541203 1017 345 32 ------
NM_002576chr1141150 449 163 123 ------
NM_002577chr353682 1605 1467 689 291 ----12915
NM_002581chr943943 3807 1933 1439 ----11864
NM_002583chr121183 ----1491
NM_002586chr611049 ------
NM_002588chr51627 --11678 --
NM_002595chr1231866 1613 437 ------
NM_002599chr111133 ------
NM_002600chr111699 --1701 --
NM_002605chr152848 91 ----1374
NM_002612chr741743 1347 597 559 --1405 --
NM_002613chr1664497 4362 3917 3714 2076 1347 --34607 3697 134 --
NM_002618chr2----145 --
NM_002627chr10----178 --
NM_002628chr331150 1042 478 11198 1355 1365
NM_002633chr12489 153 1144 199 --
NM_002635chr121124 ------
NM_002645chr113645 299 155 --12477 --
NM_002649chr71108 ------
NM_002655chr875241 4880 4625 4220 1940 1706 682 35032 4973 4247 23632 1591 --
NM_002656chr63923 750 347 --153 --
NM_002657chr2033621 3090 863 --23747 143 --
NM_002662chr341692 724 622 431 ------
NM_002663chr171179 --1543 --
NM_002670chr321600 1196 ------
NM_002687chr141162 --11100 11138
NM_002698chr191973 ------
NM_002706chr21194 170 ----
NM_002709chr232574 2245 1439 --1764 --
NM_002710chr121150 ------
NM_002711chr71820 ------
NM_002715chr541225 901 802 254 ------
NM_002717chr84667 460 223 62 ------
NM_002718chr331958 479 250 ------
NM_002719chr1432212 2131 977 ------
NM_002721chr9----194 --
NM_002725chr122831 37 --11391 --
NM_002731chr131142 217 195 --1791 --
NM_002734chr1731729 1413 169 11833 11480 --
NM_002736chr72705 392 --190 --
NM_002737chr1756120 5434 4323 1448 353 --16368 --
NM_002738chr161705 ------
NM_002740chr311798 11760 22382 626 --
NM_002742chr141130 --1173 --
NM_002745chr22134569 3823 3548 1824 1780 1624 1201 1152 1134 698 480 449 248 --44556 3334 1792 590 1788
NM_002752chr5130 --1366 --
NM_002753chr41604 ------
NM_002755chr15199 ------
NM_002778chr103378 150 38 ------
NM_002806chr14----2300 253 --
NM_002822chr1261832 1693 1385 1188 567 109 --1126 --
NM_002823chr21479 1506 1247 --
NM_002825chr71565 164 1601 --
NM_002827chr2031590 584 538 --31663 1464 446 --
NM_002828chr182687 359 --1931 --
NM_002830chr23146 137 88 ------
NM_002833chr1511386 1532 1403 --
NM_002836chr201169 ------
NM_002837chr1254568 4345 1289 1177 797 11162 ----
NM_002839chr943005 2490 2185 78 11403 12199 --
NM_002840chr141390 1027 281 215 ------
NM_002841chr32494 448 123 1175 --
NM_002843chr1122165 1018 13154 ----
NM_002844chr631350 1076 361 ------
NM_002845chr181435 ------
NM_002858chr131205 1004 885 ------
NM_002865chr81211 ------
NM_002867chr11194 --1683 --
NM_002868chr1241611 969 906 149 --12396 --
NM_002869chr1152175 2082 1653 575 304 --11816 1695
NM_002874chr921957 865 --21603 838 11524
NM_002892chr1451651 1635 1541 393 82 1281 1483 --
NM_002893chrX----1138 --
NM_002902chr153610 265 27 --1435 --
NM_002906chr11------1105
NM_002911chr1941076 678 585 394 ------
NM_002912chr62320 158 --1346 --
NM_002923chr11483 ------
NM_002924chr1--1524 ----
NM_002926chr4----1386 --
NM_002930chr182238 67 ------
NM_002940chr4--21451 371 11628 --
NM_002941chr321531 323 ------
NM_002945chr173763 743 667 ------
NM_002955chr62686 340 ------
NM_002956chr123452 384 68 ------
NM_002957chr923882 2572 --11466 --
NM_002959chr154368 3820 3790 2780 410 --1188 --
NM_002968chr1621005 27 ------
NM_002970chrX--1309 ----
NM_002971chr32389 339 ------
NM_002973chr12--1191 ----
NM_002977chr232498 1154 159 --12256 --
NM_002994chr421920 1818 --11335 --
NM_002998chr821698 115 1876 ----
NM_003011chr91568 ----1447
NM_003012chr853084 2990 2750 1093 145 --11018 --
NM_003013chr4----2680 160 --
NM_003016chr1731768 1405 272 ----11948
NM_003017chr621028 105 ------
NM_003022chrX----11308 --
NM_003026chr92549 379 ------
NM_003028chr953716 2985 2898 2877 898 ------
NM_003034chr12107920 7551 6893 6689 6528 5734 5023 3208 2881 668 12683 25372 2213 --
NM_003035chr11309 1645 ----
NM_003036chr14976 914 898 763 ------
NM_003042chr332186 668 451 ------
NM_003045chr1344609 3056 1597 1481 1524 ----
NM_003048chr222785 408 12705 11097 --
NM_003051chr141943 1255 752 638 11446 ----
NM_003060chr51903 --11031 --
NM_003068chr8280 37 1792 ----
NM_003071chr351585 1548 660 632 301 ------
NM_003072chr191291 ------
NM_003074chr321815 1707 ------
NM_003075chr121334 ------
NM_003076chr122528 422 --11521 --
NM_003081chr201281 ------
NM_003105chr11184 ------
NM_003106chr31689 ------
NM_003108chr2107109 6990 6609 5720 4434 2652 2068 2059 1652 1031 14542 ----
NM_003110chr1731075 1061 310 ----1791
NM_003111chr22559 209 11054 ----
NM_003112chr722744 37 --22225 367 --
NM_003113chr2------142
NM_003115chr1----2326 186 --
NM_003128chr232640 2234 905 --1142 1803
NM_003133chr11981 133 21027 83 --
NM_003136chr142336 330 ----1298
NM_003137chr63836 821 605 --164 --
NM_003149chr331390 1231 509 11170 ----
NM_003150chr1752304 1487 932 453 162 --1628 --
NM_003155chr842623 2548 1976 188 ------
NM_003161chr1742774 2322 2223 802 --23344 1423 --
NM_003162chr221101 718 ------
NM_003165chr931862 222 144 --11910 --
NM_003174chr104742 586 563 279 2623 254 ----
NM_003185chr201338 --11078 --
NM_003188chr62562 137 --1234 --
NM_003189chr163261 3123 2590 1072 1028 224 --23212 2237 --
NM_003194chr61562 ------
NM_003199chr18114885 4292 1796 1464 1453 1424 983 732 436 327 161 --25704 5384 --
NM_003204chr1741654 1182 612 164 ------
NM_003217chr1231650 714 121 ------
NM_003221chr663689 3421 1668 1500 1479 1131 21615 1326 ----
NM_003222chr203917 232 185 ------
NM_003223chr162860 564 --1301 --
NM_003234chr342288 1600 868 179 12230 ----
NM_003242chr35642 573 466 273 181 1918 3608 473 224 12430
NM_003246chr1531675 460 193 1617 1363 --
NM_003247chr621669 1606 11976 --11321
NM_003253chr2131665 1390 301 11736 11240 --
NM_003255chr1742532 1966 375 224 --12001 1330
NM_003257chr153918 334 123 11188 ----
NM_003262chr361993 1754 271 172 94 86 14820 23974 664 13338
NM_003269chr631206 1175 149 --11228 1447
NM_003270chrX21093 389 1771 ----
NM_003272chr14650 244 182 81 ------
NM_003274chr2122989 46 11980 ----
NM_003275chr931401 1300 1102 1346 ----
NM_003281chr164006 3993 3607 1838 1599 783 ------
NM_003286chr201807 ------
NM_003288chr2051580 1452 1410 1056 376 ------
NM_003290chr191960 ----1248
NM_003291chr133335 113 76 ------
NM_003292chr121751 662 ------
NM_003295chr13--1203 ----
NM_003298chr396173 5647 5151 4869 4646 4008 3974 1301 952 26048 1454 41845 1344 971 420 1432
NM_003304chr341479 1373 1104 1023 --11213 1450
NM_003305chr41175 ------
NM_003314chr51174 --1439 --
NM_003337chr531484 303 171 --11366 1367
NM_003338chr10278 34 11934 --21584 195
NM_003339chr551174 1111 994 531 188 --11087 --
NM_003340chr421268 410 ----11378
NM_003341chr31667 ------
NM_003342chr1742951 1307 209 62 ------
NM_003344chr71126 ------
NM_003348chr1221198 294 171 ----
NM_003350chr83862 247 220 ------
NM_003352chr23914 693 271 ------
NM_003359chr4147 --1906 --
NM_003367chr191152 ------
NM_003368chr1--1269 ----
NM_003369chr11--166 1380 1943
NM_003372chrX2939 854 ------
NM_003373chr1021981 653 11396 ----
NM_003376chr61216 11233 21895 182 --
NM_003376chr61216 11233 21895 182 --
NM_003383chr91146 --1391 --
NM_003385chr21373 ------
NM_003390chr1121092 334 ------
NM_003392chr374349 3574 2784 1534 1354 969 547 11369 13257 --
NM_003400chr21233 ------
NM_003404chr2021795 476 ------
NM_003406chr841536 1358 1305 415 --21818 272 1433
NM_003407chr191685 ------
NM_003409chr1811100 --1442 --
NM_003410chrX33060 2986 785 --11011 --
NM_003412chr333113 2786 2606 22809 2372 1692 --
NM_003413chrX51604 1370 734 463 207 --1216 --
NM_003418chr31713 1169 ----
NM_003420chr32669 30 --1159 --
NM_003431chr11170 ----188
NM_003439chr783453 1428 1112 938 920 766 745 309 11325 33577 2276 784 23224 2589
NM_003442chr112844 769 ------
NM_003453chr13139 ------
NM_003455chr1121149 562 ------
NM_003457chr17----1442 --
NM_003458chr383989 3599 2899 2507 2490 1284 1254 366 --13118 --
NM_003463chr611340 22865 1276 12120 --
NM_003468chr253125 1752 1584 748 284 ------
NM_003469chr22411 390 ------
NM_003471chr321589 311 --11842 --
NM_003474chr1072200 2173 1631 866 800 246 187 --1771 --
NM_003478chr1132944 455 365 ------
NM_003482chr1211804 ------
NM_003483chr1222846 2160 --1754 1851
NM_003488chr172969 57 ------
NM_003489chr2153013 2611 2264 354 332 --1973 --
NM_003496chr71820 ------
NM_003498chr1652553 2350 2145 2107 212 --1255 --
NM_003505chr72522 443 11715 ----
NM_003506chr811218 1102 21189 484 --
NM_003507chr211555 --1633 --
NM_003559chr1743716 3157 1016 545 ------
NM_003563chr172298 154 ----1579
NM_003566chr1212872 161 --13407
NM_003574chr1865075 3839 3562 2261 1467 1067 35443 3546 1221 14037 --
NM_003576chr1322055 851 --22790 2219 --
NM_003580chr8149 ------
NM_003581chr22947 376 ------
NM_003583chr1293524 3407 3360 3184 2983 2853 2377 1233 603 33272 838 313 --32453 1573 130
NM_003589chr131389 1220 11078 1450
NM_003590chr253587 3456 2737 2660 1384 23837 563 1392 --
NM_003592chr7----2343 325 --
NM_003597chr222152 269 --1772 11443
NM_003603chr43678 525 438 ----11682
NM_003607chr183929 3891 3822 3773 3057 2649 1408 559 1245 ----
NM_003613chr151268 --194 --
NM_003615chr332647 2484 1199 13012 ----
NM_003617chr163511 3184 1891 1613 1081 61 ----24879 4633
NM_003618chr22879 301 ------
NM_003620chr171155 --11103 --
NM_003622chr1241758 1061 972 431 1266 ----
NM_003626chr1111386 1387 21395 51 --
NM_003628chr21625 ------
NM_003629chr13846 704 36 ------
NM_003633chr522515 2190 --31865 1770 352 --
NM_003659chr2----11199 --
NM_003663chr333201 2781 812 ------
NM_003670chr32568 421 --11084 --
NM_003671chr953284 3025 2841 1189 456 ------
NM_003672chr121381 133 ------
NM_003677chr1221445 293 --1796 --
NM_003679chr173062 2972 2586 2453 408 354 177 ------
NM_003692chr91116 ------
NM_003702chr83805 603 519 1246 ----
NM_003704chr41568 ------
NM_003705chr2--1278 1715 --
NM_003713chr131544 1088 389 ------
NM_003714chr512578 22040 216 12481 --
NM_003716chr31902 ------
NM_003722chr352671 2236 2178 2030 58 22014 430 ----
NM_003725chr122418 142 ------
NM_003728chr42694 105 ------
NM_003735chr51627 --11678 --
NM_003736chr51627 --11678 --
NM_003737chr111162 ------
NM_003743chr211921 --1120 --
NM_003744chr143183 146 95 ------
NM_003745chr16129 ------
NM_003749chr132860 70 ------
NM_003750chr10----2758 675 --
NM_003758chr151539 ------
NM_003758chr151539 ------
NM_003759chr444023 1618 689 266 --13409 14284
NM_003760chr13780 688 210 ------
NM_003762chr11947 ------
NM_003763chr2042488 2379 722 316 --23115 2509 --
NM_003764chr62686 668 ------
NM_003768chr131433 1183 364 ------
NM_003772chr11----1332 --
NM_003774chr1262992 781 768 660 575 124 22288 1076 --12494
NM_003783chr111209 ------
NM_003786chr171473 ------
NM_003787chr1811449 --21237 193 --
NM_003799chr1863340 3126 3014 2868 1557 561 1975 43985 907 431 390 --
NM_003822chr142533 2247 2032 88 12879 ----
NM_003825chr151310 ------
NM_003829chr91203 --11204 --
NM_003831chr181172 ----11735
NM_003850chr13--1153 ----
NM_003858chr141586 ------
NM_003861chr1432607 835 406 1347 --32098 684 629
NM_003870chr1541972 1852 1659 310 --1603 11396
NM_003872chr252396 2102 2095 1159 960 ----1612
NM_003873chr1062039 726 544 530 466 442 ------
NM_003884chr3----21704 125 --
NM_003885chr172165 41 --12207 --
NM_003887chr282043 1879 1576 1436 700 546 540 22 21672 210 ----
NM_003895chr214859 845 499 29 11496 11526 1256
NM_003899chr133742 695 611 --12329 --
NM_003901chr1022660 1982 12044 --11801
NM_003902chr11295 ------
NM_003909chr862347 2083 1091 595 144 82 12451 --22310 99
NM_003913chr654305 3638 1294 730 518 ------
NM_003916chrX41435 1208 964 35 --1413 11104
NM_003919chr7--1183 1191 --
NM_003921chr141493 410 346 203 --21587 246 --
NM_003922chr151283 ------
NM_003924chr421137 322 ------
NM_003927chr1831094 862 133 ----1302
NM_003932chr2241826 1762 1536 457 --3765 566 165 1691
NM_003934chr921102 507 ------
NM_003941chr742276 927 889 404 12348 1914 --
NM_003947chr331310 1272 301 ------
NM_003948chr432568 129 40 ------
NM_003953chr132748 2627 261 ----1421
NM_003958chr653067 2674 757 235 22 --12873 11409
NM_003966chr5127839 7666 7644 7196 6677 5709 4800 2271 1081 384 289 116 17794 11282 26717 1370
NM_003968chr3----1189 --
NM_003971chr17----1120 --
NM_003972chr1021356 980 --1345 11298
NM_003980chr611100 ------
NM_003983chr1634012 3168 1280 --1785 --
NM_003987chr1011465 ------
NM_003988chr1011542 ------
NM_003989chr1011401 ------
NM_003990chr1011401 ------
NM_003994chr1284317 3906 3823 3196 3012 1132 690 198 --24011 2820 --
NM_003996chr62223 42 ------
NM_003998chr41594 ------
NM_004004chr1331319 323 293 --21331 91 --
NM_004006chrX52651 2597 2375 2129 358 ------
NM_004007chrX52651 2597 2375 2129 358 ------
NM_004009chrX52651 2597 2375 2129 358 ------
NM_004010chrX52651 2597 2375 2129 358 ------
NM_004011chrX52651 2597 2375 2129 358 ------
NM_004012chrX52651 2597 2375 2129 358 ------
NM_004013chrX52651 2597 2375 2129 358 ------
NM_004014chrX52651 2597 2375 2129 358 ------
NM_004015chrX52651 2597 2375 2129 358 ------
NM_004016chrX52565 2511 2289 2043 272 ------
NM_004017chrX52651 2597 2375 2129 358 ------
NM_004018chrX52565 2511 2289 2043 272 ------
NM_004020chrX52651 2597 2375 2129 358 ------
NM_004021chrX52565 2511 2289 2043 272 ------
NM_004022chrX52565 2511 2289 2043 272 ------
NM_004023chrX52565 2511 2289 2043 272 ------
NM_004024chr131332 1313 90 --1238 --
NM_004028chr1844087 3577 3417 522 ------
NM_004034chr101425 ------
NM_004039chr154307 292 153 121 ------
NM_004040chr221238 920 ------
NM_004050chr1422066 777 ------
NM_004061chr51238 ------
NM_004067chr721470 352 ------
NM_004074chr11173 ------
NM_004080chr71391 --11316 --
NM_004087chr321615 88 ------
NM_004093chr133907 412 177 --22112 830 11170
NM_004094chr1433001 2428 805 11909 52995 2925 460 208 46 --
NM_004097chr21301 ------
NM_004098chr1021127 505 ------
NM_004100chr611998 --1674 12132
NM_004105chr22918 64 2160 30 ----
NM_004114chrX1309 --1217 --
NM_004117chr652207 1437 879 498 370 --1867 --
NM_004124chr1411389 12880 12719 --
NM_004133chr822104 26 --175 --
NM_004136chr1532830 1114 964 ------
NM_004156chr8------1173
NM_004161chr221332 1109 1605 ----
NM_004162chr3------172
NM_004170chr931773 1395 758 11439 ----
NM_004172chr522018 1742 ------
NM_004200chr112897 221 ------
NM_004202chrY2670 44 ------
NM_004208chrX----169 --
NM_004219chr5148 ------
NM_004226chr21108 ------
NM_004229chrX32037 1871 149 --12082 --
NM_004232chr1822847 28 --22880 861 --
NM_004235chr91104 --1636 --
NM_004236chr151459 1168 ----
NM_004241chr101217 ------
NM_004247chr17156 ------
NM_004249chr41106 ------
NM_004267chr31169 ------
NM_004272chr521259 812 ------
NM_004274chr1412775 --2615 418 --
NM_004277chr631223 687 574 --3363 243 140 --
NM_004279chr732154 581 476 --1329 --
NM_004281chr10168 ------
NM_004293chr973701 2972 2786 2352 1085 781 592 1577 ----
NM_004296chr1442861 2459 725 548 --1438 --
NM_004302chr1242797 1889 472 331 21797 648 ----
NM_004323chr922605 829 --1972 12503
NM_004329chr102913 154 --1888 --
NM_004330chr152969 283 176 --11150
NM_004331chr81175 --32634 1706 1032 --
NM_004338chr1875763 4904 4518 4469 1647 1367 402 25952 941 1868 16732
NM_004342chr741941 1864 415 196 ------
NM_004346chr441421 1147 493 113 ------
NM_004349chr82862 475 --1128 --
NM_004354chr42823 226 1739 1212 --
NM_004358chr2021139 440 ------
NM_004360chr1612008 ------
NM_004370chr622196 222 ------
NM_004378chr151207 ------
NM_004381chr61429 ----1135
NM_004384chr552247 2123 1604 1563 698 11544 --1725
NM_004385chr5----1223 --
NM_004386chr1932288 715 592 ------
NM_004392chr1321766 653 ------
NM_004393chr342248 2126 1812 1607 ------
NM_004397chr1173696 3383 2777 1486 902 615 390 --11158 --
NM_004405chr21230 ------
NM_004411chr72713 532 --1201 --
NM_004414chr2121452 293 ------
NM_004415chr62642 546 ------
NM_004416chr123804 319 222 ------
NM_004417chr53658 503 458 ------
NM_004419chr102800 238 ------
NM_004426chr1241974 1645 1349 783 --11839 1322
NM_004427chr13843 767 246 ------
NM_004430chr811984 --22654 807 12468
NM_004432chr922413 447 12070 12047 12278
NM_004433chr141602 1452 1270 468 --11237 --
NM_004434chr1421596 1253 ------
NM_004436chr11571 ------
NM_004438chr243308 2975 75 56 --1235 --
NM_004439chr4256 43 ------
NM_004440chr641429 780 239 51 ------
NM_004449chr2131402 1396 1083 11202 ----
NM_004454chr331788 1698 1623 ------
NM_004456chr7163 ------
NM_004457chr231140 531 235 ------
NM_004458chrX42569 2200 1040 899 ------
NM_004464chr433985 3416 583 31517 1496 1279 ----
NM_004480chr141680 ------
NM_004481chr122594 559 ------
NM_004482chr22150 123 --1707 1649
NM_004485chr164372 2842 1228 1133 815 485 --1407 --
NM_004487chr31914 ------
NM_004491chr1984306 3905 2663 1521 1234 1130 1089 57 ------
NM_004498chr151393 ------
NM_004499chr51423 ------
NM_004500chr1431514 1320 53 ------
NM_004501chr154132 3254 2856 735 212 --24142 3380 --
NM_004503chr121580 ------
NM_004504chr222587 282 --12995 22256 814
NM_004506chr62742 78 ------
NM_004514chr1752450 1131 466 116 73 1796 ----
NM_004516chr192367 334 ------
NM_004520chr5----2753 218 --
NM_004525chr2----189 1476
NM_004527chr1721241 147 ------
NM_004529chr9----21390 471 --
NM_004540chr212590 279 ------
NM_004566chr101813 --1946 --
NM_004569chr14126 --1642 --
NM_004571chr2173233 3095 2561 2541 873 312 103 13304 ----
NM_004575chr421142 1035 1528 ----
NM_004583chr172570 559 179 ----
NM_004586chrX95040 4748 4448 3746 3571 1191 874 423 317 25030 3604 21516 841 1395
NM_004588chr1163901 3871 3862 2919 559 419 --11163 --
NM_004593chr31172 ------
NM_004596chr191138 ------
NM_004598chr573322 3144 2509 2470 2276 479 64 ------
NM_004600chr12624 507 ------
NM_004612chr944039 3930 974 930 --1993 --
NM_004614chr1622235 677 --1648 12460
NM_004615chrX1311 ------
NM_004622chr231640 496 109 --11759 --
NM_004627chr21----1667 1695
NM_004631chr121158 399 ------
NM_004634chr32419 258 ------
NM_004637chr311039 --11281 --
NM_004642chr122237 192 --1492 --
NM_004660chrY52306 1827 1423 637 563 1267 ----
NM_004663chr151598 11135 --11265
NM_004684chr42352 325 ------
NM_004685chr1342948 1098 390 181 ------
NM_004687chr1751835 1594 615 531 510 21525 1287 21768 1496 --
NM_004690chr61701 3661 602 258 --1267
NM_004694chr172233 144 1762 ----
NM_004703chr172274 31 --1719 --
NM_004709chrX31720 1140 1124 --11705 1313
NM_004717chr72966 338 21491 1322 ----
NM_004719chr1242331 2272 2134 1903 1375 1805 --
NM_004726chrX95592 5311 3989 3833 2207 2132 1347 320 151 11487 2395 250 --
NM_004730chr551437 1417 574 445 131 --1672 --
NM_004731chr1221340 748 --31529 1422 1248 --
NM_004733chr31620 ------
NM_004734chr1322179 208 --1424 --
NM_004736chr142244 2154 489 479 --21740 1502 --
NM_004742chr3--11602 ----
NM_004744chr451312 1253 1182 638 79 --21262 577 11001
NM_004745chr855463 2071 1963 1572 1212 11508 11547 --
NM_004748chr1543460 3434 1348 526 --123 14209
NM_004755chr1431180 753 166 11219 21138 810 --
NM_004756chr19----21424 1067 --
NM_004762chr1711619 --11272 --
NM_004768chr11906 ------
NM_004770chr82192 164 ------
NM_004772chr521347 1108 11477 ----
NM_004774chr1732319 2313 438 --11066 12916
NM_004775chr1822156 1997 --1918 --
NM_004779chr511220 166 ----
NM_004781chr121358 498 11736 ----
NM_004781chr121358 498 11736 ----
NM_004787chr41155 ------
NM_004796chr1422413 280 ------
NM_004798chr203970 525 179 --22975 37 --
NM_004799chr1170 ------
NM_004800chr131263 --1192 --
NM_004801chr22530 322 --21101 415 --
NM_004808chr1073209 2939 2783 2344 685 631 388 --1749 --
NM_004817chr92597 300 ------
NM_004822chr1763726 3639 2553 1107 984 300 --1610 --
NM_004824chr63313 267 171 ------
NM_004831chr191434 ------
NM_004834chr242608 913 843 801 ------
NM_004836chr22792 609 ------
NM_004840chrX31960 193 185 --1863 1495
NM_004841chr11336 --11146 --
NM_004842chr621773 364 --11347 --
NM_004846chr2----1119 --
NM_004850chr231170 583 489 11275 11543 --
NM_004856chr152610 462 ------
NM_004857chr1484750 4712 3858 3470 1833 625 539 69 14102 33498 1431 668 1311
NM_004859chr1712322 22288 409 11198 --
NM_004866chr553277 2000 1553 1057 508 2323 305 24131 3465 11153
NM_004867chrX--1104 ----
NM_004871chr1734376 4290 2944 24348 3211 14024 --
NM_004879chr11----1260 --
NM_004887chr521110 911 --1164 --
NM_004893chr52217 188 ------
NM_004896chr1041315 1224 570 272 ----1150
NM_004898chr452812 2451 2265 1073 328 12074 --12891
NM_004902chr201622 ------
NM_004904chr796602 6558 6225 5576 4682 1279 1251 689 70 --16322 26414 2601
NM_004905chr12214 148 1783 ----
NM_004906chr61556 ------
NM_004912chr721511 1119 1450 1123 --
NM_004915chr21----2669 574 --
NM_004921chr172378 2238 1901 968 363 215 147 --22248 424 166
NM_004929chr821511 1030 ------
NM_004936chr962668 2343 1049 936 556 375 11204 1403 --
NM_004937chr1732611 962 393 --22540 1698 --
NM_004938chr911002 ------
NM_004946chr51422 ------
NM_004947chr342318 1945 989 637 ------
NM_004950chr12121 ------
NM_004956chr783426 1517 1411 715 562 437 175 35 11046 34236 1753 1194 --
NM_004958chr1149 --1339 --
NM_004965chr211620 ------
NM_004973chr631660 1596 151 1178 169 --
NM_004976chr1164559 3377 1722 1435 1181 810 11234 13814 --
NM_004978chr121479 1318 ------
NM_004979chrX21131 226 ----1757
NM_004982chr122485 58 --1146 --
NM_004985chr1254229 4198 3248 1180 89 --178 --
NM_004992chrX138402 8202 8122 7257 6327 6196 5819 3306 2670 1534 1121 247 175 --22933 2288 --
NM_004992chrX138402 8202 8122 7257 6327 6196 5819 3306 2670 1534 1121 247 175 --22933 2288 --
NM_004995chr143960 429 315 ------
NM_004999chr653542 3419 1775 470 441 147 33864 3650 2906 --
NM_005010chr73854 748 740 --155 --
NM_005011chr71161 ------
NM_005023chr531447 1234 365 ------
NM_005028chr1041472 648 268 91 --12218 --
NM_005032chrX--11103 ----
NM_005036chr2257058 5871 3004 1814 52 --52725 1974 625 421 176 --
NM_005045chr7--1344 ----
NM_005054chr221339 350 1146 ----
NM_005056chr1264377 4137 3767 3709 3651 1606 1724 --13910
NM_005063chr1011021 --13513 13226
NM_005065chr1454669 4592 941 125 66 --21830 912 --
NM_005066chr12761 75 ------
NM_005069chr2111693 --11218 --
NM_005078chr1511561 ------
NM_005079chr832097 930 522 12746 ----
NM_005080chr221627 ------
NM_005087chr32346 106 ------
NM_005088chrX3889 206 200 ------
NM_005095chr111566 11520 ----
NM_005097chr102291 135 ------
NM_005102chr23698 185 50 1882 1851 --
NM_005110chr51831 --1719 --
NM_005113chr141504 ------
NM_005116chr2054154 3827 2798 1739 459 24178 772 22933 1028 --
NM_005119chr111038 11132 ----
NM_005121chr1733076 1405 1137 12834 1803 --
NM_005124chr62687 70 ------
NM_005126chr342174 1901 1737 617 1226 12259 --
NM_005128chr212506 41 --1168 --
NM_005133chr11----1396 --
NM_005134chr18----1306 --
NM_005135chr1543622 2423 1013 360 --21392 1246 --
NM_005151chr1822111 1709 ------
NM_005154chr152268 136 ------
NM_005156chr975369 4874 4866 4726 4435 4271 368 --34719 3781 1135 --
NM_005157chr941903 1660 1556 518 ------
NM_005160chr22105576 5221 5145 5060 4512 4438 817 538 458 363 --22694 1424 --
NM_005163chr142656 98 --1774 --
NM_005168chr271680 1573 1353 1171 653 450 326 --21481 1232 21266 466
NM_005171chr121360 ------
NM_005178chr19----1389 --
NM_005180chr1031132 317 297 ------
NM_005181chr8----1250 --
NM_005188chr11117716 7400 7224 7206 6987 2429 2217 2085 829 767 214 ----13024
NM_005190chr61721 ------
NM_005194chr203559 116 108 ------
NM_005197chr1476085 5294 5210 4631 3754 2279 1690 ------
NM_005204chr102291 35 --1799 --
NM_005206chr171244 --11219 --
NM_005215chr182237 165 ------
NM_005219chr541821 1537 1424 530 11692 ----
NM_005230chr121118 1399 1155 --
NM_005233chr322063 561 ------
NM_005235chr277411 7248 6785 6620 6527 5501 1606 11088 --12575
NM_005238chr1152997 2938 2202 988 925 --11347 --
NM_005241chr321311 353 --1550 --
NM_005242chr5----21266 599 --
NM_005243chr221126 ------
NM_005248chr11219 --1540 --
NM_005249chr14--1742 ----
NM_005252chr141753 ------
NM_005256chr113610 379 150 --1792 --
NM_005257chr182328 204 --21426 994 --
NM_005259chr211044 31422 949 174 ----
NM_005261chr8----1855 --
NM_005277chr431952 1433 634 11962 --1162
NM_005295chr71207 ------
NM_005296chrX2885 268 ------
NM_005302chr72426 417 ------
NM_005308chr101453 ------
NM_005311chr731786 915 659 12582 ----
NM_005316chr112859 154 ------
NM_005318chr2211196 1223 --11114
NM_005324chr1751995 1975 644 178 101 3677 514 108 ----
NM_005328chr81242 ------
NM_005329chr1662230 1912 1850 1612 633 294 12359 --11985
NM_005334chrX4703 237 99 92 ------
NM_005336chr242017 1410 291 236 ------
NM_005339chr432660 1028 458 --1504 --
NM_005342chrX72105 1797 1763 591 324 281 254 2764 306 ----
NM_005358chr1361770 1722 708 411 151 24 1733 --11322
NM_005359chr1834520 1362 1038 --14359 --
NM_005370chr19--11293 ----
NM_005375chr651123 984 898 846 436 21151 146 ----
NM_005382chr8--1371 1459 --
NM_005384chr9--129 ----
NM_005386chr201567 --1123 --
NM_005387chr111711 ------
NM_005388chr921502 397 ----11642
NM_005398chr1011354 ------
NM_005400chr221047 879 11030 ----
NM_005402chr7159 11680 ----
NM_005406chr1811359 ------
NM_005407chr1411216 --1999 --
NM_005414chr32303 209 ------
NM_005433chr1831828 1111 964 1466 1851 --
NM_005436chr1093922 3532 2828 2721 2519 1239 1049 874 459 --13255 --
NM_005443chr4175 ------
NM_005455chr1----2374 282 --
NM_005458chr982341 1893 988 895 754 602 343 140 ------
NM_005461chr2021699 1310 ------
NM_005465chr111997 --1567 --
NM_005474chr172582 320 ------
NM_005476chr91874 --1432 --
NM_005477chr1582449 2205 2142 1035 986 974 594 214 --1507 --
NM_005477chr1582449 2205 2142 1035 986 974 594 214 --1507 --
NM_005487chr2221852 1506 12124 11415 --
NM_005493chr61805 ------
NM_005494chr71240 ------
NM_005497chr1775881 5766 5057 4467 4187 1238 316 25623 3890 45160 4258 3729 1405 --
NM_005499chr192485 135 ------
NM_005502chr932287 2097 1037 --13084 --
NM_005504chr1285955 5882 5382 2578 1120 600 296 71 26071 1776 12269 --
NM_005509chr511650 --11363 11823
NM_005517chr141186 1064 1050 30 ------
NM_005523chr7------11594
NM_005537chr131703 --1212 --
NM_005544chr21357 ------
NM_005545chr151245 --1718 --
NM_005546chr552327 717 313 304 74 ------
NM_005561chr131793 --1686 1142
NM_005569chr2221533 44 11465 ----
NM_005570chr18121 --11074 --
NM_005573chr51555 ------
NM_005574chr112545 82 ------
NM_005587chr153705 271 25 1191 ----
NM_005591chr1132421 2091 149 12229 --12303
NM_005593chr12----1551 --
NM_005595chr13372 241 100 1658 ----
NM_005596chr956270 6044 4928 4425 581 11577 25297 4319 21081 257
NM_005598chr121288 1155 ------
NM_005600chr11272 ------
NM_005602chr321294 139 ------
NM_005604chr631825 895 324 ------
NM_005605chr8--1113 ----
NM_005607chr8------1102
NM_005611chr16------11341
NM_005627chr61659 ------
NM_005637chr1842043 1791 654 60 ------
NM_005638chrX11194 11247 ----
NM_005639chr1271887 1684 1508 1206 481 126 26 --11673 --
NM_005644chr12373 292 ------
NM_005647chrX43313 3102 1352 902 --12725 --
NM_005649chr5----1396 --
NM_005655chr831313 811 374 ------
NM_005665chr133704 1606 1211 ------
NM_005668chr544460 3266 1755 30 11544 11325 --
NM_005686chr14607 452 136 95 ------
NM_005688chr33948 377 39 --1474 --
NM_005692chr7172 ------
NM_005708chr132469 32 ------
NM_005715chr682525 2465 2347 2323 1853 1054 876 716 --11947 --
NM_005716chr191497 ------
NM_005719chr121201 1215 145 --
NM_005720chr71238 ------
NM_005721chr211080 ------
NM_005722chr242408 928 472 453 22106 265 1666 11958
NM_005734chr11------1615
NM_005737chr22672 463 1905 12289 --
NM_005738chr731906 1622 1402 --1785 --
NM_005739chr1522003 166 --1109 --
NM_005742chr2--1766 2830 126 --
NM_005746chr721845 672 32357 975 179 12239 --
NM_005748chr1232580 1159 494 --22708 796 22635 1228
NM_005751chr73482 344 179 ------
NM_005759chr224604 1677 --21806 568 23947 1695
NM_005766chr1341389 893 401 185 ------
NM_005776chr141271 1684 ----
NM_005779chr553589 3337 2602 1193 927 --11395 --
NM_005786chr182468 414 ------
NM_005788chr111639 1716 ----
NM_005789chr1741649 1454 1432 330 ------
NM_005808chr353493 3293 2946 2852 216 --13081 --
NM_005819chr143449 1369 939 171 --1483 --
NM_005822chr662288 2227 1812 1600 1579 1567 --12254 1493
NM_005826chr1----1105 --
NM_005832chr32987 491 --1249 --
NM_005839chr11285 ------
NM_005840chrX77529 7300 5809 5310 5132 2368 1879 --36961 5684 3068 16493
NM_005859chr531102 1063 978 --11425 --
NM_005862chr32810 784 11027 ----
NM_005868chr762470 2072 2044 1682 290 107 --11904 --
NM_005870chr1321051 221 ----1567
NM_005871chr103944 316 157 ----1260
NM_005882chr42818 179 --1243 --
NM_005885chr521069 133 ------
NM_005888chr121124 ------
NM_005895chr1253451 3335 3223 2680 1419 ------
NM_005898chr1163026 2392 685 577 498 469 21257 742 11250 --
NM_005900chr43383 351 50 --11166 --
NM_005901chr1888699 8037 6789 6600 2268 2025 1588 60 --37738 6255 118 16091
NM_005902chr1564549 4304 2834 1483 1353 852 --11134 --
NM_005903chr574164 3609 3406 3291 853 740 417 --44081 3687 2004 1331 11667
NM_005904chr1831371 1190 1170 ------
NM_005906chr651402 647 176 126 29 ------
NM_005908chr41125 --146 --
NM_005909chr554041 3912 3149 520 309 1982 34078 3774 821 --
NM_005911chr221220 922 --1388 --
NM_005920chr123103 2650 ------
NM_005923chr61103 --1274 --
NM_005924chr71125 1780 ----
NM_005933chr1162565 2395 2327 2191 860 387 ------
NM_005935chr454556 4320 4179 2006 666 13682 ----
NM_005937chr1733242 2619 983 --24154 366 --
NM_005941chr833912 3060 1397 21514 760 11561 --
NM_005955chr145469 4646 1582 927 --25352 3585 13718
NM_005962chr1021705 685 --22206 889 --
NM_005962chr1021705 685 --22206 889 --
NM_005963chr17--174 ----
NM_005964chr1721147 478 ------
NM_005966chr252397 1834 928 609 287 --11601 --
NM_005977chr13155 --1280 1374
NM_005986chr131439 --1608 1473
NM_005999chr11123 --1577 31227 1199 1155
NM_006003chr192201 82 ------
NM_006011chr1544283 4205 3711 207 14168 14142 --
NM_006016chr631972 1474 467 11544 ----
NM_006033chr182793 125 11613 12074 --
NM_006036chr242445 2032 1809 402 1910 11827 --
NM_006037chr274284 3883 3478 3148 2960 1572 1427 11224 23955 3174 --
NM_006038chr2041910 221 105 71 --11343 --
NM_006040chr1631062 930 466 --11290 --
NM_006043chr161693 ------
NM_006047chr2022631 139 ------
NM_006060chr764281 3475 1699 1455 1411 576 --11596 11669
NM_006067chr161800 ------
NM_006070chr3164 --1112 --
NM_006076chr742475 991 331 86 --1590 --
NM_006080chr782922 2759 2214 1908 1097 1037 939 479 ------
NM_006084chr14----1310 --
NM_006088chr9----1143 --
NM_006089chrX11732 ----1234
NM_006094chr832413 952 691 --11967 --
NM_006095chr473573 3092 3050 2838 678 450 167 --1499 11301
NM_006106chr1142903 2733 2557 701 23400 1041 11029 1389
NM_006108chr1132350 1484 548 ------
NM_006113chr141900 1390 1362 104 --1774 --
NM_006135chr121370 410 --1401 --
NM_006136chr711369 --1513 --
NM_006141chr1632515 2498 2227 --21980 568 --
NM_006145chr1921150 895 ------
NM_006148chr1722667 2581 ------
NM_006154chr1542722 2264 995 430 1194 32008 893 138 --
NM_006159chr12--1580 ----
NM_006161chr51246 --1566 --
NM_006164chr23396 361 156 ------
NM_006166chr121831 12569 42068 1939 1772 499 --
NM_006180chr921663 163 ------
NM_006186chr21218 --11069 --
NM_006195chr921225 1046 --1211 --
NM_006203chr5104715 4525 4073 3730 3671 3539 3506 1757 893 150 11919 24206 3652 25497 2105
NM_006206chr462762 2383 2272 2217 445 348 --22043 542 --
NM_006212chr165271 4905 4579 4143 3822 21 14957 ----
NM_006216chr21664 ------
NM_006218chr31111 ------
NM_006224chr1752168 1563 588 580 23 ----11690
NM_006226chr221254 879 --11180 1405
NM_006237chr1351875 1862 248 115 51 ------
NM_006243chr11848 ----11065
NM_006246chr141131 ------
NM_006251chr533029 2485 914 --12059 --
NM_006252chr166042 5807 5462 2669 2558 825 15374 37477 7244 4895 --
NM_006254chr31155 ------
NM_006255chr1421135 192 ------
NM_006256chr162727 2091 1974 1088 207 188 --32477 2206 1991 21074 718
NM_006258chr10----11058 --
NM_006266chr9------143
NM_006267chr221623 218 11741 ----
NM_006282chr2034351 1842 231 1564 33388 2918 86 --
NM_006283chr8104634 4117 4055 3667 3478 3403 1921 1416 1199 35 11678 ----
NM_006284chr11--123 ----
NM_006285chr91212 ------
NM_006292chr111173 ------
NM_006298chr671268 882 619 540 259 38 28 --22724 628 12957
NM_006306chrX75779 1776 1556 1139 792 701 127 ------
NM_006310chr17----1380 --
NM_006313chr1251670 1499 1084 510 493 --1155 11477
NM_006315chr474526 4278 3696 3147 1810 1132 638 22836 66 24328 2799 12870
NM_006320chr42925 800 ------
NM_006322chr132786 191 ------
NM_006330chr81286 ------
NM_006334chr92220 97 ------
NM_006335chr13738 434 213 11035 2863 137 --
NM_006345chr431224 912 312 11051 1888 --
NM_006352chr131769 167 133 21721 1509 11477 --
NM_006353chr611302 129 ----
NM_006359chrX3908 751 533 12252 12336 --
NM_006363chr201213 ------
NM_006364chr1431167 1108 337 1489 --1466
NM_006366chr62167 141 ------
NM_006367chr12935 283 11075 ----
NM_006371chr334558 4197 1980 --13516 --
NM_006373chr17181 11009 ----
NM_006379chr73789 181 157 ----2739 489
NM_006380chr1764375 4357 4073 3398 2819 490 11687 43658 1619 693 643 --
NM_006389chr1111356 ------
NM_006390chr1231141 480 40 --1140 --
NM_006393chr1034233 3094 1584 --1182 24303 759
NM_006401chr9----1332 --
NM_006403chr63449 370 309 --11369 --
NM_006413chr102218 28 11027 ----
NM_006416chr61702 ------
NM_006420chr2032976 2199 2118 13312 11123 --
NM_006421chr811093 129 ----
NM_006424chr431793 787 179 --11557 --
NM_006434chr1042830 2366 2077 839 1829 12169 --
NM_006449chr22364 308 ----11380
NM_006457chr463835 3746 3698 3061 2700 1307 21643 195 42989 2922 1173 559 23395 3022
NM_006459chr1011560 --11860 --
NM_006460chr172448 277 ------
NM_006464chr254134 3995 3572 234 145 --13299 --
NM_006467chr51867 --2415 95 --
NM_006469chr131643 1117 208 ------
NM_006471chr18195 ------
NM_006472chr121224 515 --31198 1171 801 --
NM_006482chr1293524 3407 3360 3184 2983 2853 2377 1233 603 33272 838 313 --32453 1573 130
NM_006486chr223631 118 74 --1511 --
NM_006489chr1462015 737 531 419 282 71 ------
NM_006496chr121531 130 --11540 --
NM_006504chr101401 --32682 1008 439 --
NM_006516chr141625 1592 1100 584 --11501 --
NM_006517chrX----1115 166
NM_006520chrX--1473 ----
NM_006526chr2031949 1654 330 --2816 672 --
NM_006527chr44575 563 486 84 --1230 --
NM_006534chr2042425 1263 842 719 --11301 --
NM_006537chr153623 591 95 ------
NM_006538chr254000 3843 3579 1171 229 --24062 884 --
NM_006539chr161515 ------
NM_006540chr821336 541 1995 ----
NM_006544chr1441429 1313 578 348 --35370 1530 1070 --
NM_006546chr17106065 4141 4055 1463 1298 1093 1078 936 693 246 --11186 --
NM_006547chr741750 838 551 272 11914 11996 --
NM_006548chr311159 --11383 --
NM_006549chr1242858 2395 424 261 --12227 --
NM_006554chr2--1248 ----
NM_006557chr931655 1546 298 --11737 --
NM_006559chr11866 ------
NM_006561chr1066076 6021 2469 2382 1104 986 ----15532
NM_006565chr1611162 11170 1793 --
NM_006570chr9--1375 ----
NM_006574chr31295 ------
NM_006575chr1421224 132 11210 ----
NM_006595chr1151313 1283 536 81 71 ------
NM_006597chr112175 25 ------
NM_006599chr16118124 7453 7060 6578 6497 5818 5763 5489 1343 992 576 --26772 5377 --
NM_006601chr1211061 ------
NM_006603chrX31488 480 327 --11736 --
NM_006609chr232083 1159 70 --41896 1884 1873 270 --
NM_006614chr322690 1440 1254 2184 156 13298
NM_006621chr1--11707 11351 --
NM_006624chr1022088 250 ------
NM_006625chr11205 --1171 --
NM_006625chr11205 --1171 --
NM_006625chr11205 --1171 --
NM_006626chr932217 1959 446 --32335 2132 74 --
NM_006628chr1544055 3607 3253 266 --24504 3912 --
NM_006636chr24640 330 186 31 ------
NM_006648chr9----1117 --
NM_006654chr1264713 4059 1206 971 819 219 --34040 3187 1220 14482
NM_006662chr161264 ------
NM_006664chr9132 ------
NM_006667chrX----1109 --
NM_006682chr731826 921 168 --52252 792 361 141 63 11144
NM_006690chr2022259 388 --22310 1764 --
NM_006698chr2031222 167 72 1504 ----
NM_006699chr122529 416 12569 12342 --
NM_006700chr122805 583 --154 --
NM_006706chr5----2332 127 --
NM_006710chr22921 109 ------
NM_006717chr922415 2095 13312 22857 177 --
NM_006718chr63923 750 347 --153 --
NM_006722chr333002 2126 800 11088 13075 --
NM_006727chr5----187 --
NM_006729chrX84288 4119 3747 2070 532 146 105 54 --2657 635 --
NM_006734chr621167 219 1632 21441 279 --
NM_006738chr1574193 4015 3888 2949 1716 733 561 ------
NM_006745chr431091 916 909 ------
NM_006746chrX11386 ------
NM_006749chr831269 941 301 --11059 --
NM_006750chr16108027 7574 6946 2613 2572 2372 1549 469 353 198 --26690 5768 --
NM_006751chr2181 ----1901
NM_006754chr72944 72 ------
NM_006759chr2185 ------
NM_006761chr171271 ------
NM_006765chr8--128 --1238
NM_006766chr842528 1687 966 761 1493 12669 --
NM_006769chr1--1159 ----
NM_006775chr643057 3015 279 121 --22912 991 --
NM_006777chrX32844 2793 2685 --2494 371 --
NM_006783chr132281 227 ------
NM_006788chr1852032 1750 1719 1599 393 ------
NM_006791chr151491 ------
NM_006800chrX2562 505 ------
NM_006805chr511459 1633 ----
NM_006806chr211172 ------
NM_006807chr172382 241 ------
NM_006811chr20--1404 ----
NM_006814chr2022235 344 --1892 --
NM_006815chr122935 527 --1359 --
NM_006822chr171233 ------
NM_006823chr851170 522 454 442 68 ------
NM_006826chr221204 200 --2837 514 --
NM_006827chr1412543 --1295 --
NM_006832chr1421073 710 ------
NM_006838chr1211351 ------
NM_006839chr21118 ------
NM_006852chr172758 534 12184 ----
NM_006870chr201564 ----1336
NM_006874chr43862 394 44 ------
NM_006885chr1663724 3272 3172 1446 724 447 11310 ----
NM_006888chr1473514 3404 2970 2927 1101 988 555 --23094 2685 --
NM_006892chr2011155 ------
NM_006892chr2011155 ------
NM_006902chr143192 2214 827 90 --12930 --
NM_006906chr113629 160 32 --1993 --
NM_006908chr721482 363 ------
NM_006910chr16--1116 ----
NM_006912chr152534 2357 962 194 70 --21698 1656 --
NM_006914chr92459 331 1119 ----
NM_006915chrX32487 984 580 ------
NM_006920chr221462 362 1581 21540 1291 --
NM_006922chr232170 2013 384 ------
NM_006924chr1711066 12781 --13158
NM_006930chr53638 314 164 197 11736 --
NM_006937chr171196 ------
NM_006939chr141202 --191 --
NM_006940chr121277 --11481 --
NM_006943chr2063219 2469 1116 1080 709 496 ------
NM_006947chr41438 1235 ----
NM_006948chr211775 1309 ----
NM_006951chr103779 712 265 ------
NM_006965chr1841164 1056 482 30 11026 ----
NM_006981chr922930 1175 --1289 --
NM_006991chr32833 721 --21005 175 --
NM_006996chr121860 104 11190 ----
NM_006997chr102399 157 ------
NM_006999chr531881 607 296 ------
NM_007005chr911578 --21536 45 --
NM_007006chr1622609 2543 --22832 2731 --
NM_007010chr1711526 --11190 --
NM_007011chr15136699 6146 5907 5327 4988 2438 1950 1861 1477 1454 1429 1206 614 14324 15416 --
NM_007013chr81790 136 1951 --
NM_007019chr201172 ------
NM_007023chr21893 ------
NM_007026chr171600 ------
NM_007030chr554941 3980 182 65 25 ------
NM_007033chr131651 1638 762 1173 ----
NM_007034chr131025 870 38 1723 ----
NM_007038chr2165924 5614 5208 5190 1036 48 --26050 1296 --
NM_007039chr1431687 761 112 1537 3855 264 63 --
NM_007040chr191184 11032 ----
NM_007042chr32917 320 --22443 209 --
NM_007043chr1221641 860 --1285 --
NM_007045chr62587 116 ------
NM_007050chr2087882 7801 7000 6032 5043 2388 1342 645 --27589 1610 --
NM_007052chrX131 ------
NM_007064chr331339 1241 1163 --1642 --
NM_007073chr654041 3557 1540 1484 975 --22852 68 --
NM_007078chr1071896 1221 429 394 374 244 170 --12560 --
NM_007084chr133294 233 64 --11193 --
NM_007106chr1331124 965 640 ------
NM_007107chr332161 1877 210 --22281 912 --
NM_007114chr331139 980 235 13015 22211 1232 143
NM_007124chr63757 732 306 ------
NM_007125chrY1192 ------
NM_007137chrX65520 4306 4123 3967 3564 1859 ------
NM_007145chr1931235 967 120 1452 ----
NM_007146chr1782859 1976 911 700 555 521 505 323 --2862 135 --
NM_007157chrX42791 1894 1114 436 --32647 1971 837 --
NM_007158chr12417 359 1271 ----
NM_007166chr1121396 1262 ------
NM_007170chr11270 ------
NM_007174chr1252144 1951 880 263 243 ------
NM_007175chr822821 576 --13176 --
NM_007176chr141677 --11152 --
NM_007185chr121001 333 ------
NM_007190chr1031158 757 24 ------
NM_007191chr12--1556 ----
NM_007197chr121907 1180 ----
NM_007198chr831521 106 22 --11276 --
NM_007200chr1574193 4015 3888 2949 1716 733 561 ------
NM_007202chr172725 95 ------
NM_007203chr953759 2498 2416 1361 903 --175 12765
NM_007204chr1199 ------
NM_007212chr122289 868 12107 ----
NM_007217chr3127 ------
NM_007220chrX73158 1287 771 554 451 116 92 --1884 --
NM_007231chrX2573 286 --1884 --
NM_007236chr1552345 1943 1851 1647 108 ------
NM_007246chr41103 --183 --
NM_007249chr13139343 8058 7322 7018 3761 3694 2999 2659 2553 2321 1589 1133 546 18991 69387 7617 6931 3473 2692 1105 18243
NM_007275chr331097 960 416 --2475 371 --
NM_007276chr72449 173 ------
NM_007285chr161109 1325 ----
NM_007286chr521938 553 ------
NM_007287chr342470 1991 1175 585 ----13092
NM_007288chr342470 1991 1175 585 ----13092
NM_007289chr342470 1991 1175 585 ----13092
NM_007308chr4----1171 --
NM_007313chr941903 1660 1556 518 ------
NM_007324chr1170 ------
NM_007331chr442287 955 479 93 12613 21746 190 --
NM_007345chr1831902 1769 503 --165 --
NM_007347chr1522902 88 13161 --1898
NM_007349chr73450 377 77 ------
NM_007358chr111563 --1723 11433
NM_007359chr1731729 1245 622 11470 ----
NM_007361chr142556 514 ------
NM_007363chrX1981 ------
NM_007375chr132452 2159 1725 --22460 574 12730
NM_012069chrX12136 --11762 --
NM_012081chr553518 2963 2439 1395 167 --23480 937 --
NM_012082chr8----3657 385 362 --
NM_012089chr121506 219 ----11233
NM_012092chr231646 543 408 ------
NM_012095chr1042188 601 571 530 --43031 2179 817 106 --
NM_012096chr363258 2799 1025 681 619 582 ----1420
NM_012097chr232185 2177 1775 ------
NM_012098chr911332 1370 21473 498 --
NM_012099chr191184 ----1336
NM_012104chr1162774 1281 1275 920 359 217 --13025 --
NM_012104chr1162774 1281 1275 920 359 217 --13025 --
NM_012120chr61884 12558 12955 --
NM_012124chr111114 ------
NM_012129chr742511 1689 1560 768 ------
NM_012137chr122787 2544 ------
NM_012141chr1384055 3986 3975 3603 3372 2578 1447 618 23687 1472 1494 --
NM_012154chr8----1647 --
NM_012156chr2022816 25 --12322 --
NM_012158chr1341293 750 741 320 1358 1448 11817
NM_012161chr431104 1088 60 ------
NM_012175chr113690 665 25 ------
NM_012193chr1134562 1528 634 --34463 1812 53 --
NM_012197chr921323 659 --1516 --
NM_012199chr1104513 4503 3992 3710 3451 3234 1003 921 711 276 24383 721 11129 --
NM_012210chr931193 1022 267 ------
NM_012213chr161690 ------
NM_012214chr2126267 5942 5840 5824 5595 5535 5487 5296 2324 2148 1687 348 --45610 1293 1235 649 --
NM_012215chr1061605 1457 763 621 600 307 --11705 --
NM_012224chr411119 --2432 42 --
NM_012233chr2----1836 --
NM_012234chr372652 2338 2316 1168 910 767 693 11355 ----
NM_012238chr106694 605 518 457 178 41 ----11302
NM_012242chr101117 1224 ----
NM_012247chr101938 --1962 --
NM_012249chr213158 1652 ----
NM_012252chr735311 4606 1213 1948 --21173 1160
NM_012255chr201429 --1105 --
NM_012257chr74859 693 182 125 1837 ----
NM_012259chr631286 1085 1030 ------
NM_012262chr1125159 5038 4693 4016 3551 3198 1390 1185 931 879 458 193 35191 5089 938 31800 1372 345 11233
NM_012281chr72797 176 22002 580 ----
NM_012294chr752804 2734 1422 920 237 --137 11011
NM_012297chr442535 2324 1714 586 --22647 1988 --
NM_012300chr542277 474 400 375 1860 ----
NM_012307chr18----1253 --
NM_012308chr1132218 1751 614 1696 ----
NM_012309chr1154328 3365 3154 535 504 11156 ----
NM_012316chr164286 4126 3728 3623 3580 444 23436 2020 24960 4647 --
NM_012317chrX5825 796 760 723 182 ----1739
NM_012320chr1611388 ------
NM_012325chr201140 ------
NM_012329chr1721106 48 ------
NM_012330chr102493 484 --1412 --
NM_012333chr121162 292 11434 ----
NM_012342chr10----171 --
NM_012343chr53781 766 420 ------
NM_012345chr1331804 1501 1291 ----1617
NM_012382chr542851 1673 1594 756 1411 11433 --
NM_012384chr2032457 2258 830 --1752 --
NM_012388chr1532915 2600 2142 --1720 --
NM_012398chr1931091 603 246 ------
NM_012412chr7--1559 --1606
NM_012416chr911188 ------
NM_012419chr63637 443 100 ------
NM_012425chr1032070 875 753 12712 ----
NM_012428chr151963 ------
NM_012434chr63517 109 85 ------
NM_012464chr442874 2487 513 180 1634 12416 --
NM_012479chr732168 642 409 --11981 --
NM_013230chrY------1508
NM_013231chr1464116 2757 1289 259 120 112 24050 1269 13617 --
NM_013233chr211288 ------
NM_013237chr5169 ------
NM_013253chr111152 11329 1574 11036
NM_013255chr7137973 7449 6979 5563 2736 2730 2686 2294 1920 1431 1081 381 363 --25831 5814 13199
NM_013256chr192283 264 --1504 --
NM_013257chr842221 1510 254 171 --32067 1783 630 --
NM_013261chr412842 ------
NM_013262chr621304 1135 ------
NM_013269chr1234371 3208 459 ----1856
NM_013275chr163734 628 130 ------
NM_013277chr123910 102 30 --1200 --
NM_013283chr5156 --2583 94 --
NM_013296chr12421 86 ------
NM_013300chr121212 ------
NM_013305chr181138 ------
NM_013309chr151486 1340 12118 --
NM_013316chr72862 849 --1212 --
NM_013323chr17--11190 1443 --
NM_013341chr222529 381 --1996 12492
NM_013354chr83431 340 141 ------
NM_013372chr151223 ------
NM_013374chr32842 443 12293 ----
NM_013381chr12----21734 580 --
NM_013386chr151782 1515 1342 601 105 --21311 1151 --
NM_013390chr921738 67 ------
NM_013396chr2121400 367 ------
NM_013423chrX21088 156 11016 ----
NM_013427chrX21088 156 11016 ----
NM_013433chr1911509 --11326 --
NM_013436chr22663 33 ------
NM_013437chr821431 913 --11297 --
NM_013438chr94509 422 350 131 1227 ----
NM_013444chrX31025 440 142 1358 ----
NM_013448chr142228 146 ------
NM_013450chr211219 --21177 790 --
NM_013943chr121258 1215 --1724 33041 2893 634
NM_013986chr221126 ------
NM_013995chrX42223 850 752 404 1973 32499 1036 817 --
NM_013999chr1721278 184 ------
NM_014000chr1021981 653 11396 ----
NM_014002chr12147 34 ------
NM_014011chr222067 294 12616 12257 --
NM_014016chr321543 1304 ------
NM_014021chr163386 3268 3249 2380 2311 266 --1305 12991
NM_014023chr10--12707 2968 731 --
NM_014031chr51302 ------
NM_014033chr1242306 1908 1453 609 ------
NM_014034chr641544 1294 1256 964 --1587 1283
NM_014048chr16105298 5017 4679 4011 1687 1669 623 455 448 230 --34598 3588 886 14567
NM_014057chr91225 --11305 1394
NM_014071chr201345 ------
NM_014079chr3------1178
NM_014089chr1322145 1940 --1544 --
NM_014106chr1542072 232 117 73 12618 --12443
NM_014112chr874395 3947 2204 2007 1139 973 386 --44897 4882 4375 1833 11817
NM_014117chr162761 722 --22684 2171 --
NM_014153chr16138 ------
NM_014154chr331443 1433 242 ------
NM_014155chr1166789 6782 6763 2991 2392 798 --26605 138 --
NM_014157chr1663966 2898 759 408 401 215 --13757 1247
NM_014181chr222797 363 ------
NM_014188chr12266 106 ------
NM_014217chr11708 --31780 174 79 --
NM_014223chr11293 1580 ----
NM_014233chr1751990 1983 1883 508 290 ------
NM_014238chr1741559 1382 1124 96 ------
NM_014240chr343216 2864 1361 654 12821 13708 --
NM_014243chr421783 1503 ------
NM_014249chr152518 31 ------
NM_014250chr2221852 1506 12124 11415 --
NM_014253chrX32450 2369 1590 ------
NM_014263chr1041194 1165 1143 55 --1522 --
NM_014264chr41501 ------
NM_014267chr111230 ------
NM_014268chr1831229 389 152 ------
NM_014271chrX1760 ------
NM_014280chr13706 647 295 ------
NM_014282chr91133 1466 --1872
NM_014283chr1----11227 --
NM_014289chrX21361 1178 --21136 457 11338
NM_014290chr91196 ------
NM_014294chr841390 151 136 65 --11108 --
NM_014299chr1942226 803 709 679 ------
NM_014305chr131175 ------
NM_014309chr22115432 5400 4830 4382 3920 1796 1180 1172 798 274 224 --11549 13513
NM_014319chr1221737 762 1561 1271 --
NM_014325chr1232130 513 99 ------
NM_014333chr1132801 2745 1782 12004 11973 --
NM_014335chr1521036 898 ------
NM_014342chr1141441 948 286 91 ----11241
NM_014344chr111776 ------
NM_014350chr541122 843 403 52 ------
NM_014351chr2221439 1418 ------
NM_014363chr132267 64 ------
NM_014368chr932170 1697 725 11527 12067 --
NM_014372chr132042 2015 418 --11577 --
NM_014382chr321711 1427 1295 ----
NM_014391chr10143 ------
NM_014392chr44435 330 197 190 ------
NM_014394chr1011014 ------
NM_014399chr73774 368 251 --1277 --
NM_014410chr181134 1365 ----
NM_014415chr321458 337 1368 1478 1596
NM_014423chr555358 5316 4840 4830 4518 1748 33954 2265 793 --
NM_014431chr1041699 1257 479 239 ------
NM_014445chr321575 425 12045 1933 --
NM_014447chr441240 1221 1045 102 ----11405
NM_014452chr62857 340 ------
NM_014454chr6----11023 --
NM_014456chr1021780 118 --21466 98 --
NM_014458chr121116 1028 11252 1147 --
NM_014462chr8182 ------
NM_014469chr113771 669 248 ------
NM_014470chr122731 218 ------
NM_014488chr113523 240 169 ------
NM_014491chr71421 ------
NM_014494chr1632380 697 55 --1886 --
NM_014504chr72823 489 --1111 --
NM_014515chr121399 ------
NM_014554chr1221436 851 --12095 --
NM_014572chr1331711 1195 653 ----2369 269
NM_014574chr141552 ------
NM_014575chr31197 ------
NM_014577chr224920 881 716 634 --1853 --
NM_014586chr21124738 4609 4546 4446 4030 3882 3268 1302 1016 323 252 80 --24670 1844 --
NM_014587chr1611356 ------
NM_014588chr203597 215 56 --1708 --
NM_014591chr1021312 416 ------
NM_014592chr52731 637 ------
NM_014600chr231647 1043 221 --11140 --
NM_014602chr3166 ------
NM_014607chr222057 1563 --1405 --
NM_014612chr911295 21004 251 2379 237 --
NM_014613chr533055 2282 2060 --22516 2441 --
NM_014614chr22963 585 ------
NM_014615chr1633550 2960 2368 ------
NM_014616chr331307 283 159 ------
NM_014629chr8--1410 21227 207 --
NM_014630chr1511308 13521 ----
NM_014635chr221307 314 ------
NM_014636chr964013 3750 3342 3172 539 347 --12972 --
NM_014646chr1863189 2843 2784 2138 974 852 ------
NM_014647chr1662057 1567 1543 830 318 237 --1790 --
NM_014660chr7--21093 283 ----
NM_014663chr13372 238 47 ------
NM_014666chr511006 --1189 --
NM_014667chr331593 739 165 12447 1320 168
NM_014671chr721050 488 ------
NM_014674chr353747 1572 1551 1140 843 --12957 --
NM_014676chr111445 1528 ----
NM_014679chr1131040 545 267 ----21090 183
NM_014682chr842232 2125 1872 353 1108 11897 --
NM_014683chr1711653 ------
NM_014686chr1952400 2156 1934 1833 871 ------
NM_014689chr21435 ------
NM_014701chr1512925 1826 ----
NM_014702chr673422 3078 2455 494 448 168 60 13369 22669 2520 --
NM_014705chr731712 762 84 ------
NM_014707chr74742 642 608 366 ------
NM_014711chr1631807 1763 631 ----1106
NM_014713chr21340 --1364 1126
NM_014721chr6167309 6899 5625 5311 5252 5182 5147 5054 5015 4614 2266 1742 1417 1064 739 376 --14763 25736 1588
NM_014725chrX31402 1339 1255 ------
NM_014727chr191257 ------
NM_014729chr812053 ----1119
NM_014730chr1254999 4734 4669 4578 403 13279 --11787
NM_014730chr1254999 4734 4669 4578 403 13279 --11787
NM_014731chr202174 22 ------
NM_014732chr16105717 5180 5162 4919 3616 2172 1911 1587 1035 1028 11104 12201 --
NM_014733chr52229 59 32138 1827 308 12028 21426 269
NM_014735chrX2742 702 ------
NM_014736chr151766 1109 ----
NM_014739chr613828 --22998 90 13943
NM_014741chr1112184 ------
NM_014743chr432264 2254 355 --22675 2201 1408
NM_014746chr253103 1515 712 568 432 1470 ----
NM_014747chr164907 3800 3576 2287 1579 1105 --1783 --
NM_014751chr81132 ------
NM_014752chr1121938 585 --31541 334 302 --
NM_014755chr283105 1701 1060 894 864 689 683 438 1512 13363 --
NM_014758chr11--21838 737 1889 --
NM_014761chr162843 336 ------
NM_014764chr122870 147 11248 2201 52 --
NM_014765chr132479 856 452 12349 ----
NM_014766chr733236 1123 435 22514 2491 11169 --
NM_014772chr1833370 2711 778 --12401 --
NM_014774chr142577 786 466 388 ------
NM_014776chr1263070 2685 2670 2446 1933 686 --22814 2314 11080
NM_014779chr331093 258 179 ------
NM_014786chr111149 ----1428
NM_014790chr5--1194 ----
NM_014795chr22878 478 ----21125 268
NM_014803chr1042374 2318 1909 1085 --21024 901 12728
NM_014807chr111647 --1274 --
NM_014810chr153435 3110 2697 1279 757 1111 ----
NM_014812chr141746 776 498 467 11984 ----
NM_014813chr1--2614 54 193 --
NM_014819chr521918 1674 ----12199
NM_014820chr321765 801 1577 11567 --
NM_014822chr42256 31 1138 ----
NM_014826chr183929 3891 3822 3773 3057 2649 1408 559 1245 ----
NM_014827chr1--1385 11624 --
NM_014829chr53609 361 140 --12218 --
NM_014830chr1263771 3585 3099 2975 2758 1409 12378 ----
NM_014835chr2021512 870 11940 21577 1421 --
NM_014836chr1051547 761 467 120 68 21579 146 11355 --
NM_014838chr2252504 2065 576 403 112 ------
NM_014839chr122426 1904 --42312 2010 1949 724 --
NM_014840chr1263221 711 607 287 229 119 --22942 325 --
NM_014846chr81105 ------
NM_014847chr11441 ------
NM_014848chr1562496 2159 1953 1008 917 526 1477 2764 305 --
NM_014850chr354548 3225 1890 1265 255 ----11678
NM_014857chr1--122 ----
NM_014862chr1533922 2976 919 --13533 14067
NM_014864chr144320 3597 1631 990 --12803 --
NM_014870chr154287 4071 3383 1824 372 ----11165
NM_014871chr121104 ------
NM_014872chr961614 705 599 568 523 166 1409 --22149 348
NM_014873chr164780 4493 1715 951 941 729 13087 14845 --
NM_014874chr12327 155 --11780 --
NM_014876chr2231991 1970 1892 1215 11638 --
NM_014883chr442398 1825 884 206 1803 --1970
NM_014890chr32233 102 ------
NM_014891chr721051 1045 --21271 232 --
NM_014893chrY2913 171 ------
NM_014897chr1743015 499 406 238 --177 --
NM_014899chr522119 855 1390 13039 12242
NM_014901chr552201 431 301 177 119 ----22135 1715
NM_014903chr12----22341 210 --
NM_014905chr211763 2463 339 11737 --
NM_014906chr1733239 2954 467 13127 33740 904 749 --
NM_014912chr103228 63 28 1397 11156 --
NM_014915chr1021049 451 21449 1388 ----
NM_014916chr72793 619 ------
NM_014918chr1511582 ------
NM_014920chr622934 501 --33237 286 258 --
NM_014921chr1911036 13014 ----
NM_014923chr1321437 167 193 11456 1633
NM_014924chr1423073 2596 --32516 1138 786 --
NM_014926chr31947 --11018 --
NM_014935chr133881 3836 2652 13177 1474 --
NM_014937chr1011277 --2465 232 --
NM_014939chr1841553 1178 1101 369 ------
NM_014945chr511516 130 ----
NM_014946chr233057 2758 2664 ------
NM_014947chr132742 2303 190 13137 ----
NM_014949chr1160 ------
NM_014950chr14--1462 11730 --
NM_014951chr1021769 883 ------
NM_014952chr1541957 1420 541 60 --32058 1311 78 --
NM_014953chr1344305 3984 1095 135 --1332 1977
NM_014961chr422237 2159 --11653 1544
NM_014962chr2072787 2382 2050 1923 1011 632 176 ------
NM_014974chr1021568 1177 ------
NM_014982chr1495241 4949 3676 3641 1983 1757 1564 727 531 15275 11349 11423
NM_014988chr44954 868 470 207 ----1101
NM_014989chr651932 1923 1534 1262 83 --1758 --
NM_014991chr422795 868 13275 ----
NM_014994chr1542321 1928 651 463 --11616 --
NM_014999chr1221644 196 --21386 1140 --
NM_015000chr1232708 2172 671 12667 32276 2105 1051 --
NM_015002chr1242077 401 357 226 ------
NM_015008chr363193 2949 2919 2351 1376 714 12589 13648 --
NM_015017chr121238 1025 ------
NM_015020chr1633698 3328 1365 --33594 2776 880 --
NM_015024chr821463 1241 ------
NM_015025chr232254 2194 1928 11718 1761 --
NM_015026chr1274705 3781 3733 1811 1688 826 329 31877 1746 540 23316 1711 11163
NM_015037chr10--1246 ----
NM_015039chr133954 2812 621 13679 ----
NM_015040chr222210 178 2742 529 1401 13302
NM_015042chr1523787 414 1221 ----
NM_015045chr1062028 2018 1985 1915 1815 167 --12124 --
NM_015049chr242979 2624 1289 549 --13026 --
NM_015050chr641277 1190 858 112 ------
NM_015051chr942618 2460 2343 2208 1694 ----
NM_015052chr731305 388 381 --11209 --
NM_015053chr112244 ------
NM_015057chr131275 ------
NM_015064chr1252855 2714 2595 2456 981 --12787 --
NM_015068chr752721 1120 1088 985 831 13592 13488 --
NM_015071chr5126244 6113 5876 4805 4759 4710 4574 4433 1420 453 292 195 --2478 231 16232
NM_015072chr142515 386 --176 --
NM_015074chr143711 3244 596 347 --21108 137 --
NM_015075chrX41797 1719 1521 1405 --1648 --
NM_015076chr663147 1550 1326 740 464 143 14518 44196 536 288 270 13508
NM_015082chr522559 2164 ------
NM_015087chr13--22413 383 1756 --
NM_015090chr174616 1572 1346 1118 910 835 564 ------
NM_015091chr142814 90 ------
NM_015092chr1694003 3590 1847 1401 1394 1388 1224 964 498 --23510 1547 --
NM_015093chr611624 11434 ----
NM_015097chr342051 1849 1446 284 --11876 --
NM_015110chr93926 613 229 1270 22294 822 --
NM_015115chr431091 915 353 --1411 12494
NM_015125chr192484 421 ------
NM_015130chr421125 341 ------
NM_015132chr721997 296 --21976 461 --
NM_015137chr822377 593 11901 1183 --
NM_015138chr1532659 706 649 ------
NM_015143chr421205 50 --2257 134 --
NM_015144chr1673448 3195 2898 2874 2616 470 295 --1672 23051 2554
NM_015149chr11145 --21748 1417 --
NM_015151chr211330 --2655 158 11015
NM_015155chr1073378 2825 2346 2080 1062 858 33 1561 --1276
NM_015156chr1433915 1091 738 ------
NM_015157chr1111119 --11173 --
NM_015163chr1421242 778 ------
NM_015170chr81342 ------
NM_015172chr121074 454 ------
NM_015176chr1----11101 --
NM_015180chr141321 --1289 --
NM_015185chrX42909 2383 1126 80 --1859 --
NM_015192chr2072792 2122 2064 2006 517 435 401 ------
NM_015199chr362735 2614 1864 1112 828 66 ------
NM_015200chr432621 2188 979 11675 1851 --
NM_015203chr1123 1196 ----
NM_015206chr1562893 2816 1061 624 216 118 ------
NM_015208chr1872943 2824 1124 828 313 297 51 --33837 3385 1513 --
NM_015215chr152691 2108 1244 204 198 --22710 799 --
NM_015216chr51179 172 1977 --
NM_015225chr952699 2646 2359 822 186 ------
NM_015226chr1622142 1275 ----23233 2744
NM_015230chr431577 694 392 1138 21343 1259 1149
NM_015231chr111790 ------
NM_015233chr1342522 2217 2150 492 1175 ----
NM_015236chr421284 283 ------
NM_015238chr51229 ------
NM_015239chr93217 206 179 ------
NM_015247chr1675194 5056 4846 3958 3899 1327 956 --24962 190 11903
NM_015250chr941789 767 348 154 --11663 --
NM_015251chr1631476 412 147 --2764 673 --
NM_015252chr21896 ------
NM_015263chr151444 --2821 748 1247
NM_015265chr242365 2246 1969 884 1328 ----
NM_015267chr12--22058 57 11583 12021
NM_015268chr31187 ------
NM_015269chr1----1622 --
NM_015270chr1261969 1860 1749 508 495 90 ------
NM_015271chr463254 2918 2834 1484 1220 1053 23043 2616 23831 696 --
NM_015272chr162566 291 ------
NM_015275chr1211536 11430 ----
NM_015277chr184514 431 60 52 --2587 447 --
NM_015278chr643212 2897 2740 2161 ----1238
NM_015282chr242841 2124 1882 320 12085 1350 --
NM_015284chr121481 589 --32071 1986 489 --
NM_015285chr1822346 2282 --21924 365 --
NM_015288chr533291 3196 538 --22976 1512 --
NM_015291chr143492 3388 770 730 ------
NM_015293chr62573 247 1730 ----
NM_015294chr1721148 944 ------
NM_015296chr1311102 ------
NM_015299chr1463007 2944 2523 1384 1226 983 ------
NM_015308chr111765 ------
NM_015310chr896867 6730 6715 5750 5319 3081 3068 2274 478 18327 36809 3259 559 25101 1679
NM_015313chr1144678 4501 919 768 1310 14469 --
NM_015316chr1441272 1249 1053 199 ------
NM_015326chr112757 11034 ----
NM_015327chr121201 314 ------
NM_015329chr1942643 1970 1829 65 --22101 527 --
NM_015331chr11579 ------
NM_015332chr743199 1246 1191 530 13464 12996 --
NM_015335chr1222548 2128 --22457 862 --
NM_015336chr1252427 2011 1834 1789 435 22528 962 1683 --
NM_015338chr2041930 1708 1460 113 ------
NM_015339chr202898 101 ------
NM_015344chr812040 1551 ----
NM_015347chr1282677 2463 2345 2095 1902 1153 941 689 --21853 776 1953
NM_015349chr632005 926 284 --32702 2678 1041 --
NM_015355chr1741737 222 177 106 1334 21921 610 --
NM_015358chr212504 290 ------
NM_015359chr812025 --12412 --
NM_015360chr51173 ------
NM_015361chr22784 173 1872 ----
NM_015365chrX64170 3710 3046 2608 655 182 ------
NM_015381chr2211786 1753 ----
NM_015385chr1042830 2366 2077 839 1829 12169 --
NM_015387chr231647 555 194 12116 ----
NM_015396chr331367 1298 472 ------
NM_015397chr9--1140 11922 --
NM_015409chr1252716 2162 1964 298 104 11923 12710 --
NM_015416chr121945 --169 --
NM_015423chr1121588 1173 ----21687 1410
NM_015429chr3--11068 ----
NM_015435chr821093 344 ------
NM_015436chr433132 2196 33 22355 368 ----
NM_015443chr1721317 618 --1211 --
NM_015446chr121568 434 21660 1177 ----
NM_015455chr583805 3688 3088 1620 1159 1092 968 345 14041 13048 --
NM_015457chr11--1699 ----
NM_015460chr371539 1465 804 515 266 184 80 ------
NM_015464chr7--1226 ----
NM_015475chr2--1693 1132 --
NM_015477chr151879 1388 1963 --
NM_015483chr731127 1009 863 1446 ----
NM_015488chr211620 11646 ----
NM_015497chr1511075 ------
NM_015508chr35535 434 296 110 92 --149 11358
NM_015520chr332105 2094 839 --12517 --
NM_015523chr111235 ------
NM_015525chr6125 ------
NM_015530chr22716 399 1842 1209 --
NM_015531chr111146 ------
NM_015535chr274062 2694 1521 759 637 497 410 12959 24049 229 12681
NM_015542chr1011125 ------
NM_015548chr61321 1989 --138
NM_015549chr141550 ------
NM_015550chr753483 2963 2530 543 124 --1629 --
NM_015554chr1572264 2193 2181 2064 545 451 23 21137 201 --1346
NM_015557chr14451 404 330 32 --1863 --
NM_015564chr533381 3348 799 1776 ----
NM_015565chr2132302 1695 98 ------
NM_015567chr1341136 930 852 821 134 ----
NM_015571chr631921 982 686 12632 1821 22122 205
NM_015575chr223472 990 ------
NM_015576chr32655 316 --22953 1087 --
NM_015577chr531749 606 473 --11612 --
NM_015578chr192211 117 --21529 276 --
NM_015601chr102718 39 ------
NM_015607chr1--1147 ----
NM_015609chr1----12967 --
NM_015626chr171134 ------
NM_015627chr141739 622 612 113 --1366 --
NM_015630chr21259 ------
NM_015635chr941983 1927 241 123 --11365 --
NM_015640chr134206 1141 301 --1635 --
NM_015641chr741220 1057 347 53 --1197 --
NM_015649chr19------1344
NM_015675chr191564 ------
NM_015678chr1341446 1368 1108 679 ------
NM_015691chrX--1524 31970 426 357 --
NM_015711chr191748 ------
NM_015714chr12367 238 ------
NM_015726chr141491 1247 619 98 21739 601 ----
NM_015833chr2121972 1962 --1247 --
NM_015840chr141804 866 643 67 ------
NM_015841chr141804 866 643 67 ------
NM_015850chr822387 285 --12235 --
NM_015866chr151517 1421 1355 242 70 1499 11098 --
NM_015872chr111752 --11628 --
NM_015878chr81698 11486 ----
NM_015879chr18198609 8558 8426 8219 8004 7929 7621 6944 6674 6367 5866 3413 1520 1204 857 815 597 591 231 --68012 7401 7300 5963 1416 1259 27551 2031
NM_015881chr111152 11329 1574 11036
NM_015885chr113699 356 165 ------
NM_015886chr844333 2105 1579 734 14574 15047 --
NM_015888chr132999 2546 2115 --32724 2637 1096 --
NM_015891chr621581 574 --22079 1417 --
NM_015898chr1911881 2774 559 2917 180 --
NM_015902chr84797 737 630 176 ------
NM_015905chr71494 1584 ----
NM_015906chr164536 3903 3831 3432 3030 758 --14014 --
NM_015912chr831984 827 108 --2894 411 --
NM_015932chr132180 88 ------
NM_015938chr32301 275 --1423 --
NM_015939chr202604 174 1225 1246 --
NM_015955chr2--1425 ----
NM_015975chrX31833 741 27 11174 1205 1297
NM_015980chr52621 354 --11564 --
NM_015993chr163553 159 120 ------
NM_016018chr842728 2671 2625 2005 --2391 51 --
NM_016019chr73946 878 364 --1730 --
NM_016021chr642940 1158 1149 388 12893 22567 623 --
NM_016032chrX51094 872 521 250 149 --11191 --
NM_016038chr72251 57 ------
NM_016041chr17----2276 127 --
NM_016061chr261659 1649 1577 1515 1142 467 --11092 --
NM_016072chr1282443 2217 2156 1960 1586 1580 772 374 ------
NM_016073chr151780 ------
NM_016076chr143184 2728 2053 798 1431 22686 2081 12302
NM_016078chr174885 763 341 208 ------
NM_016083chr6103776 3167 3054 2827 2810 2506 2415 748 556 409 --23835 1410 --
NM_016084chr172553 132 ------
NM_016090chr11----11067 --
NM_016098chr62344 40 1404 --1338
NM_016099chr821351 1134 --1262 --
NM_016103chr51362 ------
NM_016107chr521285 895 ------
NM_016121chr111031 ----11039
NM_016123chr121927 --21098 474 --
NM_016129chr4----2376 76 --
NM_016131chr262157 1866 1510 871 258 239 --11692 --
NM_016133chr221610 1265 ------
NM_016151chr16136 --144 --
NM_016152chr321199 1152 ------
NM_016156chr1132286 1809 910 21818 1510 ----
NM_016162chr121655 ------
NM_016185chr172806 246 --1112 --
NM_016190chr1126 ------
NM_016192chr21107 ------
NM_016201chr321997 1467 ------
NM_016205chr41965 ------
NM_016206chr3138477 8459 7876 7144 6931 6888 6433 5492 3533 1835 1055 517 430 1943 26416 193 16910
NM_016217chr633560 1175 222 ------
NM_016224chr61751 1138 21744 1688 1247
NM_016227chr1----11227 --
NM_016231chr17----11574 --
NM_016248chr1333440 2431 1490 33355 1565 976 2734 142 13475
NM_016255chr653311 2781 1130 1053 276 --22680 308 --
NM_016258chr12690 581 ------
NM_016260chr2106879 6871 6847 5532 5090 2526 2457 1929 722 692 25369 65 21920 1252 26629 959
NM_016269chr431070 403 341 --21167 981 --
NM_016270chr192420 352 ------
NM_016271chr182675 263 --11686 --
NM_016275chr332781 949 570 --12233 --
NM_016277chr621438 371 --11223 --
NM_016279chr5138 ------
NM_016281chr1211102 ------
NM_016284chr162360 188 ------
NM_016287chr161867 1811 1763 426 156 67 --11627 --
NM_016289chr252118 1720 740 317 67 --22283 40 --
NM_016291chr3----123 --
NM_016297chr253151 1242 1158 903 317 1187 33541 2444 478 --
NM_016303chrX----160 --
NM_016308chr151796 1653 1491 835 630 --1500 11286
NM_016315chr221701 1632 ------
NM_016320chr1121142 77 --1832 --
NM_016322chr972971 2616 2189 1194 842 518 292 --23069 61 --
NM_016333chr161479 ------
NM_016338chr51951 --11075 1846
NM_016374chr151268 1205 1128 152 97 2143 31 31394 1222 23 --
NM_016374chr151268 1205 1128 152 97 2143 31 31394 1222 23 --
NM_016376chr1773939 3832 3776 1613 797 781 356 23878 3768 13391 --
NM_016377chr621773 364 --11347 --
NM_016395chr1511291 --1175 --
NM_016396chr1543013 2221 542 96 1693 ----
NM_016403chr113616 573 546 1708 ----
NM_016422chr11178 22743 603 1979 12733
NM_016424chr1721428 576 ------
NM_016436chr2012089 --22182 752 --
NM_016441chr272324 832 767 631 174 123 81 --11676 --
NM_016448chr1----21805 255 --
NM_016472chr1421031 309 11249 ----
NM_016485chr62911 154 --11919 --
NM_016486chr11197 --1420 --
NM_016488chr1221704 452 ----11676
NM_016507chr1731179 872 108 1315 --11115
NM_016513chr622934 501 --33237 286 258 --
NM_016525chr93762 244 238 ------
NM_016529chr132322 256 ------
NM_016530chr1543725 3362 2603 692 11659 --31143 488 408
NM_016531chr421068 809 13373 34124 3460 3353 --
NM_016542chrX------1604
NM_016545chr11733 ------
NM_016546chr121421 ------
NM_016577chr364328 4243 2874 1385 864 236 ------
NM_016586chr142409 202 --1392 --
NM_016587chr72449 173 ------
NM_016598chr351181 1148 596 145 50 ------
NM_016603chr562222 1629 1478 122 100 68 180 11532 12060
NM_016605chr542285 1065 438 349 ------
NM_016617chr131797 183 21536 659 --
NM_016620chr12523 484 ------
NM_016621chr1133959 1723 1200 ------
NM_016623chr81521 ------
NM_016626chr1841708 1161 390 217 ------
NM_016628chr103787 663 649 181 ----
NM_016644chr5----169 --
NM_016733chr2221533 44 11465 ----
NM_016818chr21----2669 574 --
NM_016824chr1021224 484 ------
NM_016830chr121517 ------
NM_016936chr162366 145 --1136 12095
NM_016950chr421485 443 ----11182
NM_017412chr811003 --1265 --
NM_017415chr574260 4148 3401 1434 1346 1170 573 --34017 4008 3301 --
NM_017420chr1433008 1043 912 12953 1509 --
NM_017423chr452078 1901 1776 759 462 --11467 --
NM_017426chr41427 ----1502
NM_017447chr2142741 1041 540 442 11313 ----
NM_017455chr151963 ------
NM_017456chr1711619 --11272 --
NM_017489chr82106 55 ------
NM_017519chr621373 327 ------
NM_017522chr121158 399 ------
NM_017545chr201465 --1598 --
NM_017548chr321909 1898 ------
NM_017551chr1011901 --12697 --
NM_017563chr386251 5481 4994 2260 1913 1264 417 23 --25727 138 --
NM_017567chr21119 ------
NM_017569chr13182 ------
NM_017575chr1711610 ------
NM_017580chr1042338 2034 1970 1721 1370 --11921
NM_017590chr2242715 2505 1677 886 ------
NM_017593chr4175 ------
NM_017594chr912917 21103 115 12607 --
NM_017602chrX142 ------
NM_017610chr153425 263 102 1713 ----
NM_017612chr12155 ------
NM_017629chr151787 1279 749 523 153 ----11193
NM_017633chr632404 1563 1363 --23565 2477 12773
NM_017634chr82354 206 ------
NM_017635chr1131470 1156 190 --21283 94 --
NM_017637chr989135 8455 7934 2438 2061 820 673 85 51941 1445 1211 121 78 37338 6099 1460 --
NM_017640chr61248 ------
NM_017643chr1733071 1242 551 ------
NM_017644chr311902 ----14876
NM_017645chr943028 2982 2651 284 135 ----
NM_017650chr7105894 5484 5301 4300 4244 3762 2247 1236 1047 152 14998 1825 23930 457
NM_017658chr1494428 3086 1502 1483 1231 1020 515 255 146 --13963 --
NM_017661chr153526 427 44 ------
NM_017680chr91732 ------
NM_017686chr121136 753 1375 --21054 792
NM_017693chr1311106 1480 ----
NM_017694chr231580 1473 106 ------
NM_017709chr163324 3144 2710 1352 1259 87 --11033 --
NM_017714chr20137 1667 --1158
NM_017719chr312330 1317 --2673 295
NM_017734chr1----2242 52 --
NM_017737chr152060 1760 1352 784 572 --1159 --
NM_017742chr1811804 ----11536
NM_017744chr132192 444 301 11726 1122 12272
NM_017752chrX31812 1757 823 --1179 --
NM_017754chr654271 3611 3061 125 75 --11847 24635 3581
NM_017758chr171449 --11506 --
NM_017761chr141464 504 471 180 ----11512
NM_017762chr151962 --21778 622 --
NM_017769chr1452850 2735 2011 1032 422 ------
NM_017770chr682982 2718 1132 1074 941 840 323 188 ------
NM_017778chr841448 1248 526 129 --21327 463 --
NM_017780chr82787 330 ------
NM_017787chr1052855 1877 518 146 70 11825 ----
NM_017798chr201166 1157 ----
NM_017799chr1431912 1768 143 1660 ----
NM_017811chr912594 --1763 --
NM_017813chr865610 5040 3643 1155 877 827 15268 2708 344 25570 4058
NM_017824chr102934 79 ----22292 139
NM_017831chr1864636 4025 3971 3017 1286 1123 1149 23557 568 --
NM_017845chr42843 656 ------
NM_017847chr11201 --11759 --
NM_017848chrX54021 1868 1802 1391 689 --24173 1265 1373
NM_017849chr242964 2634 1052 520 ------
NM_017856chrX21942 511 --1675 --
NM_017869chr161627 ------
NM_017887chr1150 ------
NM_017893chr1011166 --11020 --
NM_017902chr1064852 3593 2012 1055 170 85 1105 24841 3577 15755
NM_017910chr22369 91 ------
NM_017913chr92129 91 ------
NM_017915chr122412 142 ------
NM_017922chr141271 ------
NM_017925chr911367 --1453 --
NM_017933chr231366 1027 33 11034 11429 --
NM_017935chr41256 ------
NM_017938chrX22080 2037 ------
NM_017944chr1172907 2789 2723 2539 2236 1205 117 1694 12992 --
NM_017948chr91173 --1349 --
NM_017953chr11220 ----1237
NM_017954chr721431 389 41688 1293 1230 493 2546 321 --
NM_017955chr142927 53 ------
NM_017958chr283060 2595 2289 993 482 287 214 70 --22578 782 --
NM_017969chr21171 ------
NM_017974chr231041 461 133 ------
NM_017987chr1052137 1432 1379 861 363 ------
NM_017988chr123868 785 190 --192 --
NM_017994chr762883 2605 2530 1899 442 343 --11142 --
NM_018010chr321471 273 --11287 --
NM_018011chr131617 ------
NM_018013chr652846 2101 1221 1168 568 22594 1941 ----
NM_018014chr21486 ----1978
NM_018027chr10----53318 2714 1249 540 219 --
NM_018030chr182881 133 2908 216 ----
NM_018045chr162269 1047 922 623 555 69 12221 --12606
NM_018046chr511777 --11874 1617
NM_018047chr52817 760 144 ----
NM_018061chr14659 496 228 119 --11469 --
NM_018063chr101351 1136 ----
NM_018078chr41321 --1178 11074
NM_018084chr2102690 2118 1284 1053 1032 936 855 709 339 206 23080 2994 ----
NM_018085chr1117168 6986 5485 5382 5349 3279 2634 2313 1746 1280 81 12614 26134 1203 22917 1627
NM_018086chr241871 1864 1606 677 --11547 --
NM_018087chr1170 ------
NM_018092chr1651088 608 513 268 251 ------
NM_018098chr321036 77 --190 --
NM_018103chr1188 ------
NM_018105chr82912 374 ------
NM_018117chr101695 --1492 --
NM_018120chr821093 135 ------
NM_018121chr1083052 2775 2658 2452 2130 984 962 561 --12597 --
NM_018126chr431087 56 39 --1601 --
NM_018128chr1721019 42 --11419 --
NM_018133chr3--1873 11981 --
NM_018137chr11515 1244 1273 --
NM_018155chr342772 2557 2473 233 43411 3382 3176 763 12851 --
NM_018157chr1242696 2251 2235 2050 --23269 2827 --
NM_018159chrX--11102 189 --
NM_018164chr12----169 --
NM_018171chr122663 269 ------
NM_018181chr1831778 1265 94 --21760 510 --
NM_018182chr1742198 1413 900 588 ------
NM_018184chr362025 1977 1858 1429 1411 832 ----11397
NM_018191chr13142 --11919 --
NM_018192chr31872 11049 ----
NM_018200chr1542365 1997 1988 752 --1831 --
NM_018206chr16------1301
NM_018208chr1----139 --
NM_018211chr131832 895 394 1426 ----
NM_018223chr122220 32 --1472 --
NM_018227chr423027 1280 156 ----
NM_018243chr473736 3315 3228 1448 912 521 410 --12606 --
NM_018246chr842735 2699 2114 747 --3939 876 325 --
NM_018247chr632555 2168 957 --11919 --
NM_018254chr1----2947 490 11829
NM_018257chr2052432 1847 1830 1007 511 --11930 --
NM_018263chr2--32465 843 237 ----
NM_018270chr203697 319 41 --1337 --
NM_018287chr105954 421 354 242 113 ------
NM_018293chr372889 2796 2557 1184 772 625 53 --12308 --
NM_018299chr832638 2624 136 22484 2436 156 --
NM_018313chr32944 112 --1719 --
NM_018314chr112711 650 ------
NM_018315chr41430 ------
NM_018327chr20--11772 ----
NM_018330chr1041489 1277 1267 175 ------
NM_018334chr7----1187 --
NM_018351chr1224722 815 34661 3297 1130 22950 1307 --
NM_018361chr841176 1169 330 321 --33786 3447 766 --
NM_018362chr11113082 2849 2786 1516 1394 1301 735 707 528 521 316 --13559 23592 3538
NM_018364chr133027 1242 1048 13392 33728 582 403 13006
NM_018367chr111450 --22233 626 --
NM_018368chr6154 ------
NM_018370chr1211965 --11594 1469
NM_018374chr724747 3781 15040 ----
NM_018388chrX21009 170 ----11344
NM_018398chr31324 ------
NM_018403chr331297 669 650 --43133 2735 1053 599 --
NM_018416chr1212342 21836 937 11759 --
NM_018424chr921620 1360 --21462 747 --
NM_018429chr5--12193 32096 1774 204 --
NM_018433chr2----1574 --
NM_018440chr8178164 8043 7504 7211 6914 5396 5267 3464 2695 2572 2260 2149 2121 1656 1286 827 368 28682 5562 87946 7856 7332 6171 5880 5317 3087 715 --
NM_018441chr22539 66 ------
NM_018442chr1------124
NM_018444chr852044 1752 900 374 218 ----1109
NM_018446chr3----129 --
NM_018448chr12------1173
NM_018452chr6_random53401 3064 2596 374 139 13870 ----
NM_018462chr32887 221 ------
NM_018464chr102360 145 ------
NM_018469chr1731024 555 81 11462 ----
NM_018471chr22440 434 ------
NM_018475chr41109 ------
NM_018482chr822554 600 1805 12091 1247
NM_018489chr142155 1785 1649 293 1142 2585 303 --
NM_018527chr131169 --1108 --
NM_018534chr22139 70 ------
NM_018557chr231452 365 95 1340 11289 --
NM_018566chr154452 3717 1826 1293 886 14695 84994 4412 4073 3500 1606 1544 1143 990 --
NM_018584chr12960 484 --184 --
NM_018590chr10143 ------
NM_018602chr151122 ------
NM_018638chr1235251 3631 1398 14394 ----
NM_018640chr1222507 36 1383 2692 564 12492
NM_018650chr11674 1633 11750 --
NM_018652chr1521044 784 --1286 1961
NM_018657chr34845 797 290 226 --1651 --
NM_018682chr75715 703 595 545 76 ------
NM_018685chr7185 ------
NM_018689chr1542691 2443 920 659 ------
NM_018695chr562292 1859 1747 1535 872 819 1695 11716 --
NM_018698chrX51654 645 570 163 81 ------
NM_018703chr16--1116 ----
NM_018704chr12677 646 11548 ----
NM_018710chr82988 440 ------
NM_018712chr1141531 1437 1139 305 --1522 --
NM_018713chr12246 39 ----1892
NM_018718chr7----160 --
NM_018719chr731189 341 41 ------
NM_018728chr1521296 23 1539 11128 --
NM_018834chr51825 --1234 --
NM_018840chr201381 ------
NM_018841chr143852 3720 3397 2960 ----13317
NM_018844chr722050 1699 --11740 --
NM_018846chr71823 --1241 --
NM_018890chr721482 363 ------
NM_018898chr512013 1158 12264 --
NM_018899chr512013 1158 12264 --
NM_018900chr512013 1158 12264 --
NM_018901chr512013 1158 12264 --
NM_018902chr512013 1158 12264 --
NM_018903chr512013 1158 12264 --
NM_018904chr512013 1158 12264 --
NM_018905chr512013 1158 12264 --
NM_018906chr512013 1158 12264 --
NM_018907chr512013 1158 12264 --
NM_018908chr512013 1158 12264 --
NM_018909chr512013 1158 12264 --
NM_018910chr512013 1158 12264 --
NM_018911chr512013 1158 12264 --
NM_018912chr51627 --11678 --
NM_018913chr51627 --11678 --
NM_018914chr51627 --11678 --
NM_018915chr51627 --11678 --
NM_018916chr51627 --11678 --
NM_018917chr51627 --11678 --
NM_018918chr51627 --11678 --
NM_018919chr51627 --11678 --
NM_018920chr51627 --11678 --
NM_018921chr51627 --11678 --
NM_018922chr51627 --11678 --
NM_018923chr51627 --11678 --
NM_018924chr51627 --11678 --
NM_018925chr51627 --11678 --
NM_018926chr51627 --11678 --
NM_018927chr51627 --11678 --
NM_018928chr51627 --11678 --
NM_018929chr51627 --11678 --
NM_018945chr641441 911 872 197 --22809 1417 --
NM_018951chr72811 41 ------
NM_018970chr782645 2500 1999 858 664 560 482 348 ----11133
NM_018976chr1252480 1877 1849 1020 472 ------
NM_018977chrX31099 782 674 ------
NM_018979chr1242587 2570 862 606 1105 ----
NM_018993chr2011432 ------
NM_018999chr1054353 4341 4150 3989 1626 --34638 3942 1490 --
NM_019001chr384169 3679 3274 1769 728 680 188 147 --1382 --
NM_019003chrX1127 ------
NM_019004chr712305 41680 766 644 196 ----
NM_019006chr151618 ------
NM_019022chr1832831 453 212 ------
NM_019027chr432058 669 496 --11752 --
NM_019028chr111333 ------
NM_019042chr73460 379 65 ------
NM_019045chrX1785 ------
NM_019049chr12616 113 ------
NM_019050chr441990 498 435 197 --2649 532 --
NM_019058chr101212 ------
NM_019071chr7196 ------
NM_019072chr554195 3597 2777 448 256 --1606 --
NM_019087chr511646 ------
NM_019091chr21103 --21100 992 --
NM_019096chr62399 360 ------
NM_019102chr7258 22 ------
NM_019102chr7258 22 ------
NM_019106chr2222228 2166 ----1861
NM_019114chr941853 830 554 187 ------
NM_019116chr1633212 3009 161 ------
NM_019117chrX42858 2474 1362 333 ------
NM_019555chr321289 156 --188 --
NM_019556chrX1526 ------
NM_019557chr11879 ------
NM_019558chr21361 ----1318
NM_019590chr101547 ------
NM_019593chr2073166 3061 2801 2709 2497 441 73 --1298 1375
NM_019600chr152785 516 ------
NM_019606chr71397 ------
NM_019610chr131690 857 250 ------
NM_019842chr61357 ------
NM_019885chr232924 2658 2410 --22811 2518 --
NM_019891chr111115 --1964 --
NM_019903chr1021224 484 ------
NM_020066chr1--1921 --1402
NM_020116chr41330 21399 52 ----
NM_020122chr222002 608 --45928 5421 4735 1824 --
NM_020123chr1031240 978 114 1404 21006 334 --
NM_020134chr241161 1047 809 189 --1394 --
NM_020137chrX1352 ------
NM_020139chr451805 1752 763 524 479 ------
NM_020141chr111889 ------
NM_020144chr752098 1640 1311 733 603 --11413 --
NM_020148chr1832034 1158 412 ------
NM_020150chr1031703 1617 1384 --12252 --
NM_020154chr15124 ------
NM_020163chr321659 1444 12016 ----
NM_020168chr1511357 ------
NM_020177chr583306 3131 903 649 132 86 66 23 --12291 --
NM_020178chr1721109 966 --1212 --
NM_020180chr1831375 1151 1116 ------
NM_020193chr1131302 193 23 1101 21229 89 --
NM_020194chr22611 534 ------
NM_020198chr1721583 1099 --21128 322 11077
NM_020199chr531216 1161 174 192 ----
NM_020204chr11571 ------
NM_020205chr132314 953 803 23447 3250 ----
NM_020210chr151977 ------
NM_020225chr41302 ------
NM_020226chr42497 313 ------
NM_020245chr674686 4617 3993 3801 1597 539 234 13921 24350 483 --
NM_020309chr193835 709 118 ------
NM_020315chr221185 11039 --1328
NM_020317chr13100 68 42 1109 ----
NM_020336chr2053694 3366 2608 2348 1486 --12951 --
NM_020337chr431173 1139 531 --1243 --
NM_020338chr101496 --13171 --
NM_020340chr651907 923 879 166 74 ----12067
NM_020341chr2042045 2022 1720 1512 --2482 399 --
NM_020342chr271929 1818 1740 1733 964 553 160 ------
NM_020346chr1121262 219 1372 ----
NM_020348chr1031944 1055 1004 12484 --12756
NM_020357chr31509 ----11413
NM_020382chr121243 ------
NM_020384chrX31773 1183 701 ------
NM_020390chr3154652 4633 4597 4512 4397 4184 4139 3550 3221 1800 1525 1415 1363 637 451 13707 ----
NM_020403chr133464 305 260 1569 ----
NM_020416chr42818 101 ------
NM_020423chr12237 206 ------
NM_020429chr732283 1963 208 ------
NM_020432chr73719 212 48 1222 11588 --
NM_020440chr142593 2540 675 204 ------
NM_020449chrX1486 ------
NM_020453chr421979 143 --2271 109 --
NM_020456chr1322274 1461 11565 2609 201 --
NM_020463chr211451 ------
NM_020466chr694286 4244 3454 3382 1728 1536 816 544 178 33851 3109 54 31957 784 331 11358
NM_020474chr1821977 1292 ------
NM_020529chr141465 1104 ----
NM_020546chr572558 2181 1236 1174 1106 658 248 ------
NM_020631chr161060 1043 943 570 485 154 --11223 --
NM_020640chr311485 21526 696 1461 --
NM_020644chr111298 --1859 --
NM_020647chr821856 380 22196 929 ----
NM_020654chr331452 1352 335 --164 --
NM_020673chr20117381 7015 6937 6699 5796 5485 4919 2440 2386 1877 1417 26727 2379 57144 5515 1703 549 346 11068
NM_020686chr1642897 2397 2273 1147 --1138 --
NM_020689chr2031596 1474 1073 --1437 --
NM_020699chr175001 3913 3855 2165 1712 1384 503 1581 15332 11916
NM_020704chr732128 459 324 --12530 --
NM_020713chr2062949 2686 2179 2098 2076 840 --12305 --
NM_020718chr16106498 5764 5306 4175 2248 1263 1113 962 515 96 --11431 --
NM_020727chr2142881 2767 1227 915 12828 23477 817 12966
NM_020728chr752352 2296 2207 1996 813 23067 1241 12639 12117
NM_020732chr621373 327 ------
NM_020734chr1222155 1067 22065 964 ----
NM_020739chr1543460 3434 1348 526 --123 14209
NM_020740chr171356 134 ----
NM_020749chr821400 1284 --137 1265
NM_020752chr1052254 1135 857 551 448 --32200 1943 1036 12773
NM_020760chr221604 1391 11990 1378 --
NM_020762chr122412 173 ------
NM_020764chr1611055 ------
NM_020766chrX64604 4090 4065 3934 3415 1686 --2750 518 --
NM_020771chr61961 --1528 --
NM_020772chr17118288 7673 7120 6824 5721 5639 3309 3037 2069 1258 38 37809 1953 1483 17940 12889
NM_020773chr432534 2108 510 11896 ----
NM_020774chr1864935 4310 4122 842 612 297 --35754 2343 2138 46022 5581 4353 1268
NM_020782chr12104817 4606 4436 4403 4246 4074 4013 3462 3195 437 14179 --33303 1799 1016
NM_020783chr1831783 1506 897 ------
NM_020786chr1611834 11431 ----
NM_020791chr1711431 --31324 1003 183 --
NM_020792chr362463 2385 2254 467 454 70 11870 11779 --
NM_020794chr11139 ------
NM_020796chr512565 12749 --12283
NM_020800chr31487 21394 231 1117 --
NM_020801chr532259 2185 2089 11619 1805 --
NM_020804chr622323 2134 --2783 168 --
NM_020805chr1831784 1647 545 ----11818
NM_020806chr142750 589 ------
NM_020809chr1142260 2213 1512 463 ----1305
NM_020810chr1442892 2877 301 109 --1908 --
NM_020819chr611047 ------
NM_020825chr1673481 3073 2960 2553 2340 924 331 --23154 3092 --
NM_020830chr282597 2364 1151 1133 960 892 160 79 1591 12844 --
NM_020841chr1233829 2501 521 13652 43167 2663 862 749 --
NM_020843chr151134 ------
NM_020850chr1653289 3108 2812 2371 499 ------
NM_020853chr1222769 1065 --1619 --
NM_020854chr183964 487 64 1360 173 --
NM_020856chr1921581 363 --2406 396 1313
NM_020858chr1552386 1920 1474 301 191 --22329 517 --
NM_020860chr4--11189 ----
NM_020868chr211498 --1150 --
NM_020870chr41468 ------
NM_020871chrX41997 1769 1005 939 12535 1622 --
NM_020872chr351726 1421 505 388 270 ------
NM_020899chr1732514 1864 1717 --1718 --
NM_020909chr251428 877 719 439 35 1792 --14059
NM_020918chr10103432 3403 3050 3028 2885 2832 2734 2374 1434 1415 11108 12723 --
NM_020921chr1483337 3291 2546 2490 2343 1369 779 34 22738 2527 ----
NM_020922chrX31853 1481 300 ------
NM_020935chr244554 2855 871 234 11112 24096 1084 --
NM_020940chr1032462 1146 365 --22230 274 --
NM_020946chr931696 1677 537 11529 11257 --
NM_020948chr143169 2514 1015 897 12648 ----
NM_020952chr9----1178 --
NM_020960chr984764 3902 3564 3061 1622 833 782 25 13679 14856 --
NM_020962chr1562171 2017 1975 1826 1819 502 1581 12366 --
NM_020975chr1061466 1439 1388 1326 574 243 ------
NM_020977chr461757 1441 1433 305 135 87 --41977 1850 1535 721 --
NM_020980chr152695 292 ------
NM_020983chr1261969 1860 1749 508 495 90 ------
NM_020987chr1031343 1283 548 ------
NM_020993chr123924 816 718 22600 1821 ----
NM_021005chr151430 2996 324 ----
NM_021007chr231969 1739 736 --21680 1664 --
NM_021012chr1763214 2934 2775 2476 1255 638 ------
NM_021019chr121180 ------
NM_021020chr863116 3065 2943 2658 1027 38 ------
NM_021033chr1363182 1074 952 847 515 434 ------
NM_021038chr373135 3106 2763 2598 2452 1161 751 13194 ----
NM_021064chr61629 --1336 --
NM_021069chr43678 525 438 ----11682
NM_021072chr542211 1704 583 217 ------
NM_021079chr1712618 ----12908
NM_021083chrX43272 2951 2936 1405 --33492 3309 2557 13551
NM_021088chr261844 578 423 354 298 146 --2785 414 1487
NM_021090chr2264646 3468 1762 1144 512 88 --21868 793 --
NM_021101chr342533 2197 1677 820 --1613 --
NM_021102chr191383 ------
NM_021109chrX144 ------
NM_021109chrX144 ------
NM_021111chr91410 11282 ----
NM_021132chr101937 1507 ----
NM_021136chr141727 2720 513 2583 468 --
NM_021137chr1732135 1622 1586 11969 3591 502 191 --
NM_021139chr41375 ------
NM_021140chrX3802 206 164 ------
NM_021144chr9134 ------
NM_021151chr7--1337 1394 2986 25
NM_021160chr6--1178 ----
NM_021167chr711845 22365 2278 42418 2032 658 331 --
NM_021180chr13774 551 93 ------
NM_021183chrX41880 1737 762 717 ----1699
NM_021189chr12858 242 ------
NM_021190chr1--31246 844 340 1530 --
NM_021191chr121817 22013 1956 12002 11776
NM_021192chr21429 ------
NM_021202chr2032501 2074 1920 --22511 2206 --
NM_021204chr4----1959 --
NM_021205chr142877 2401 992 625 ----11893
NM_021215chr204874 743 438 325 1587 1367 --
NM_021222chr141449 1437 1164 467 ------
NM_021224chr91145 ------
NM_021229chr1231126 896 29 ------
NM_021238chr1262053 2012 1614 1528 1491 628 ------
NM_021239chr14--1343 --11328
NM_021240chr92475 171 1493 ----
NM_021244chr6----1175 --
NM_021252chr1052068 1786 1535 584 498 --21315 696 --
NM_021260chr141306 1240 ----
NM_021614chr51257 ------
NM_021622chr1042272 1583 332 242 ------
NM_021629chr354861 4784 4591 523 329 --34443 3937 3223 --
NM_021633chr1--1141 1274 --
NM_021643chr2----11231 1382
NM_021648chr632641 1721 978 1443 12713 --
NM_021649chr53606 445 175 ----11657
NM_021705chr621154 1105 --11260 2416 301
NM_021728chr142728 265 ------
NM_021738chr104742 586 563 279 2623 254 ----
NM_021785chrX--171 ----
NM_021813chr695721 5197 4813 4705 4468 2100 982 757 69 1650 14557 --
NM_021818chr14175 11029 1571 --
NM_021871chr4147 ------
NM_021872chr2021139 440 ------
NM_021873chr2021139 440 ------
NM_021911chr574856 4528 4156 3669 1889 1590 330 1640 25222 3602 --
NM_021912chr1533392 2746 736 --11588 --
NM_021914chr1452263 974 433 404 277 --1511 --
NM_021940chr631364 1066 454 ------
NM_021945chr652282 1309 854 654 476 --22364 264 --
NM_021946chrX21257 142 ------
NM_021947chr1751145 484 446 347 286 ------
NM_021949chrX32719 1038 446 ------
NM_021950chr1122229 1386 ------
NM_021956chr61266 ------
NM_021959chr6121 ------
NM_021961chr1187081 6592 6057 5623 4928 2252 1499 659 26364 5430 34588 1381 362 --
NM_021962chr1721794 104 --1357 --
NM_021964chr3106547 5925 5391 4037 1294 1155 395 175 156 33 22103 753 14629 22244 927
NM_021973chr43578 230 115 ------
NM_021976chr64769 676 670 301 ------
NM_021980chr10----21410 170 --
NM_021994chr7--1178 1954 --
NM_021998chrX51532 1207 982 557 202 11136 --11524
NM_022006chr192372 98 ------
NM_022041chr1642670 552 450 330 ------
NM_022048chr1555879 5415 4089 752 549 24451 1493 11396 --
NM_022051chr11109 --1567 --
NM_022058chr23581 507 30 --1557 --
NM_022062chr1131952 1761 21 ------
NM_022064chr31206 ------
NM_022068chr181178 --182 --
NM_022079chr102718 39 ------
NM_022080chr2052432 1897 1794 375 342 22631 672 2627 248 --
NM_022114chr134658 4056 3581 24467 1691 ----
NM_022118chr133426 187 69 ------
NM_022123chr14158 --185 --
NM_022130chr541392 1181 369 88 ------
NM_022137chr1441688 782 438 132 ------
NM_022138chr641087 382 107 100 1266 ----
NM_022154chr4--138 ----
NM_022166chr1655554 5483 5372 2259 533 --25764 1132 --
NM_022346chr42346 125 ------
NM_022361chr61408 ------
NM_022373chr7----2964 360 --
NM_022457chr1127 ------
NM_022459chr1324532 1988 24692 1811 11396 --
NM_022465chr1252411 1932 663 411 182 --12991 --
NM_022469chr132544 1065 483 --1127 --
NM_022473chr151773 13145 34470 2982 1311 --
NM_022474chr1452487 1829 1079 936 259 ----11857
NM_022475chr41713 141 ----
NM_022476chr163331 226 30 --1421 --
NM_022483chr511500 --2692 586 --
NM_022484chr741391 1094 250 33 ------
NM_022491chr1252311 1005 407 153 131 ------
NM_022494chr101352 ------
NM_022572chr211620 11646 ----
NM_022658chr1221130 467 --11339 --
NM_022716chr133036 2058 671 --12774 --
NM_022719chr2293691 3375 2940 2489 2385 1488 716 431 171 --43843 3723 2424 948 --
NM_022728chr71211 --1679 --
NM_022735chr141672 1601 172 85 ----11262
NM_022739chr172852 453 ------
NM_022749chr831398 1390 68 ------
NM_022753chr142223 2081 1050 296 22580 1962 160 --
NM_022755chr932499 663 159 ----12017
NM_022763chr362873 2561 2207 2043 684 578 1426 22488 2386 --
NM_022771chr122385 308 --158 --
NM_022780chr261559 1390 689 588 493 53 1266 ----
NM_022781chr93659 588 582 --22228 908 --
NM_022824chr541641 735 561 389 1438 11189 --
NM_022826chr2------1931
NM_022828chr531487 1405 1245 11611 --1167
NM_022831chr141651 1632 1591 1323 ------
NM_022841chr1552513 2275 1708 857 763 --12728 --
NM_022843chr133525 396 204 11039 21408 185 --
NM_022845chr1671700 1518 743 636 445 404 186 21857 1498 1503 --
NM_022893chr262602 2280 2018 796 583 292 12997 --12167
NM_022894chr241135 477 260 180 ----11441
NM_022898chr14114630 4482 4095 3708 1531 1381 1279 856 694 270 132 11402 1663 --
NM_022900chr711110 ------
NM_022918chr1111678 ------
NM_022977chrX42569 2200 1040 899 ------
NM_023000chr1451651 1635 1541 393 82 1281 1483 --
NM_023001chr1451651 1635 1541 393 82 1281 1483 --
NM_023008chr19177 --1133 --
NM_023009chr11673 ------
NM_023010chrX1846 ------
NM_023012chr12181 --2774 536 --
NM_023016chr232473 492 486 12017 12511 12062
NM_023072chr19185 1865 ----
NM_023076chr1672467 2415 2166 775 720 162 48 --31853 992 385 22966 566
NM_023105chr822387 285 --12235 --
NM_023106chr822387 285 --12235 --
NM_023110chr822387 285 --12235 --
NM_023111chr822387 285 --12235 --
NM_023112chr1432992 2759 2536 ------
NM_023923chr143704 1103 579 533 --4760 150 136 83 --
NM_023927chr521054 868 ------
NM_023929chr842620 2107 867 34 --11796 --
NM_023940chr431022 956 380 ------
NM_024007chr532555 1981 578 ------
NM_024017chr1721363 618 ------
NM_024019chr43967 260 163 ------
NM_024037chr1----1840 --
NM_024052chr1742039 1998 991 262 --11045 --
NM_024060chr112221 63 ------
NM_024061chr71606 ------
NM_024071chr141564 --1445 --
NM_024089chr131164 ------
NM_024090chr41222 --1759 --
NM_024094chr83916 115 75 --1136 --
NM_024095chr122240 61 --1400 1329
NM_024102chr121196 295 ------
NM_024107chr173733 670 594 --1583 --
NM_024297chr172458 103 ------
NM_024312chr121410 --147 137
NM_024315chr7------122
NM_024324chr221150 ------
NM_024344chr153502 417 343 ------
NM_024345chr934594 769 218 24522 4104 21576 153 --
NM_024408chr143468 1083 1037 333 --13218 --
NM_024415chr51228 ------
NM_024416chr91225 --11305 1394
NM_024490chr152539 520 ------
NM_024491chr31621 ------
NM_024496chr14------1281
NM_024513chr353624 2565 773 722 163 --33464 3365 72 --
NM_024524chr333177 2662 90 12957 12097 --
NM_024525chr1----1559 --
NM_024529chr11256 ------
NM_024539chrX21075 972 --1474 --
NM_024548chr341617 1386 1164 241 ------
NM_024557chr11188 11573 ----
NM_024561chr1331087 1019 73 --1444 --
NM_024567chr81275 ------
NM_024569chr132825 2704 338 ----1498
NM_024574chr41107 ------
NM_024582chr4----2746 252 --
NM_024612chr172371 82 1767 3979 801 106 --
NM_024615chr5------1230
NM_024617chr9----1715 --
NM_024639chr61551 --11863 --
NM_024645chr821603 296 --142 --
NM_024646chr133814 786 141 11541 42768 1581 1396 1228 --
NM_024656chr1961562 1094 1054 1036 382 167 ----1261
NM_024659chr2--1706 ----
NM_024665chr3134381 4251 3679 3602 3506 3414 3362 3344 1810 1779 1707 1341 1332 14213 11852 1251
NM_024670chr101462 1269 21549 1364 --
NM_024674chr143158 699 439 100 11290 12465 --
NM_024680chr111378 ------
NM_024689chrX21159 35 ------
NM_024700chr161147 796 783 228 90 70 ------
NM_024713chr151263 --21335 26 11357
NM_024721chr852079 1052 984 871 206 1898 1514 --
NM_024725chr112203 160 ------
NM_024745chr161385 --2719 311 --
NM_024749chr151987 1623 700 625 52 --1459 --
NM_024751chr431669 450 95 1355 1598 1535
NM_024755chr151746 --1376 --
NM_024757chr9----11170 --
NM_024761chr964048 3448 3437 3416 1977 286 --25252 617 11040
NM_024770chr286685 6438 5707 5669 5590 4952 273 148 --35894 1948 677 --
NM_024786chr510913 790 769 748 727 704 681 660 637 616 ------
NM_024792chr172403 55 --2953 182 --
NM_024804chr11340 --1129 --
NM_024824chr1431556 1409 465 ------
NM_024835chr17--1297 ----
NM_024837chr1521949 371 ------
NM_024852chr1133 ------
NM_024881chr1943698 3446 921 763 13814 33578 1085 341 --
NM_024884chr1453918 3912 3243 2932 1346 --23770 365 --
NM_024887chr131582 583 301 ------
NM_024900chr441726 1475 855 525 11702 ----
NM_024900chr441726 1475 855 525 11702 ----
NM_024930chr52312 80 ------
NM_024939chr1621679 1061 ------
NM_024947chr3119173 9164 8820 7715 5825 3301 2827 2508 2123 1103 177 26793 2366 39315 8842 8587 29394 1332
NM_024949chr453725 3420 1248 932 669 --1453 --
NM_024953chr1221837 22 1606 12073 --
NM_024971chr9----1178 --
NM_024989chr2118091 8036 7371 7063 6129 2886 2730 2113 1380 361 337 --17927 --
NM_024991chr1042830 2366 2077 839 1829 12169 --
NM_024993chr221462 236 --124 --
NM_025054chr811269 --11410 --
NM_025065chr13612 599 95 ------
NM_025073chr163920 1270 918 538 349 69 1722 33641 1515 316 --
NM_025076chr21198 ------
NM_025126chr12--1527 ----
NM_025133chr22308 210 --1423 --
NM_025134chr1622140 1828 --11694 --
NM_025138chr132471 159 ------
NM_025146chr33504 431 29 12459 11038 --
NM_025147chr211066 --196 --
NM_025151chr822135 1717 --32042 1610 822 --
NM_025152chr1431356 708 242 11389 11231 --
NM_025154chr72287 281 11086 11273 --
NM_025160chr12624 590 24174 3671 23882 1343 --
NM_025179chr144526 3703 3183 1678 --23856 1316 --
NM_025181chr21625 --1181 --
NM_025182chr921044 818 --1986 --
NM_025184chrX1835 ------
NM_025187chr16----1447 --
NM_025191chr14839 647 285 239 1518 ----
NM_025195chr831538 331 45 ----1687
NM_025208chr1142211 2103 706 607 1216 22443 590 --
NM_025212chr4131 ------
NM_025221chr42890 574 1411 ----
NM_025222chr322164 474 23016 2809 22287 1869 --
NM_025235chr1022194 1617 --22032 209 1372
NM_025237chr17----1312 --
NM_025244chr2--182 ----
NM_025263chr651577 719 683 665 192 --11221 --
NM_030594chr151135 1867 1389 --
NM_030621chr1473385 3075 2905 2899 1389 1345 1312 11646 ----
NM_030625chr1012581 --1626 --
NM_030627chr543645 3191 1636 611 23079 797 33936 3271 882 --
NM_030629chr1631746 1473 660 ------
NM_030637chr14----1141 --
NM_030647chr755502 5201 2297 875 147 --26016 1515 16254
NM_030648chr443592 2152 1045 696 13650 21198 232 25296 1127
NM_030650chr2103948 3751 3644 3340 1689 982 760 736 588 525 176 ----
NM_030661chr741575 553 453 418 1676 11365 --
NM_030664chr1031930 1632 448 ------
NM_030670chr1241969 1571 785 186 ------
NM_030671chr1241969 1571 785 186 ------
NM_030674chr1245659 5425 4011 540 21699 883 1254 --
NM_030752chr61135 --1171 --
NM_030755chr1422285 158 ------
NM_030758chr22175 1438 ----
NM_030759chr101662 ------
NM_030762chr1241724 1572 1367 1268 ------
NM_030780chr81331 ------
NM_030791chr142605 148 11360 11141 --
NM_030803chr231041 461 133 ------
NM_030806chr1159261 8841 8444 7932 7730 6586 6515 6427 5796 2936 2729 2489 1448 906 100 --16507 --
NM_030808chr171241 1908 ----
NM_030816chr1--33650 1170 609 23116 849 --
NM_030817chr1283519 3493 3442 3307 2862 2737 644 292 11495 22666 2355 --
NM_030820chr62731 209 ------
NM_030884chr322239 1422 --1254 --
NM_030891chr2111109 --11333 --
NM_030906chr111410 --153 --
NM_030911chr1331649 1639 50 ------
NM_030913chr1----1232 --
NM_030915chr2----32343 825 803 --
NM_030918chr155160 4653 4108 3820 2151 --24632 1379 --
NM_030920chr121572 336 --11889 --
NM_030922chr153756 624 343 ------
NM_030926chr22889 94 ------
NM_030939chr62471 124 ------
NM_030949chr631379 1101 58 ------
NM_030953chr531035 584 109 11077 ----
NM_030963chr62616 93 ------
NM_030964chr542722 2583 1465 690 --33381 2953 197 --
NM_030979chr131333 ------
NM_030981chr1121158 97 ------
NM_031157chr121234 ------
NM_031208chr16----2715 134 1624
NM_031216chr1821707 872 --1645 --
NM_031217chr11----1129 --
NM_031226chr152811 116 --2465 33 --
NM_031243chr742383 2018 1639 313 ------
NM_031262chr931121 773 97 ------
NM_031263chr931178 830 154 ------
NM_031266chr51423 ------
NM_031268chr1664497 4362 3917 3714 2076 1347 --34607 3697 134 --
NM_031283chr22318 293 1619 1138 --
NM_031314chr1431514 1320 53 ------
NM_031371chr151268 1205 1128 152 97 2143 31 31394 1222 23 --
NM_031371chr151268 1205 1128 152 97 2143 31 31394 1222 23 --
NM_031407chrX2507 409 ------
NM_031411chr512013 1158 12264 --
NM_031419chr31408 ----11485
NM_031422chr181503 ------
NM_031424chr201156 ------
NM_031427chr1495384 5313 5076 4665 4138 3877 3764 2036 811 14115 24166 1557 --
NM_031435chr1242893 2749 2490 447 33096 2991 69 22982 649 --
NM_031442chrX32167 1108 923 --12143 --
NM_031445chr221358 692 ----12112
NM_031461chr821544 548 32235 2116 382 ----
NM_031468chr766342 5604 3172 1433 671 167 --47098 5697 2312 710 --
NM_031469chr693462 2943 2883 1489 1178 814 455 273 33 ------
NM_031483chr2063416 2772 2625 1387 772 418 ------
NM_031492chr111508 ------
NM_031844chr154132 3254 2856 735 212 --24142 3380 --
NM_031845chr253610 3342 3310 663 290 --1609 --
NM_031847chr253610 3342 3310 663 290 --1609 --
NM_031849chr512013 1158 12264 --
NM_031857chr512013 1158 12264 --
NM_031860chr512013 1158 12264 --
NM_031890chr2222748 862 1205 1777 13022
NM_031935chr12970 148 --1389 --
NM_031942chr21454 11277 2929 359 --
NM_031953chr41476 ------
NM_032017chr121639 26 --11534 11593
NM_032021chr1131101 983 215 ------
NM_032028chr52628 539 ------
NM_032042chr53668 245 232 ----12012
NM_032047chr322118 2057 --1430 --
NM_032052chr221325 --1985 --
NM_032088chr51627 --11678 --
NM_032092chr51627 --11678 --
NM_032102chr1142960 2495 1092 749 --12050 1931
NM_032121chrX42758 2608 2403 34 ------
NM_032124chr1831069 957 832 ------
NM_032142chr18--1191 ----
NM_032144chr22424 154 --21672 1140 1547
NM_032145chr661685 1467 1397 1334 440 155 --11247 --
NM_032146chr3--1119 ----
NM_032147chr1211040 ------
NM_032153chr332762 926 331 ------
NM_032154chr101943 ------
NM_032160chr1834295 1591 869 ------
NM_032182chr10130 11053 ----
NM_032186chr12523 484 ------
NM_032199chr1063869 3219 2406 1176 989 364 23796 996 --13465
NM_032208chr222967 2265 --22795 2415 --
NM_032217chr421200 303 --1213 --
NM_032221chr2031923 1323 818 --1270 --
NM_032226chr94833 816 776 70 ------
NM_032228chr1153242 2831 2666 2388 999 --23408 2884 --
NM_032229chr132998 445 ------
NM_032233chr142760 331 ------
NM_032236chr12937 706 ------
NM_032239chr421215 152 --2924 905 --
NM_032242chr342067 914 420 242 --23325 2455 --
NM_032246chr1531154 232 74 1324 ----
NM_032256chr12--1791 ----
NM_032268chr1673044 2951 2152 1104 1016 818 255 ------
NM_032281chr1933167 2086 159 ------
NM_032288chr312304 ------
NM_032291chr13622 386 104 --1290 --
NM_032299chr11192 ------
NM_032303chr92668 494 ----11386
NM_032312chr22851 253 --1135 --
NM_032320chr111322 --1193 --
NM_032321chr253189 1155 978 438 158 21033 859 2269 167 12835
NM_032352chr1421133 133 --21428 581 11403
NM_032373chr1025298 1993 14790 45700 4940 4748 3925 14207
NM_032403chr51627 --11678 --
NM_032410chr8----11211 --
NM_032411chr2----1215 --
NM_032420chr51347 ------
NM_032424chr1111469 1573 --11088
NM_032433chr1911257 11343 1617 11481
NM_032437chr12149 123 ------
NM_032438chr671647 1507 1329 1285 1223 335 30 ------
NM_032439chr10151 --1461 --
NM_032440chr1022867 44 --22614 2004 --
NM_032445chr1522411 419 --1938 --
NM_032457chr411265 --13678 --
NM_032458chrX23237 3156 --23076 2335 32873 2549 664
NM_032466chr83472 243 161 --1460 --
NM_032468chr83472 243 161 --1460 --
NM_032482chr191601 1740 ----
NM_032491chr1241049 1025 440 258 ------
NM_032494chr2----142 --
NM_032499chr151462 --1235 --
NM_032505chr352777 2707 2447 2343 446 --32467 819 216 1323
NM_032509chr82874 587 12473 ----
NM_032511chr61444 ------
NM_032521chr2043040 2952 2387 1165 ------
NM_032532chr61656 ------
NM_032539chrX2553 287 ------
NM_032547chr41284 ------
NM_032557chr42775 353 ----1302
NM_032569chr162618 236 --11607 11420
NM_032582chr17----21497 1284 --
NM_032603chr2----1732 --
NM_032632chr1431463 371 189 --1150 --
NM_032638chr331563 1094 30 --170 --
NM_032663chr1242040 1380 227 35 ------
NM_032682chr331110 451 253 12778 23379 2347 --
NM_032701chr19----1634 --
NM_032727chr10149 ------
NM_032777chr821461 315 --11178 --
NM_032778chr323124 1213 --1745 --
NM_032780chr112361 164 --1799 --
NM_032781chr113629 160 32 --1993 --
NM_032784chr62728 229 ------
NM_032801chr1132535 1926 1626 --1567 --
NM_032812chr10129 ------
NM_032829chr1211079 11090 ----
NM_032837chr1762167 2158 2128 1462 528 40 ------
NM_032844chr102356 251 ------
NM_032859chr1353452 1571 880 504 420 --22800 2775 --
NM_032867chr111125 1595 ----
NM_032870chr62401 107 ------
NM_032873chr1164455 4269 3740 3523 835 391 23701 1238 32795 712 694 --
NM_032875chr171797 ------
NM_032883chr202688 41 --1566 --
NM_032900chr102375 107 --13424 --
NM_032906chr41746 1797 ----
NM_032918chr1231258 1150 228 1333 ----
NM_032932chr1775514 4930 1863 1537 1093 749 223 11231 14519 --
NM_032936chr7----1190 --
NM_032961chr42887 264 ------
NM_032975chr1873324 3153 2838 2580 2329 1109 837 --1406 --
NM_032978chr182939 373 --1151 --
NM_032979chr182939 373 --1151 --
NM_032980chr1873324 3153 2838 2580 2329 1109 837 --1406 --
NM_032981chr182939 373 --1151 --
NM_032991chr441421 1147 493 113 ------
NM_033014chr91225 --11305 1394
NM_033020chr164536 3903 3831 3432 3030 758 --14014 --
NM_033023chr71196 ------
NM_033030chr211564 ------
NM_033055chr1195 ------
NM_033071chr62573 247 1730 ----
NM_033117chr9169 --2375 120 --
NM_033127chr1--2285 137 ----
NM_033132chr1331446 442 403 ------
NM_033133chr1733051 2782 2354 13704 ----
NM_033135chr1142211 2103 706 607 1216 22443 590 --
NM_033136chr541749 1396 1385 658 21702 711 ----
NM_033137chr541749 1396 1385 658 21702 711 ----
NM_033138chr741941 1864 415 196 ------
NM_033139chr741941 1864 415 196 ------
NM_033140chr741941 1864 415 196 ------
NM_033141chr1441576 607 593 126 --21995 1708 --
NM_033143chr434316 3747 914 31848 1827 1610 ----
NM_033150chr12----156 --
NM_033157chr741941 1864 415 196 ------
NM_033181chr6103776 3167 3054 2827 2810 2506 2415 748 556 409 --23835 1410 --
NM_033207chr1042431 2309 67 34 --22639 815 --
NM_033211chr531987 379 177 --1388 11909
NM_033222chr961278 1143 1016 1010 490 174 --11108 --
NM_033224chr757706 5628 5121 4881 2263 26968 389 32981 1390 478 --
NM_033254chr33497 488 126 ------
NM_033260chr6181 --1144 --
NM_033272chr21123 --1333 --
NM_033285chr874448 4394 3112 1315 867 697 480 12900 54372 3064 856 428 300 --
NM_033300chr121158 399 ------
NM_033326chr1132406 84 29 11759 ----
NM_033331chr953284 3025 2841 1189 456 ------
NM_033334chr91254 --1108 --
NM_033360chr1264350 4319 3369 1301 210 136 --1199 --
NM_033387chr922615 2272 22637 679 ----
NM_033389chr1784718 4342 4194 3834 3568 3136 1842 78 13597 ----
NM_033394chr221617 1483 --21125 646 --
NM_033396chr111158 --1314 --
NM_033425chr1133252 3092 948 1181 32695 963 928 13207
NM_033430chr463975 3917 1494 886 539 256 ------
NM_033437chr463975 3917 1494 886 539 256 ------
NM_033496chr101473 --138 --
NM_033497chr101473 --138 --
NM_033498chr101473 --138 --
NM_033500chr101473 --138 --
NM_033503chr1543733 3626 1541 910 11270 23694 3258 --
NM_033505chr2126544 5448 5346 5008 4720 2512 2079 1532 1325 715 115 29 12346 45566 5044 4945 4892 --
NM_033512chr832879 2811 601 1136 ----
NM_033535chr431104 1088 60 ------
NM_033550chr2042270 1882 1810 144 --1441 --
NM_033624chr1242077 401 357 226 ------
NM_033631chr143249 2617 1259 1017 ------
NM_033632chr41430 ------
NM_033642chrX1309 --1217 --
NM_033644chr542277 474 400 375 1860 ----
NM_033645chr542277 474 400 375 1860 ----
NM_033656chr2175555 4981 3921 1086 314 187 166 25144 47 24821 739 --
NM_033666chr102892 793 1111 ----
NM_052827chr12--1211 11053 --
NM_052832chr842886 1997 1871 66 12966 ----
NM_052834chr1822346 2282 --21924 365 --
NM_052865chr20------1916
NM_052879chr1212831 1697 1408 12518
NM_052880chr2231462 1394 978 --1899 --
NM_052885chr1234251 1562 1149 ------
NM_052886chr821923 681 12059 ----
NM_052896chr132553 2120 758 ------
NM_052900chr811469 --11290 --
NM_052904chr63477 299 272 1387 ----
NM_052905chr241605 745 718 663 --1752 --
NM_052910chr1341767 1674 1656 1622 ------
NM_052911chr181694 ------
NM_052918chr1053707 3316 2539 1373 564 ------
NM_052923chr6154 ------
NM_052934chr121593 43 ------
NM_052971chr52326 78 ------
NM_053016chr9137987 7902 7883 6487 6177 5640 5471 5251 3018 1784 1499 1347 343 --26616 2705 11205
NM_053023chr1172889 2412 2306 1056 966 808 508 --12941 184
NM_053024chr331472 1364 228 11520 1996 --
NM_053025chr32593 459 11177 ----
NM_053026chr32593 459 11177 ----
NM_053027chr32593 459 11177 ----
NM_053028chr32593 459 11177 ----
NM_053031chr32593 459 11177 ----
NM_053032chr32593 459 11177 ----
NM_053043chr712325 34478 2480 411 34812 4392 1621 --
NM_053056chr1173105 3085 2408 1113 1048 560 335 --21019 93 --
NM_053064chr1442676 1990 1873 92 12359 32257 2169 986 --
NM_053067chr92350 131 1227 ----
NM_053274chr1----142 --
NM_053281chrX1410 ------
NM_054026chr81890 ------
NM_057089chr71166 --1503 --
NM_057169chr1263070 2685 2670 2446 1933 686 --22814 2314 11080
NM_057170chr1263070 2685 2670 2446 1933 686 --22814 2314 11080
NM_057175chr432105 746 406 ------
NM_058170chr11234 --2426 117 --
NM_058172chr451704 1383 1139 416 88 ------
NM_058191chr213901 780 562 --1133 1671
NM_058229chr8167 ------
NM_058237chr141718 1320 1421 2799 368
NM_058240chr14159 --11246 --
NM_058241chr23721 612 309 21705 836 12268 12259
NM_058241chr23721 612 309 21705 836 12268 12259
NM_078467chr661309 1291 1268 1153 472 230 ------
NM_078469chr1031173 1135 919 --1413 --
NM_078629chrX2562 505 ------
NM_078630chrX2562 505 ------
NM_079420chr2124 ------
NM_079422chr2124 ------
NM_079837chr161627 ------
NM_080422chr181324 ------
NM_080423chr181324 ------
NM_080425chr201325 ------
NM_080426chr201325 ------
NM_080546chr921447 903 ------
NM_080597chr182881 133 2908 216 ----
NM_080599chr1011125 ------
NM_080626chr12------1325
NM_080632chrX1846 ------
NM_080645chr622196 222 ------
NM_080664chr14----1103 --
NM_080676chr2032873 1138 147 23190 856 ----
NM_080682chr12613 542 ------
NM_080723chr621326 545 ------
NM_080738chr11380 --11726 --
NM_080742chr6182 ------
NM_080743chr642139 1664 320 258 --31819 963 365 12123
NM_080759chr1321766 653 ------
NM_080760chr1321766 653 ------
NM_080832chrX1200 --1576 --
NM_080840chr201169 ------
NM_080841chr201169 ------
NM_080867chr1454528 4497 1867 1586 1206 1693 21668 1548 --
NM_080872chr823049 990 22991 524 22920 1585 12858
NM_080927chr353140 2723 1175 504 277 13228 ----
NM_100264chr103787 663 649 181 ----
NM_100486chr103787 663 649 181 ----
NM_130386chr181105 ------
NM_130391chr943005 2490 2185 78 11403 12199 --
NM_130392chr943005 2490 2185 78 11403 12199 --
NM_130393chr943005 2490 2185 78 11403 12199 --
NM_130434chr15------1447
NM_130435chr101401 --32682 1008 439 --
NM_130439chr1021705 685 --22206 889 --
NM_130439chr1021705 685 --22206 889 --
NM_130440chr141390 1027 281 215 ------
NM_130468chr151743 1727 ----
NM_130469chr145941 914 866 600 215 ------
NM_130781chr52536 160 ------
NM_130798chr151310 ------
NM_130808chr3182 --1349 --
NM_130809chr54949 653 326 223 --1790 --
NM_130811chr201281 ------
NM_133170chr2087882 7801 7000 6032 5043 2388 1342 645 --27589 1610 --
NM_133264chr1723632 2846 --33183 2559 458 --
NM_133265chrX62715 2433 1121 1076 704 468 1879 ----
NM_133266chr112970 363 ------
NM_133330chr432155 1243 1105 --1715 13219
NM_133331chr432155 1243 1105 --1715 13219
NM_133334chr4106106 6069 5874 5305 4661 2236 1787 1750 1168 769 --15502 --
NM_133335chr432155 1243 1105 --1715 13219
NM_133372chr532105 2065 141 172 22139 247 --
NM_133433chr51873 ------
NM_133444chr191452 --11099 --
NM_133445chr922401 1055 --13335 --
NM_133473chr192753 26 --21803 74 1653
NM_133476chr12----11052 --
NM_133478chr2148 --1761 --
NM_133493chr674623 3002 1719 1318 1025 792 349 --13802 --
NM_133496chr184350 4206 3879 3374 1651 1079 848 117 --21816 1498 --
NM_133631chr321531 323 ------
NM_133647chr1543622 2423 1013 360 --21392 1246