TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3064-3p
miRNA Sequence: UUGCCACACUGCAACACCUUACA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr52579 462 --11523 --
NM_000084chrX46927 5745 1644 755 --14726 --
NM_000090chr21917 ------
NM_000109chrX1200 ------
NM_000110chr1----1244 1302
NM_000125chr653701 1048 943 526 166 ------
NM_000138chr1511773 1720 ----
NM_000165chr62357 101 1350 ----
NM_000176chr522490 147 ------
NM_000245chr711449 ------
NM_000264chr931294 1118 227 --1475 --
NM_000314chr1012888 --12758 1426
NM_000332chr666592 6221 4743 2693 1313 772 --1410 --
NM_000337chr534822 2214 1667 ----24933 4251
NM_000368chr934042 1345 1286 1792 11675 14583
NM_000390chrX22435 1118 ------
NM_000393chr221631 641 ----12075
NM_000408chr211292 1835 23002 975 --
NM_000428chr142950 590 ----122
NM_000430chr1722913 623 13599 ----
NM_000435chr191856 ------
NM_000439chr532532 664 433 --1119 --
NM_000459chr91237 ------
NM_000489chrX1930 ------
NM_000503chr81152 ------
NM_000533chrX1792 ------
NM_000544chr6_cox_hap123184 2336 --22966 251 --
NM_000555chrX45926 4963 1770 1657 27197 1760 --16679
NM_000598chr731210 498 113 ------
NM_000633chr1883878 3851 3413 1784 1355 1142 1073 333 --24189 1714 --
NM_000680chr81134 ------
NM_000685chr3------1734
NM_000685chr3------1734
NM_000693chr1531756 1669 310 --148 --
NM_000702chr142250 2058 1524 93 1104 ----
NM_000719chr1264083 1775 1191 1073 908 714 14963 ----
NM_000726chr2----1942 --
NM_000780chr8197 --1354 --
NM_000793chr1444992 1100 845 478 1679 1992 --
NM_000801chr203738 714 348 ------
NM_000813chr53853 197 137 ------
NM_000814chr151485 ------
NM_000827chr521935 810 ------
NM_000829chr111926 ------
NM_000839chr31457 ------
NM_000845chr7----135 --
NM_000872chr101337 ------
NM_000875chr1555020 4823 2140 1921 423 14981 --14673
NM_000956chr142307 139 ------
NM_000965chr3----11102 --
NM_001001323chr1212894 ------
NM_001001394chr21542 ------
NM_001001396chr154164 3709 3623 3179 1106 11212 11159 --
NM_001001481chr813202 ------
NM_001001560chr222550 515 ------
NM_001001664chr211468 --12997 --
NM_001001938chr92362 60 ------
NM_001001971chr101114 ------
NM_001001974chr101478 22050 265 ----
NM_001002295chr101165 ------
NM_001002860chr1444358 4075 3804 1021 ------
NM_001003407chr1064852 4754 4329 844 471 44 11752 ----
NM_001003408chr1064852 4754 4329 844 471 44 11752 ----
NM_001003652chr1898406 6138 3082 2835 2787 2523 964 654 69 ------
NM_001003674chr1827055 1749 11321 ----
NM_001003675chr1827055 1749 11321 ----
NM_001003681chr221265 --11981 --
NM_001003698chr61600 ------
NM_001003699chr61600 ------
NM_001003712chr1221013 766 ----11146
NM_001003792chr31194 ------
NM_001003793chr31194 ------
NM_001003810chr41799 ------
NM_001004065chr953423 2887 2439 1359 362 ------
NM_001004304chr1253035 2088 2049 852 305 ------
NM_001004317chr644048 3901 1784 1178 ----1896
NM_001004360chr221962 1505 ------
NM_001004419chr1233428 896 407 ----14499
NM_001005366chr121159 ------
NM_001005404chr1754365 1288 997 606 360 13966 ----
NM_001005463chr1041965 883 551 470 ------
NM_001005473chr536535 6328 5106 15757 24490 1947 --
NM_001005746chr2----1942 --
NM_001005747chr2----1942 --
NM_001005782chr22284 72 ------
NM_001005910chr31453 ------
NM_001005911chr31453 ------
NM_001006600chr53869 615 151 ------
NM_001006684chrX1383 ------
NM_001007023chr1444992 1100 845 478 1679 1992 --
NM_001007097chr943277 3131 1128 37 ------
NM_001007226chr172295 132 --11104 --
NM_001007227chr172295 132 --11104 --
NM_001007228chr172295 132 --11104 --
NM_001007229chr172295 132 --11104 --
NM_001007230chr172295 132 --11104 --
NM_001007466chr675106 4888 4490 1008 985 325 254 --1979 21884 386
NM_001007546chr221600 1234 ------
NM_001007794chr11786 ----1626
NM_001008239chr1832633 2598 867 --21176 107 --
NM_001008401chr19--1111 1512 2598 345
NM_001008408chr766014 5986 5104 1544 998 305 15870 --16284
NM_001008539chr855389 4499 3688 687 358 ------
NM_001008540chr21420 ------
NM_001008738chr522471 200 ------
NM_001008801chr1921517 653 ----4875 709 358 103
NM_001009899chr345563 5487 4862 1385 15917 24548 2610 --
NM_001009960chr722095 1818 ----2262 98
NM_001009993chr293886 3701 3645 3630 3620 3228 3066 1083 736 ------
NM_001010853chr642721 2269 2187 565 22730 445 2656 434 --
NM_001010862chrX43269 2554 1164 722 --11315 --
NM_001010867chr185195 4508 2691 2038 1808 1626 530 217 ------
NM_001010888chrX33556 3364 469 --22855 1442 --
NM_001010927chr61423 157 ----
NM_001010971chr11999 ------
NM_001011663chr101725 ------
NM_001011885chr1511589 ------
NM_001012393chr1111301 --13795 14410
NM_001012420chr1542901 1981 473 182 ------
NM_001012423chr1542901 1981 473 182 ------
NM_001012753chr19------2454 102
NM_001012755chrX35117 837 540 13212 ----
NM_001012977chrX3561 343 293 ------
NM_001013398chr731210 498 113 ------
NM_001013415chr411121 ------
NM_001013693chr172833 996 950 921 666 506 339 --12933 --
NM_001013693chr172833 996 950 921 666 506 339 --12933 --
NM_001013746chr7--1658 1157 6743 574 490 410 326 242
NM_001013843chr151339 --1308 --
NM_001014380chr1343640 2303 1872 1065 --1624 --
NM_001014434chr11350 ------
NM_001014797chr1077847 7139 7103 6078 2422 2272 1874 --26187 1684 --
NM_001014809chr44921 658 169 159 ------
NM_001015508chr81617 ------
NM_001015877chrX32058 1203 412 --12268 --
NM_001015887chr311259 ------
NM_001017371chr22311 29 --11380 --
NM_001017395chr343395 3180 2677 316 ------
NM_001017424chr141650 1178 771 519 ------
NM_001017425chr141650 1178 771 519 ------
NM_001017926chr811594 ------
NM_001018050chr2283172 3007 2999 970 749 212 206 46 23033 2226 ----
NM_001018052chr2283172 3007 2999 970 749 212 206 46 23033 2226 ----
NM_001018056chr91210 ------
NM_001018067chr135033 4023 3445 24938 1236 --14857
NM_001018068chr135033 4023 3445 24938 1236 --14857
NM_001018069chr135033 4023 3445 24938 1236 --14857
NM_001018074chr522490 147 ------
NM_001018075chr522490 147 ------
NM_001018076chr522490 147 ------
NM_001018077chr522490 147 ------
NM_001018088chr15155 --1172 --
NM_001018108chr151810 ------
NM_001023567chr1532293 1998 1987 --1728 --
NM_001024024chr141173 ------
NM_001024070chr141169 ------
NM_001024094chr522490 147 ------
NM_001024460chr63994 360 189 ------
NM_001024463chr153854 290 164 ------
NM_001024808chr121351 ------
NM_001024934chr6152 ------
NM_001024935chr6152 ------
NM_001024936chr6152 ------
NM_001024947chr51403 ------
NM_001025076chr1021251 809 --21863 94 1319
NM_001025077chr1034863 2609 2167 --11452 11677
NM_001025079chr313181 ------
NM_001025232chr12193 ------
NM_001025266chr364166 3770 3440 972 587 140 ------
NM_001025356chr1221167 1063 --22902 2471 --
NM_001025580chrX----12741 --
NM_001025595chr421263 1185 ----1551
NM_001029858chr632199 1249 768 11102 --13368
NM_001029863chr633184 2312 1172 ------
NM_001029882chr11497 ------
NM_001029882chr11497 ------
NM_001030055chr1443469 1293 1005 656 --13592 1286
NM_001031695chr2221267 529 ----1262
NM_001031732chr422871 709 11187 13180 --
NM_001031812chr52267 146 2716 634 --1658
NM_001032999chr2054555 3546 2080 1419 1367 ------
NM_001033030chr3------152
NM_001033031chr3------152
NM_001033032chr3------152
NM_001033049chr211399 ------
NM_001033081chr1--11464 ----
NM_001033082chr1--11464 ----
NM_001033117chr364187 3404 1374 1186 960 38 --23983 3835 11033
NM_001033507chr121343 694 ----11905
NM_001033561chr17----1708 --
NM_001033602chr1362519 2410 2126 2104 1037 589 ------
NM_001034852chr1422036 1542 ------
NM_001037132chr712124 ------
NM_001037133chr712124 ------
NM_001037172chr3----2871 177 --
NM_001037174chr212174 ------
NM_001037324chr31745 ------
NM_001037533chr11301 ------
NM_001037553chr2165084 3857 3405 1326 1119 41 ------
NM_001037954chr1142814 2669 2476 504 ------
NM_001038702chr53756 744 728 --1552 --
NM_001039538chr233181 800 619 ------
NM_001039569chr223032 2192 ------
NM_001039590chrX32829 2664 1484 ------
NM_001039591chrX32829 2664 1484 ------
NM_001039618chr1114778 --25423 4042 --
NM_001039709chr2054555 3546 2080 1419 1367 ------
NM_001039762chr10196 ------
NM_001039840chrX14530 --1591 --
NM_001039960chr1221118 37 ------
NM_001040110chr721758 464 --1246 11895
NM_001040157chr411990 ------
NM_001040181chr31182 ----1945
NM_001040182chr31182 ----1945
NM_001040183chr31182 ----1945
NM_001040199chr31182 ----1945
NM_001040200chr31182 ----1945
NM_001040272chr922079 696 --12021 --
NM_001040284chr1644976 4712 4669 2243 1771 14516 --
NM_001040424chr2122545 447 11175 22853 2205 --
NM_001040429chr131448 22816 862 --1544
NM_001040653chr32851 253 --22304 642 --
NM_001040708chr81991 ------
NM_001042404chr12652 244 --1227 --
NM_001042413chr931146 741 491 ------
NM_001042414chr13146 ------
NM_001042440chr5----11285 11925
NM_001042441chr5----11285 11925
NM_001042442chr5----11285 11925
NM_001042443chr5----11285 11925
NM_001042444chr5----11285 11925
NM_001042445chr5----11285 11925
NM_001042446chr5----11285 11925
NM_001042473chr10167 ------
NM_001042481chr1421835 294 ------
NM_001042494chr1533469 2968 817 ------
NM_001042495chr1533469 2968 817 ------
NM_001042496chr1533469 2968 817 ------
NM_001042497chr1533469 2968 817 ------
NM_001042506chrX3561 343 293 ------
NM_001042550chr931561 744 205 ------
NM_001042555chr1234240 1912 434 --13054 --
NM_001042573chr1772109 1630 1426 770 230 155 101 12043 22116 419 --
NM_001042601chr31879 ------
NM_001042603chr1255156 3963 1711 339 247 25080 4414 ----
NM_001042604chr334753 1101 586 ------
NM_001042749chrX126 --21499 69 --
NM_001042750chrX126 --21499 69 --
NM_001042751chrX126 --21499 69 --
NM_001042784chr4151 ------
NM_001043318chr14--12569 13940 13097
NM_001043351chr112266 ------
NM_001044305chr631361 1048 169 ------
NM_001044722chr52267 146 2716 634 --1658
NM_001044723chr52267 146 2716 634 --1658
NM_001048183chr153393 2992 2388 1487 869 ------
NM_001071775chr1311955 ------
NM_001077628chr11513 ------
NM_001106chr3118481 7524 6555 6188 2998 2974 2925 2909 1385 1214 1176 27962 6849 33268 2386 2025 19599
NM_001113490chrX13568 --12376 --
NM_001144chr161128 --11182 --
NM_001148chr4127 ------
NM_001151chr4170 ------
NM_001167chrX66158 4366 4239 2576 1081 764 1665 ----
NM_001173chr1443469 1293 1005 656 --13592 1286
NM_001200chr201883 ------
NM_001219chr71686 ----11982
NM_001227chr1021351 341 1333 ----
NM_001237chr41112 ----11110
NM_001237chr41112 ----11110
NM_001241chr221973 710 1186 --11543
NM_001241chr221973 710 1186 --11543
NM_001256chr1742568 2484 2374 1011 ------
NM_001259chr725957 5044 15999 14942 --
NM_001260chr131351 ------
NM_001300chr101354 ------
NM_001313chr44921 658 169 159 ------
NM_001326chr11158 ------
NM_001329chr10----1496 --
NM_001356chrX22514 2236 ----1590
NM_001378chr2----1490 --
NM_001380chr101800 ------
NM_001386chr812462 ------
NM_001390chr1853085 2934 2327 1190 97 ------
NM_001427chr731648 1369 163 --11507 --
NM_001429chr223761 251 146 ------
NM_001431chr611043 ------
NM_001438chr112461 ------
NM_001440chr872216 2100 2053 1968 1948 1824 1001 --11956 1257
NM_001461chr1------1223
NM_001483chr7----1715 --
NM_001493chrX----1600 --
NM_001494chr101574 ------
NM_001497chr952545 2235 1767 875 508 12127 ----
NM_001530chr1421113 452 ------
NM_001543chr554134 2969 1148 882 726 11099 --1740
NM_001584chr111473 ------
NM_001616chr213019 ------
NM_001642chr1111182 ------
NM_001649chrX62385 2349 2320 2025 620 291 ------
NM_001650chr1834092 3670 3510 --11584 13341
NM_001656chr531815 1333 34 --1176 --
NM_001659chr1242601 2185 1941 96 12614 ----
NM_001679chr31287 --1112 --
NM_001682chr1212608 ------
NM_001684chr153881 3426 3340 2896 823 1929 1876 --
NM_001695chr832926 1436 545 ----11006
NM_001709chr1142694 2603 2460 242 --12615 --
NM_001720chr12817 432 ------
NM_001730chr1311534 ----11318
NM_001730chr1311534 ----11318
NM_001731chr121644 ----1876
NM_001750chr5----11285 11925
NM_001777chr313181 ------
NM_001781chr12178 ----1778
NM_001797chr16--1166 ----
NM_001826chr11370 ------
NM_001858chr62786 362 --24680 4440 --
NM_001873chr4160 ------
NM_001880chr2195 ------
NM_001918chr198594 6333 3248 2504 2367 1935 1882 1769 438 --27309 5791 1958
NM_001939chrX63820 3750 3311 2488 861 154 --13329 12364
NM_001949chr622810 1263 12979 1847 --
NM_001964chr521185 1091 ------
NM_001981chr122131 1716 --12056 --
NM_001995chr42931 594 ------
NM_001999chr51949 ------
NM_002006chr455011 4106 2068 2056 1389 --11356 --
NM_002023chr141099 323 230 42 ------
NM_002025chrX69189 9101 6916 6899 3050 1899 --19123 28216 3676
NM_002033chr1183830 3661 3257 2578 1277 483 441 364 ----12897
NM_002039chr4----1173 --
NM_002040chr2123112 2665 ------
NM_002045chr31326 ----1159
NM_002051chr101165 ------
NM_002077chr912122 ------
NM_002080chr162898 851 ------
NM_002126chr1744112 3489 1355 184 13755 ----
NM_002130chr52424 205 11527 --2499 478
NM_002137chr7------11663
NM_002138chr41799 ------
NM_002140chr91354 ------
NM_002146chr171104 ------
NM_002148chr22627 616 ------
NM_002149chr23594 490 233 --1627 --
NM_002214chr715626 ------
NM_002247chr1021886 150 ------
NM_002264chr374971 4581 3905 3516 967 305 184 ------
NM_002266chr17190 ------
NM_002267chr1311940 ------
NM_002268chr31592 1237 11195 --
NM_002270chr534963 4744 3931 25247 1288 ----
NM_002271chr1332250 1839 1740 ----11489
NM_002313chr1064852 4754 4329 844 471 44 11752 ----
NM_002334chr1141838 1611 1534 1406 --11381 --
NM_002336chr1234039 3737 1923 ------
NM_002356chr622810 2584 --1971 --
NM_002358chr4145 ------
NM_002359chr1773433 3175 1545 1468 1328 962 705 ------
NM_002374chr233181 800 619 ------
NM_002376chr141478 ------
NM_002382chr1411118 ------
NM_002478chr111537 ------
NM_002499chr1521577 311 ------
NM_002505chr6------1553
NM_002515chr14----1823 --
NM_002536chrX1251 ------
NM_002545chr1111301 --13795 14410
NM_002577chr343646 1590 1233 674 --11260 --
NM_002590chr13----1490 --
NM_002605chr1511193 ------
NM_002610chr221199 34 --1263 12412
NM_002613chr16104630 3594 3375 1842 1699 620 608 595 449 402 24948 4471 ----
NM_002641chrX1672 ------
NM_002645chr11--12297 ----
NM_002670chr31356 ------
NM_002709chr233179 2495 350 12804 1823 --
NM_002710chr1221131 712 ------
NM_002716chr1142909 2542 1230 637 ----13227
NM_002719chr1412334 --1655 11604
NM_002721chr91167 ------
NM_002736chr722131 1507 --12021 --
NM_002738chr16159 ------
NM_002740chr342772 2658 2210 739 ------
NM_002745chr2284347 3416 3383 2927 1338 826 732 155 --23738 2879 14044
NM_002755chr152683 616 ------
NM_002787chr7--1524 ----
NM_002830chr21272 ------
NM_002840chr131073 1042 220 ----11296
NM_002851chr7----1250 --
NM_002858chr13842 519 247 --1446 --
NM_002868chr1232362 1562 715 12432 ----
NM_002886chr344551 3572 904 219 --13936 --
NM_002896chr112281 72 ------
NM_002906chr1121618 319 ------
NM_002912chr61894 ------
NM_002922chr1----1224 --
NM_002942chr31387 ------
NM_002955chr61600 ------
NM_003038chr22617 320 --12296 12620
NM_003045chr1344664 3480 975 28 --15020 --
NM_003046chr855389 4499 3688 687 358 ------
NM_003070chr91844 ------
NM_003076chr12--1292 ----
NM_003079chr1711016 ------
NM_003099chr1556004 5376 5361 4588 308 ------
NM_003100chr51120 ------
NM_003106chr32708 370 ------
NM_003108chr276120 5097 2507 1694 1154 126 120 11484 ----
NM_003111chr22311 29 --11380 --
NM_003112chr723087 2051 --1967 --
NM_003113chr21187 ------
NM_003128chr252658 2212 1879 1850 108 ------
NM_003161chr1743320 1059 1007 686 12292 ----
NM_003189chr143364 705 428 217 ------
NM_003199chr1845416 4387 3811 2022 ------
NM_003203chr231773 850 193 --1752 --
NM_003211chr1221318 661 1481 1140 --
NM_003216chr2253308 2140 1307 1291 1050 1176 12526 --
NM_003236chr2----139 13393
NM_003239chr141804 1193 --1314
NM_003255chr1732243 2163 24 12290 ----
NM_003286chr20143 ------
NM_003298chr386211 2385 2334 1767 1541 1021 913 73 --26198 670 --
NM_003314chr5------1459
NM_003319chr2----1784 --
NM_003330chr12----1275 --
NM_003342chr1713058 12049 --12233
NM_003348chr1211607 ------
NM_003352chr22284 72 ------
NM_003372chrX2362 22 ------
NM_003374chr51206 ------
NM_003383chr91210 ------
NM_003390chr111260 ------
NM_003392chr363282 2963 1603 1387 407 158 ------
NM_003394chr121495 ------
NM_003403chr141251 ------
NM_003406chr82287 146 --1446 --
NM_003412chr332783 2054 454 --21023 447 --
NM_003430chr19132 --11503 3476 308 224
NM_003441chr4--1115 41177 931 529 358 41095 446 369 32
NM_003458chr363986 3597 3319 738 615 158 13356 54032 1553 1537 1252 558 --
NM_003463chr621178 435 ------
NM_003467chr21420 ------
NM_003468chr234170 3421 380 ------
NM_003474chr1012354 ------
NM_003478chr1123265 2492 ------
NM_003489chr2123092 579 --1900 --
NM_003502chr161129 ------
NM_003563chr172295 132 --11104 --
NM_003574chr1865378 3999 3729 3535 1409 289 11811 11553 --
NM_003583chr1223911 279 --1259 --
NM_003603chr41430 ------
NM_003618chr23843 408 163 --1127 --
NM_003629chr131204 1164 702 ----13173
NM_003631chr102820 729 ------
NM_003633chr522460 767 ----12125
NM_003636chr1193 ------
NM_003644chr1785776 5285 5275 5012 4335 1899 1143 289 11887 ----
NM_003659chr2158 ------
NM_003663chr343300 3062 1001 68 ------
NM_003716chr311026 1337 1146 --
NM_003743chr211710 ------
NM_003758chr1521302 426 ------
NM_003758chr1521302 426 ------
NM_003787chr18----1311 --
NM_003791chr16174 ------
NM_003794chr31142 ------
NM_003795chr61236 ------
NM_003796chr191146 ------
NM_003822chr142326 849 571 525 ------
NM_003861chr1422682 1080 --1990 --
NM_003872chr222118 560 ------
NM_003884chr311777 ------
NM_003885chr1742598 1769 974 680 ----1814
NM_003895chr2132167 1733 815 --12113 --
NM_003902chr12517 269 ------
NM_003913chr6----33692 677 617 --
NM_003931chr6152 ------
NM_003934chr91389 ------
NM_003939chr1033546 2634 928 ----21553 841
NM_003941chr731948 1738 642 12534 ----
NM_003951chrX1294 ------
NM_003998chr41488 ------
NM_004006chrX1200 ------
NM_004007chrX1200 ------
NM_004009chrX1200 ------
NM_004010chrX1200 ------
NM_004011chrX1200 ------
NM_004012chrX1200 ------
NM_004013chrX1200 ------
NM_004014chrX1200 ------
NM_004015chrX1200 ------
NM_004016chrX1114 ------
NM_004017chrX1200 ------
NM_004018chrX1114 ------
NM_004019chrX1378 ------
NM_004020chrX1200 ------
NM_004021chrX1114 ------
NM_004022chrX1114 ------
NM_004023chrX1114 ------
NM_004024chr131297 1237 371 --154 --
NM_004028chr1834092 3670 3510 --11584 13341
NM_004040chr231235 374 288 ----11041
NM_004093chr1312243 --11053 --
NM_004103chr81854 ------
NM_004113chr31437 --1201 --
NM_004124chr1433505 2424 1018 ----12702
NM_004136chr1533076 2887 437 --22332 662 --
NM_004157chr31127 ------
NM_004161chr21532 21557 1190 ----
NM_004181chr41308 ------
NM_004200chr1132446 2028 539 ----13278
NM_004227chr742296 2267 144 83 --22907 2775 11091
NM_004229chrX21850 808 11661 ----
NM_004235chr91666 ------
NM_004242chr63413 392 281 ------
NM_004253chr91879 ------
NM_004267chr32372 33 ------
NM_004268chr111332 ------
NM_004274chr14--1714 ----
NM_004305chr2161 ------
NM_004311chr1033085 3004 2505 ------
NM_004326chr121223 1135 ------
NM_004329chr101228 ------
NM_004330chr1511033 ------
NM_004338chr1827055 1749 11321 ----
NM_004342chr71608 ------
NM_004349chr81164 ------
NM_004384chr52267 146 2716 634 --1658
NM_004392chr132751 189 ------
NM_004432chr9----11526 --
NM_004438chr233045 2258 466 --32403 1192 392 --
NM_004454chr321469 633 11760 ----
NM_004459chr17----1239 22014 1375
NM_004461chr191194 ------
NM_004464chr414115 ----11418
NM_004484chrX145 ------
NM_004499chr51194 ------
NM_004501chr123354 3242 ------
NM_004503chr121629 ------
NM_004504chr2140 1806 ----
NM_004514chr1751000 722 692 95 41 --11145 --
NM_004537chr1211430 ------
NM_004575chr41561 ------
NM_004586chrX33306 1903 1630 --24118 781 --
NM_004612chr964697 4356 1436 1303 972 869 --33019 1068 792 --
NM_004622chr21131 ------
NM_004630chr1121204 188 ------
NM_004637chr32935 423 --11128 --
NM_004643chr141343 ------
NM_004654chrY1908 1501 ----
NM_004663chr1511064 ------
NM_004687chr1752037 1582 1283 755 85 ------
NM_004703chr1712207 ----21897 606
NM_004711chr2253601 3570 1372 432 378 11093 11467 --
NM_004730chr51506 ------
NM_004734chr1321069 618 ----1757
NM_004736chr112268 ------
NM_004745chr846285 5971 4749 1245 11047 14577 1264
NM_004760chr722443 2311 1654 ----
NM_004772chr5----11473 1513
NM_004774chr1732025 997 701 ------
NM_004834chr212625 43335 2541 427 367 12407 --
NM_004835chr3------1734
NM_004835chr3------1734
NM_004836chr2------1373
NM_004857chr1434472 1536 732 --33622 3250 66 --
NM_004863chr1464804 1663 923 884 91 54 ------
NM_004884chr1511512 ------
NM_004901chr82275 79 ------
NM_004911chr72679 604 ----1704
NM_004921chr142485 712 505 361 ------
NM_004947chr332012 1048 202 --32513 911 879 --
NM_004962chr102775 76 ------
NM_004965chr21----1488 --
NM_004985chr1211154 146 ----
NM_005010chr712124 ------
NM_005011chr721758 464 --1246 11895
NM_005012chr1----126 --
NM_005022chr171189 ------
NM_005032chrX1957 ------
NM_005056chr1265400 4207 3434 1955 583 491 25324 4658 ----
NM_005065chr1415366 --13552 24633 4167
NM_005080chr221646 --177 --
NM_005088chrX2718 605 ------
NM_005093chr2054555 3546 2080 1419 1367 ------
NM_005118chr91986 ------
NM_005121chr1743399 1263 1055 852 ------
NM_005124chr61954 ------
NM_005126chr32500 316 --21735 375 --
NM_005135chr1533469 2968 817 ------
NM_005140chrX1815 ------
NM_005156chr914694 --25159 4312 --
NM_005160chr2235730 5420 4146 ------
NM_005171chr1211002 ------
NM_005180chr1011159 ------
NM_005188chr11127680 7093 6436 5703 2541 2328 1902 1337 1317 387 361 63 --37043 5244 504 --
NM_005197chr1455481 4848 2284 1065 328 --23944 541 178
NM_005201chr3--1224 ----
NM_005225chr202921 202 ------
NM_005229chrX1114 ------
NM_005240chr11643 ------
NM_005249chr142844 681 ------
NM_005261chr8197 ------
NM_005279chr21608 ----1197
NM_005339chr424016 2718 --23773 3607 --
NM_005342chrX22560 1047 1350 1950 12505
NM_005349chr4187 ----144
NM_005359chr1856501 6466 6339 3958 2136 1916 16083 --
NM_005375chr631073 1003 857 --1115 --
NM_005381chr21119 ------
NM_005386chr201754 ----1768
NM_005387chr111674 ------
NM_005399chr124316 4043 --2662 507 --
NM_005406chr1811404 ------
NM_005433chr1812107 ------
NM_005487chr221265 --11981 --
NM_005497chr1745997 5609 5476 3763 ------
NM_005502chr922808 663 --22443 1116 --
NM_005563chr11603 ------
NM_005569chr2251540 1379 1306 1040 574 ------
NM_005578chr313249 --24950 340 --
NM_005639chr121123 ------
NM_005667chr2179 ------
NM_005688chr331168 989 946 ----1542
NM_005707chr152190 23 --1112 --
NM_005724chr15--1320 1273 --
NM_005734chr11----1680 --
NM_005737chr222518 728 ------
NM_005748chr1232571 502 232 ------
NM_005759chr224632 3111 13794 2767 376 --
NM_005765chrX----2773 195 --
NM_005766chr131957 ------
NM_005767chr131288 ------
NM_005776chr14--1769 ----
NM_005779chr543411 3311 2731 883 ------
NM_005822chr611466 ------
NM_005840chrX36556 4670 1426 15581 ----
NM_005859chr521288 1092 ------
NM_005868chr732475 1983 232 --1104 1415
NM_005871chr101703 ------
NM_005872chr11194 ----1147
NM_005885chr5--11573 --1527
NM_005895chr1284064 3889 3525 2916 2687 1454 605 73 --13371 11475
NM_005898chr1131959 602 449 ------
NM_005901chr1898406 6138 3082 2835 2787 2523 964 654 69 ------
NM_005909chr543952 3295 1691 1148 14324 13990 --
NM_005911chr2----11351 --
NM_005930chr141330 ------
NM_005941chr834223 1502 965 --1105 146
NM_005955chr174210 3763 2193 1903 976 852 332 1496 ----
NM_005966chr211755 ----12411
NM_006015chr11474 ------
NM_006037chr264898 4289 784 707 515 202 21929 940 24586 1045 1320
NM_006047chr2013223 ------
NM_006054chr111264 --11662 --
NM_006090chr11786 ----1626
NM_006091chr1511766 ------
NM_006095chr414343 ------
NM_006106chr1123456 2664 13127 1967 --
NM_006108chr111118 ------
NM_006116chr2241641 1577 1353 178 ------
NM_006123chrX----1144 146
NM_006135chr1154 ------
NM_006136chr711083 ------
NM_006141chr1642720 1815 1721 232 --11783 --
NM_006166chr1212178 ------
NM_006167chr821871 276 11816 ----
NM_006178chr1741412 1283 1271 1261 ------
NM_006183chr121117 ------
NM_006186chr21271 ------
NM_006194chr1411275 ------
NM_006197chr82778 129 ------
NM_006206chr422837 2563 ------
NM_006224chr1761884 793 699 534 368 238 ------
NM_006243chr11835 2671 291 ----
NM_006251chr533299 2206 554 ------
NM_006252chr146945 6786 5003 584 --11772 --
NM_006267chr221812 546 --11737 --
NM_006282chr2064187 3091 1657 917 614 414 --11752 --
NM_006306chrX55371 5145 4449 3645 2174 ----15562
NM_006310chr1711233 21037 1007 ----
NM_006311chr17155 ------
NM_006321chr371972 1371 790 706 631 551 38 ------
NM_006330chr81507 ------
NM_006350chr5--1345 ----
NM_006352chr121900 1445 --169 1539
NM_006357chr21405 ------
NM_006375chrX21232 560 --21600 1245 --
NM_006379chr7----1337 1836
NM_006389chr111191 ------
NM_006393chr1054421 4041 3860 1520 494 --13567 --
NM_006415chr911019 --1456 --
NM_006451chr5----1863 --
NM_006475chr13------1202
NM_006482chr1223911 279 --1259 --
NM_006489chr14----1823 --
NM_006524chr7----2736 148 51066 905 821 401 65
NM_006544chr1421257 958 ------
NM_006546chr1735607 829 698 12585 ----
NM_006548chr31434 ----1378
NM_006558chr8----1440 --
NM_006561chr1021251 809 --21863 94 1319
NM_006565chr16------1311
NM_006572chr1733036 665 163 --11011 --
NM_006589chr1--1386 ----
NM_006598chr541270 1243 743 688 11338 11299 --
NM_006599chr1685761 3066 2898 2217 2128 1644 1486 58 12872 --12090
NM_006602chr201666 ------
NM_006603chrX126 --21499 69 --
NM_006612chr171408 ------
NM_006622chr53467 130 105 ------
NM_006625chr11836 ------
NM_006625chr11836 ------
NM_006625chr11836 ------
NM_006646chr1332987 2137 75 ------
NM_006654chr1234240 1912 434 --13054 --
NM_006658chr72885 52 ------
NM_006667chrX11105 ------
NM_006690chr2052208 1523 639 323 307 ------
NM_006717chr933122 2117 1044 ------
NM_006720chr1064852 4754 4329 844 471 44 11752 ----
NM_006729chrX44836 3453 1870 895 --11333 --
NM_006731chr915732 --15762 --
NM_006777chrX1687 12641 --12942
NM_006802chr111044 ------
NM_006805chr51657 ------
NM_006888chr1453347 3273 2180 773 598 --22132 1321 --
NM_006901chr151104 140 ----
NM_006924chr1724202 308 ----1654
NM_006930chr511329 ----11493
NM_006947chr421435 1343 --21784 1385 --
NM_006950chrX4853 824 799 744 ------
NM_006981chr922957 479 ------
NM_006996chr111778 --21720 1661 --
NM_006999chr521964 150 ------
NM_007005chr9----11394 --
NM_007006chr16----179 --
NM_007007chr1224225 3524 13964 13793 --
NM_007011chr15106843 5914 5524 2624 2528 2425 1829 1684 506 391 --35921 4320 1451 --
NM_007050chr2057634 7187 837 710 100 ------
NM_007106chr13----1416 12800
NM_007107chr311848 11750 22341 50 --
NM_007124chr6------11960
NM_007125chrY1505 ------
NM_007137chrX35040 1273 1251 --31856 728 466 --
NM_007145chr191481 --21205 404 --
NM_007146chr1712255 --1129 --
NM_007191chr121552 --1546 --
NM_007197chr122750 48 ----1262
NM_007203chr953423 2887 2439 1359 362 ------
NM_007219chr202774 67 ------
NM_007222chr811594 ------
NM_007275chr321055 70 ----1859
NM_007363chrX3402 218 168 --1193 --
NM_007371chr9169 ------
NM_007375chr11918 ----12061
NM_009585chr3------1734
NM_009585chr3------1734
NM_012064chr125962 871 416 270 130 ------
NM_012081chr543723 1300 727 670 ------
NM_012082chr81230 ------
NM_012096chr323427 562 22718 2316 1555 --
NM_012097chr212174 ------
NM_012098chr91548 ------
NM_012104chr1143645 1273 746 93 --1400 --
NM_012104chr1143645 1273 746 93 --1400 --
NM_012110chr41108 ------
NM_012137chr11185 ------
NM_012158chr132585 232 --2739 97 --
NM_012193chr1145187 1895 1313 528 ------
NM_012200chr11180 ------
NM_012215chr1021470 328 --1491 1632
NM_012218chr1942558 2193 891 157 1303 ----
NM_012233chr231050 793 450 ------
NM_012234chr332834 2619 2528 --11292 --
NM_012250chr1111307 --11032 --
NM_012257chr71286 ------
NM_012259chr611175 --1158 --
NM_012262chr134004 3682 2093 --1848 --
NM_012290chr211283 ------
NM_012297chr4133 ------
NM_012300chr51974 ------
NM_012302chr11114 ------
NM_012309chr1153863 3536 3445 614 456 ------
NM_012311chr10------1426
NM_012326chr2------1843
NM_012399chr2211931 ------
NM_012412chr72866 190 ------
NM_012417chr171494 ------
NM_012454chr61423 157 ----
NM_012471chrX31617 559 416 ------
NM_012479chr721063 357 ------
NM_013236chr221210 ------
NM_013240chr2154096 4006 1179 904 898 12717 13316 1255
NM_013261chr423704 332 13150 ----
NM_013269chr1233355 823 334 ----14426
NM_013281chr201534 ------
NM_013286chr33670 600 250 ------
NM_013309chr1522082 683 --22263 942 --
NM_013348chr1921016 898 2934 136 ----
NM_013357chr8------1626
NM_013365chr222550 515 ------
NM_013438chr921743 1344 --1389 --
NM_013989chr1444992 1100 845 478 1679 1992 --
NM_014011chr2----1267 --
NM_014023chr1052508 2382 2216 1120 175 ------
NM_014030chr1721165 1041 ------
NM_014038chr71325 ------
NM_014048chr1635249 4333 1593 23581 3264 ----
NM_014060chrX193 ------
NM_014106chr152626 27 ----1901
NM_014112chr854949 3871 1041 619 575 --13692 --
NM_014117chr1612725 --12416 --
NM_014141chr754789 4432 4403 4396 1725 1330 ----
NM_014159chr32546 211 ------
NM_014181chr222872 1879 ------
NM_014213chr21158 ------
NM_014217chr141650 1178 771 519 ------
NM_014243chr41808 ------
NM_014250chr221265 --11981 --
NM_014253chrX32471 1555 605 --1213 1646
NM_014309chr2221257 519 ----1252
NM_014317chr10----1257 --
NM_014319chr121282 --11734 1429
NM_014325chr1252019 1801 1690 482 72 ------
NM_014331chr435785 1491 291 27609 2378 ----
NM_014344chr111864 ------
NM_014350chr531078 330 240 ------
NM_014363chr131830 ------
NM_014368chr921931 1352 21832 1710 --11843
NM_014399chr74950 263 219 201 ------
NM_014423chr511852 --25449 460 --
NM_014426chr201614 ------
NM_014445chr342299 722 406 295 12097 ----
NM_014447chr421262 1184 ----1551
NM_014476chr41560 ----1374
NM_014500chrX198 ------
NM_014504chr71293 ------
NM_014521chr21295 ------
NM_014586chr2163350 2964 1818 1454 849 829 --14479 --
NM_014612chr921502 524 ------
NM_014614chr2169 1432 ----
NM_014647chr1622243 451 --1234 12040
NM_014659chr153854 290 164 ------
NM_014660chr711146 ------
NM_014661chr1053868 3385 2727 830 225 --11342 13797
NM_014671chr751532 447 285 237 174 ------
NM_014693chr31745 ------
NM_014701chr151513 ------
NM_014702chr622865 272 --13075 1922
NM_014705chr71662 1238 ----
NM_014721chr646511 6023 168 116 --14884 --
NM_014730chr1264300 3957 3808 3367 1874 219 ------
NM_014730chr1264300 3957 3808 3367 1874 219 ------
NM_014743chr452590 2159 1070 1024 789 11994 12237 --
NM_014755chr2------13617
NM_014764chr1211241 ------
NM_014766chr732483 656 108 1285 12381 --
NM_014791chr91226 ------
NM_014810chr143591 2995 1134 597 --22287 154 --
NM_014812chr12652 244 --1227 --
NM_014819chr511640 --22306 298 --
NM_014824chr1121308 739 ----1389
NM_014828chr1412428 ------
NM_014830chr1253912 3599 3071 987 700 --23039 2708 --
NM_014839chr112266 ------
NM_014850chr364187 3404 1374 1186 960 38 --23983 3835 11033
NM_014864chr142917 1233 932 471 13569 ----
NM_014873chr121694 1258 --11070 14722
NM_014897chr1723118 2519 ----11985
NM_014903chr121124 ----1571
NM_014904chr1023395 366 13029 ----
NM_014906chr1733356 3220 2723 1556 ----
NM_014912chr1043477 2875 466 361 ------
NM_014924chr1463081 2631 1247 948 913 272 ------
NM_014935chr163386 2927 1112 669 397 338 ------
NM_014952chr1561697 1418 1274 651 240 119 ------
NM_014974chr1021279 111 --1322 --
NM_014988chr421057 135 --11046 --
NM_014989chr611646 ------
NM_014994chr1542142 1590 368 232 --1416 --
NM_015008chr343395 3180 2677 316 ------
NM_015017chr11278 ------
NM_015020chr1611500 --23265 2502 --
NM_015026chr1224648 308 --1648 14176
NM_015039chr134041 1372 957 --1579 --
NM_015049chr221112 70 ------
NM_015071chr546486 5267 4200 1176 ------
NM_015074chr194629 4244 3988 3849 1218 960 617 221 106 --23315 1542 14951
NM_015076chr633489 3129 2793 ----1679
NM_015093chr6----1499 --
NM_015100chr141533 678 549 418 ------
NM_015107chrX4842 836 830 517 --1978 --
NM_015132chr72760 146 ------
NM_015144chr1643446 2576 1156 230 --12614 12598
NM_015153chr6----1594 --
NM_015155chr1053221 2369 968 468 316 --22684 557 --
NM_015185chrX1236 --1486 --
NM_015199chr3--12890 ----
NM_015206chr1553465 3398 3312 854 822 ------
NM_015215chr11948 ----22064 673
NM_015230chr431575 1414 297 ------
NM_015233chr1362519 2410 2126 2104 1037 589 ------
NM_015252chr21648 ------
NM_015263chr151859 ----11095
NM_015271chr411551 13524 13735 --
NM_015272chr16----11923 --
NM_015285chr1842387 1973 222 123 --2942 442 --
NM_015296chr1311086 --1366 --
NM_015310chr878017 7740 7311 6650 6214 1654 1472 --12644 13283
NM_015313chr1144268 986 662 638 --1179 --
NM_015315chr522575 484 ----13450
NM_015328chr732811 2398 188 ------
NM_015336chr121847 11827 12104 --
NM_015344chr821754 245 --11793 --
NM_015349chr612847 ------
NM_015354chr91382 ------
NM_015358chr211144 ------
NM_015365chrX----12741 --
NM_015375chr154263 3271 3225 1792 264 1358 ----
NM_015423chr1121480 486 ------
NM_015446chr1----11546 --
NM_015465chr51199 ------
NM_015520chr321992 1964 ------
NM_015535chr243711 1479 592 274 --22955 726 11242
NM_015542chr10148 ------
NM_015549chr143578 498 228 --1471 --
NM_015560chr321898 314 1192 ----
NM_015565chr2132120 2083 799 ------
NM_015567chr131838 ------
NM_015569chr114140 --13313 13381
NM_015570chr711688 ------
NM_015601chr10164 ------
NM_015640chr135033 4023 3445 24938 1236 --14857
NM_015726chr111764 --11244 --
NM_015832chr18--1178 ----
NM_015833chr211399 ------
NM_015852chr7----1238 101244 1163 1079 995 827 659 575 491 407 71
NM_015853chr11152 ------
NM_015874chr4187 ----144
NM_015878chr811801 ------
NM_015902chr81112 ------
NM_015905chr71392 1513 ----
NM_015906chr144282 4049 3339 3282 --24600 3828 11588
NM_015912chr8----11588 --
NM_015980chr531578 1369 500 --11317 --
NM_015995chr15104908 3989 3963 2181 2010 1994 1737 1475 1097 916 --11021 --
NM_016018chr842690 1882 978 31 ------
NM_016022chr11905 ------
NM_016061chr21280 ------
NM_016066chr1--151 ----
NM_016072chr122553 322 ------
NM_016141chr31147 ------
NM_016152chr3----11102 --
NM_016192chr2------1114
NM_016217chr653637 1422 536 310 186 ------
NM_016220chr7--1658 1157 6743 574 490 410 326 242
NM_016248chr1322438 1035 --11594 --
NM_016252chr21815 ------
NM_016258chr1--1666 ----
NM_016260chr227378 5151 --22600 1802 --
NM_016304chr151743 ------
NM_016374chr121020 74 ----1259
NM_016374chr121020 74 ----1259
NM_016422chr1121091 515 --2183 76 --
NM_016441chr2--11652 ----
NM_016447chr71171 ------
NM_016463chr5153 ------
NM_016507chr1742778 1071 715 410 ------
NM_016530chr1524020 2543 ----1391
NM_016577chr384259 4059 3429 1231 1215 1204 1195 1157 14431 ----
NM_016603chr532048 1652 131 ------
NM_016605chr572720 2563 2473 2427 2189 1025 203 ------
NM_016733chr2251540 1379 1306 1040 574 ------
NM_016936chr1622135 318 ----11959
NM_016952chr1124000 2743 1836 ----
NM_017412chr81312 ------
NM_017447chr2143594 3534 1365 85 ----14284
NM_017519chr6------2879 369
NM_017544chrX----1802 --
NM_017580chr1042335 1942 289 65 ------
NM_017590chr2241755 1745 1704 1027 --11910 --
NM_017610chr152593 339 ------
NM_017628chr435295 4935 831 --34365 3963 3731 1869
NM_017629chr11326 ------
NM_017634chr811921 --11690 --
NM_017637chr958018 6546 6508 1190 136 13067 ----
NM_017641chr123924 437 252 ------
NM_017658chr1413298 ----14637
NM_017667chr72182 155 ------
NM_017670chr11176 ------
NM_017672chr15----2969 319 --
NM_017686chr111073 ------
NM_017693chr13----1115 --
NM_017709chr143217 1424 769 762 ----1947
NM_017719chr322033 1755 ------
NM_017754chr654001 3376 1954 1041 788 13979 33243 677 234 --
NM_017805chr191207 ------
NM_017813chr8----11805 --
NM_017824chr101552 ------
NM_017848chrX31734 482 436 --1747 --
NM_017896chr202566 437 --23467 3423 1641
NM_017902chr1055770 4905 3874 1528 818 --14765 --
NM_017905chr131262 ------
NM_017919chr934232 1234 656 ------
NM_017934chr6192 ------
NM_017998chr911340 --1365 --
NM_018011chr131460 ------
NM_018014chr2--11118 ----
NM_018027chr1032681 563 68 ------
NM_018031chr31411 ------
NM_018045chr11350 ------
NM_018080chr15155 --1172 --
NM_018087chr1----1226 --
NM_018105chr8------1338
NM_018120chr8162 1172 ----
NM_018133chr321504 351 ------
NM_018147chr3------152
NM_018155chr3--11136 21344 745 --
NM_018159chrX21490 461 ----1399
NM_018171chr12------1222
NM_018181chr1811954 --11804 --
NM_018182chr1712229 ------
NM_018243chr443540 2719 2580 166 ------
NM_018260chr191898 --1268 2520 436
NM_018299chr813202 ------
NM_018313chr322282 1848 12612 ----
NM_018315chr411121 ------
NM_018330chr10--11260 1698 11449
NM_018360chrX180 --1143 --
NM_018364chr133923 3849 2682 12885 ----
NM_018374chr721586 785 ------
NM_018403chr343889 3390 2895 2807 --12755 --
NM_018437chr9125 ------
NM_018440chr878465 8149 7269 6287 5897 2487 468 --2996 824 15587
NM_018448chr1211264 ------
NM_018464chr10----1110 --
NM_018475chr41714 ------
NM_018557chr211425 ------
NM_018566chr133906 3107 1529 1201 ----
NM_018638chr1264818 4812 4735 1852 579 203 11259 15160 13803
NM_018639chr1241027 467 437 361 ------
NM_018695chr53869 615 151 ------
NM_018717chr432346 1860 750 ----12795
NM_018718chr71791 ------
NM_018847chr91444 ----1271
NM_018948chr121124 932 --1299 --
NM_018963chr2141364 1051 1019 25 ------
NM_018970chr73681 251 61 ------
NM_018992chr1611547 ------
NM_018999chr1064052 3580 1960 1088 812 135 ------
NM_019001chr334753 1101 586 ------
NM_019018chr5----1770 --
NM_019044chr254191 4170 1828 1664 1315 ------
NM_019063chr212074 ------
NM_019084chr1021033 867 --1331 12048
NM_019087chr511514 ------
NM_019094chr1233306 413 321 ------
NM_019116chr1643626 2298 733 136 --12609 --
NM_019555chr3--11297 1387 1197
NM_019558chr21382 ------
NM_019605chr11197 ------
NM_019610chr142130 1801 1402 1352 ------
NM_019843chr222143 38 ------
NM_019859chr101368 ------
NM_019895chr31182 ----1945
NM_020122chr244843 4709 1777 793 --1606 --
NM_020132chr2165084 3857 3405 1326 1119 41 ------
NM_020137chrX2382 68 ------
NM_020189chr8127 ------
NM_020204chr11350 ------
NM_020205chr131175 968 775 --13044 --
NM_020228chr1152194 1034 795 789 327 1803 ----
NM_020235chr3--1286 ----
NM_020240chr53756 744 728 --1552 --
NM_020245chr675012 4794 4396 914 891 231 160 --1885 21790 292
NM_020309chr191320 ------
NM_020311chr21596 ------
NM_020336chr2023576 2456 23079 2535 23071 2512 --
NM_020342chr23815 458 319 ------
NM_020357chr321329 134 ------
NM_020362chr13554 291 248 ----1326
NM_020381chr631404 1285 345 --11547 --
NM_020382chr1211562 ------
NM_020390chr344650 4488 362 231 1701 ----
NM_020429chr753041 2281 1126 1110 305 ------
NM_020440chr132450 510 344 12217 23224 1245 --
NM_020443chr165791 4616 2261 1268 527 201 12146 ----
NM_020452chr121373 559 ------
NM_020463chr221478 31 ------
NM_020466chr644707 3402 1046 440 --23847 346 --
NM_020473chrX1672 ------
NM_020630chr102679 671 ------
NM_020640chr312259 ------
NM_020651chr2----11437 --
NM_020653chr171139 ------
NM_020665chrX1243 --1252 --
NM_020717chrX44825 1303 1092 422 13784 14171 --
NM_020727chr2143467 1589 550 201 --13550 --
NM_020732chr6------2879 369
NM_020742chrX1935 --12265 1850
NM_020752chr1022829 752 12665 ----
NM_020760chr21622 ------
NM_020766chrX1618 ------
NM_020772chr1728084 339 --11851 --
NM_020794chr121094 187 ------
NM_020795chr17----1268 --
NM_020796chr512261 ------
NM_020801chr51435 ------
NM_020804chr612577 ------
NM_020808chr1169 ------
NM_020809chr111250 ------
NM_020830chr22463 403 ----12516
NM_020832chr11686 ------
NM_020841chr1221013 766 ----11146
NM_020854chr181194 ------
NM_020856chr191637 1219 ----
NM_020858chr152363 27 --2793 534 --
NM_020859chr443800 3417 1276 546 ------
NM_020868chr221962 1505 ------
NM_020871chrX1739 ------
NM_020899chr1752395 2204 709 516 460 ----12234
NM_020925chr1----1407 11305
NM_020926chrX2149 127 ----1106
NM_020935chr234469 2879 232 1824 ----
NM_020977chr4127 ------
NM_020993chr121351 ------
NM_021005chr151460 ------
NM_021032chr31437 --1201 --
NM_021033chr13------12980
NM_021069chr41430 ------
NM_021110chr8176 ------
NM_021111chr911048 ------
NM_021120chrX42915 2768 2628 2105 22363 1964 ----
NM_021136chr141227 151 ----
NM_021141chr21254 ------
NM_021180chr11791 ------
NM_021183chrX21957 1641 --1536 11600
NM_021202chr2022809 2027 --13018 12217
NM_021222chr121136 1092 ------
NM_021239chr1411464 ------
NM_021253chr621408 1036 ----11420
NM_021255chr1443640 2936 1119 405 ------
NM_021622chr101478 22050 265 ----
NM_021627chr31785 ------
NM_021639chr12695 210 ------
NM_021649chr5122 --2643 172 --
NM_021705chr6------1553
NM_021809chr201522 ------
NM_021813chr625629 252 --24583 67 --
NM_021911chr53853 197 137 ------
NM_021912chr151485 ------
NM_021940chr631361 1048 169 ------
NM_021961chr1167439 1832 1812 1622 1526 1037 --1339 --
NM_021963chrX1275 ----1196
NM_021964chr336404 4117 1835 ------
NM_021973chr41530 ----1268
NM_021998chrX31422 1287 428 ------
NM_021999chr131186 ------
NM_022048chr1555373 5120 4860 2550 2187 --11332 --
NM_022079chr10164 ------
NM_022080chr2012586 --32738 986 21 22506 195
NM_022085chr631573 1342 338 1242 21121 425 --
NM_022114chr163591 3361 953 927 483 98 ------
NM_022137chr1422036 1542 ------
NM_022166chr1635837 5126 3862 12477 25218 755 --
NM_022170chr711566 ------
NM_022336chr242336 1857 819 633 ------
NM_022463chr171128 ------
NM_022494chr10----1349 --
NM_022497chr362904 2550 1105 971 440 414 --13767 --
NM_022552chr211223 ------
NM_022758chr693177 2940 2610 2552 1271 1096 725 679 494 ------
NM_022776chr3--1173 --1538
NM_022780chr231671 1590 473 --11388 --
NM_022781chr942566 2494 343 83 ------
NM_022802chr10----1496 --
NM_022810chrX1294 ------
NM_022821chr11107 ------
NM_022900chr71152 ----2398 115
NM_022912chr242519 1865 1235 692 ------
NM_023923chr153393 2992 2388 1487 869 ------
NM_023943chr32199 162 ------
NM_024016chr171165 ------
NM_024055chr51640 ------
NM_024077chr91726 ------
NM_024086chr173951 220 197 166 ----
NM_024095chr123554 346 105 ------
NM_024107chr172861 319 ------
NM_024111chr151221 ------
NM_024294chr693177 2940 2610 2552 1271 1096 725 679 494 ------
NM_024415chr5127 ------
NM_024511chr463441 3165 2563 2148 372 207 13234 13273 11146
NM_024524chr331088 729 22 12515 ----
NM_024546chr13126 ------
NM_024551chr122775 149 ------
NM_024551chr122775 149 ------
NM_024554chr141524 1119 334 102 ------
NM_024569chr1152 ------
NM_024607chr853797 1724 1589 1097 25 13741 24482 239 --
NM_024657chrX2633 509 ------
NM_024665chr323235 809 --23748 1338 --
NM_024689chrX1256 11502 11273 --
NM_024692chr231908 1239 702 --11463 --
NM_024704chr203452 310 200 --1983 1298
NM_024742chr1611651 ------
NM_024755chr151339 --1308 --
NM_024770chr256492 6035 1472 802 790 11833 11883 --
NM_024824chr141181 ------
NM_024899chr181494 ------
NM_024900chr431957 1679 187 --21840 1472 --
NM_024900chr431957 1679 187 --21840 1472 --
NM_024921chrX1796 --1757 --
NM_024947chr348813 6898 3823 100 --17216 --
NM_024949chr444709 3289 3036 424 --24401 3213 --
NM_025054chr833238 876 251 --24046 785 --
NM_025075chr31217 --172 --
NM_025090chr1751362 483 181 164 92 --2316 103 --
NM_025134chr16--11017 ----
NM_025138chr132404 152 --1932 --
NM_025146chr342617 2006 1026 718 --1428 --
NM_025160chr124259 3265 ----14140
NM_025191chr121025 56 --1452 --
NM_025203chr221318 236 ------
NM_025235chr1011920 ----1114
NM_025250chr713015 ------
NM_030621chr1422965 2680 --13072 --
NM_030629chr161692 ------
NM_030674chr1255822 4274 3707 3585 296 ----13604
NM_030806chr167076 6716 6298 3049 1774 619 ------
NM_030810chr631573 1342 338 1242 21121 425 --
NM_030820chr6148 ------
NM_030918chr154029 1877 1000 809 659 ----15118
NM_030920chr121955 127 1410 ----
NM_030964chr52900 261 ------
NM_030965chr1------1586
NM_030980chr11592 ------
NM_031243chr7------11663
NM_031262chr91297 ------
NM_031263chr91354 ------
NM_031266chr51194 ------
NM_031268chr16104630 3594 3375 1842 1699 620 608 595 449 402 24948 4471 ----
NM_031275chr11------1606
NM_031369chr41799 ------
NM_031370chr41799 ------
NM_031371chr121020 74 ----1259
NM_031371chr121020 74 ----1259
NM_031435chr1223031 1279 --13024 --
NM_031469chr61151 ----13679
NM_031476chr1662108 1800 1123 1105 823 138 ------
NM_031844chr123354 3242 ------
NM_031845chr233181 800 619 ------
NM_031847chr233181 800 619 ------
NM_031850chr3------1734
NM_031850chr3------1734
NM_031922chr6----1525 --
NM_031935chr1--1899 ----
NM_031953chr4----1173 --
NM_031954chr1252616 2212 1913 977 560 --1599 --
NM_031992chr711566 ------
NM_032012chr934540 1582 68 --14444 15319
NM_032049chr3------1734
NM_032049chr3------1734
NM_032102chr1173073 2668 2596 2236 2163 2014 336 1164 ----
NM_032116chr1343640 2303 1872 1065 --1624 --
NM_032121chrX42429 2213 697 522 12795 ----
NM_032132chr11152 ------
NM_032138chr131456 ------
NM_032142chr18----1273 --
NM_032145chr611667 ------
NM_032153chr312235 ------
NM_032154chr101725 ------
NM_032181chr21280 ------
NM_032291chr1----1327 --
NM_032295chr72406 253 ------
NM_032321chr223265 2823 32626 1174 1012 ----
NM_032373chr1055590 5367 4033 3860 361 15558 1921 11478
NM_032440chr10----12386 --
NM_032457chr4----13693 --
NM_032458chrX22388 742 --12598 --
NM_032466chr821585 1054 ------
NM_032468chr821585 1054 ------
NM_032471chr6--188 --197
NM_032505chr332065 1700 634 ----12357
NM_032514chr201404 ------
NM_032523chr22476 86 ------
NM_032557chr41737 ------
NM_032576chrY------1143
NM_032580chr171143 ------
NM_032711chr1773433 3175 1545 1468 1328 962 705 ------
NM_032725chr11--168 136 --
NM_032809chr971241 1068 1047 403 365 75 25 ------
NM_032810chr102332 167 ------
NM_032865chr1741239 409 88 81 --1600 --
NM_032869chr821715 48 ------
NM_032875chr172625 335 ------
NM_032900chr1063179 2586 2534 1465 1299 1161 11228 ----
NM_032905chr102948 160 --11288 --
NM_032949chr13----1490 --
NM_032961chr411041 ------
NM_032968chrX12758 ----11661
NM_032969chrX12758 ----11661
NM_032973chrY22753 490 ----11655
NM_032975chr1853085 2934 2327 1190 97 ------
NM_032980chr1853085 2934 2327 1190 97 ------
NM_032995chr251508 1326 1065 453 348 ----1379
NM_033020chr144282 4049 3339 3282 --24600 3828 11588
NM_033055chr111052 ------
NM_033133chr1721385 1094 ------
NM_033138chr71608 ------
NM_033139chr71608 ------
NM_033140chr71608 ------
NM_033143chr434446 96 90 ----11749
NM_033157chr71608 ------
NM_033211chr511846 ------
NM_033309chr163301 217 77 ------
NM_033326chr1121004 89 11561 1801 --
NM_033338chr1021351 341 1333 ----
NM_033339chr1021351 341 1333 ----
NM_033340chr1031467 457 79 1449 ----
NM_033360chr1211275 1167 ----
NM_033425chr1142814 2669 2476 504 ------
NM_033515chr611354 ------
NM_033551chr522575 484 ----13450
NM_033631chr133096 385 140 13119 1125 --
NM_033632chr411121 ------
NM_033637chr1033546 2634 928 ----21553 841
NM_033644chr51974 ------
NM_033645chr51974 ------
NM_033656chr2165367 5070 2188 1726 1543 1433 ------
NM_044472chr11730 ------
NM_052834chr1842387 1973 222 123 --2942 442 --
NM_052864chr41495 ----11424
NM_052885chr1243795 1532 1035 299 1338 ----
NM_052886chr841921 1888 1531 571 ------
NM_052904chr6----1220 --
NM_052927chr512039 ------
NM_052951chr201166 ------
NM_053002chr31185 ----11160
NM_053016chr947810 6737 5664 1230 --12848 1455
NM_053043chr766014 5986 5104 1544 998 305 15870 --16284
NM_054016chr131291 633 218 ------
NM_054016chr131291 633 218 ------
NM_054016chr131291 633 218 ------
NM_058170chr111178 ------
NM_058172chr4--1222 11702 1434
NM_058237chr1421027 228 ------
NM_058241chr221873 610 186 --11443
NM_058241chr221873 610 186 --11443
NM_080391chr12461 417 ------
NM_080392chr12510 466 ------
NM_080552chr201630 ------
NM_080599chr10148 ------
NM_080759chr132751 189 ------
NM_080760chr132751 189 ------
NM_080867chr1453267 3200 1309 1149 710 --11864 23369 1952
NM_080927chr352868 2542 183 125 69 --23138 3065 11185
NM_130440chr131073 1042 220 ----11296
NM_130459chr971475 1467 572 558 448 334 102 1539 ----
NM_130831chr321898 314 1192 ----
NM_130832chr321898 314 1192 ----
NM_130833chr321898 314 1192 ----
NM_130834chr321898 314 1192 ----
NM_130835chr321898 314 1192 ----
NM_130836chr321898 314 1192 ----
NM_130837chr321898 314 1192 ----
NM_133170chr2057634 7187 837 710 100 ------
NM_133265chrX13568 --12376 --
NM_133334chr4106161 6126 5813 5522 4999 4955 3928 2255 1140 37 --21782 1165 --
NM_133370chr422871 709 11187 13180 --
NM_133372chr522471 200 ------
NM_133378chr2----1784 --
NM_133432chr2----1784 --
NM_133437chr2----1784 --
NM_133468chr731696 909 297 --12249 --
NM_133499chrX4923 894 869 814 ------
NM_133638chr51150 ------
NM_133646chr253929 3703 1688 1057 231 14316 --15449
NM_133647chr1533469 2968 817 ------
NM_134421chr23594 490 233 --1627 --
NM_134447chr191146 ------
NM_138270chrX1930 ------
NM_138338chr2283172 3007 2999 970 749 212 206 46 23033 2226 ----
NM_138340chr181425 ------
NM_138395chr2------128
NM_138409chr641335 399 292 264 --1427 --
NM_138426chr742471 818 767 742 ------
NM_138462chr91155 ------
NM_138494chr722095 1818 ----2262 98
NM_138554chr912145 ------
NM_138559chr2--11108 ----
NM_138713chr1685761 3066 2898 2217 2128 1644 1486 58 12872 --12090
NM_138714chr1685761 3066 2898 2217 2128 1644 1486 58 12872 --12090
NM_138730chr63438 417 306 ------
NM_138771chr7------1255
NM_138786chr31387 ------
NM_138927chr213987 661 76 ------
NM_138967chr1552201 663 293 74 24 ------
NM_138971chr1143645 1273 746 93 --1400 --
NM_138971chr1143645 1273 746 93 --1400 --
NM_138972chr1143645 1273 746 93 --1400 --
NM_138972chr1143645 1273 746 93 --1400 --
NM_138973chr1143645 1273 746 93 --1400 --
NM_138973chr1143645 1273 746 93 --1400 --
NM_139015chr1241616 1366 1251 531 ------
NM_139045chr91844 ------
NM_139048chr311210 ------
NM_139071chr12--1292 ----
NM_139131chr111674 ------
NM_139135chr11474 ------
NM_139168chr531407 263 145 ------
NM_139182chr431575 1414 297 ------
NM_139207chr1222104 1417 --1709 --
NM_139246chr951610 933 822 381 129 1363 11583 --
NM_139343chr2161 ------
NM_139344chr2161 ------
NM_139345chr2161 ------
NM_139346chr2161 ------
NM_139347chr2161 ------
NM_139348chr2161 ------
NM_139349chr2161 ------
NM_139350chr2161 ------
NM_139351chr2161 ------
NM_144571chr455201 2703 2594 2533 1016 14762 36847 4904 796 --
NM_144582chr252145 1665 621 482 221 ------
NM_144610chr171386 ------
NM_144775chr1744901 3402 1138 435 1399 11759 --
NM_144778chr131627 ------
NM_144949chr2----1267 --
NM_144963chr8----12727 --
NM_144967chrX------1327
NM_144979chr41534 ------
NM_145010chr1031943 1490 136 ------
NM_145055chr1832633 2598 867 --21176 107 --
NM_145063chr62509 194 ------
NM_145112chr1411118 ------
NM_145185chr191785 ------
NM_145259chr21831 ------
NM_145307chr1043976 3388 938 735 12838 ----
NM_145686chr212625 43335 2541 427 367 12407 --
NM_145687chr212625 43335 2541 427 367 12407 --
NM_145690chr82287 146 --1446 --
NM_145698chr10167 ------
NM_145735chr1352782 2631 1094 903 646 12346 22353 2339 --
NM_145739chr22476 86 ------
NM_147150chr953423 2887 2439 1359 362 ------
NM_147189chr841600 1434 817 300 ------
NM_147202chr972609 2494 2467 2349 1932 1096 942 --22440 957 --
NM_147233chr211710 ------
NM_148174chr811801 ------
NM_148955chr1556004 5376 5361 4588 308 ------
NM_152227chr201614 ------
NM_152237chr2251746 1547 1182 427 191 11175 ----
NM_152262chr19------2599 102
NM_152265chr1155 ------
NM_152271chr81143 ------
NM_152282chr3----2871 177 --
NM_152292chr421536 784 12151 ----
NM_152330chr1421835 294 ------
NM_152345chr171864 ------
NM_152376chr131380 577 64 ----11821
NM_152450chr1511660 --11638 1824
NM_152470chr183475 456 145 --13458 --
NM_152475chr1912417 ------
NM_152538chr311259 ------
NM_152556chr712477 ------
NM_152594chr15----1911 --
NM_152606chr191326 ------
NM_152622chr52401 231 --1803 --
NM_152624chr596926 6530 5512 4906 2932 2710 1328 675 480 16479 ----
NM_152629chr931146 741 491 ------
NM_152636chr1132221 2215 883 ------
NM_152638chr1211216 ------
NM_152641chr121679 12268 ----
NM_152647chr15152 ------
NM_152678chr361986 1830 922 783 195 92 ------
NM_152682chr431647 1446 641 ------
NM_152688chr6151 ------
NM_152694chrX1169 ------
NM_152734chr625316 960 ------
NM_152737chr641807 662 490 300 --11989 --
NM_152756chr511101 14002 ----
NM_152765chr831595 1530 639 --12302 --
NM_152787chrX42623 936 291 136 1670 --13202
NM_152793chr744375 3560 1042 273 11518 ----
NM_152826chr1556004 5376 5361 4588 308 ------
NM_152838chr2013223 ------
NM_152857chr62713 59 --2796 351 --
NM_152858chr62713 59 --2796 351 --
NM_152888chr81841 ------
NM_152896chr91638 ------
NM_152924chr15106843 5914 5524 2624 2528 2425 1829 1684 506 391 --35921 4320 1451 --
NM_153184chr311971 ------
NM_153188chr534963 4744 3931 25247 1288 ----
NM_153261chr161616 --11100 --
NM_153331chr3----1629 --
NM_153333chrX1383 ------
NM_153450chr11160 ------
NM_153499chr1252498 2485 1177 781 549 ------
NM_153500chr1252498 2485 1177 781 549 ------
NM_153607chr5----33026 2864 325 --
NM_153616chr152363 27 --2793 534 --
NM_153617chr152363 27 --2793 534 --
NM_153618chr152363 27 --2793 534 --
NM_153620chr7--11620 ----
NM_153649chr112266 ------
NM_153685chr1221182 456 ------
NM_153687chr1221421 1143 11091 11504 --
NM_153693chr121629 ------
NM_153759chr211223 ------
NM_153810chr1054591 4568 4372 1839 700 ----35115 1240 1132
NM_170665chr1241519 1284 804 370 --21473 1189 --
NM_170675chr15----1432 --
NM_170676chr15----1432 --
NM_170706chr134041 1372 957 --1579 --
NM_170719chr132404 152 --1932 --
NM_170720chr1921016 898 2934 136 ----
NM_170731chr1142694 2603 2460 242 --12615 --
NM_170732chr1142694 2603 2460 242 --12615 --
NM_170733chr1142694 2603 2460 242 --12615 --
NM_170734chr1142694 2603 2460 242 --12615 --
NM_170735chr1142694 2603 2460 242 --12615 --
NM_171999chr181760 ------
NM_172016chr621408 1036 ----11420
NM_172058chr81152 ------
NM_172059chr81152 ------
NM_172060chr81152 ------
NM_172070chr221700 707 ------
NM_172071chr157130 6709 6343 1876 501 ------
NM_172130chr1193 ------
NM_172226chr1252498 2485 1177 781 549 ------
NM_173060chr5----11285 11925
NM_173061chr5----11285 11925
NM_173063chr5----11285 11925
NM_173171chr21271 ------
NM_173172chr21579 ------
NM_173173chr21271 ------
NM_173174chr81854 ------
NM_173175chr81854 ------
NM_173176chr81854 ------
NM_173198chr922957 479 ------
NM_173200chr922957 479 ------
NM_173214chr1685761 3066 2898 2217 2128 1644 1486 58 12872 --12090
NM_173454chr1511193 ------
NM_173495chrX1484 11609 1589 --
NM_173511chr233272 1167 784 --11375 --
NM_173531chr1912528 ----13786
NM_173582chr1166289 5315 5237 2295 1378 570 1666 ----
NM_173642chr199064 9015 8311 7980 7244 6123 3016 2831 169 ------
NM_173645chr21190 ------
NM_173653chr311301 ------
NM_173665chr51781 ------
NM_173670chr5----11007 --
NM_173851chr833534 2689 717 23469 3107 ----
NM_174890chr101568 ------
NM_175061chr71325 ------
NM_175607chr3--11498 ----
NM_175612chr3--11498 ----
NM_175629chr211223 ------
NM_175634chr81164 ------
NM_175635chr81164 ------
NM_175636chr81164 ------
NM_175861chr1254979 4527 3708 2400 37 ----24263 436
NM_175863chr6------2879 369
NM_175910chr1912208 ----9889 810 726 642 558 474 222 138 54
NM_176812chr20289 38 ------
NM_177398chr121343 694 ----11905
NM_177399chr121343 694 ----11905
NM_177438chr1422965 2680 --13072 --
NM_177441chr172861 319 ------
NM_177985chr212174 ------
NM_177999chr973332 2861 2816 2595 938 520 442 ------
NM_178026chr201178 ------
NM_178140chr511952 ------
NM_178151chrX45926 4963 1770 1657 27197 1760 --16679
NM_178152chrX45926 4963 1770 1657 27197 1760 --16679
NM_178153chrX45926 4963 1770 1657 27197 1760 --16679
NM_178566chr911530 ------
NM_178586chr1412334 --1655 11604
NM_181050chr161129 ------
NM_181332chrX1935 --12265 1850
NM_181349chr753041 2281 1126 1110 305 ------
NM_181354chr811720 ----11149
NM_181458chr211182 ------
NM_181459chr21948 ------
NM_181460chr21995 ------
NM_181481chr1827055 1749 11321 ----
NM_181482chr1827055 1749 11321 ----
NM_181483chr1827055 1749 11321 ----
NM_181509chr201404 ------
NM_181521chr1686849 6834 6323 4907 4573 2363 1664 1181 --21518 1372 --
NM_181552chr7----1869 --
NM_181671chr171805 ------
NM_181672chrX----1822 --
NM_181673chrX----1822 --
NM_181689chr201754 ----1768
NM_181702chr8197 ------
NM_181706chr1122409 2121 1518 135 --
NM_181784chr2------12356
NM_181794chr6--188 --197
NM_181795chr6--188 --197
NM_181825chr222677 40 ------
NM_181836chr512410 ------
NM_182314chrX21232 560 --21600 1245 --
NM_182481chr2131349 436 26 --11299 1324
NM_182482chr2131349 436 26 --11299 1324
NM_182493chr1675238 4827 3857 3559 3448 1262 1123 1262 ----
NM_182503chr665408 5226 4120 1960 1251 334 15567 ----
NM_182515chr1966640 6281 4553 4220 4143 1771 15397 14691 24942 605
NM_182543chr102103 52 ------
NM_182641chr17----1239 22014 1375
NM_182678chr21405 ------
NM_182729chr12----1275 --
NM_182742chr12----1275 --
NM_182743chr12----1275 --
NM_182762chr742433 2125 1618 497 16027 ----
NM_182789chr5----1863 --
NM_182972chr142559 2200 2136 649 --12022 --
NM_183237chr33823 299 188 1719 ----
NM_183323chr5----1863 --
NM_183393chr311026 1337 1146 --
NM_183394chr311026 1337 1146 --
NM_194247chr21349 --1343 14145
NM_194272chr15145 ------
NM_194278chr14--12569 13940 13097
NM_194282chr422756 720 ------
NM_194286chr1224654 3761 21453 386 1251 --
NM_194291chr852686 2583 1929 643 150 --11211 --
NM_194314chr135294 4145 2077 ------
NM_194328chr942566 2494 343 83 ------
NM_194329chr942566 2494 343 83 ------
NM_194330chr942566 2494 343 83 ------
NM_194332chr942566 2494 343 83 ------
NM_194434chr1865378 3999 3729 3535 1409 289 11811 11553 --
NM_197941chr51745 --22897 2129 --
NM_197962chr1--151 ----
NM_197978chr9125 ------
NM_198047chr21496 ------
NM_198173chr11791 ------
NM_198174chr11791 ------
NM_198181chr1532666 561 366 12951 1799 --
NM_198215chr101114 ------
NM_198264chr1--1386 ----
NM_198270chrX23147 512 1642 --1807
NM_198273chr521240 52 ------
NM_198390chr161692 ------
NM_198391chr201534 ------
NM_198467chr7----1585 --
NM_198513chr811778 ------
NM_198549chr183199 2883 2587 1127 1111 934 799 383 ------
NM_198568chr6----132 --
NM_198793chr313177 ------
NM_198859chr362068 1917 1751 759 648 546 --21585 957 --
NM_198902chr15--1320 1273 --
NM_198965chr121355 ------
NM_198966chr121355 ------
NM_199040chr1233306 413 321 ------
NM_199132chr1921517 653 ----4875 709 358 103
NM_199160chr921872 1293 21773 1651 --11784
NM_199355chr161191 ------
NM_199421chr1453267 3200 1309 1149 710 --11864 23369 1952
NM_199437chr1152194 1034 795 789 327 1803 ----
NM_199438chr1152194 1034 795 789 327 1803 ----
NM_199439chr1152194 1034 795 789 327 1803 ----
NM_199454chr163591 3361 953 927 483 98 ------
NM_199462chr154263 3271 3225 1792 264 1358 ----
NM_199478chrX1792 ------
NM_201253chr11445 ------
NM_201266chr222118 560 ------
NM_201279chr222118 560 ------
NM_201280chr63659 379 115 ----21560 547
NM_201432chr1785776 5285 5275 5012 4335 1899 1143 289 11887 ----
NM_201433chr1785776 5285 5275 5012 4335 1899 1143 289 11887 ----
NM_201436chr72866 190 ------
NM_201516chr72922 246 ------
NM_201517chr72866 190 ------
NM_201624chr11278 ------
NM_201628chr153294 2621 1094 878 826 ----1891
NM_201633chr51349 ------
NM_201995chr111775 ------
NM_201998chr111840 ------
NM_203283chr4187 ----144
NM_203284chr4187 ----144
NM_203301chr1431612 1292 28 ------
NM_203349chr1521929 343 ------
NM_203354chr141330 ------
NM_203355chr141330 ------
NM_203356chr141330 ------
NM_203394chr1232140 1721 386 ------
NM_203399chr11603 ------
NM_203401chr11603 ------
NM_203434chr91942 ------
NM_203446chr2122977 2543 --12923 --
NM_203458chr133596 329 25 ------
NM_203504chr4133 ------
NM_203505chr4133 ------
NM_205768chr121900 1445 --169 1539
NM_205860chr142326 849 571 525 ------
NM_206594chr112461 ------
NM_206595chr112461 ------
NM_206852chr141227 151 ----
NM_206853chr633413 1529 600 ------
NM_206854chr634674 1861 544 ------
NM_206855chr625639 1509 --1609 --
NM_206857chr141227 151 ----
NM_206876chr233179 2495 350 12804 1823 --
NM_206907chr533299 2206 554 ------
NM_206909chr878017 7740 7311 6650 6214 1654 1472 --12644 13283
NM_207123chr4----1173 --
NM_207171chr141533 678 549 418 ------
NM_207304chr131514 ------
NM_207406chr424639 1157 --1175 14401
NM_207577chr1152872 2738 2548 1118 191 21139 912 --1921
NM_207660chr141181 ------
NM_207661chr141181 ------
NM_207662chr141181 ------
NM_213589chr244508 2142 1837 671 ------
NM_213609chr3--11102 ----