TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3064-5p
miRNA Sequence: UCUGGCUGUUGUGGUGUGCAA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000020chr1272295 1594 662 484 318 249 152 1306 --12188
NM_000027chr41905 ------
NM_000034chr161191 ------
NM_000052chrX42642 2631 2500 1134 --12320 12972
NM_000053chr1331491 132 89 --2697 68 --
NM_000081chr141565 1474 654 230 ------
NM_000084chrX166516 6316 6222 6145 6093 5205 4622 4418 4398 4310 4265 2378 1941 1626 1120 308 26054 474 26073 2762 12640
NM_000092chr223986 1151 1309 ----
NM_000093chr912205 --11691 --
NM_000115chr1321669 152 11736 ----
NM_000125chr693466 2999 2928 1689 1542 1144 461 195 72 ----11109
NM_000129chr641059 963 554 275 1524 ----
NM_000158chr31109 --1238 --
NM_000168chr753280 1171 848 536 345 ----12954
NM_000176chr533900 1220 288 --1619 --
NM_000202chrX53599 3568 1074 553 164 ----12605
NM_000212chr1772297 1648 829 628 572 489 354 1951 11731 --
NM_000214chr2041242 243 207 194 ------
NM_000216chrX43340 3218 2903 59 1655 ----
NM_000217chr1273813 3803 3627 3520 1569 1257 498 11063 ----
NM_000259chr1595657 5099 5088 4708 4612 4264 2300 1210 1179 ------
NM_000264chr922406 721 22809 814 ----
NM_000267chr1763016 2780 2624 2270 742 340 --22851 2808 --
NM_000282chr13242 22 ------
NM_000284chrX41875 1491 295 83 --11466 --
NM_000304chr172828 88 ------
NM_000310chr111222 ------
NM_000314chr1062223 1173 975 937 696 571 ------
NM_000315chr111139 ------
NM_000318chr872697 2687 2625 2073 1820 643 112 ------
NM_000321chr1311122 --11380 --
NM_000328chrX125 ------
NM_000332chr656774 6554 4664 2366 1735 45834 5780 2882 2286 26627 310 --
NM_000333chr32786 222 ------
NM_000335chr3--22074 605 171 2443 174
NM_000337chr5116203 5912 5529 2134 1893 1344 1294 730 572 547 71 15586 25032 4352 14506
NM_000340chr321290 1180 ------
NM_000345chr42679 84 ------
NM_000362chr2253430 2950 935 873 476 1706 --12632
NM_000368chr974666 4446 3462 1446 1390 825 255 11271 13662 --
NM_000386chr173693 668 604 ----1118
NM_000390chrX32399 993 582 ------
NM_000408chr242547 1233 756 24 ----13271
NM_000427chr11213 ------
NM_000430chr1731435 1316 673 ------
NM_000439chr542111 2092 1592 773 1393 ----
NM_000449chr121210 1108 ------
NM_000460chr3--1354 ----
NM_000461chr344423 3517 1023 319 ------
NM_000474chr71503 ------
NM_000480chr1141684 1526 590 303 --11688 --
NM_000484chr211323 ------
NM_000533chrX41421 1414 774 644 ------
NM_000539chr34562 239 70 64 11372 ----
NM_000555chrX97787 7412 7071 6021 4869 3053 2920 2668 870 47437 6420 5128 2148 ----
NM_000575chr231117 870 798 ------
NM_000599chr241774 1269 1258 575 11819 43807 3370 3278 59 24095 1563
NM_000602chr731203 485 422 ----11341
NM_000609chr1083167 2179 1920 899 844 581 520 423 12418 12054 --
NM_000615chr1132381 479 268 ------
NM_000617chr1251477 278 76 42 32 --11814 --
NM_000627chr21644 ------
NM_000663chr1643112 2323 2154 332 22571 2052 ----
NM_000687chr204300 277 231 157 1614 1596 --
NM_000689chr9156 ------
NM_000719chr1296581 5686 5006 4318 4161 2421 2216 2089 416 46046 5082 4629 2681 26006 616 --
NM_000721chr182369 2060 1094 1034 920 548 165 70 --1463 --
NM_000722chr7189 ------
NM_000724chr1032027 1995 664 1344 11860 --
NM_000726chr2--1926 ----
NM_000738chr118944 834 798 740 673 333 320 313 --1891 --
NM_000782chr201313 --1207 --
NM_000793chr1464753 3238 3167 784 704 542 34128 3944 814 ----
NM_000806chr511898 11337 ----
NM_000807chr44602 559 530 208 ------
NM_000809chr476326 5813 2634 1263 1206 810 134 15860 ----
NM_000811chr51523 ------
NM_000813chr554269 4259 1066 586 338 --25570 1809 --
NM_000814chr1584002 3817 3376 2846 1349 827 268 216 ------
NM_000818chr10152 ------
NM_000826chr44974 444 381 270 ------
NM_000827chr542575 2172 1853 1607 --1946 1730
NM_000831chr1175375 5364 5352 5211 5139 4120 3942 3849 2404 1616 1524 1334 238 229 174 158 126 45456 780 415 307 55718 4651 2294 1394 832 --
NM_000838chr652157 2036 1989 1717 204 4795 502 465 38 ----
NM_000845chr72145 120 ------
NM_000859chr551579 1234 1183 1170 128 11098 ----
NM_000868chrX11747 1533 ----
NM_000870chr551389 493 186 51 31 21077 444 ----
NM_000875chr15126627 6229 6174 6061 5811 5614 5334 4646 4592 4491 2760 1091 14760 12164 --
NM_000879chr5284 24 ------
NM_000880chr81200 ------
NM_000891chr1783571 2581 1364 1013 891 552 459 112 ------
NM_000899chr1254183 3441 2928 686 508 12668 ----
NM_000917chr101117 1355 ----
NM_000926chr1186655 6252 5949 3789 3242 2949 1102 1014 16996 ----
NM_000949chr5--189 ----
NM_000950chrX22899 421 ------
NM_000961chr20103078 2989 2452 1414 1383 1185 1029 772 399 375 11014 2776 469 --
NM_000965chr32293 214 ------
NM_001001323chr1233139 940 373 ------
NM_001001331chr372404 2329 2204 2033 932 311 295 ------
NM_001001395chr1232468 818 438 ------
NM_001001396chr143024 2727 1709 500 11470 ----
NM_001001419chr545035 1679 1462 753 --12075 13920
NM_001001420chr545035 1679 1462 753 --12075 13920
NM_001001433chr2082641 2573 2238 2212 2167 868 649 366 --1842 --
NM_001001438chr211407 ------
NM_001001481chr843055 2991 1225 903 ----11286
NM_001001549chr74846 682 218 136 --31808 1804 883 --
NM_001001550chr74846 682 218 136 --31808 1804 883 --
NM_001001555chr74846 682 218 136 --31808 1804 883 --
NM_001001664chr223602 1320 --11437 --
NM_001001787chr1----1493 --
NM_001001890chr2173908 3706 3432 1260 879 712 111 --1143 14054
NM_001001924chr831807 729 552 ------
NM_001001925chr831807 729 552 ------
NM_001001931chr831807 729 552 ------
NM_001001971chr102313 203 1982 1446 --
NM_001001974chr1031824 695 66 ------
NM_001001995chrX1212 ------
NM_001002233chr832103 1535 158 1291 2788 91 --
NM_001002257chr222982 1184 22530 244 --1865
NM_001002294chr11135 ------
NM_001002755chr2------135
NM_001002756chr2------135
NM_001002757chr2------135
NM_001002762chr1092751 2268 2127 1148 897 772 568 357 41 22790 1140 42604 2272 537 365 --
NM_001002814chr883633 3564 3244 2461 1535 1178 1012 158 1291 33192 788 91 --
NM_001002838chrX1734 ----1476
NM_001002860chr1431640 1001 969 --23252 637 1736
NM_001002919chr21527 ------
NM_001003652chr1898123 7821 7728 7238 7230 5437 3361 2011 641 38065 7072 6854 --18213
NM_001003674chr1856300 4587 1670 1438 1205 35420 2246 361 25787 434 11472
NM_001003675chr1856300 4587 1670 1438 1205 35420 2246 361 25787 434 11472
NM_001003681chr223803 349 213 ------
NM_001003698chr631557 454 35 --11580 --
NM_001003699chr631557 454 35 --11580 --
NM_001003790chr81295 ------
NM_001003791chr81295 ------
NM_001003792chr31987 ------
NM_001003793chr31987 ------
NM_001003794chr3173105 3028 2994 2797 2748 2738 2616 2433 2421 1990 1970 1952 1190 1145 968 555 483 1940 ----
NM_001003799chr72586 535 ------
NM_001003800chr993714 3092 2899 2876 2802 2783 1001 846 29 2790 622 ----
NM_001003810chr41594 ------
NM_001003927chr172517 55 ------
NM_001003940chr1593601 3554 2356 1100 1080 978 816 797 605 33430 2895 1195 83543 3181 1293 1189 821 571 536 490 --
NM_001003942chr1593601 3554 2356 1100 1080 978 816 797 605 33430 2895 1195 83543 3181 1293 1189 821 571 536 490 --
NM_001003943chr1593605 3558 2360 1104 1084 982 820 801 609 33434 2899 1199 83547 3185 1297 1193 825 575 540 494 --
NM_001004065chr952866 2672 1227 1076 495 13024 ----
NM_001004127chr1311024 --2806 710 --
NM_001004304chr1252806 2713 2480 2125 239 --12300 --
NM_001004323chr71137 ------
NM_001004360chr211591 11401 1597 --
NM_001004419chr1231149 906 836 22875 958 ----
NM_001004441chr5--1635 ----
NM_001005375chrY1101 ----11141
NM_001005463chr1012270 ------
NM_001005473chr546055 5505 2476 651 ----14232
NM_001005609chrX133404 3076 2951 2407 2333 1522 1348 1332 1231 1212 620 108 52 32534 479 348 ----
NM_001005732chr213485 44 28 ------
NM_001005733chr213442 44 28 ------
NM_001005746chr2--1926 ----
NM_001005747chr2--1926 ----
NM_001005845chr83635 582 267 1142 1177 --
NM_001006600chr532381 955 728 21699 550 ----
NM_001006610chr162671 27 1108 ----
NM_001007023chr1464753 3238 3167 784 704 542 34128 3944 814 ----
NM_001007097chr9104589 4542 4236 4221 2040 1985 1689 1382 695 226 23354 3135 13216 11562
NM_001007102chr631556 457 208 ------
NM_001007237chr162358 2071 1904 1794 1058 874 --1146 --
NM_001007277chr111369 ----1742
NM_001007466chr665198 4153 3656 1016 528 44 --13284 --
NM_001007471chr92619 290 ------
NM_001007559chr1841824 1779 42 25 11916 ----
NM_001007565chr31317 ------
NM_001008220chr583596 3443 2796 1266 767 513 462 131 --21096 343 --
NM_001008222chrX51346 431 414 271 208 --11249 --
NM_001008225chr7--1293 1139 --
NM_001008388chr42848 147 ------
NM_001008407chr751206 609 258 219 44 11541 --1685
NM_001008660chr1111123 ------
NM_001008701chr1962433 2228 1006 209 128 38 --22556 1053 1446
NM_001008738chr541962 922 465 116 ------
NM_001008801chr1921419 728 11668 ----
NM_001009569chr101130 ------
NM_001009813chr19----1331 --
NM_001009955chr12575 542 ------
NM_001009955chr12575 542 ------
NM_001009960chr761842 1811 453 364 121 110 ------
NM_001009993chr2124439 4351 4184 2982 2937 2867 1367 1279 915 739 685 37 24173 2971 ----
NM_001010846chr194595 3805 3382 3012 2909 1751 601 440 299 22848 128 13616 --
NM_001010861chr132706 2131 2096 22350 2031 ----
NM_001010867chr1206716 6429 5955 5784 5299 5094 4532 4366 4156 2259 2186 2021 1834 1443 1232 1014 772 695 676 322 14270 55712 1609 1588 1411 1384 --
NM_001010888chrX74278 2973 2819 1561 618 573 214 ------
NM_001010891chr596215 5850 5511 5242 2659 2468 1754 1570 881 ----15380
NM_001010908chr10--1530 ----
NM_001010942chr122533 30 ------
NM_001010986chrX22020 1889 ----11840
NM_001011537chr331641 945 443 ------
NM_001011551chrX1145 ------
NM_001011657chrX2341 49 --2406 106 --
NM_001011666chr785670 5437 5130 5078 5021 4931 4374 289 --15969 --
NM_001011713chr1431314 1232 244 ------
NM_001011885chr1531756 1204 539 ------
NM_001012329chr142182 1971 1705 147 --21953 929 --
NM_001012393chr1154430 3701 3675 3286 1214 ----11485
NM_001012420chr1532659 2333 106 1912 ----
NM_001012423chr1522333 106 1912 ----
NM_001012426chr683029 2523 930 842 713 671 372 133 2806 427 ----
NM_001012427chr683029 2523 930 842 713 671 372 133 2806 427 ----
NM_001012751chr10141 --11568 --
NM_001012754chr1331869 1776 538 --1822 --
NM_001012756chr1943135 2541 2046 422 11175 ----
NM_001012977chrX21070 21 --3965 956 26 --
NM_001012989chrX1445 ------
NM_001013031chr1042648 2491 2364 355 ----12369
NM_001013399chr64903 710 400 324 ------
NM_001013406chr7--21279 159 ----
NM_001013415chr411337 ----1391
NM_001013624chr174928 359 273 38 1317 ----
NM_001013699chr121491 ------
NM_001014336chr122285 63 ------
NM_001014380chr1343860 3699 2107 965 11268 11109 11767
NM_001014797chr10117500 7354 7086 7078 6822 6586 5854 2110 1397 1364 1138 16722 ----
NM_001014809chr43731 708 23 ----1849
NM_001015045chr452319 911 889 836 625 --22327 2323 --
NM_001015877chrX1977 ------
NM_001017368chr1752126 2081 200 90 70 11009 ----
NM_001017371chr211044 ------
NM_001017395chr333685 3149 2458 12303 --13235
NM_001017424chr141946 1823 169 31 11745 ----
NM_001017425chr141946 1823 169 31 11745 ----
NM_001017440chr7208037 7886 7515 6911 6507 6443 5934 5053 2831 2718 2412 1794 1399 1362 1237 1099 982 378 329 282 36579 1890 1392 12882 --
NM_001017962chr101117 1355 ----
NM_001017969chr91257 ------
NM_001018025chrX5785 755 545 326 227 ------
NM_001018050chr22143330 3212 2984 2977 2669 2418 2380 1331 1195 934 527 367 307 126 12585 11335 --
NM_001018052chr22143330 3212 2984 2977 2669 2418 2380 1331 1195 934 527 367 307 126 12585 11335 --
NM_001018054chr11985 11343 ----
NM_001018057chr113920 290 209 ----11424
NM_001018064chr922054 1736 11849 ----
NM_001018065chr984536 3732 2133 1085 987 869 646 151 35373 4750 110 24451 991 --
NM_001018066chr984536 3732 2133 1085 987 869 646 151 35373 4750 110 24451 991 --
NM_001018067chr175357 4710 4124 3746 1009 725 197 ------
NM_001018068chr175357 4710 4124 3746 1009 725 197 ------
NM_001018069chr175357 4710 4124 3746 1009 725 197 ------
NM_001018074chr533900 1220 288 --1619 --
NM_001018075chr533900 1220 288 --1619 --
NM_001018076chr533900 1220 288 --1619 --
NM_001018077chr533900 1220 288 --1619 --
NM_001018108chr1542286 1577 1401 54 ------
NM_001018111chr752858 2493 1384 956 372 12695 11108 --
NM_001018115chr32598 421 ------
NM_001020658chr121326 1046 ------
NM_001020658chr121326 1046 ------
NM_001023560chr63913 319 162 ------
NM_001023567chr15--1920 11523 --
NM_001024094chr533900 1220 288 --1619 --
NM_001024218chr14----179 --
NM_001024455chrX72490 1995 1848 1003 857 484 257 --12369 --
NM_001024460chr611044 ------
NM_001024463chr157826 343 304 223 191 181 96 11074 ----
NM_001024599chr141334 854 512 207 ----11068
NM_001024649chr51495 ------
NM_001024666chrX2687 67 1434 ----
NM_001024847chr331862 362 258 --1554 --
NM_001024858chr14102933 2808 2731 2197 2066 1161 1130 926 561 500 11195 22241 459 --
NM_001024947chr53766 369 263 135 ----
NM_001024948chr143188 2144 1084 1042 --12982 --
NM_001025076chr1075723 5457 4780 4446 4120 3869 1930 ------
NM_001025077chr1097081 6815 6138 5804 5478 5227 5107 518 62 1960 ----
NM_001025079chr333778 2741 1043 22685 832 ----
NM_001025105chr53524 403 96 ------
NM_001025107chr172142 1707 911 649 625 389 197 ----1735
NM_001025107chr172142 1707 911 649 625 389 197 ----1735
NM_001025108chr274070 3855 3736 929 864 573 86 ------
NM_001025266chr3134431 4358 3919 3137 1786 1375 1235 1210 976 590 567 366 349 --14219 --
NM_001025356chr1221941 1011 --1152 --
NM_001025389chr1141684 1526 590 303 --11688 --
NM_001025390chr1141684 1526 590 303 --11688 --
NM_001025580chrX33447 2825 22 --23115 298 --
NM_001025603chr121210 1108 ------
NM_001025780chr9----1199 --
NM_001029858chr611353 12278 13189 --
NM_001029859chr1142038 723 342 246 --2289 54 --
NM_001029863chr611040 ------
NM_001029875chr512369 12338 12972 --
NM_001030007chr1633849 2879 2488 ----1281
NM_001030272chr11128 ------
NM_001030273chr11128 ------
NM_001031679chr1252842 2464 1019 841 809 --11037 --
NM_001031695chr22104828 4803 4327 4275 4235 4030 3969 991 935 339 23982 1949 23959 3586 --
NM_001031711chr54705 424 250 161 --1356 --
NM_001031732chr442949 2931 2671 2515 13337 ----
NM_001031746chr1031413 489 267 2567 405 ----
NM_001031804chr1654380 3444 3319 3297 3009 --123 --
NM_001031812chr521588 579 ------
NM_001032221chr921706 656 ------
NM_001032280chr62482 292 ------
NM_001032282chr83512 172 51 124 ----
NM_001032293chr17169 ------
NM_001032296chr1342454 2343 2063 1979 ----1176
NM_001032380chr1021930 1538 --11295 --
NM_001032394chr62366 117 12090 ----
NM_001033081chr131617 1238 563 --1138 --
NM_001033082chr131617 1238 563 --1138 --
NM_001033087chr2052804 2549 2101 1229 661 22405 1241 12052 --
NM_001033112chr51248 1776 ----
NM_001033117chr374505 4316 4004 3674 3022 1244 176 --24192 1413 --
NM_001033506chr111294 ------
NM_001033518chr752252 1833 436 344 313 1328 12842 --
NM_001033519chr752252 1833 436 344 313 1328 12842 --
NM_001033520chr752252 1833 436 344 313 1328 12842 --
NM_001033557chr24986 586 108 87 ------
NM_001033566chr172200 193 ------
NM_001033568chr172200 193 ------
NM_001033602chr1331805 658 614 ------
NM_001033723chr86926 835 815 784 226 109 --22422 1929 12106
NM_001033925chr1052121 1772 1550 750 471 2744 568 ----
NM_001034841chr16125442 4605 4203 3775 3682 3562 3371 2208 1906 1408 747 80 13749 21511 788 1882
NM_001034845chr451031 901 423 78 56 ------
NM_001034954chr1052890 2619 732 444 78 21169 325 --12311
NM_001034955chr1052890 2619 732 444 78 21169 325 --12311
NM_001034956chr1052890 2619 732 444 78 21169 325 --12311
NM_001034957chr1052890 2619 732 444 78 21169 325 --12311
NM_001035chr131045 974 348 11233 ----
NM_001035260chr1011176 11587 ----
NM_001035511chr112164 1843 11565 1435
NM_001035512chr112271 --11672 1542
NM_001035513chr112271 --11672 1542
NM_001035521chr21648 1682 ----
NM_001037132chr72579 157 ------
NM_001037133chr72579 157 ------
NM_001037317chr132706 2131 2096 22350 2031 ----
NM_001037331chr181626 ------
NM_001037334chr1842347 1994 1647 416 --11512 1348
NM_001037339chr13659 67 53 1140 ----
NM_001037340chr13659 67 53 1140 ----
NM_001037341chr13659 67 53 1140 ----
NM_001037341chr13659 67 53 1140 ----
NM_001037535chrX2504 346 1133 ----
NM_001037536chrX2504 346 1133 ----
NM_001037540chrX2504 346 1133 ----
NM_001037631chr21115 ------
NM_001037954chr1133362 2834 1357 1988 11216 --
NM_001038493chr221245 120 ------
NM_001039348chr22369 36 ------
NM_001039349chr22369 36 ------
NM_001039538chr223131 2345 --12993 1712
NM_001039547chr3157542 7510 7281 6605 6316 6013 5887 5865 5614 5480 2819 2219 1909 1889 1075 17251 --11085
NM_001039570chr22134186 4136 3989 3972 3442 3405 3185 3004 1222 1192 927 896 272 24329 461 13861 23705 3190
NM_001039571chr22134186 4136 3989 3972 3442 3405 3185 3004 1222 1192 927 896 272 24329 461 13861 23705 3190
NM_001039577chr184405 3380 1454 1034 970 706 123 60 12866 33847 1678 1476 11748
NM_001039585chr143869 3827 3720 139 --11219 --
NM_001039590chrX41611 1125 682 458 ------
NM_001039591chrX41611 1125 682 458 ------
NM_001039618chr1165802 4846 4781 4647 4340 1722 --14400 --
NM_001039711chr121000 239 ------
NM_001039712chr121000 239 ------
NM_001039802chr11901 --21178 1128 --
NM_001039840chrX33883 1882 1706 --14771 --
NM_001039916chr1221044 928 ----1863
NM_001039917chr1221044 928 ----1863
NM_001039918chr1221044 928 ----1863
NM_001039919chr1221044 928 ----1863
NM_001039920chr1221044 928 ----1863
NM_001039937chr1324120 3514 ----13759
NM_001039960chr1251648 1112 559 281 180 --2609 199 --
NM_001040002chr17--1589 31167 354 94 --
NM_001040057chr73574 520 137 ------
NM_001040142chr211636 12423 ----
NM_001040143chr211636 12423 ----
NM_001040159chr42478 143 1236 1321 --
NM_001040172chr551389 493 186 51 31 21077 444 ----
NM_001040173chr551389 493 186 51 31 21077 444 ----
NM_001040202chr42738 445 --12149 --
NM_001040280chr641263 1155 282 250 ------
NM_001040284chr1675552 5111 5030 4566 4130 1567 1396 14064 ----
NM_001040402chr441175 809 151 59 ------
NM_001040429chr1321354 464 --12828 --
NM_001040441chr1105175 5143 4523 3796 1973 1798 1767 1338 944 913 ------
NM_001040450chr1542813 2781 1125 1102 22492 260 ----
NM_001040453chr1542813 2781 1125 1102 22492 260 ----
NM_001040653chr352647 2174 1840 1050 885 --1960 21902 799
NM_001040712chr921334 1201 --32972 981 977 --
NM_001040715chr16--11188 --124
NM_001040876chr43711 425 145 ------
NM_001042371chr1671926 1909 1589 1565 1392 735 679 ------
NM_001042403chr121736 ------
NM_001042404chr13531 348 101 ------
NM_001042406chr641043 465 180 46 ------
NM_001042413chr983114 1384 1370 1166 718 535 452 163 13998 ----
NM_001042414chr13141 ------
NM_001042425chr62482 292 ------
NM_001042430chr141168 ------
NM_001042473chr1022140 866 ------
NM_001042481chr1422673 1688 --11042 --
NM_001042492chr1763016 2780 2624 2270 742 340 --22851 2808 --
NM_001042494chr1542667 1317 256 184 13085 ----
NM_001042495chr1542667 1317 256 184 13085 ----
NM_001042496chr1542667 1317 256 184 13085 ----
NM_001042497chr1542667 1317 256 184 13085 ----
NM_001042506chrX21080 21 --3965 956 26 --
NM_001042510chr8----1646 1400
NM_001042511chr8----1646 1400
NM_001042537chrX41632 976 722 714 ------
NM_001042555chr1234493 3020 1241 14444 1547 --
NM_001042599chr266696 5273 5086 4980 1279 96 --15389 1257
NM_001042601chr332478 2245 2058 ------
NM_001042604chr344153 4054 3266 980 13186 ----
NM_001042632chr2062020 1799 1727 982 821 176 12287 2903 30 --
NM_001042633chr2062020 1799 1727 982 821 176 12287 2903 30 --
NM_001042646chr321398 493 1128 ----
NM_001042749chrX21778 1503 11477 --11307
NM_001042750chrX21778 1503 11477 --11307
NM_001042751chrX21778 1503 11477 --11307
NM_001043318chr1493420 3377 3303 3126 2766 1402 1370 849 471 --12819 --
NM_001043351chr141601 832 558 61 --1917 --
NM_001044305chr61379 11561 ----
NM_001044385chr243988 3655 2991 2587 ------
NM_001044722chr521588 579 ------
NM_001044723chr521588 579 ------
NM_001046chr522565 639 ------
NM_001083620chr44973 443 380 269 ------
NM_001092chr1792322 2283 2255 2248 2228 2200 1553 176 124 1906 ----
NM_001095chr121353 --11481 --
NM_001096chr172618 121 ------
NM_001099678chr386051 4902 4870 4736 4188 4162 2434 982 ------
NM_001106chr3138872 8231 8199 8078 7970 7904 7177 6895 3364 2842 2056 1265 303 --16665 --
NM_001111chr172142 1707 911 649 625 389 197 ----1735
NM_001113490chrX53610 2648 2380 856 585 1406 ----
NM_001128chr1633849 2879 2488 ----1281
NM_001148chr451891 1593 854 829 758 ------
NM_001149chr1011140 ------
NM_001152chrX1214 ------
NM_001156chr10194 ------
NM_001167chrX96178 5685 4972 4386 4354 4185 2418 2390 2060 1690 ----
NM_001177chr1221589 63 ------
NM_001178chr11128 ------
NM_001186chr2142872 2258 1278 487 ------
NM_001191chr2061167 1098 1030 1016 924 68 11085 21070 155 --
NM_001198chr64875 757 543 52 ------
NM_001200chr201153 ------
NM_001201chr483658 3604 1467 1390 1111 1073 1061 758 1131 12782 --
NM_001204chr284989 4957 4693 2304 885 662 438 150 ------
NM_001222chr1031604 1558 139 --156 136
NM_001226chr42226 195 --155 --
NM_001237chr41973 ------
NM_001237chr41973 ------
NM_001241chr232333 1520 353 --22457 31 --
NM_001241chr232333 1520 353 --22457 31 --
NM_001257chr162313 93 --1601 --
NM_001260chr131129 ------
NM_001262chr11111 ------
NM_001270chr53999 319 42 --11069 --
NM_001271chr1562787 2701 2211 878 312 74 12742 --12353
NM_001273chr122479 432 ------
NM_001278chr102259 99 ------
NM_001286chr161984 1864 1778 971 127 106 1291 ----
NM_001289chrX21237 149 11509 ----
NM_001304chr172917 234 ----1407
NM_001310chr1242533 2414 1037 22 11095 11190 --
NM_001313chr43731 708 23 ----1849
NM_001343chr551657 1548 1375 1108 345 179 ----
NM_001346chr342773 2341 211 22 --11848 --
NM_001356chrX32019 790 674 166 ----
NM_001362chr143634 334 154 ------
NM_001364chr1143524 3057 1882 112 ------
NM_001369chr531294 474 372 ------
NM_001387chr551983 1168 972 830 760 --22981 1990 --
NM_001389chr211424 ------
NM_001397chr182264 2222 1959 1916 1766 1028 1008 654 1198 1714 21750 136
NM_001399chrX133404 3076 2951 2407 2333 1522 1348 1332 1231 1212 620 108 52 32534 479 348 ----
NM_001401chr941574 1402 645 28 1335 ----
NM_001402chr631928 1479 761 --11672 --
NM_001406chr1741582 1193 702 323 ------
NM_001412chrX43674 2742 1258 1241 12683 ----
NM_001416chr171441 --130 --
NM_001417chr1241714 1610 1498 550 21264 769 --1212
NM_001423chr1231736 1440 249 11337 ----
NM_001426chr21281 ------
NM_001438chr163409 3069 1437 1080 820 578 ------
NM_001448chrX41790 1560 1361 1237 ------
NM_001449chrX1306 ------
NM_001460chr152738 2203 954 230 196 2880 39 --11248
NM_001494chr101495 ------
NM_001497chr932630 975 37 1265 12322 --
NM_001498chr621233 119 1128 164 --
NM_001508chr2--1971 1254 --
NM_001521chr21648 1682 ----
NM_001526chr61156 ------
NM_001530chr141456 ------
NM_001542chr162358 2071 1904 1794 1058 874 --1146 --
NM_001543chr5144795 4076 3833 3512 3403 3064 2943 1743 874 858 758 497 479 461 21136 67 44186 3046 1928 1347 --
NM_001554chr12476 197 ------
NM_001555chrX184 ------
NM_001616chr212995 12449 12412 --
NM_001650chr1832671 997 442 13044 ----
NM_001660chr32577 542 ------
NM_001663chr1422251 850 ------
NM_001664chr3--1702 ----
NM_001677chr1129 --11131 --
NM_001681chr121555 ------
NM_001682chr1232853 654 87 ------
NM_001683chr372404 2329 2204 2033 932 311 295 ------
NM_001701chr911530 ------
NM_001704chr61162 ------
NM_001709chr1142497 2193 1814 191 12415 ----
NM_001717chr151102 --11147 --
NM_001730chr132479 258 ------
NM_001730chr132479 258 ------
NM_001742chr71456 ------
NM_001743chr22524 385 ------
NM_001746chr51495 ------
NM_001754chr2173908 3706 3432 1260 879 712 111 --1143 14054
NM_001755chr1621501 255 ------
NM_001759chr1285196 4748 4455 4260 3666 572 556 370 13917 13881 --
NM_001777chr333778 2741 1043 22685 832 ----
NM_001791chr11901 --21178 1128 --
NM_001792chr18176 ------
NM_001833chr9168 ------
NM_001839chr1161 --1277 --
NM_001845chr131510 ------
NM_001859chr973730 2852 2709 2543 1520 678 647 --1429 --
NM_001862chr2163 ------
NM_001875chr21166 ------
NM_001882chr5----1104 --
NM_001891chr41348 ------
NM_001892chr53524 403 96 ------
NM_001895chr201145 ------
NM_001901chr61427 --1408 --
NM_001920chr121639 177 ----
NM_001930chr19185 ------
NM_001949chr621037 258 ------
NM_001954chr63578 285 50 1611 ----
NM_001957chr421990 448 12275 ----
NM_001968chr4--1333 ----
NM_001969chr1463400 3209 2829 2386 1208 730 33256 2957 1152 12707 23568 63
NM_001977chr421445 560 ------
NM_001981chr12854 380 2939 296 --1209
NM_001982chr1221107 183 11162 2823 44 --
NM_001987chr1284282 3957 3294 3206 3100 1484 763 30 11723 ----
NM_001995chr41181 ------
NM_001999chr521039 558 --144 --
NM_002006chr424990 2044 15300 1533 1353
NM_002015chr1353382 3092 2265 2039 845 ------
NM_002024chrX11845 --1867 --
NM_002025chrX77404 6441 3689 3089 2631 1657 833 16453 --11746
NM_002028chr141382 --21141 296 148
NM_002031chr61192 ------
NM_002037chr6176 ------
NM_002040chr2131997 452 311 --2941 262 --
NM_002054chr23378 152 46 ------
NM_002061chr131867 1835 1391 ------
NM_002063chrX31040 910 902 ----1265
NM_002076chr1273213 2950 2805 2111 2090 712 79 --1149 --
NM_002077chr941799 1753 1476 440 --21740 268 --
NM_002099chr421597 59 ------
NM_002126chr1723621 2917 22894 855 ----
NM_002137chr72404 119 --1823 --
NM_002138chr41594 ------
NM_002146chr1711217 194 ----
NM_002154chr51106 ------
NM_002156chr2187 ------
NM_002158chr273678 2886 2342 1469 818 770 399 ------
NM_002188chr52671 636 1808 2661 654 --
NM_002189chr10124 ------
NM_002192chr71203 ------
NM_002193chr25385 360 236 179 104 11488 --1248
NM_002202chr5192 ------
NM_002203chr553751 2946 2822 2751 1466 --145 --
NM_002211chr102440 225 ------
NM_002214chr744767 2208 1584 1323 ----1491
NM_002222chr31333 ------
NM_002223chr1263704 3673 3474 3138 369 342 ------
NM_002233chr111420 ------
NM_002234chr121271 1550 ----
NM_002239chr21964 ------
NM_002247chr1022311 657 ----11825
NM_002254chr23755 350 52 ----1302
NM_002264chr344440 1914 1819 1735 1527 ----
NM_002267chr132652 146 ------
NM_002268chr331682 1420 508 ------
NM_002270chr533477 2025 562 ------
NM_002271chr132907 225 ----11627
NM_002285chr274070 3855 3736 929 864 573 86 ------
NM_002293chr162509 2317 1913 1747 562 444 ------
NM_002310chr545471 5049 1657 401 34898 2054 1587 24083 26 12427
NM_002333chr1961134 1048 1012 505 137 59 --11098 --
NM_002334chr1141674 1634 834 789 --1392 --
NM_002336chr1254562 3886 3326 3275 3186 1445 ----
NM_002356chr61893 --1702 --
NM_002374chr223131 2345 --12993 1712
NM_002397chr521760 120 ------
NM_002398chr22933 105 ------
NM_002401chr1782486 2439 2407 2317 933 480 280 164 1999 1123 --
NM_002409chr2293234 2726 2436 2172 2088 1040 951 372 262 3992 583 569 ----
NM_002430chr22----1588 --
NM_002442chr1271696 648 548 275 92 86 62 ----11149
NM_002444chrX41886 557 361 138 ------
NM_002467chr81129 ------
NM_002480chr1231439 1150 68 1320 ----
NM_002481chr1167387 6917 6757 6105 6052 5977 3083 2910 2214 2182 1038 747 644 430 316 137 27179 4858 16112 17803
NM_002495chr5143 ------
NM_002501chr1993709 3699 3305 1082 886 720 511 277 169 13137 14039 1484
NM_002505chr631163 608 320 --2324 209 --
NM_002518chr23801 343 237 1861 ----
NM_002522chr1773263 2679 2409 1211 1201 1118 958 1723 1800 --
NM_002526chr631634 1192 482 ----11410
NM_002537chr151718 ------
NM_002545chr1154430 3701 3675 3286 1214 ----11485
NM_002547chrX53472 2652 2624 891 674 1274 ----
NM_002553chr7165 ------
NM_002577chr343609 2647 1196 655 13274 ----
NM_002581chr984635 4177 3875 1760 1110 513 447 274 14498 44825 1571 1432 73 --
NM_002588chr551577 1510 1425 1189 1146 --21150 160 --
NM_002600chr13659 67 53 1140 ----
NM_002609chr571617 1606 696 547 504 465 240 --31204 409 93 --
NM_002613chr1661957 1641 1274 887 866 95 21576 1340 23984 3754 1892
NM_002629chr101156 1198 ----
NM_002632chr144620 277 210 102 1841 1712 --
NM_002645chr1132078 314 181 ------
NM_002655chr854097 1749 1067 939 133 13476 1874 --
NM_002656chr62938 741 ------
NM_002657chr2032623 1321 590 13378 2557 431 --
NM_002667chr6--21272 849 ----
NM_002687chr14126 1538 ----
NM_002709chr232681 2274 86 ------
NM_002711chr71631 ------
NM_002717chr82577 202 ------
NM_002718chr321019 246 21735 412 ----
NM_002730chr19------2321 87
NM_002731chr163118 2368 2357 2222 1098 856 ----1612
NM_002733chr122226 142 ------
NM_002734chr17----1795 --
NM_002738chr162733 270 ------
NM_002745chr2284432 3080 2855 2793 1197 673 458 367 11180 11722 --
NM_002753chr41320 1559 ----
NM_002825chr71493 ------
NM_002828chr182796 144 ------
NM_002830chr21386 ------
NM_002834chr1243283 1098 670 549 52692 2677 2481 1441 1046 23108 2700 --
NM_002835chr7--2635 62 1510 --
NM_002837chr1274438 3880 3249 2788 764 517 90 34258 3766 1251 ----
NM_002839chr921334 1201 --32972 981 977 --
NM_002843chr1163080 2974 2848 2576 1243 361 23040 2310 --12994
NM_002844chr62322 57 ------
NM_002855chr11113419 3073 2751 2421 1390 1290 1069 344 163 145 123 11107 12506 12930
NM_002857chr151897 1779 249 54 34 12225 ----
NM_002858chr11325 11162 ----
NM_002869chr112615 182 ------
NM_002886chr374298 4005 3319 3173 1165 452 111 14797 11072 --
NM_002892chr14--11514 ----
NM_002906chr1151650 1625 1579 673 463 ------
NM_002923chr12621 160 ------
NM_002940chr43711 425 145 ------
NM_002941chr331597 448 284 --1292 --
NM_002942chr321235 142 2958 530 ----
NM_002945chr172246 221 1615 1225 --
NM_002948chr3151 --1810 --
NM_002955chr631557 454 35 --11580 --
NM_002956chr122983 967 ------
NM_002959chr153972 3587 3017 1682 1505 34315 3757 1559 ----
NM_002965chr1568 62 47 41 35 ------
NM_002971chr311114 ------
NM_002977chr233321 3191 124 ------
NM_002994chr431424 299 208 ------
NM_003001chr112271 --11672 1542
NM_003003chr171207 --159 --
NM_003010chr1791700 1621 1512 962 924 583 448 340 265 ------
NM_003012chr873164 887 349 307 261 192 169 --1659 --
NM_003013chr42580 297 ------
NM_003017chr631116 941 405 ------
NM_003026chr911187 --1238 --
NM_003028chr9103820 3577 3276 2567 2555 1506 1183 951 631 79 13100 13446 --
NM_003030chr321678 104 1167 --11450
NM_003031chr162671 27 1108 ----
NM_003034chr1247538 2729 2546 1573 16802 ----
NM_003045chr1384172 3729 3296 3227 938 777 416 124 31388 876 456 33188 1350 177 --
NM_003069chrX1100 ------
NM_003071chr321422 557 ----11428
NM_003076chr1241711 433 348 325 ------
NM_003079chr17----1163 --
NM_003081chr2011192 ------
NM_003101chr141344 1299 371 62 ------
NM_003106chr31427 ------
NM_003107chr642561 1971 786 722 --2982 726 2694 239
NM_003108chr256815 6716 2102 2041 1190 14628 14722 --
NM_003111chr211044 ------
NM_003113chr21195 ------
NM_003126chr11429 ------
NM_003133chr11160 ------
NM_003150chr1742217 1461 756 74 --1595 11635
NM_003155chr832180 515 328 ------
NM_003157chr3179 ------
NM_003161chr1732680 2335 985 1618 ----
NM_003174chr10----1298 --
NM_003178chr342206 1978 1391 882 --11957 --
NM_003199chr1895530 5007 4945 3532 1727 1578 1500 581 479 --1483 --
NM_003202chr551752 1562 1396 298 93 11532 --1501
NM_003206chr61365 ------
NM_003216chr2263322 2849 2423 2175 193 136 ----13221
NM_003220chr62482 292 ------
NM_003236chr2123165 3058 2960 2919 2723 2671 1108 1061 866 758 335 26 ------
NM_003242chr331862 362 258 --1554 --
NM_003244chr181157 ------
NM_003253chr211150 ------
NM_003262chr344569 3642 1280 402 34829 4707 3574 ----
NM_003274chr2152820 2295 987 472 149 12256 136 2608 89
NM_003298chr3105465 4989 4507 4379 3788 1857 1748 1327 709 108 24288 837 24630 2339 --
NM_003300chr141189 ------
NM_003320chr1163825 3763 3482 3221 1031 394 23030 404 54325 3704 914 147 143 --
NM_003324chr1231375 1239 599 1326 1540 --
NM_003326chr162528 2301 2290 2260 840 107 ------
NM_003342chr1742450 2122 901 769 ------
NM_003344chr771657 1544 1520 1402 666 481 271 ------
NM_003348chr1231475 474 446 ------
NM_003360chr4175 ------
NM_003369chr1132653 1702 674 ----2930 786
NM_003373chr1021916 770 21449 315 ----
NM_003385chr2159 ------
NM_003387chr252591 1889 804 749 470 12952 ----
NM_003390chr1131005 705 49 ------
NM_003399chrX61005 989 881 716 710 269 1873 1273 1645
NM_003405chr222318 117 ------
NM_003407chr191452 ------
NM_003411chrY41576 1276 262 64 ------
NM_003413chrX31935 1361 169 ------
NM_003457chr17169 ------
NM_003462chr161417 589 532 274 104 67 --1210 --
NM_003463chr632727 179 69 1144 12711 --
NM_003466chr252446 1883 941 909 485 12110 2732 291 --
NM_003468chr264147 3998 3888 3654 3327 3286 21697 1274 43687 2734 1642 490 --
NM_003472chr611000 ------
NM_003478chr1122092 1041 ------
NM_003483chr1242679 2406 2114 632 ------
NM_003559chr1793507 3444 3262 2793 2771 2725 2702 2685 1427 128 11151 122
NM_003566chr1221046 256 --12354 --
NM_003576chr1342454 2343 2063 1979 ----1176
NM_003580chr81562 ------
NM_003590chr223316 479 13720 ----
NM_003624chr1961367 1341 1123 974 939 126 --21372 421 1349
NM_003629chr143163 2669 1406 195 21157 280 1149 --
NM_003632chr172663 608 ------
NM_003633chr521943 590 12111 11877 --
NM_003644chr17126116 5471 5454 5178 2411 2096 1831 1563 892 550 470 421 15315 14671 --
NM_003659chr23928 854 250 --1360 --
NM_003663chr343079 2209 1192 1123 ------
NM_003676chr11673 --1164 --
NM_003677chr1272218 2186 2097 1933 1556 639 594 ------
NM_003686chr1------140
NM_003690chr21571 ------
NM_003692chr91144 ------
NM_003713chr12526 407 ------
NM_003714chr552211 1037 905 432 283 12866 ----
NM_003722chr332308 2241 1700 12698 1817 --
NM_003735chr551577 1510 1425 1189 1146 --21150 160 --
NM_003736chr551577 1510 1425 1189 1146 --21150 160 --
NM_003743chr262173 1815 1516 1403 296 100 ------
NM_003758chr151281 ------
NM_003758chr151281 ------
NM_003759chr443968 3758 1497 22 33909 3776 1054 ----
NM_003762chr121025 1000 11247 11136 --
NM_003763chr2082641 2573 2238 2212 2167 868 649 366 --1842 --
NM_003800chr62951 151 175 ----
NM_003822chr143073 2180 633 559 --12805 --
NM_003825chr153509 457 324 1130 ----
NM_003842chr842374 1542 923 515 125 22253 77 --
NM_003858chr141248 --1709 --
NM_003870chr1542018 713 585 98 ------
NM_003873chr1032095 118 27 --1200 --
NM_003877chr122161 53 ------
NM_003885chr175897 803 734 669 441 1332 --11072
NM_003891chr131274 ------
NM_003895chr2142162 1974 1591 243 ------
NM_003901chr1032486 2395 694 1371 ----
NM_003908chr2021142 433 ------
NM_003913chr651429 1338 1301 442 366 ------
NM_003927chr18--1792 ----
NM_003930chr741902 872 840 569 12064 1800 --
NM_003941chr722320 1751 --12406 --
NM_003953chr151150 1122 854 843 196 --12817 --
NM_003958chr653130 1104 1060 170 149 12413 12858 --
NM_003966chr567682 5828 1305 1172 835 221 22972 1927 ----
NM_003983chr1694071 3856 3371 3021 2910 2824 2817 1627 133 23305 829 23375 3009 --
NM_003994chr1254183 3441 2928 686 508 12668 ----
NM_004028chr1832671 997 442 13044 ----
NM_004034chr10194 ------
NM_004055chr1192078 2024 1881 1842 1546 1500 843 836 82 ------
NM_004064chr121835 ------
NM_004073chr1----1208 --
NM_004075chr121236 ------
NM_004079chr152514 1850 1806 310 211 ------
NM_004081chrY1101 ----11141
NM_004085chrX2614 79 ------
NM_004087chr331674 438 241 ------
NM_004094chr1452477 2186 1942 1034 1024 ------
NM_004099chr941673 839 658 600 21536 311 ----
NM_004102chr1----1478 --
NM_004105chr22369 36 ------
NM_004113chr321302 575 ------
NM_004114chrX11038 ------
NM_004117chr622151 251 1575 1635 --
NM_004124chr1432764 2329 570 ------
NM_004132chr1021198 413 --11011 --
NM_004134chr52544 158 125 ----
NM_004157chr34848 735 156 55 ------
NM_004161chr231381 366 185 ----11050
NM_004162chr32991 439 ------
NM_004170chr931820 1484 512 ------
NM_004171chr11159059 8671 7881 7792 6390 6116 3541 2408 2146 1621 1390 1160 962 786 156 26149 3037 17989 12237
NM_004177chr1141428 1319 690 163 ------
NM_004183chr113287 81 75 2667 207 133 --
NM_004200chr1193218 3006 2994 2768 2253 2144 1010 637 446 1288 1125 1296
NM_004227chr762599 2427 1903 792 609 338 --12063 --
NM_004232chr1853536 3409 3121 3014 1451 12809 ----
NM_004233chr641263 1155 282 250 ------
NM_004235chr91605 ----197
NM_004261chr11844 ------
NM_004267chr32182 162 ------
NM_004272chr531542 309 190 ------
NM_004280chr62475 94 ------
NM_004286chr2282812 2575 2157 1969 1873 1038 1005 78 2525 186 12202 1117
NM_004296chr14113841 3140 2937 2771 2615 2452 1518 1252 1115 1072 474 23590 2485 13088 12945
NM_004301chr31384 ------
NM_004302chr1262843 1012 997 548 311 111 11068 ----
NM_004304chr2--1331 ----
NM_004309chr171346 --31002 877 262 --
NM_004311chr1042639 2455 1030 874 --2701 496 --
NM_004316chr1221026 171 --11052 --
NM_004321chr292924 2636 2589 2379 2301 969 739 516 353 --53027 2792 2493 2316 25 --
NM_004329chr1031413 1323 301 ------
NM_004330chr15--1790 ----
NM_004338chr1856300 4587 1670 1438 1205 35420 2246 361 25787 434 11472
NM_004342chr71786 ------
NM_004369chr22249 46 ------
NM_004370chr62716 273 ------
NM_004380chr1611684 ------
NM_004384chr521588 579 ------
NM_004385chr53581 122 40 ----1541
NM_004392chr1342022 1689 1056 1027 ----151
NM_004397chr1164086 3834 3649 3466 1500 1108 ------
NM_004420chr1152393 2154 1492 939 789 --41983 1518 535 37 --
NM_004423chr352111 1868 814 576 409 --144 12496
NM_004426chr1231703 1695 1324 --1566 --
NM_004429chrX61282 1231 1139 587 486 220 --21326 521 --
NM_004430chr851024 856 229 189 76 12151 22753 175 --
NM_004432chr932183 290 96 ------
NM_004438chr242202 2104 1262 405 ------
NM_004447chr1211116 ------
NM_004450chr142359 117 ------
NM_004454chr34891 627 216 37 ----1559
NM_004459chr172445 88 175 ----
NM_004500chr1421692 1358 ------
NM_004501chr144031 3988 1439 828 ------
NM_004503chr122747 153 ------
NM_004505chr1741443 719 604 253 21579 365 ----
NM_004527chr17--1589 31167 354 94 --
NM_004537chr121138 1409 ----
NM_004543chr2150 ------
NM_004583chr173787 583 302 ------
NM_004588chr11113051 2522 1563 1282 1130 1068 872 774 762 572 483 1699 12526 --
NM_004602chr2021531 416 --1272 --
NM_004614chr1672379 2162 2094 2039 1880 481 109 12290 31545 900 643 --
NM_004616chr12131 ------
NM_004620chr111250 ------
NM_004625chr3--137 ----
NM_004631chr11985 11343 ----
NM_004641chr101130 ------
NM_004646chr192440 408 1848 ----
NM_004654chrY1322 1310 ----
NM_004657chr231515 625 595 1290 148 --
NM_004660chrY1670 167 22196 1614 --
NM_004663chr1521464 1439 ------
NM_004687chr1711312 --1611 --
NM_004698chr11160 ------
NM_004703chr1742458 2231 2223 1007 ------
NM_004705chr111121 ------
NM_004716chr115817 754 363 294 203 ------
NM_004717chr711096 11430 ----
NM_004725chr10----1571 --
NM_004726chrX74538 4506 3908 1990 1192 932 706 35359 5139 4655 14750 15569
NM_004734chr1363207 2696 2545 2414 398 392 --124 --
NM_004742chr32636 545 ------
NM_004747chr1021315 274 ------
NM_004748chr1553602 3533 3168 2762 337 1371 22595 1677 --
NM_004760chr712493 1161 12177 --
NM_004772chr511226 ------
NM_004774chr1742953 2754 2273 1199 42933 757 87 32 11942 --
NM_004775chr183533 157 118 ------
NM_004776chr2063154 2765 2091 1284 1277 182 --12825 --
NM_004779chr511091 1984 ----
NM_004788chr1132507 1801 1105 ------
NM_004796chr1431620 951 199 1291 ----
NM_004799chr1150 ------
NM_004801chr231047 429 401 ------
NM_004805chr21530 --21180 219 --
NM_004808chr1063133 3073 2383 2136 2064 849 23043 172 12906 --
NM_004822chr172850 507 --52805 2745 2633 1582 638 11609
NM_004840chrX81915 1849 1835 1545 1514 870 374 320 ------
NM_004842chr63626 403 251 1386 ----
NM_004849chr631462 1178 1139 1126 ----
NM_004867chrX1569 140 ----
NM_004879chr111247 ----1620
NM_004887chr51834 ------
NM_004896chr1011091 11502 ----
NM_004898chr442855 1934 296 218 11167 22665 191 --
NM_004904chr785670 5437 5130 5078 5021 4931 4374 289 --15969 --
NM_004912chr7--21279 159 ----
NM_004947chr342149 1993 1976 657 32173 823 99 11022 --
NM_004948chr1811360 11330 --11267
NM_004973chr631547 529 399 ----1202
NM_004976chr11124993 4901 4088 3848 3522 1938 1800 1594 1544 1419 272 135 14569 11804 24906 46
NM_004992chrX148386 8044 7671 7535 7373 6854 6842 6489 6405 5959 3116 1682 1649 1318 21875 232 1208 17329
NM_004992chrX148386 8044 7671 7535 7373 6854 6842 6489 6405 5959 3116 1682 1649 1318 21875 232 1208 17329
NM_005010chr72579 157 ------
NM_005016chr12----180 --
NM_005020chr72539 479 ------
NM_005028chr1062198 2190 1761 797 344 170 --11823 --
NM_005032chrX3238 58 26 2690 198 ----
NM_005056chr1234291 464 164 1510 23904 3411 --
NM_005063chr1023352 2347 23678 425 140 --
NM_005076chr183593 3522 2840 2805 1454 1214 757 684 11115 33526 938 58 --
NM_005096chrX31145 909 244 ------
NM_005105chr131699 814 424 --11592 --
NM_005109chr352414 2007 1651 697 197 1961 ----
NM_005116chr2084000 3781 3614 1418 1082 823 712 298 23677 3620 --23976 3209
NM_005121chr1752727 1161 722 307 268 12815 12710 --
NM_005124chr6--2200 95 ----
NM_005135chr1542667 1317 256 184 13085 ----
NM_005151chr1842347 1994 1647 416 --11512 1348
NM_005154chr151662 ------
NM_005156chr931891 1793 183 --34905 3979 3603 --
NM_005168chr231516 1213 90 1260 ----
NM_005180chr102514 477 ------
NM_005187chr1661987 1975 1546 1425 779 217 --11296 --
NM_005188chr11137058 6484 6381 5820 5634 5528 5507 3321 1811 1549 954 807 678 26677 1053 47726 2818 2041 179 --
NM_005189chr1782382 2337 1987 1908 1821 739 571 486 32276 2184 1993 12294 --
NM_005190chr64903 710 400 324 ------
NM_005197chr1486038 5864 5169 2048 1992 1226 607 441 11899 11218 --
NM_005214chr2178 ------
NM_005221chr71270 ------
NM_005233chr332291 709 288 ----11920
NM_005235chr266696 5273 5086 4980 1279 96 --15389 1257
NM_005241chr32849 518 ------
NM_005245chr42763 152 ------
NM_005254chr152544 81 ------
NM_005256chr112757 64 ------
NM_005259chr21113 1231 ----
NM_005261chr82182 122 ------
NM_005271chr1051154 1096 833 334 144 --1345 --
NM_005276chr1261606 1469 1377 420 151 22 11077 ----
NM_005276chr1261606 1469 1377 420 151 22 11077 ----
NM_005296chrX11059 1683 --2871 113
NM_005311chr74846 682 218 136 --31808 1804 883 --
NM_005312chr972634 2459 1719 990 891 165 125 1850 41723 1032 994 218 --
NM_005313chr1531328 1050 500 ------
NM_005328chr82297 27 ------
NM_005338chr7124055 3946 3842 3610 3579 2657 1520 1498 674 241 104 71 23956 3445 32745 2689 2518 1531
NM_005339chr433245 641 398 23889 1180 23463 948 --
NM_005347chr921573 555 ------
NM_005359chr1876382 6073 5119 4248 2604 2284 2209 36396 5163 4715 11417 --
NM_005378chr2124 ------
NM_005384chr9--1199 ----
NM_005385chr342632 1746 413 215 ------
NM_005386chr203340 145 72 --160 1822
NM_005387chr11149 1624 ----
NM_005392chr93707 629 510 21150 393 1155 --
NM_005397chr752858 2493 1384 956 372 12695 11108 --
NM_005398chr10--1402 ----
NM_005407chr141364 ------
NM_005433chr181547 1330 1502 --
NM_005436chr1023352 1427 1987 1166 --
NM_005455chr13594 523 361 ------
NM_005465chr132011 743 121 1782 ----
NM_005475chr1242791 751 715 682 43085 2936 674 315 22631 2570 12212
NM_005477chr1562532 1632 819 617 486 319 42047 1965 1616 271 ----
NM_005477chr1562532 1632 819 617 486 319 42047 1965 1616 271 ----
NM_005487chr223803 349 213 ------
NM_005497chr17146026 5927 5629 5293 5262 4641 4591 4390 4359 4225 4117 1942 966 656 ------
NM_005499chr191234 ------
NM_005501chr174997 422 353 186 --1832 1929
NM_005502chr941178 849 818 378 22352 89 ----
NM_005503chr1561129 903 385 275 106 71 --2878 27 --
NM_005504chr1246229 5920 4615 1824 24506 4208 ----
NM_005517chr12952 565 ------
NM_005520chr5128 ------
NM_005542chr711755 --11357 --
NM_005546chr572389 1677 1502 1490 541 198 175 1220 ----
NM_005550chr161629 --1528 --
NM_005565chr51398 ----1415
NM_005575chr52616 89 ------
NM_005576chr15--1261 ----
NM_005578chr354046 3657 3158 1304 451 24479 3239 23699 22 --
NM_005596chr986394 5989 5422 5407 5056 565 450 47 16215 ----
NM_005604chr632082 913 660 1293 ----
NM_005614chr711029 ------
NM_005629chrX3841 536 38 --1540 --
NM_005634chrX3521 498 183 ------
NM_005637chr1841824 1779 42 25 11916 ----
NM_005639chr1241189 666 97 49 --11231 --
NM_005647chrX62945 2704 2497 2382 2236 46 --32653 1304 1230 13293
NM_005655chr83512 172 51 124 ----
NM_005668chr564301 3702 3654 1682 1029 863 --1477 --
NM_005708chr131406 ------
NM_005715chr672582 2433 2101 1812 823 758 488 ------
NM_005717chr13446 407 384 ------
NM_005723chr41233 ------
NM_005725chr122344 401 ------
NM_005730chr1283352 3168 2436 2409 2399 937 696 26 23341 2529 23325 513 --
NM_005731chr21341 ------
NM_005734chr11175 ------
NM_005748chr1222595 987 ------
NM_005749chr171687 ------
NM_005754chr531154 317 25 ------
NM_005759chr294596 3154 1420 1350 1059 1008 743 279 39 43836 1481 1159 805 13908 13429
NM_005768chr123553 144 98 ------
NM_005779chr573485 2364 1120 1029 973 876 157 --1741 --
NM_005813chr241721 1615 936 380 --1910 --
NM_005828chr1784217 4093 4077 3596 3091 1773 155 94 --11281 --
NM_005832chr31407 --1542 --
NM_005840chrX87278 6796 5763 5284 5028 2776 302 99 37464 6831 6630 ----
NM_005842chr131188 ------
NM_005843chr241532 1503 771 756 ------
NM_005862chr31717 148 ----
NM_005863chr1031370 1338 157 ------
NM_005864chr142789 617 ------
NM_005868chr722391 401 --1405 --
NM_005872chr11206 ------
NM_005896chr22528 339 1122 ----
NM_005898chr11146 --22879 1171 --
NM_005899chr1731527 1402 1332 --11406 --
NM_005901chr1898123 7821 7728 7238 7230 5437 3361 2011 641 38065 7072 6854 --18213
NM_005902chr1563897 3760 3069 1725 948 890 --44448 4129 2973 2830 --
NM_005903chr545035 1679 1462 753 --12075 13920
NM_005909chr564178 2988 2791 2673 1158 277 ------
NM_005911chr221363 125 ------
NM_005927chr51193 ------
NM_005933chr1152947 2654 2629 2335 664 --32633 1034 455 --
NM_005934chr1941798 905 796 697 12651 154 12027
NM_005935chr494950 3943 3883 2112 1019 856 713 392 125 21832 1799 --11244
NM_005937chr1773617 3498 3491 3087 1285 1206 844 --23030 1372 --
NM_005938chrX6969 892 449 404 111 44 ------
NM_005941chr873295 2667 1659 1104 735 643 89 ----13851
NM_005955chr1105173 4546 4418 1808 1650 1564 1439 993 862 503 44956 1835 1692 466 11019 --
NM_005957chr194819 4787 4116 4085 3895 1678 1070 348 217 24918 3309 43473 1545 1541 1097 1141
NM_005966chr272291 1926 1827 1515 615 175 119 1969 ----
NM_005986chr1312528 1700 12516 --
NM_006007chr954490 4320 4213 4199 3852 14074 14221 --
NM_006011chr1553637 2716 1502 310 46 13559 12642 11175
NM_006015chr131062 980 921 ------
NM_006022chr13186 ------
NM_006029chr142141 43 ------
NM_006032chr141212 ------
NM_006034chr1172391 1921 695 644 453 433 314 141 --2743 725
NM_006036chr242115 1909 1782 1652 ----1302
NM_006037chr294117 3540 3161 1961 864 848 787 137 57 ------
NM_006038chr2011479 1438 1636 --
NM_006041chr171137 ------
NM_006047chr2053157 3082 1323 1168 798 ------
NM_006054chr1141398 647 508 372 ------
NM_006070chr31317 ------
NM_006080chr712368 1701 ----
NM_006085chr13860 351 184 ------
NM_006089chrX71657 1527 1402 558 379 199 150 1747 ----
NM_006094chr812189 ------
NM_006095chr454218 3593 2961 2928 293 23992 3204 13046 11226
NM_006100chr31239 ------
NM_006106chr1132462 2272 76 1368 12836 --
NM_006135chr12898 331 ------
NM_006136chr71431 ----190
NM_006141chr1652745 2435 806 783 663 ------
NM_006148chr1742228 1838 1015 735 12502 ----
NM_006154chr1562068 1873 1828 601 511 243 --12606 --
NM_006156chr14182 ------
NM_006158chr821755 1429 ------
NM_006159chr12199 ------
NM_006164chr22116 31 ------
NM_006180chr922054 1736 11849 ----
NM_006190chr221048 740 ------
NM_006202chr1971948 1841 673 550 535 513 414 --11506 --
NM_006203chr575547 4150 3721 3527 1631 1470 1027 13883 22160 1246 --
NM_006212chr164895 4719 1000 936 852 684 --1668 --
NM_006241chr312210 --11685 --
NM_006251chr542541 1054 445 58 --11312 --
NM_006256chr142306 814 754 249 12131 ----
NM_006264chr41181 ------
NM_006265chr83597 307 23 ------
NM_006275chr2032428 2197 2146 --12168 --
NM_006279chr12897 218 --2161 54 1139
NM_006282chr2043541 3240 1808 80 21661 1387 1163 --
NM_006283chr864612 4339 4234 3595 1804 855 11652 23250 3021 --
NM_006306chrX125831 5717 5096 4560 4354 4331 4214 4169 3884 1505 1343 1067 55550 5273 5049 4760 759 --25748 3780
NM_006310chr1731001 931 487 --1876 --
NM_006313chr12--11102 ----
NM_006317chr51269 ------
NM_006320chr4123 ------
NM_006321chr321552 1515 1520 1107 --
NM_006325chr121261 ------
NM_006328chr11----1510 --
NM_006350chr51265 ------
NM_006352chr1--1197 ----
NM_006359chrX41632 976 722 714 ------
NM_006367chr11130 ------
NM_006371chr374948 4899 4741 3501 2034 1170 416 11016 15163 --
NM_006373chr1721277 307 11018 ----
NM_006387chr1951012 960 306 229 32 2400 340 1908 --
NM_006393chr1074567 1547 1453 1203 1075 705 405 ------
NM_006407chr351335 1324 1013 1004 542 11064 ----
NM_006434chr1052890 2619 732 444 78 21169 325 --12311
NM_006449chr242099 1355 583 298 1222 ----
NM_006451chr51919 ------
NM_006454chr473043 2569 2307 916 606 597 41 --32921 2171 2081 --
NM_006459chr103381 193 162 --21230 585 --
NM_006464chr264396 3926 3830 3756 3430 3399 14324 23971 2847 --
NM_006472chr121190 1180 --1193 11260
NM_006496chr12772 79 1189 ----
NM_006520chrX11547 ----1354
NM_006521chrX31401 1342 372 1173 155 --
NM_006526chr202833 652 ------
NM_006529chr421491 656 ------
NM_006532chr1931596 342 106 --11324 --
NM_006538chr273375 3046 1617 1454 1410 1336 450 1818 1100 --
NM_006539chr161501 ------
NM_006544chr14105433 5396 4820 4612 4570 2293 1586 1574 148 109 --14377 --
NM_006546chr1796640 6487 6126 5983 5286 1858 1609 1451 1086 --35970 4994 2177 --
NM_006547chr731525 691 117 11842 ----
NM_006548chr331786 1497 258 --3198 138 79 184
NM_006557chr921553 1398 ------
NM_006558chr82368 29 ------
NM_006559chr12859 841 ------
NM_006561chr1075723 5457 4780 4446 4120 3869 1930 ------
NM_006575chr1411099 --1173 --
NM_006587chr421319 32 ------
NM_006595chr1131766 1692 163 --11720 --
NM_006599chr1698279 6879 5922 5277 3317 2636 2316 2302 696 16281 16211 25604 1668
NM_006601chr121202 ------
NM_006603chrX21778 1503 11477 --11307
NM_006614chr323453 2517 11322 --1990
NM_006618chr121498 102 ------
NM_006620chr653714 3701 2974 1648 620 ------
NM_006624chr1022029 1624 ------
NM_006628chr1544402 3897 3640 3595 ------
NM_006629chr1831926 773 413 1782 --1935
NM_006644chr131523 ------
NM_006646chr1311052 11079 1807 22900 812
NM_006650chr583596 3443 2796 1266 767 513 462 131 --21096 343 --
NM_006654chr1234493 3020 1241 14444 1547 --
NM_006690chr2092322 2155 2091 771 384 262 97 81 38 --142 --
NM_006696chr52233 219 ------
NM_006713chr51574 ------
NM_006717chr951363 1316 923 559 261 ------
NM_006718chr62938 741 ------
NM_006726chr41303 ------
NM_006727chr5----1100 --
NM_006729chrX84551 4341 3886 3752 3709 2225 630 326 ------
NM_006738chr15103930 3775 3453 2915 1689 1658 1048 1024 205 45 13374 33797 3538 1712 --
NM_006746chrX2504 346 1133 ----
NM_006749chr82962 28 ------
NM_006750chr1685902 2750 2108 1738 1254 1067 1032 783 1186 ----
NM_006763chr131532 294 249 --21616 653 1440
NM_006769chr12653 98 ------
NM_006775chr622760 1184 --12146 12025
NM_006786chr1125 ------
NM_006791chr151595 ------
NM_006800chrX2590 498 ------
NM_006802chr141118 1106 995 446 ------
NM_006805chr521360 237 ------
NM_006811chr203906 883 861 ------
NM_006818chr11873 ------
NM_006827chr1452690 1333 772 766 290 --141 --
NM_006828chr6156 ------
NM_006832chr143433 290 33 1976 ----
NM_006838chr1231826 1674 1442 --11541 --
NM_006851chr1212599 22929 978 ----
NM_006852chr171245 31876 1816 1001 22704 199 --
NM_006854chr721847 1832 1161 ----
NM_006856chr123991 254 156 ----132
NM_006868chr1882901 2804 2533 2160 2115 983 572 473 138 23107 3103 22120 988
NM_006873chr233353 3048 1053 --1291 --
NM_006874chr411170 ------
NM_006876chr11130 ------
NM_006884chr321678 104 1167 --11450
NM_006885chr1623717 3252 --13197 --
NM_006888chr1462346 1379 1348 958 757 306 --1344 --
NM_006894chr11135 ------
NM_006914chr9----1575 --
NM_006915chrX12270 ------
NM_006920chr22737 543 21349 266 ----
NM_006922chr221804 126 ------
NM_006924chr1713619 13366 ----
NM_006927chr1661939 1907 1606 604 275 201 1413 11617 12108
NM_006946chr111573 --1414 1470
NM_006951chr103654 645 544 1682 ----
NM_006981chr952541 964 825 688 397 1176 ----
NM_006990chr152451 2108 1546 395 379 32179 946 494 12475 --
NM_007006chr1683256 3012 2841 2748 2684 1206 361 54 ------
NM_007008chr23622 593 138 2664 345 ----
NM_007011chr1576159 5548 5167 5054 4640 4297 2394 1499 34979 4939 4860 --
NM_007013chr82331 49 1925 ----
NM_007017chr53816 106 100 ------
NM_007034chr11277 ------
NM_007038chr2184431 4104 3807 1738 1141 748 611 492 25543 5402 --13890
NM_007042chr352479 2282 2031 427 140 11711 ----
NM_007047chr642253 340 309 169 12323 --12234
NM_007050chr20177878 7612 7538 7296 6065 5660 5498 3185 3101 2209 2161 1788 1715 1693 1179 240 234 11568 35225 1760 659 17340
NM_007052chrX184 ------
NM_007054chr553006 2851 2801 1334 915 ------
NM_007073chr693951 1631 1547 1525 1391 1115 773 727 185 1936 ----
NM_007078chr1052694 2662 2527 701 216 ------
NM_007096chr9168 ------
NM_007106chr1341825 783 547 251 ------
NM_007107chr352060 1661 1629 692 593 11828 ----
NM_007118chr5------1791
NM_007125chrY11154 11292 ----
NM_007126chr91132 ------
NM_007146chr1742687 2604 2155 439 12248 ----
NM_007156chrX288 48 ------
NM_007159chr331401 1348 1192 --11282 --
NM_007166chr1111123 ------
NM_007167chr13879 344 336 1804 ----
NM_007170chr13946 323 121 ------
NM_007174chr1262190 844 648 578 230 103 ------
NM_007200chr15103930 3775 3453 2915 1689 1658 1048 1024 205 45 13374 33797 3538 1712 --
NM_007203chr952866 2672 1227 1076 495 13024 ----
NM_007216chr111250 ------
NM_007235chr121434 ------
NM_007236chr1562211 2079 2010 1770 1680 329 ----12267
NM_007246chr41979 ------
NM_007249chr1388534 2873 2414 2305 2271 1256 945 578 1455 ----
NM_007276chr721039 321 ------
NM_007282chr33636 353 251 ------
NM_007283chr3173105 3028 2994 2797 2748 2738 2616 2433 2421 1990 1970 1952 1190 1145 968 555 483 1940 ----
NM_007285chr16155 ----1396
NM_007286chr541990 1338 788 670 140 ----
NM_007308chr42679 84 ------
NM_007324chr1150 ------
NM_007331chr442576 1682 964 701 2945 542 ----
NM_007345chr1811964 11547 ----
NM_007353chr742473 1134 842 537 12813 2154 150 --
NM_007358chr141580 1532 1275 320 ------
NM_007373chr103650 542 149 ----1488
NM_009588chr61394 ------
NM_012069chrX92474 2027 1982 1071 992 454 325 314 119 ----21692 100
NM_012072chr2063408 3375 1153 887 764 38 1585 ----
NM_012081chr533474 3330 2348 ------
NM_012095chr1093164 3132 2868 2371 2218 1258 984 412 386 13362 ----
NM_012096chr353123 2879 2640 2542 1411 ------
NM_012100chr22804 772 ------
NM_012104chr1173091 3056 2703 1050 789 637 448 23560 97 ----
NM_012104chr1173091 3056 2703 1050 789 637 448 23560 97 ----
NM_012115chr61537 ------
NM_012124chr111150 ------
NM_012137chr152815 2620 2557 1842 507 22478 1080 --1358
NM_012141chr1324120 3514 ----13759
NM_012156chr2032130 1077 549 32804 382 45 11297 --
NM_012158chr131206 --1121 --
NM_012160chr62532 446 ------
NM_012164chr9106302 5449 5307 4816 2412 1648 681 477 154 75 32998 1922 1429 1821 --
NM_012175chr111233 ------
NM_012193chr1164712 4301 4131 4087 1235 217 13413 --11361
NM_012199chr174390 3862 3725 3706 3217 908 166 ----2901 187
NM_012210chr921185 973 ------
NM_012214chr2105648 4965 4235 2474 2380 1930 1425 1393 783 772 --22478 1578 11526
NM_012234chr342601 2560 2408 1051 ----11332
NM_012238chr102537 397 --11426 --
NM_012249chr241118 473 462 66 ----13341
NM_012257chr72778 733 ------
NM_012259chr6284 54 ------
NM_012262chr135165 4925 4142 13973 ----
NM_012286chrX1585 ------
NM_012287chr374316 2895 1741 1696 1439 372 56 12874 --13713
NM_012288chr6145316 5061 4391 4361 3605 2118 1522 1343 976 897 732 604 517 115 --34958 2204 980 --
NM_012290chr221581 1105 ------
NM_012294chr793967 3481 3340 3291 1135 1082 683 168 137 1231 2971 565 --
NM_012300chr562533 2355 2204 864 815 630 ------
NM_012301chr721954 235 1767 ----
NM_012302chr12911 308 --1243 --
NM_012306chr12113463 3339 3079 2567 2529 2193 1402 1253 1221 944 117 --42883 1375 1215 1070 --
NM_012307chr182286 37 ------
NM_012311chr103608 510 148 ------
NM_012316chr1115376 5330 5268 5101 5070 4778 4614 4427 4005 1061 98 11888 146 --
NM_012323chr2271386 1354 1221 620 388 286 26 11193 --11085
NM_012326chr22699 131 --2321 300 --
NM_012330chr1021169 286 ------
NM_012334chr574590 4240 4208 3436 3036 1682 84 --14076 1291
NM_012347chr672698 1837 1191 1005 815 665 601 12089 ----
NM_012381chr6161 122 ----
NM_012383chr91424 ------
NM_012384chr2062250 951 871 355 299 53 1740 42254 1583 629 429 --
NM_012388chr1511148 12381 ----
NM_012398chr1982881 1835 955 722 621 610 402 237 11174 ----
NM_012399chr2251471 1319 699 659 511 --179 --
NM_012408chr203750 649 90 ------
NM_012412chr71749 ------
NM_012416chr931125 768 308 ------
NM_012428chr151164 ------
NM_012433chr2134 1123 ----
NM_012446chr52110 40 ------
NM_012448chr1732515 2427 920 1826 11973 --
NM_012455chr221254 1234 --31545 1444 444 --
NM_012460chr14198 ------
NM_012463chr1271806 1732 1449 1384 700 654 122 ------
NM_012479chr72611 186 ------
NM_013230chrY31404 1376 1132 ------
NM_013233chr21508 ------
NM_013253chr113920 290 209 ----11424
NM_013255chr7107890 7553 7426 7029 6066 5965 2770 2467 1704 1591 47861 7460 5599 2263 ----
NM_013261chr443495 2335 1151 603 ------
NM_013262chr63314 200 151 11223 11153 --
NM_013269chr1231076 833 763 22802 885 ----
NM_013283chr52276 174 ------
NM_013293chr7----1471 --
NM_013300chr12--1221 ----
NM_013309chr1532246 375 44 12086 12218 --
NM_013333chr19----1301 --
NM_013336chr362007 1488 805 756 325 224 ------
NM_013354chr811193 ------
NM_013372chr1542927 2340 1057 699 1101 ----
NM_013377chr12--1638 ----
NM_013382chr1472320 1969 1806 820 178 80 51 11959 22337 2005 --
NM_013390chr92367 342 ------
NM_013392chr2----182 --
NM_013396chr211350 1155 ----
NM_013399chr1641475 719 458 384 ----1373
NM_013411chr12662 333 32507 2121 949 12205 --
NM_013423chrX1197 ------
NM_013427chrX1197 ------
NM_013437chr81195 ------
NM_013444chrX1729 ------
NM_013446chr71905 ------
NM_013450chr21217 ------
NM_013451chr101166 ------
NM_013943chr143297 2315 1241 376 ------
NM_013951chr252446 1883 941 909 485 12110 2732 291 --
NM_013952chr252523 1960 1018 986 562 12187 2809 368 --
NM_013953chr252523 1960 1018 986 562 12187 2809 368 --
NM_013989chr1464753 3238 3167 784 704 542 34128 3944 814 ----
NM_013992chr252523 1960 1018 986 562 12187 2809 368 --
NM_013993chr63578 285 50 1611 ----
NM_013994chr63578 285 50 1611 ----
NM_014000chr1021916 770 21449 315 ----
NM_014011chr221649 644 1870 ----
NM_014016chr331571 1443 1410 11104 ----
NM_014018chr8141 ------
NM_014028chr613093 22916 2342 ----
NM_014030chr1761149 1009 777 759 458 380 --1137 --
NM_014048chr1684039 3515 3494 1919 1887 1319 522 476 --13349 --
NM_014057chr921480 517 ------
NM_014109chr811126 1494 ----
NM_014112chr875043 4987 4342 4136 1598 1098 801 ------
NM_014117chr16--22523 1891 12345 12711
NM_014141chr784129 4038 4019 3983 3774 3677 3332 1998 1885 ----
NM_014155chr1175527 5224 4791 1531 920 368 197 26405 588 16619 --
NM_014157chr1693282 3112 2761 2574 2440 1137 889 311 240 33048 2825 1533 ----
NM_014161chr63228 57 48 1262 187 --
NM_014181chr242145 2130 1832 408 ------
NM_014191chr123965 333 255 ------
NM_014210chr172517 55 ------
NM_014216chr1441414 1087 545 58 ----1568
NM_014217chr141946 1823 169 31 11745 ----
NM_014238chr1741460 1315 1286 1262 ------
NM_014240chr393840 3647 3544 3388 2835 2581 1578 996 43 11484 11558 --
NM_014243chr421451 653 --11573 --
NM_014248chr221134 ------
NM_014250chr223803 349 213 ------
NM_014271chrX------1573
NM_014282chr91420 2794 80 ----
NM_014289chrX11160 --1925 1472
NM_014299chr1931752 1744 212 1364 11966 11908
NM_014309chr22104818 4793 4317 4265 4225 4020 3959 981 925 329 23972 1939 23949 3576 --
NM_014317chr10128 ------
NM_014319chr122782 398 ------
NM_014325chr1252104 1748 1698 1671 592 11437 ----
NM_014326chr1551379 972 940 496 159 ------
NM_014345chr61847 --1117 --
NM_014352chr1151418 1219 518 373 290 ------
NM_014363chr13191 ------
NM_014372chr121398 79 11880 ----
NM_014397chr93986 95 31 1587 ----
NM_014405chr1772097 1924 1806 1497 804 626 590 1494 12150 --
NM_014421chr462081 1449 1368 663 613 581 --1197 --
NM_014423chr565347 5333 4925 4887 4547 1282 --23423 2201 11687
NM_014432chr631125 249 67 ------
NM_014437chr12741 383 ------
NM_014445chr361787 1516 756 597 420 269 --1760 --
NM_014480chr193863 274 107 ------
NM_014491chr741029 871 805 147 ------
NM_014494chr1621540 103 --181 --
NM_014554chr1212258 ----164
NM_014585chr221082 154 ------
NM_014603chr1731208 686 462 --11313 --
NM_014607chr231869 731 415 ------
NM_014613chr572612 2425 2317 2106 1195 1049 404 32738 1898 76 ----
NM_014615chr1653268 2636 2496 1241 434 22853 2847 ----
NM_014629chr851265 1063 996 514 56 ------
NM_014634chr22153326 3254 3184 2866 2694 2670 2456 597 569 548 511 466 427 309 136 --2498 460 --
NM_014636chr953800 3607 2994 1123 94 13375 12771 --
NM_014647chr1641988 1500 1467 785 11433 ----
NM_014659chr157826 343 304 223 191 181 96 11074 ----
NM_014660chr71119 ------
NM_014665chr8113599 3579 3540 3170 3040 2995 2662 960 836 749 483 22876 1466 53435 3077 1073 743 691 --
NM_014666chr551067 842 829 204 177 ----1853
NM_014667chr332027 329 305 --162 --
NM_014674chr353418 2673 1230 1185 1154 32462 1541 1322 ----
NM_014676chr121326 1046 ------
NM_014677chr821256 402 --2522 288 --
NM_014682chr821424 204 --1889 --
NM_014686chr1971816 1606 1575 832 628 308 214 --1769 --
NM_014689chr22205 53 ------
NM_014701chr1551274 774 683 631 49 2532 437 ----
NM_014702chr623028 536 ------
NM_014705chr722067 395 ----21744 716
NM_014721chr686048 5155 4934 4888 2553 2388 1910 1708 1823 --12563
NM_014729chr841678 840 398 73 ------
NM_014730chr12125094 4488 4471 3663 1855 1781 1626 1607 1543 943 842 53 24363 1550 41383 1346 1211 950 21891 1388
NM_014730chr12125094 4488 4471 3663 1855 1781 1626 1607 1543 943 842 53 24363 1550 41383 1346 1211 950 21891 1388
NM_014732chr16174607 4538 4330 4215 3828 3564 2257 1982 1896 1625 1435 1162 1002 876 371 230 100 25487 1688 34014 3952 391 25122 4233
NM_014733chr521981 1430 1861 ----
NM_014739chr634057 2903 529 --11441 --
NM_014747chr1125826 5251 4774 4636 4077 2314 2194 1333 864 766 643 365 33895 1859 1817 14712 --
NM_014751chr812017 --11392 --
NM_014754chr81738 --1798 --
NM_014755chr253935 3196 2909 1459 834 23432 912 ----
NM_014757chr552004 1691 1613 1585 178 --1693 --
NM_014758chr1141842 1709 100 51 22316 414 166 --
NM_014762chr182518 2363 2206 1954 702 615 576 456 32378 2018 200 --1516
NM_014766chr783426 3259 2863 1377 996 926 810 740 22811 127 21431 862 --
NM_014767chr1051110 764 651 639 398 11445 11468 194
NM_014771chr1641088 932 845 174 1972 --21081 875
NM_014772chr18103482 2948 2775 2519 2409 864 565 538 463 136 2148 60 43210 1284 1246 774 --
NM_014779chr331171 1011 94 ------
NM_014781chr81106 ------
NM_014786chr1141246 1128 223 173 --2177 100 --
NM_014787chr122542 855 1225 --11057
NM_014790chr5197 ------
NM_014795chr221429 143 ------
NM_014812chr13531 348 101 ------
NM_014813chr1188 ------
NM_014824chr1151750 777 697 58 41 ------
NM_014828chr1441987 868 154 22 ------
NM_014830chr1223565 2909 13075 144 32530 668 602
NM_014832chr1311840 2396 303 ----
NM_014836chr1021930 1538 --11295 --
NM_014839chr11624 198 ----
NM_014840chr1252635 2625 2279 796 435 --12338 1207
NM_014844chr14104170 3856 3813 3683 3174 2857 2701 536 360 116 1412 11590 --
NM_014848chr1572362 2306 2298 2120 1121 851 770 ------
NM_014850chr374505 4316 4004 3674 3022 1244 176 --24192 1413 --
NM_014872chr972123 1898 1758 904 554 504 33 1803 --1246
NM_014873chr184274 4164 3498 3038 3017 1689 1407 1037 ------
NM_014877chr17137432 7309 7106 6110 6064 2465 2155 1841 1594 1202 426 280 274 12105 15234 --
NM_014883chr452319 911 889 836 625 --22327 2323 --
NM_014893chrY31816 1709 138 --1354 --
NM_014897chr1742913 2668 1081 459 ------
NM_014906chr1732908 311 25 1608 21109 346 --
NM_014912chr102799 161 ------
NM_014920chr683634 2650 1194 1071 1000 976 843 296 ----12792
NM_014921chr1962433 2228 1006 209 128 38 --22556 1053 1446
NM_014924chr1452428 2069 2023 1271 275 --11105 --
NM_014932chr3----11908 --
NM_014934chr1363401 3385 3235 671 549 33 --13762 --
NM_014935chr193761 3339 3143 2999 2376 1186 452 253 146 11384 ----
NM_014939chr1831069 1030 1021 ------
NM_014945chr51568 11810 --21917 1698
NM_014946chr222909 2331 22360 1985 12413 --
NM_014951chr1042568 1735 1608 482 --22572 927 1579
NM_014962chr2022746 2727 12065 ----
NM_014969chr11280 ------
NM_014982chr1454133 3734 1551 1433 821 24806 3387 ----
NM_014988chr432712 2515 768 12132 --1709
NM_014994chr1592090 2049 1747 1583 926 697 573 434 140 31490 864 686 1809 --
NM_014996chr31340 ------
NM_015000chr1233010 2784 2747 --12985 --
NM_015008chr333685 3149 2458 12303 --13235
NM_015020chr16103623 3617 3323 3253 3177 2986 2465 500 390 313 13875 13659 --
NM_015023chr121659 1573 --11279 --
NM_015024chr811227 ------
NM_015026chr1233598 3267 3102 --13745 1366
NM_015027chr162537 170 ----11918
NM_015032chr1321145 174 ------
NM_015035chr20136380 6343 6087 5914 5900 5433 5402 5005 2609 2368 931 394 32 15793 44119 2681 2459 490 --
NM_015039chr193531 3378 3042 3036 1735 1718 934 610 176 13491 11018 11726
NM_015042chr1551325 1067 444 246 30 --13149 --
NM_015045chr1011607 --1389 --
NM_015046chr9229 23 1229 ----
NM_015049chr222296 838 22132 902 13221 --
NM_015051chr943132 3079 2971 2377 12636 ----
NM_015059chr1543049 2570 1206 294 1465 22819 807 --
NM_015064chr1283567 3535 3483 3404 2680 2601 2342 24 12353 21187 1056 --
NM_015069chr16----1225 --
NM_015071chr5136025 5448 5249 5026 4950 4800 4264 4229 2203 2139 1133 584 180 45599 4025 2125 343 ----
NM_015073chr1981703 1423 1351 843 814 804 351 164 --1598 --
NM_015074chr1104448 4223 4008 3976 3638 3426 3288 3268 3252 3236 14248 35006 3272 3240 --
NM_015075chrX82157 1582 896 754 715 660 237 166 21944 71 1503 --
NM_015076chr644299 1672 1636 24 11510 11677 --
NM_015077chr17154443 4354 4174 3972 3957 3944 3906 1709 1604 1549 1165 833 560 448 199 11787 44337 676 452 346 --
NM_015082chr542612 2342 1005 906 12379 12495 2730 379
NM_015090chr1135325 5299 4573 4369 4347 4269 2220 1495 1158 1040 278 151 23 34659 4584 1770 55699 5103 4360 1991 1755 --
NM_015092chr1653448 1681 1650 703 441 11782 ----
NM_015093chr621269 552 ------
NM_015094chr22144588 4278 4119 3768 3554 3212 2849 1887 1657 1612 1414 1264 495 196 --53086 1741 1475 528 356 13800
NM_015097chr322251 2112 --1621 --
NM_015101chr141930 953 765 114 --21135 391 --
NM_015110chr952194 2106 2060 1868 1616 ------
NM_015113chr1772083 1792 971 659 548 503 143 12106 1615 --
NM_015115chr441175 809 151 59 ------
NM_015129chrX41561 1253 499 261 --1617 --
NM_015130chr441112 901 462 368 ------
NM_015137chr842207 1046 850 382 ------
NM_015141chr352474 872 835 486 331 ------
NM_015144chr1683440 3082 3000 2891 2751 602 342 245 --3832 828 565 --
NM_015149chr161807 1660 1592 715 676 108 1855 12120 --
NM_015155chr1072510 2451 2378 2261 2247 2053 443 ------
NM_015156chr1483930 3624 3449 1608 1395 932 110 79 --1329 --
NM_015157chr111817 3867 803 481 1205 1119
NM_015170chr831927 913 867 1510 ----
NM_015172chr131535 396 77 162 --1249
NM_015178chr852398 1845 505 356 145 1575 --1161
NM_015190chr101409 --1484 1380
NM_015194chr178571 552 516 509 439 415 315 33 1326 1564 --
NM_015199chr31910 ------
NM_015208chr1853972 3799 2874 1613 1204 --33941 3588 2692 --
NM_015225chr982232 1212 1195 1164 1029 576 518 484 ------
NM_015231chr111373 1160 ----
NM_015233chr1331805 658 614 ------
NM_015238chr51449 ------
NM_015250chr932016 1394 554 ------
NM_015251chr1662143 1654 902 870 731 301 12261 1246 --
NM_015263chr153955 862 53 ------
NM_015267chr1252065 1867 1693 1578 1401 ------
NM_015270chr1242268 2211 2041 574 --2817 524 --
NM_015271chr421736 1247 11361 --13156
NM_015272chr1632118 2074 1404 ----11875
NM_015275chr12--11342 1402 --
NM_015278chr631198 767 424 22950 411 22893 2883 --
NM_015282chr232819 2429 327 --32535 2513 91 --
NM_015284chr161383 808 768 378 232 203 1109 21825 1594 --
NM_015288chr593732 3336 2614 2568 1107 870 784 384 61 11310 1747 1492
NM_015291chr152984 950 904 741 393 --11293 --
NM_015299chr1482863 2855 1470 541 501 321 176 43 1398 1188 13625
NM_015310chr8106450 5919 2873 2606 2568 2426 1304 1204 671 458 36385 2654 1116 ----
NM_015313chr1164817 4569 4337 1195 1116 1091 --13320 --
NM_015316chr142865 36 ----190
NM_015317chr222162 1810 ------
NM_015320chr22996 945 11025 ----
NM_015326chr152681 2647 2487 1865 594 2641 255 1223 --
NM_015335chr123991 897 857 1737 1237 --
NM_015336chr1212265 --11888 --
NM_015344chr831566 1355 1345 --2463 459 --
NM_015347chr1232376 349 81 2834 496 12380 --
NM_015349chr643096 1872 617 555 --23019 1186 --
NM_015353chr1741834 1795 1756 241 1765 32480 695 42 --
NM_015365chrX33447 2825 22 --23115 298 --
NM_015375chr184283 4251 1901 1870 827 693 417 402 23348 556 23413 511 --
NM_015381chr2262051 1766 1388 341 183 65 --11910 --
NM_015385chr1052890 2619 732 444 78 21169 325 --12311
NM_015387chr221551 1545 ------
NM_015393chr483302 3232 3219 2893 1360 910 611 234 33569 925 255 1249 --
NM_015419chrX41044 1036 797 64 ------
NM_015429chr311041 ------
NM_015442chr3------1201
NM_015446chr111275 ------
NM_015455chr573743 3684 3252 2498 575 361 155 ------
NM_015458chr894851 4071 4039 2119 1958 1867 514 361 349 22088 222 13275 --
NM_015460chr33616 574 71 11354 1354 --
NM_015470chr231225 403 387 --11240 --
NM_015472chr3129 ------
NM_015472chr3129 ------
NM_015475chr2------1287
NM_015493chr1962204 2007 1592 876 844 167 --22011 710 127
NM_015523chr111287 ------
NM_015535chr233955 3860 235 22870 1505 11173 --
NM_015557chr193607 3542 3410 2520 2509 2368 2259 1189 113 42933 2926 2298 188 13503 --
NM_015560chr352343 2124 1973 651 620 22534 2064 ----
NM_015564chr563609 3415 2523 2491 1391 1292 13310 ----
NM_015569chr143016 1829 1075 696 14697 --11313
NM_015575chr243417 3221 2719 333 ----2889 515
NM_015576chr352869 2101 1183 818 688 ------
NM_015578chr1931537 704 546 ------
NM_015602chr111470 11602 ----
NM_015609chr172690 2494 2475 2156 1988 698 334 1302 1903 --
NM_015610chr752252 1833 436 344 313 1328 12842 --
NM_015630chr22427 43 ------
NM_015640chr175357 4710 4124 3746 1009 725 197 ------
NM_015646chr122533 30 ------
NM_015678chr1321320 147 ------
NM_015700chr2------135
NM_015719chr191139 ------
NM_015832chr18------156
NM_015840chr172142 1707 911 649 625 389 197 ----1735
NM_015841chr172142 1707 911 649 625 389 197 ----1735
NM_015852chr72755 503 ------
NM_015879chr18188422 7745 7557 7496 7286 7206 7097 5888 5851 5820 5757 5202 2848 2731 1500 1363 1097 723 35552 2083 1233 17824 --
NM_015881chr113920 290 209 ----11424
NM_015885chr111128 ------
NM_015902chr81234 --1716 --
NM_015975chrX21384 323 11630 ----
NM_015981chr572686 2236 2121 2111 1131 805 193 ------
NM_015986chr1731471 1004 194 ------
NM_015995chr1584544 3416 3364 1805 1417 411 373 24 --1377 --
NM_016003chr752252 1833 436 344 313 1328 12842 --
NM_016009chr163522 3491 3221 2977 389 119 21107 1012 ----
NM_016019chr711002 --1113 --
NM_016021chr662343 1924 1912 1050 744 560 1996 12089 --
NM_016022chr1--1948 2200 196 --
NM_016025chr1631425 684 418 ------
NM_016032chrX51346 431 414 271 208 --11249 --
NM_016040chr122759 66 ------
NM_016061chr21274 ------
NM_016072chr123582 304 207 ------
NM_016073chr151952 ------
NM_016083chr623808 1449 13438 ----
NM_016096chr8----1646 1400
NM_016120chrX41092 902 463 22 ------
NM_016132chr1533191 867 683 22919 2173 ----
NM_016152chr32293 214 ------
NM_016169chr1073072 2266 1257 813 706 235 26 --23195 2122 1391
NM_016206chr347592 2650 1955 312 16830 11710 17093
NM_016224chr631565 1404 150 ------
NM_016231chr171396 ------
NM_016235chr1651482 1282 1246 592 135 1363 1114 --
NM_016255chr622675 105 ----12060
NM_016257chr183556 3183 2734 2264 818 626 611 509 31227 237 31 ----
NM_016258chr12750 631 ------
NM_016260chr277524 5526 4694 2291 1913 1578 824 12760 1978 11941
NM_016261chr174784 531 178 146 ------
NM_016269chr431032 809 428 ------
NM_016271chr1841560 761 417 115 12222 ----
NM_016277chr611336 ------
NM_016279chr51339 ------
NM_016287chr121327 1282 11770 1391 --
NM_016308chr141956 1581 446 240 ------
NM_016320chr113942 322 26 ------
NM_016322chr953225 3055 2771 2542 2307 12378 --11154
NM_016373chr161130 --1540 --
NM_016376chr1764387 2731 1298 1150 746 699 --13554 --
NM_016377chr63626 403 251 1386 ----
NM_016396chr1552942 2313 1206 439 395 ------
NM_016399chr123739 313 84 ------
NM_016418chr22113680 3393 3328 1543 1158 1048 797 734 553 450 75 23778 3126 32654 1162 915 --
NM_016424chr173691 569 213 ------
NM_016436chr2042315 1720 953 129 ------
NM_016441chr23727 582 542 21488 611 1711 --
NM_016448chr141800 1271 753 387 ------
NM_016453chr3----137 --
NM_016470chr201348 1507 ----
NM_016472chr1411064 ------
NM_016480chr51248 1776 ----
NM_016507chr1712253 1215 ----
NM_016511chr122190 37 ------
NM_016513chr683634 2650 1194 1071 1000 976 843 296 ----12792
NM_016522chr1111066 ------
NM_016526chr1192434 2124 2002 991 972 828 465 429 173 --1209 --
NM_016531chr443981 1646 511 503 22822 480 --1492
NM_016547chr12609 456 ------
NM_016559chr31207 ------
NM_016577chr374337 4089 3779 3486 3349 1429 1381 23381 605 1899 --
NM_016587chr721039 321 ------
NM_016591chr5148 --2360 249 --
NM_016603chr531955 842 35 ------
NM_016604chr53869 137 108 ------
NM_016620chr12269 25 ------
NM_016621chr11124446 4206 4110 3752 3185 3111 2911 1761 1715 1494 1116 323 24415 81 44425 4391 2915 643 14451
NM_016623chr81234 ------
NM_016628chr10--1892 ----
NM_016631chr2121026 852 ------
NM_016644chr51529 ------
NM_016653chr231210 311 157 11020 ----
NM_016654chr152544 81 ------
NM_016734chr982006 1812 1658 1622 1338 1269 795 56 21503 81 11511 --
NM_016830chr121372 --122 --
NM_016929chr654219 3680 3293 2957 790 1575 2274 239 --
NM_016936chr1651985 1354 854 566 174 1492 ----
NM_016940chr211612 --1470 --
NM_016950chr42478 143 1236 1321 --
NM_016952chr1173975 3266 598 293 252 40 21 1976 --12832
NM_017412chr821020 107 ------
NM_017415chr564368 4119 4000 3487 3250 2868 12948 11736 14374
NM_017418chr9145 ----1511
NM_017420chr1433294 3146 2655 12752 --12941
NM_017423chr42502 480 1392 ----
NM_017447chr21------11217
NM_017452chr2021531 416 --1272 --
NM_017453chr2021531 416 --1272 --
NM_017454chr2021531 416 --1272 --
NM_017455chr151164 ------
NM_017488chr221393 1055 1159 1543 188
NM_017512chr181143 ----1116
NM_017519chr611135 ------
NM_017522chr11985 11343 ----
NM_017541chr31170 ------
NM_017548chr341786 472 62 45 --1277 --
NM_017549chr711174 ------
NM_017551chr1042025 1876 944 206 --21890 1693 --
NM_017563chr3125859 5383 5168 4666 4458 4257 3998 969 644 576 433 133 1758 ----
NM_017570chr8151 ------
NM_017580chr1022184 1870 --11892 --
NM_017592chr1962537 2403 1724 598 541 124 --1850 --
NM_017599chr1221962 410 ------
NM_017610chr1521814 60 1813 11405 --
NM_017622chr17132 1281 1561 1545
NM_017626chr1031589 1106 390 21628 409 21442 1110 --
NM_017628chr444271 3967 1950 1863 11974 44706 4260 4256 245 --
NM_017635chr11159 21259 569 ----
NM_017637chr9159482 8810 7751 7176 7153 6541 6379 5882 2969 2898 2237 1785 1733 1202 68 38975 3563 1521 27180 6222 --
NM_017640chr64662 332 289 47 ------
NM_017641chr1211166 ----1330
NM_017643chr1742786 2386 2119 444 ------
NM_017644chr354276 4225 4114 1530 1131 11731 1865 --
NM_017650chr755224 5146 4131 1232 776 --14884 15493
NM_017651chr621485 1256 --21573 617 --
NM_017664chr13148 ------
NM_017666chrX42036 1650 1514 105 1648 ----
NM_017672chr151432 ----1173
NM_017712chr19175326 4745 4646 4578 4439 4407 1585 1493 1448 1115 920 889 798 754 652 257 77 14214 15267 --
NM_017719chr32472 196 11740 21009 476 --
NM_017728chr17153093 3000 2987 2570 2354 2148 2069 2052 1910 1866 1066 1051 1040 702 492 32632 2626 2002 12919 --
NM_017737chr131897 853 780 1475 11691 --
NM_017738chr92183 109 ------
NM_017741chr472234 2203 2067 1824 638 307 94 1241 ----
NM_017742chr181366 --2486 449 --
NM_017744chr192198 1973 1627 949 857 491 420 396 255 --11690 --
NM_017745chrX2466 187 ----1143
NM_017749chr114987 768 676 167 --1150 --
NM_017752chrX--11861 11381 --
NM_017758chr1751361 972 295 270 181 21390 1053 11237 --
NM_017769chr1422856 153 --1693 --
NM_017778chr81178 ------
NM_017779chr161778 1074 920 879 597 236 --11746 --
NM_017780chr81769 ------
NM_017787chr1032651 514 103 32288 2278 859 12722 12727
NM_017798chr201314 ------
NM_017799chr1411346 ------
NM_017810chr163489 146 78 ------
NM_017812chr71206 ------
NM_017813chr874989 4982 4898 4229 3557 2101 1980 ------
NM_017822chr122628 314 ------
NM_017824chr101225 ------
NM_017848chrX84313 4132 3598 3272 3199 2889 1737 1458 174 ----
NM_017849chr252807 2617 2483 1025 656 --1263 12701
NM_017851chr1561154 823 463 184 173 104 11104 2277 86 --
NM_017866chr82818 392 ------
NM_017893chr1081178 993 456 271 160 147 79 36 --1151 --
NM_017902chr1094954 4789 1945 1358 1308 1110 1095 979 139 35292 3908 494 ----
NM_017911chr2251529 968 608 563 481 1422 ----
NM_017919chr965483 5345 4857 2228 1967 674 14022 ----
NM_017925chr94773 582 558 492 ------
NM_017935chr42778 273 ------
NM_017943chr141692 --1724 --
NM_017944chr1132292 1142 533 ----12765
NM_017946chr741357 1325 577 52 ------
NM_017949chr172265 243 ----1100
NM_017994chr752902 2671 2333 2257 121 ----22554 221
NM_018008chr32342 328 --1272 --
NM_018014chr221353 300 ------
NM_018017chr1031168 1066 554 --199 --
NM_018027chr1052877 1030 409 390 110 22315 332 1413 12835
NM_018028chr1941190 947 852 104 1254 2844 228 --
NM_018045chr132569 2528 703 ----11912
NM_018070chr12575 542 ------
NM_018084chr253207 2847 2673 430 419 ------
NM_018085chr1117829 6190 5983 5848 5748 2765 2269 1759 1727 1643 38 38075 5522 671 12082 --
NM_018086chr221753 146 1245 ----
NM_018092chr162293 79 --1541 --
NM_018098chr31997 ------
NM_018110chr1651345 1280 1213 900 94 --11230 --
NM_018121chr1032817 1109 320 12050 23080 2119 --
NM_018126chr411451 ------
NM_018128chr1751303 1010 911 477 220 --21272 38 --
NM_018133chr33401 360 60 ------
NM_018137chr131161 1061 22 ----1932
NM_018155chr353313 2736 1212 373 73 ------
NM_018157chr1242737 868 663 338 ----1393
NM_018177chr431044 254 72 ------
NM_018178chr121819 334 1621 ----
NM_018182chr1732112 2081 580 21747 1445 32093 281 253 --
NM_018184chr31201 1340 --1182
NM_018202chr14839 270 235 71 ------
NM_018211chr131961 536 85 1209 11965 11726
NM_018227chr423088 2039 12032 ----
NM_018241chr41124 ----1982
NM_018243chr452757 2739 2707 2573 392 12954 ----
NM_018245chr102524 145 1197 1435 --
NM_018254chr121928 484 ------
NM_018263chr232451 1950 409 ----11903
NM_018273chr192210 157 --2171 27 --
NM_018286chr171304 ------
NM_018287chr101291 ------
NM_018293chr342665 2570 997 320 1310 ----
NM_018299chr843055 2991 1225 903 ----11286
NM_018307chr172200 193 ------
NM_018313chr342404 2191 682 56 21967 1727 12028 --
NM_018315chr411337 ----1391
NM_018325chr911467 ------
NM_018334chr71376 ------
NM_018339chr921718 677 ------
NM_018362chr1143375 3298 2610 1216 142 ----
NM_018364chr123830 3473 ------
NM_018367chr1162161 2139 1994 670 536 446 11923 2747 399 --
NM_018373chr14106454 5622 4709 4184 4034 1857 1444 917 349 268 199 16250 --
NM_018374chr764611 3446 1968 1943 480 316 1505 ----
NM_018387chr91409 ------
NM_018399chr62527 33 ----1184
NM_018403chr353355 2915 2884 2792 509 1311 21339 283 --
NM_018429chr552480 2410 2008 571 465 --12484 --
NM_018439chr1822495 106 --1110 --
NM_018440chr8108723 7486 6745 6275 3122 2684 2237 1652 919 723 28469 1200 26540 5701 --
NM_018445chr15192 --1153 --
NM_018449chr92233 114 --2683 679 --
NM_018452chr6_random53697 1096 625 547 475 1458 ----
NM_018462chr31281 1661 ----
NM_018471chr22538 32 ------
NM_018475chr41601 ------
NM_018482chr821649 498 ------
NM_018486chrX1364 ------
NM_018490chr112661 154 ----21350 488
NM_018509chr1731663 521 170 --1628 --
NM_018566chr134647 3949 1306 13877 ----
NM_018584chr11301 ------
NM_018638chr1244653 3670 1354 494 ------
NM_018640chr1232468 818 438 ------
NM_018644chr1172126 1852 1804 771 396 267 244 --1464 --
NM_018650chr11166 ------
NM_018667chr16102351 2217 2132 1831 1129 1120 520 495 436 191 --2587 126 --
NM_018689chr1532297 1755 856 12135 2798 365 --
NM_018693chr21112 ------
NM_018695chr532381 955 728 21699 550 ----
NM_018704chr121845 244 2209 75 --162
NM_018718chr772040 1826 1643 863 587 501 374 1676 --12050
NM_018898chr541684 593 461 31 1825 ----
NM_018899chr541684 593 461 31 1825 ----
NM_018900chr541684 593 461 31 1825 ----
NM_018901chr541684 593 461 31 1825 ----
NM_018902chr541684 593 461 31 1825 ----
NM_018903chr541684 593 461 31 1825 ----
NM_018904chr541684 593 461 31 1825 ----
NM_018905chr541684 593 461 31 1825 ----
NM_018906chr541684 593 461 31 1825 ----
NM_018907chr541684 593 461 31 1825 ----
NM_018908chr541684 593 461 31 1825 ----
NM_018909chr541684 593 461 31 1825 ----
NM_018910chr541684 593 461 31 1825 ----
NM_018911chr541684 593 461 31 1825 ----
NM_018912chr551577 1510 1425 1189 1146 --21150 160 --
NM_018913chr551577 1510 1425 1189 1146 --21150 160 --
NM_018914chr551577 1510 1425 1189 1146 --21150 160 --
NM_018915chr551577 1510 1425 1189 1146 --21150 160 --
NM_018916chr551577 1510 1425 1189 1146 --21150 160 --
NM_018917chr551577 1510 1425 1189 1146 --21150 160 --
NM_018918chr551577 1510 1425 1189 1146 --21150 160 --
NM_018919chr551577 1510 1425 1189 1146 --21150 160 --
NM_018920chr551577 1510 1425 1189 1146 --21150 160 --
NM_018921chr551577 1510 1425 1189 1146 --21150 160 --
NM_018922chr551577 1510 1425 1189 1146 --21150 160 --
NM_018923chr551577 1510 1425 1189 1146 --21150 160 --
NM_018924chr551577 1510 1425 1189 1146 --21150 160 --
NM_018925chr551577 1510 1425 1189 1146 --21150 160 --
NM_018926chr551577 1510 1425 1189 1146 --21150 160 --
NM_018927chr551577 1510 1425 1189 1146 --21150 160 --
NM_018928chr551577 1510 1425 1189 1146 --21150 160 --
NM_018929chr551577 1510 1425 1189 1146 --21150 160 --
NM_018945chr693681 3078 2940 2576 1245 1213 1065 739 91 13040 ----
NM_018970chr762917 2448 2359 1075 872 70 12278 ----
NM_018979chr1232531 1811 761 12297 ----
NM_018999chr1054856 1606 1199 735 469 --11310 --
NM_019001chr344153 4054 3266 980 13186 ----
NM_019004chr712195 ------
NM_019030chr5151 ------
NM_019036chr641043 465 180 46 ------
NM_019046chr106695 663 316 195 133 102 --1905 --
NM_019049chr11623 ------
NM_019050chr442201 1422 802 404 ------
NM_019058chr102531 119 ------
NM_019063chr242116 2019 880 166 ------
NM_019080chr1331394 1224 285 ------
NM_019089chr1152966 2685 2494 2459 2354 2315 2288 1429 1152 1130 1085 393 328 133 103 1367 --13136
NM_019091chr21432 ------
NM_019098chr821228 33 ------
NM_019106chr2273340 2820 2524 2363 2346 2188 1028 2570 452 12454 --
NM_019116chr1652860 1505 1162 971 949 22682 149 1215 --
NM_019555chr331693 1216 665 11150 21714 1145 --
NM_019558chr21275 ------
NM_019590chr1011101 ----11063
NM_019593chr2032791 2058 178 --1195 --
NM_019594chr951338 613 533 286 143 1149 197 11021
NM_019600chr151668 ------
NM_019605chr1--1471 ----
NM_019613chr1731221 1068 238 ------
NM_019842chr6140 ------
NM_019852chr14135 ------
NM_019854chr121679 ------
NM_019885chr252191 1086 728 213 158 11930 12406 --
NM_020039chr121353 --11481 --
NM_020116chr431299 732 232 ------
NM_020127chr14671 566 332 242 ----11663
NM_020141chr132354 2338 200 ----12126
NM_020143chr2195 ----1132
NM_020144chr731879 497 375 ----1413
NM_020148chr1852234 907 268 65 38 ----12405
NM_020150chr1032216 777 669 21953 491 ----
NM_020160chr19----1331 --
NM_020177chr513324 11078 ----
NM_020178chr17----1931 11162
NM_020205chr142713 786 676 390 32573 914 497 ----
NM_020211chr1561273 1146 573 481 464 336 --21171 1044 --
NM_020243chr225826 786 745 601 225 ------
NM_020245chr655104 4059 3562 922 434 --13190 --
NM_020248chr142182 1971 1705 147 --21953 929 --
NM_020310chr1792564 2166 1982 1864 1830 1103 681 615 101 --190 --
NM_020336chr2042871 2660 1100 238 23243 1183 ----
NM_020337chr452919 2699 849 431 54 ------
NM_020338chr1062873 2786 2525 743 726 588 ------
NM_020341chr203498 306 108 131 1197 --
NM_020342chr232447 442 95 ------
NM_020348chr1042415 924 894 555 22314 803 ----
NM_020381chr621385 317 ------
NM_020382chr124537 373 342 289 ------
NM_020390chr333587 1079 751 --1958 --
NM_020403chr1321167 183 ------
NM_020420chrY1101 ----11141
NM_020429chr742538 2463 1249 407 22094 1195 42793 828 505 248 --
NM_020432chr71412 --2454 103 --
NM_020440chr152985 2567 936 773 413 --12065 --
NM_020443chr1126902 6836 5940 5895 5693 5532 4595 2753 1740 1676 1271 51 15510 26426 2512 11745
NM_020455chr62366 117 12090 ----
NM_020463chr231243 970 137 ------
NM_020466chr694695 3319 1651 886 804 722 465 389 243 ------
NM_020474chr1841265 1251 424 132 ------
NM_020532chr23622 593 138 2664 345 ----
NM_020640chr3166 ------
NM_020654chr3174 11269 ----
NM_020686chr1643112 2323 2154 332 22571 2052 ----
NM_020699chr134756 3593 806 11978 11937 --
NM_020703chr11528 ------
NM_020706chr211162 ------
NM_020713chr2082967 2771 1109 501 450 240 65 34 11997 21113 136 --
NM_020717chrX94849 4817 1947 1769 1584 1448 1219 425 38 --21385 169 11351
NM_020718chr1654717 2033 1713 798 214 25434 791 1587 --
NM_020727chr2133307 2514 648 --22456 723 --
NM_020728chr752777 2741 2200 1137 876 ------
NM_020732chr611135 ------
NM_020739chr1553602 3533 3168 2762 337 1371 22595 1677 --
NM_020742chrX31775 371 156 ------
NM_020747chr52360 115 ------
NM_020749chr831807 729 552 ------
NM_020752chr1052551 2427 2228 621 321 2965 190 ----
NM_020766chrX44049 1734 1500 1376 24161 4146 ----
NM_020771chr611129 ------
NM_020772chr1788437 8402 5786 5240 3267 2012 1857 1082 26422 2279 ----
NM_020778chr1544918 4133 1670 516 33815 3774 915 11248 --
NM_020781chr752954 2585 2379 910 524 22001 803 ----
NM_020783chr1812246 1267 --11870
NM_020791chr1721175 1039 ------
NM_020792chr331771 272 250 11074 ----
NM_020803chr442347 2315 2181 1558 --11750 --
NM_020804chr652188 1771 897 774 537 ------
NM_020806chr14----179 --
NM_020807chr16101775 1495 1217 1124 690 561 491 397 391 314 11138 --1212
NM_020809chr1131782 1428 519 ----21825 597
NM_020813chr1972434 2248 1977 603 515 494 339 1843 21876 117 --
NM_020819chr611250 ------
NM_020824chr10------1165
NM_020830chr25825 352 282 258 102 --1628 --
NM_020845chr12102177 1962 1909 1902 1767 1706 753 684 52 43 ------
NM_020850chr1642127 1248 833 593 43080 2826 1286 1200 13027 12593
NM_020854chr1851365 1151 1110 1066 600 ------
NM_020860chr43349 249 208 ------
NM_020868chr211591 11401 1597 --
NM_020871chrX2693 243 ------
NM_020897chr141173 501 487 233 --11177 --
NM_020919chr22498 321 ------
NM_020922chrX1734 ----1476
NM_020925chr131120 946 182 2343 322 ----
NM_020935chr244238 3349 2907 547 ----14214
NM_020951chr1922283 1794 1412 ----
NM_020952chr92619 290 ------
NM_020956chr1964224 3917 1359 1340 1067 27 34605 3964 225 24560 3600 --
NM_020958chr14150 ------
NM_020959chr19143 ------
NM_020964chr1884026 3789 3569 3497 1289 1049 632 304 ----13033
NM_020977chr451891 1593 854 829 758 ------
NM_020983chr1242268 2211 2041 574 --2817 524 --
NM_020987chr1011140 ------
NM_020988chr1621153 1147 ------
NM_021003chr141584 --1156 --
NM_021007chr211636 12423 ----
NM_021032chr321302 575 ------
NM_021033chr1343209 2842 1386 539 ------
NM_021079chr1792765 2751 2066 1325 1081 1045 978 812 245 1675 ----
NM_021081chr20134 ------
NM_021090chr22114432 3363 3149 3056 1954 1162 841 779 552 414 373 --21958 924 --
NM_021097chr252618 1019 812 632 380 ------
NM_021106chr92741 522 1265 ----
NM_021111chr92908 451 ------
NM_021116chr7208509 7164 6573 6410 6100 3369 3337 3143 3108 2964 2909 2717 2646 2608 2467 1987 1419 747 520 322 31704 687 508 32952 1730 80 58064 5772 2454 1289 91
NM_021120chrX42561 2503 1114 764 22484 2187 12216 1864
NM_021144chr91386 ------
NM_021145chr72283 113 ------
NM_021159chr421503 1078 ------
NM_021202chr2021907 1170 --11930 --
NM_021204chr41341 ------
NM_021218chr92913 881 ------
NM_021238chr1241817 1399 401 282 ------
NM_021239chr142402 249 ------
NM_021622chr1031824 695 66 ------
NM_021629chr384438 4126 3535 3349 3323 3190 1882 1851 1640 ----
NM_021633chr151205 1013 885 487 28 ------
NM_021705chr631163 608 320 --2324 209 --
NM_021728chr143379 272 68 1809 ----
NM_021738chr10----1298 --
NM_021809chr2051861 1720 1586 665 393 --136 --
NM_021813chr644375 3813 1781 1381 1418 158 --
NM_021907chr2----1219 --
NM_021911chr554269 4259 1066 586 338 --25570 1809 --
NM_021912chr1584002 3817 3376 2846 1349 827 268 216 ------
NM_021914chr1441493 926 745 240 --11605 --
NM_021935chr3134 ------
NM_021940chr61379 11561 ----
NM_021943chr661918 1735 463 211 132 71 --1111 3862 740 76
NM_021945chr662370 1100 1083 750 720 105 --22499 82 --
NM_021949chrX52214 2038 1784 861 230 1976 ----
NM_021954chr1332951 799 689 1435 ----
NM_021956chr621366 1089 160 ----
NM_021959chr61957 ----1384
NM_021961chr1165760 4848 2858 2825 2596 1410 21700 1530 22266 1801 12329
NM_021962chr1792322 2283 2255 2248 2228 2200 1553 176 124 1906 ----
NM_021964chr345515 4423 699 171 --12401 11265
NM_021970chr42742 138 ------
NM_021977chr663302 3193 2456 1404 220 94 ------
NM_021995chr1125 ------
NM_021998chrX1441 ------
NM_022037chr2126 --191 --
NM_022039chr103553 42 30 ----1431
NM_022048chr15156277 5238 5127 4711 4402 4317 4190 4118 2404 1344 1253 1206 1097 859 151 11107 1164 13859
NM_022051chr11686 ------
NM_022066chr1751052 866 787 728 43 ------
NM_022080chr2052467 2364 1888 578 29 1113 ----
NM_022103chr193925 397 200 ------
NM_022166chr16125358 4508 4178 2357 2224 1425 1401 1166 919 772 363 171 33983 1501 991 14475 153
NM_022173chr2126 --191 --
NM_022336chr272063 1652 1493 958 776 696 194 1143 22067 260 --
NM_022340chr372830 2530 2396 940 908 441 49 11289 12255 --
NM_022351chr843385 2829 1129 790 ------
NM_022373chr73796 653 21 ------
NM_022437chr23391 156 118 1344 ----
NM_022444chr721538 1291 ------
NM_022451chr101843 ------
NM_022459chr1384749 2541 1763 1223 1091 882 341 198 24893 483 ----
NM_022465chr1232262 1112 304 ------
NM_022473chr1563352 1410 1157 938 403 120 ------
NM_022477chr2031390 1300 1255 ----11520
NM_022484chr711360 ------
NM_022491chr1263153 2808 2721 2709 336 218 ------
NM_022495chr142152 124 ------
NM_022497chr373124 1315 1129 959 666 608 568 23050 577 1641 --
NM_022552chr231263 1203 1032 ------
NM_022648chr273868 3455 3435 3382 3272 2991 24 21528 890 22917 1819 11249
NM_022658chr1211290 ------
NM_022716chr142889 2718 2130 351 ------
NM_022719chr22123322 3038 2961 2852 2684 2648 1368 1298 1272 1242 954 643 33436 156 103 11017 --
NM_022726chr611602 21280 527 ----
NM_022733chr131095 208 153 ------
NM_022737chr194416 295 165 33 --1128 1421
NM_022739chr1711051 ------
NM_022748chr772714 2649 2285 2093 540 220 56 12142 ----
NM_022758chr653162 1159 728 593 240 12400 12849 --
NM_022763chr342760 763 370 250 1126 --12538
NM_022771chr121232 ------
NM_022778chr151397 1157 1130 1103 969 --21317 1161 --
NM_022780chr241593 1176 575 83 ------
NM_022782chr12------163
NM_022784chr1531153 733 222 ------
NM_022817chr241522 1476 909 795 11844 129 --
NM_022832chr452113 965 908 874 638 --1913 --
NM_022841chr153705 650 409 12660 ----
NM_022843chr131212 ------
NM_022845chr1621455 209 ------
NM_022899chr31190 ------
NM_022918chr1111909 1207 ----
NM_023000chr14--11514 ----
NM_023001chr14--11514 ----
NM_023012chr122616 598 1566 177 --
NM_023035chr196314 291 206 183 144 114 --1118 --
NM_023074chr19----21269 1265 --
NM_023076chr1621118 689 --12013 --
NM_023929chr8----1236 --
NM_024007chr532689 2163 799 --12638 --
NM_024038chr191283 ------
NM_024068chr124410 378 195 99 ------
NM_024090chr431654 1369 93 1291 ----
NM_024099chr112280 114 ------
NM_024294chr653162 1159 728 593 240 12400 12849 --
NM_024295chr841800 766 670 21 --11783 --
NM_024312chr1231457 1413 1401 ----11062
NM_024345chr974585 3717 2213 1707 1676 1089 1007 --33802 1543 1421 --
NM_024348chr91116 ----193
NM_024408chr163734 3485 2306 2294 998 103 ------
NM_024411chr20127 ----11072
NM_024416chr921480 517 ------
NM_024421chr1811152 11122 --11059
NM_024511chr473460 2295 686 647 609 522 476 ----11048
NM_024513chr3103330 2465 1450 1427 1357 959 558 502 175 86 --21299 826 22649 700
NM_024524chr322793 2176 ------
NM_024546chr131128 ------
NM_024551chr1212083 11993 --12333
NM_024551chr1212083 11993 --12333
NM_024567chr81545 ------
NM_024569chr13931 920 273 143 12894 --
NM_024594chr531857 276 198 ------
NM_024607chr8113424 2877 2785 1747 1117 1085 783 719 386 243 81 --32959 445 170 --
NM_024613chr831301 635 99 ------
NM_024617chr91796 ------
NM_024640chr13787 225 100 ----1390
NM_024643chr141140 ------
NM_024665chr34933 115 102 48 ------
NM_024666chr1541419 609 527 72 11767 ----
NM_024667chr1261432 1083 709 624 415 113 --11550 11659
NM_024674chr142566 2245 2024 814 11114 ----
NM_024686chr11460 ------
NM_024689chrX61680 1357 1341 1290 1191 380 ------
NM_024698chr118964 895 555 511 468 378 247 58 --266 27 --
NM_024713chr1521579 454 11461 ----
NM_024740chr1143135 3090 1528 1120 --31238 1068 224 --
NM_024757chr931060 180 34 ------
NM_024769chr1141042 445 84 40 ------
NM_024770chr2126338 4177 2081 2049 1629 1576 1392 1156 1098 810 778 644 131 26621 2501 26529 391
NM_024779chr122326 79 11187 ----
NM_024784chr1151106 882 837 681 349 ----1998
NM_024785chr21288 41466 1280 338 156 1476 --
NM_024786chr53300 237 124 --3334 330 326 --
NM_024798chr15112606 2469 2264 886 781 665 421 387 321 249 209 11795 32341 975 253 12870
NM_024825chr191215 ------
NM_024834chr1031953 1906 41 2374 326 ----
NM_024873chr46868 837 794 771 200 173 ------
NM_024881chr1973531 3337 3141 2532 1185 551 97 13555 11052 13273
NM_024884chr14104302 3683 3033 2850 2799 1129 712 360 207 175 ------
NM_024900chr42766 60 31585 390 287 ----
NM_024900chr42766 60 31585 390 287 ----
NM_024909chr631333 553 33 21541 1463 ----
NM_024930chr562005 1954 1864 1829 595 511 12345 --1201
NM_024939chr1651423 1359 494 253 27 --11245 --
NM_024942chr101199 ------
NM_024947chr3118257 8212 7506 3735 3168 3012 2615 2355 2010 1641 109 48458 3240 1277 787 --13800
NM_024949chr4104514 4279 3910 3708 3387 3079 1371 738 533 331 13160 24459 359 --
NM_024953chr121501 ------
NM_024963chr785625 5181 4759 4453 3877 1462 431 32 45491 3828 1990 611 23659 111 --
NM_024969chr21153 ------
NM_024971chr92619 290 ------
NM_024989chr285214 2654 2472 2065 1070 526 495 47 15074 ----
NM_024991chr1052890 2619 732 444 78 21169 325 --12311
NM_025073chr1134305 4065 4022 3701 3251 1642 1636 1561 805 764 615 328 145 11659 ----
NM_025083chr1581977 1609 1537 1466 355 320 282 169 21730 1452 1261 --
NM_025106chr161922 1761 1190 357 106 32 --11219 --
NM_025113chr1321162 298 11324 ----
NM_025133chr21418 ------
NM_025134chr1652228 2221 1861 565 420 ------
NM_025146chr322278 2134 ----1773
NM_025151chr832103 1535 158 1291 2788 91 --
NM_025160chr152988 2649 1701 1578 980 13014 ----
NM_025179chr1144335 3980 3768 3434 3420 3334 1686 1607 1599 1545 1048 657 176 160 11805 11653 1686
NM_025184chrX2909 635 ------
NM_025191chr173331 2748 2593 973 907 640 266 --13217 13245
NM_025238chr1531553 1001 336 ------
NM_025248chr1723227 1073 22568 511 11188 1813
NM_030576chr1781989 1961 1918 1054 822 331 93 45 1861 1183 12100
NM_030594chr1511253 ------
NM_030623chr21645 1161 ----
NM_030627chr553071 2675 1330 1069 719 1850 ----
NM_030629chr162464 64 --31466 675 76 --
NM_030647chr745916 2465 2266 781 14220 15317 --
NM_030648chr4135276 4324 2115 1944 1459 1216 1204 1041 711 383 349 338 191 14484 22060 1740 --
NM_030661chr731544 1340 1120 --11256 1527
NM_030674chr1274581 3936 3689 2059 1930 1703 43 13790 22017 971 --
NM_030759chr102203 162 ------
NM_030761chr152417 2030 1934 919 776 12533 --1582
NM_030786chr121679 421 ------
NM_030791chr143692 141 76 ------
NM_030799chr572159 2099 1924 766 562 369 263 135 ----
NM_030806chr1199130 7822 7641 6963 6955 6877 6857 6643 6375 6365 6287 6159 5873 3328 3123 2797 1799 1754 1500 12237 16721 --
NM_030809chr1222291 312 ------
NM_030816chr143290 3094 2347 274 ------
NM_030820chr62291 183 --1296 --
NM_030821chr41721 ------
NM_030877chr20197 ------
NM_030885chr312044 --11943 12120
NM_030906chr112482 206 ------
NM_030915chr262112 2099 1493 730 644 254 --31532 472 35 --
NM_030927chr1071230 1199 1132 1114 606 579 106 146 ----
NM_030939chr61733 ------
NM_031216chr182633 189 ------
NM_031243chr72404 119 --1823 --
NM_031268chr1661957 1641 1274 887 866 95 21576 1340 23984 3754 1892
NM_031271chr831486 1462 1445 ------
NM_031284chr15285 44 ------
NM_031306chr14893 856 357 325 ------
NM_031314chr1421692 1358 ------
NM_031369chr41594 ------
NM_031370chr41594 ------
NM_031407chrX1447 ------
NM_031411chr541684 593 461 31 1825 ----
NM_031417chr1962401 2345 346 92 86 63 11924 32316 502 180 12350
NM_031427chr14165778 5754 5467 5240 4691 4300 4269 4215 3949 1658 1524 1429 1265 1202 676 303 ----14724
NM_031439chr84561 342 306 78 --21444 1419 --
NM_031444chr2252475 2150 1807 1571 804 22347 312 153 --
NM_031445chr212543 --22937 2725 --
NM_031453chr101567 --2929 99 --
NM_031461chr821556 783 1646 --1711
NM_031468chr7208037 7886 7515 6911 6507 6443 5934 5053 2831 2718 2412 1794 1399 1362 1237 1099 982 378 329 282 36579 1890 1392 12882 --
NM_031475chr11529 --268 64 1641
NM_031844chr144031 3988 1439 828 ------
NM_031845chr223131 2345 --12993 1712
NM_031847chr223131 2345 --12993 1712
NM_031849chr541684 593 461 31 1825 ----
NM_031857chr541684 593 461 31 1825 ----
NM_031858chr1731527 1402 1332 --11406 --
NM_031860chr541684 593 461 31 1825 ----
NM_031862chr1731527 1402 1332 --11406 --
NM_031866chr101894 ----1352
NM_031890chr2292970 2847 2763 2736 2645 2540 2323 930 127 ------
NM_031892chrX4915 785 687 67 ------
NM_031954chr1292888 2355 2232 2063 2019 1896 1835 1111 258 1131 ----
NM_031989chr12----180 --
NM_032012chr964985 3822 3688 1976 1416 433 24794 3888 13997 --
NM_032013chr2031390 1300 1255 ----11520
NM_032021chr1111002 ------
NM_032042chr542711 2563 2311 705 22677 2160 22479 241 --
NM_032088chr551577 1510 1425 1189 1146 --21150 160 --
NM_032092chr551577 1510 1425 1189 1146 --21150 160 --
NM_032102chr1142942 2183 756 367 --12268 --
NM_032116chr1343860 3699 2107 965 11268 11109 11767
NM_032124chr181169 --198 --
NM_032139chr19--1261 --1394
NM_032144chr2132 ------
NM_032147chr121736 ------
NM_032186chr12269 25 ------
NM_032192chr171223 ------
NM_032193chr1151549 1455 1431 401 135 1231 21893 246 --
NM_032199chr1053619 3359 943 837 89 23115 1236 ----
NM_032208chr232372 2286 225 1791 23008 739 2771 215
NM_032217chr421049 1039 --1946 --
NM_032239chr431437 1349 1250 --1484 --
NM_032242chr372730 1151 780 693 512 369 344 --13227 13099
NM_032268chr1692759 2661 1301 1186 1159 840 800 421 390 --11237 --
NM_032283chr141832 1700 407 371 --31217 636 632 --
NM_032287chr2283117 2986 1035 930 794 620 459 33 1738 11200 --
NM_032288chr331641 945 443 ------
NM_032289chr561775 1456 1410 1292 1235 259 --298 71 1114
NM_032311chr2251896 1812 1681 1268 474 ----122
NM_032320chr11----1282 --
NM_032329chr284150 3768 3701 1608 1426 960 503 119 23157 1011 23875 3486 --
NM_032345chr12----183 --
NM_032364chr122959 273 ------
NM_032373chr1075886 4240 4232 4057 4025 2036 1590 ------
NM_032379chr111237 ------
NM_032403chr551577 1510 1425 1189 1146 --21150 160 --
NM_032410chr811005 --184 --
NM_032429chr10--1501 ----
NM_032431chr1151082 726 707 696 192 ------
NM_032438chr631556 457 208 ------
NM_032440chr1052940 2905 2752 2192 64 --1838 --
NM_032441chrX2341 49 --2406 106 --
NM_032445chr154856 550 278 261 ------
NM_032449chr192820 2645 2390 1984 1783 1110 757 324 306 --12175 --
NM_032457chr453635 3427 3413 3033 2379 ------
NM_032491chr1231258 228 206 1235 ----
NM_032523chr2122 ------
NM_032538chr682853 2755 2525 2255 984 562 455 318 --2279 59 --
NM_032539chrX1661 --1843 --
NM_032564chr113675 242 163 ------
NM_032582chr1741466 742 619 265 21602 376 ----
NM_032603chr23495 188 169 ----1571
NM_032622chr431183 379 146 ------
NM_032623chr41290 ------
NM_032632chr1421643 182 --1711 --
NM_032646chr1751302 1133 413 335 186 21108 557 11548 --
NM_032682chr3--32670 2554 817 ----
NM_032689chr1931234 1115 442 --11084 11309
NM_032784chr6174 ------
NM_032801chr112376 347 1102 21692 1656 --
NM_032808chr152796 388 --1783 --
NM_032810chr1031080 551 247 ------
NM_032825chr192996 876 ----1814
NM_032826chr7105368 5151 4341 4212 3321 1986 1641 912 385 109 24961 655 21157 456 1461
NM_032827chr241042 771 422 187 --3848 798 51 --
NM_032833chr131076 180 25 11804 ----
NM_032842chr741448 1318 586 541 ------
NM_032858chr1163 ------
NM_032866chr15113159 2951 2547 2531 1999 1128 1056 965 811 288 52 21993 1028 12046 --
NM_032867chr112452 224 --1235 --
NM_032873chr1164497 3436 2986 1106 1080 302 ------
NM_032892chr15130 ------
NM_032900chr1043588 3543 2430 1428 21246 511 ----
NM_032906chr4137 --1214 --
NM_032927chr41216 --1164 --
NM_032943chr111237 ------
NM_032947chr53323 133 23 --11025 --
NM_032961chr441348 1314 1087 330 ------
NM_032967chrX4743 407 322 268 ------
NM_032968chrX22592 1245 ----1141
NM_032969chrX22592 1245 ----1141
NM_032971chrY3770 349 295 ------
NM_032972chrY3770 349 295 ------
NM_032973chrY22591 1245 ----1141
NM_032992chr42226 195 --155 --
NM_032995chr241647 1596 1166 304 21676 316 21126 630 --
NM_032998chr121000 239 ------
NM_033014chr921480 517 ------
NM_033030chr211377 ----189
NM_033036chr1151456 1334 1247 1112 573 1584 157 11349
NM_033055chr1--1422 ----
NM_033081chr2021484 77 ------
NM_033082chr12186 ------
NM_033083chr353153 2184 852 649 360 1334 22645 929 --
NM_033121chr1251566 1278 571 404 375 ------
NM_033132chr13--1411 ----
NM_033133chr1753198 2815 2513 787 265 1890 12339 1284
NM_033138chr71786 ------
NM_033139chr71786 ------
NM_033140chr71786 ------
NM_033141chr1452130 2098 1901 1864 317 --2348 37 --
NM_033143chr454163 2817 1461 938 431 ----1201
NM_033147chr2----1219 --
NM_033148chr2----1219 --
NM_033157chr71786 ------
NM_033181chr623808 1449 13438 ----
NM_033201chr1621095 443 1764 11003 --
NM_033211chr531688 258 111 11433 ----
NM_033215chrX2336 130 ------
NM_033222chr921349 192 ------
NM_033224chr7176953 6914 6800 6754 5806 5241 5210 3201 3002 2436 2326 2259 1019 988 850 192 87 1969 --27907 3095
NM_033225chr8134 --22571 616 --
NM_033226chr161227 ------
NM_033254chr31105 ------
NM_033285chr873544 2868 1429 1392 1362 839 295 ------
NM_033300chr11985 11343 ----
NM_033326chr1122095 1717 ------
NM_033389chr1733695 887 503 21890 479 31589 1517 297 1472
NM_033393chr472560 2118 1031 558 393 348 107 ------
NM_033401chr16150 ------
NM_033421chr2061364 689 617 403 326 165 11631 2593 247 --
NM_033425chr1133362 2834 1357 1988 11216 --
NM_033429chr1552868 2356 948 493 167 ----11040
NM_033430chr453851 3619 3001 2665 738 ------
NM_033437chr453851 3619 3001 2665 738 ------
NM_033480chr672698 1837 1191 1005 815 665 601 12089 ----
NM_033481chr672698 1837 1191 1005 815 665 601 12089 ----
NM_033503chr1593601 3554 2356 1100 1080 978 816 797 605 33430 2895 1195 83543 3181 1293 1189 821 571 536 490 --
NM_033515chr611290 ------
NM_033632chr411337 ----1391
NM_033642chrX11038 ------
NM_033644chr562533 2355 2204 864 815 630 ------
NM_033645chr562533 2355 2204 864 815 630 ------
NM_033656chr2135544 5266 5027 35850 5321 733 ----
NM_052845chr1262868 2724 1256 1176 1155 1083 --12373 --
NM_052869chr1751302 1133 413 335 186 21108 557 11548 --
NM_052876chr1932030 1823 1719 --22437 1792 11973
NM_052880chr2211228 1525 165 --
NM_052882chr191510 ------
NM_052885chr1274482 4387 3102 1535 732 361 347 ------
NM_052900chr81549 ------
NM_052905chr21417 ----1679
NM_052906chr22104766 4386 3746 3442 3196 1849 1496 1472 1139 934 34167 1212 35 31548 1360 74 --
NM_052910chr13----22067 228 --
NM_052918chr1042847 2690 2563 554 ----12568
NM_052927chr511649 ------
NM_052934chr131729 1524 671 11827 --11483
NM_052971chr5133 ------
NM_053016chr9107489 7418 6757 6726 3157 3125 2699 2610 491 476 26584 6516 1294 --
NM_053023chr1142763 2579 2282 288 --11002 --
NM_053025chr321761 1527 ----1225
NM_053026chr321761 1527 ----1225
NM_053027chr321761 1527 ----1225
NM_053028chr321761 1527 ----1225
NM_053031chr321761 1527 ----1225
NM_053032chr321761 1527 ----1225
NM_053056chr1152700 2235 1196 967 51 --2940 778 --
NM_053064chr1442479 2429 1235 914 ------
NM_054016chr151501 1332 653 409 206 ------
NM_054016chr151501 1332 653 409 206 ------
NM_054016chr151501 1332 653 409 206 ------
NM_054025chr1172126 1852 1804 771 396 267 244 --1464 --
NM_054027chr522175 459 --240 36 --
NM_054108chr11------123
NM_057159chr941574 1402 645 28 1335 ----
NM_057164chr22249 46 ------
NM_057165chr22249 46 ------
NM_057166chr22249 46 ------
NM_057167chr22249 46 ------
NM_057175chr432562 1980 316 ------
NM_057178chr1752126 2081 200 90 70 11009 ----
NM_057749chr81110 ------
NM_058172chr41376 ------
NM_058241chr222233 253 --12357 --
NM_058241chr222233 253 --12357 --
NM_078625chr611107 ------
NM_078626chr11111 ------
NM_078629chrX2590 498 ------
NM_078630chrX2590 498 ------
NM_079834chr1981518 1465 1420 1180 1101 486 428 122 --21552 1490 --
NM_080422chr18130 ------
NM_080423chr18130 ------
NM_080546chr962202 2069 1631 1532 607 148 ------
NM_080617chr201243 ------
NM_080645chr62716 273 ------
NM_080654chr111152 1486 ----
NM_080664chr1451733 1368 503 456 193 11506 11668 --
NM_080676chr2052804 2549 2101 1229 661 22405 1241 12052 --
NM_080683chr41181 ------
NM_080684chr41181 ------
NM_080685chr41181 ------
NM_080759chr1342022 1689 1056 1027 ----151
NM_080760chr1342022 1689 1056 1027 ----151
NM_080792chr2041896 186 131 79 31857 1510 269 31449 758 244 --
NM_080832chrX2402 271 ------
NM_080867chr14104519 4125 3856 3767 3722 3252 3192 1178 968 838 --14966 --
NM_080872chr863980 3621 1552 579 383 34 --11508 --
NM_100264chr10--1892 ----
NM_100486chr10--1892 ----
NM_130385chr1172778 2623 2553 2311 2203 1193 803 12289 ----
NM_130386chr18----1139 --
NM_130387chr34948 298 146 75 ------
NM_130391chr921334 1201 --32972 981 977 --
NM_130392chr921334 1201 --32972 981 977 --
NM_130393chr921334 1201 --32972 981 977 --
NM_130434chr1511114 ------
NM_130466chr1241228 1162 289 128 --1536 --
NM_130469chr145894 831 296 169 141 --2378 132 --
NM_130773chr23818 706 181 ------
NM_130795chr92741 522 1265 ----
NM_130798chr153509 457 324 1130 ----
NM_130811chr2011192 ------
NM_130830chr393703 2995 2891 2594 2509 1327 1290 1173 1129 13858 21546 1149 33676 3577 2625
NM_130831chr352343 2124 1973 651 620 22534 2064 ----
NM_130832chr352343 2124 1973 651 620 22534 2064 ----
NM_130833chr352343 2124 1973 651 620 22534 2064 ----
NM_130834chr352343 2124 1973 651 620 22534 2064 ----
NM_130835chr352343 2124 1973 651 620 22534 2064 ----
NM_130836chr352343 2124 1973 651 620 22534 2064 ----
NM_130837chr352343 2124 1973 651 620 22534 2064 ----
NM_130847chr1165800 5720 4197 2137 1801 1277 14245 13824 --
NM_133170chr20177878 7612 7538 7296 6065 5660 5498 3185 3101 2209 2161 1788 1715 1693 1179 240 234 11568 35225 1760 659 17340
NM_133264chr1753705 3371 2996 703 254 23136 2639 11313 --
NM_133265chrX53610 2648 2380 856 585 1406 ----
NM_133266chr113998 739 326 ------
NM_133329chr231513 1440 137 1527 ----
NM_133334chr4105770 5510 5083 4890 4080 3907 1533 1495 1401 974 --31537 1503 1499 14755
NM_133367chr642948 2572 782 667 13168 ----
NM_133370chr442949 2931 2671 2515 13337 ----
NM_133372chr541962 922 465 116 ------
NM_133443chr1641690 1539 631 591 --21889 675 --
NM_133445chr963724 3112 3099 2553 972 227 1750 --13225
NM_133459chr1821890 640 ------
NM_133468chr732208 1629 403 --12171 --
NM_133476chr1221044 928 ----1863
NM_133478chr262531 2089 2058 894 863 84 1138 22175 728 --
NM_133486chrX1142 --1173 --
NM_133494chr11104 ------
NM_133496chr194186 3444 3197 3107 881 836 714 169 138 --1365 --
NM_133503chr121639 177 ----
NM_133504chr121639 177 ----
NM_133505chr121639 177 ----
NM_133506chr121639 177 ----
NM_133507chr122817 121 1255 ----
NM_133631chr331597 448 284 --1292 --
NM_133645chr61485 ------
NM_133647chr1542667 1317 256 184 13085 ----
NM_134427chr92741 522 1265 ----
NM_134470chr32634 514 ------
NM_138324chr152729 668 ------
NM_138338chr22143330 3212 2984 2977 2669 2418 2380 1331 1195 934 527 367 307 126 12585 11335 --
NM_138385chr461421 1310 1123 166 130 57 --1436 --
NM_138386chr4--185 ----
NM_138423chr1541478 640 570 236 ------
NM_138426chr742411 1837 1010 580 ------
NM_138444chr1334790 4348 176 14128 ----
NM_138457chr683029 2523 930 842 713 671 372 133 2806 427 ----
NM_138459chr632702 808 326 ------
NM_138473chr1253939 3815 1763 1612 1112 --11275 --
NM_138492chr51353 ------
NM_138494chr761842 1811 453 364 121 110 ------
NM_138559chr221343 290 ------
NM_138578chr2061167 1098 1030 1016 924 68 11085 21070 155 --
NM_138612chr161237 ------
NM_138621chr273375 3046 1617 1454 1410 1336 450 1818 1100 --
NM_138633chr63626 403 251 1386 ----
NM_138638chr1441493 926 745 240 --11605 --
NM_138694chr642437 409 203 155 12408 ----
NM_138713chr1698279 6879 5922 5277 3317 2636 2316 2302 696 16281 16211 25604 1668
NM_138714chr1698279 6879 5922 5277 3317 2636 2316 2302 696 16281 16211 25604 1668
NM_138727chr192198 1973 1627 949 857 491 420 396 255 --11690 --
NM_138728chr192198 1973 1627 949 857 491 420 396 255 --11690 --
NM_138735chr231047 429 401 ------
NM_138771chr7----11290 --
NM_138774chr194845 590 165 41 ----1719
NM_138782chr511942 1388 ----
NM_138927chr214904 833 768 69 ------
NM_138966chr18------1519
NM_138969chr82537 339 ----1408
NM_138970chr1431620 951 199 1291 ----
NM_138971chr1173091 3056 2703 1050 789 637 448 23560 97 ----
NM_138971chr1173091 3056 2703 1050 789 637 448 23560 97 ----
NM_138972chr1173091 3056 2703 1050 789 637 448 23560 97 ----
NM_138972chr1173091 3056 2703 1050 789 637 448 23560 97 ----
NM_138973chr1173091 3056 2703 1050 789 637 448 23560 97 ----
NM_138973chr1173091 3056 2703 1050 789 637 448 23560 97 ----
NM_138980chr41189 ------
NM_138981chr41320 1559 ----
NM_138982chr41189 ------
NM_138994chr16150 ------
NM_139035chrX1100 ------
NM_139048chr31184 1303 --1318
NM_139071chr1241711 433 348 325 ------
NM_139131chr11149 1624 ----
NM_139132chr113942 322 26 ------
NM_139135chr131062 980 921 ------
NM_139207chr123812 283 189 --11392 --
NM_139244chr63842 149 128 ----134
NM_139246chr951875 1717 760 705 133 ------
NM_139276chr1742217 1461 756 74 --1595 11635
NM_139280chr1741091 368 328 158 ------
NM_139321chr2094140 3742 3719 3382 3040 578 279 268 35 1427 23635 930 --
NM_144488chr92741 522 1265 ----
NM_144489chr92741 522 1265 ----
NM_144567chr151925 1880 908 628 493 ------
NM_144571chr446033 2121 2030 1247 14423 1264 --
NM_144574chr142224 218 ------
NM_144578chr1465197 4220 3878 3811 922 563 --23629 568 --
NM_144579chr2102880 2535 1803 1010 940 720 654 563 491 460 22454 427 22520 40 --
NM_144590chr1042641 1174 295 179 --2350 264 1246
NM_144599chr1584497 4091 3679 3548 1726 1560 1513 801 24223 924 1176 --
NM_144601chr162762 471 21104 1013 1791 --
NM_144610chr17157 ------
NM_144628chr2062857 2289 1160 619 453 163 1894 ----
NM_144633chr34514 496 134 26 ----1284
NM_144636chr31702 ------
NM_144664chr1111923 1334 ----
NM_144721chr482579 2538 2519 2480 2156 1728 1697 584 ------
NM_144726chr51503 ------
NM_144767chr15103930 3775 3453 2915 1689 1658 1048 1024 205 45 13374 33797 3538 1712 --
NM_144775chr17104956 4225 3944 3239 1677 1536 1181 1090 1065 213 --73810 3792 1540 866 545 421 285 1905
NM_144778chr1322611 159 --1359 --
NM_144949chr221649 644 1870 ----
NM_144963chr82304 73 --1206 --
NM_144967chrX----1772 --
NM_144973chr1283895 1767 1633 1552 451 360 348 101 14872 ----
NM_144974chr132623 157 ------
NM_144979chr41142 ------
NM_145011chr1021680 108 --1357 --
NM_145048chr42613 97 1957 ----
NM_145049chr52911 865 ------
NM_145117chr1143102 174 100 90 --1507 --
NM_145174chr2251363 1194 1057 286 254 ------
NM_145175chr241004 352 233 165 --179 --
NM_145185chr19141939 1928 1866 1697 1647 1589 1404 551 497 338 312 278 110 34 11258 2565 204 --
NM_145203chr13----196 --
NM_145206chr1073200 2199 1262 472 451 352 277 ------
NM_145207chr484816 4612 4026 1849 1341 901 857 457 --2486 461 --
NM_145244chr421460 158 --156 --
NM_145259chr256609 6569 1836 765 706 --15675 --
NM_145279chr141940 1383 1167 453 11322 11699 --
NM_145307chr1044220 3480 3161 1303 11806 ----
NM_145332chr61121 ------
NM_145333chr61121 ------
NM_145350chr1741309 633 410 225 ----2569 510
NM_145351chr1782449 2020 1962 1773 1066 762 360 301 --2636 556 11709
NM_145698chr1022140 866 ------
NM_145716chr12575 542 ------
NM_145725chr141189 ------
NM_145726chr141189 ------
NM_145739chr2122 ------
NM_145800chrX1945 ------
NM_145803chr111250 ------
NM_145808chr732488 832 99 ------
NM_145912chr22104227 3982 3752 3331 3282 2977 2879 1891 1809 472 34646 1225 503 54509 4262 1617 519 380 11089
NM_147147chr693951 1631 1547 1525 1391 1115 773 727 185 1936 ----
NM_147150chr952866 2672 1227 1076 495 13024 ----
NM_147156chr1021039 336 ------
NM_147175chrX21955 1642 ------
NM_147189chr832322 2176 568 1224 ----
NM_147202chr942201 360 135 115 --12623 --
NM_147223chr272356 1998 1699 1586 479 283 171 ------
NM_147233chr262173 1815 1516 1403 296 100 ------
NM_148170chr1154983 3971 2242 121 36 1697 24987 102 --
NM_148894chr41768 ------
NM_148898chr741029 871 805 147 ------
NM_148899chr741029 871 805 147 ------
NM_148957chr13--22035 169 1153 --
NM_152230chr10157 ------
NM_152237chr2231462 1210 373 11481 3660 604 205 11370
NM_152247chr221258 ----1314
NM_152263chr1126101 5971 4643 4630 4010 2431 2341 2296 1649 1127 1050 664 ------
NM_152265chr131425 1348 49 21447 641 ----
NM_152267chr2262368 2068 2033 860 804 439 11924 1273 12330
NM_152277chr52563 194 --1724 --
NM_152287chr1662466 2279 2247 2184 2041 948 --31779 562 459 --
NM_152330chr1422673 1688 --11042 --
NM_152344chr1731203 262 37 ------
NM_152388chr243988 3655 2991 2587 ------
NM_152409chr542645 2305 1031 23 ------
NM_152414chr821628 520 ------
NM_152429chr1051435 1128 475 443 419 ------
NM_152437chr1232148 866 231 --12311 --
NM_152442chr1231173 395 343 ------
NM_152446chr143716 291 211 ------
NM_152450chr1532052 745 70 21984 56 ----
NM_152455chr1541832 922 857 586 22402 2105 ----
NM_152470chr18113414 3075 3045 2778 2564 2552 1074 974 926 70 55 --21285 1165 1423
NM_152510chr223358 291 161 ------
NM_152525chr22132 63 ----171
NM_152556chr732255 1981 1620 ------
NM_152581chrX21016 370 ------
NM_152594chr1521956 258 ------
NM_152622chr52862 645 --12196 --
NM_152624chr596103 5261 4602 4580 4529 1913 1173 751 324 --1688 --
NM_152629chr983114 1384 1370 1166 718 535 452 163 13998 ----
NM_152636chr1172466 2441 2358 1252 741 462 447 ------
NM_152641chr1232831 659 39 ------
NM_152643chr103994 434 200 --31160 1156 1019 --
NM_152652chr161189 ------
NM_152660chr11656 ------
NM_152663chr1174 ------
NM_152666chr11826 --1782 --
NM_152678chr342355 942 910 23 11789 ----
NM_152682chr411274 ------
NM_152692chrX1145 ------
NM_152699chr383422 3302 3236 2843 2303 1125 676 164 --13357 --
NM_152704chr134914 698 389 348 1977 ----
NM_152736chr63913 319 162 ------
NM_152737chr611699 --1643 --
NM_152739chr7--138 ----
NM_152740chr71735 ------
NM_152744chr793098 2993 2863 2702 2241 2200 1155 1102 634 --1606 11238
NM_152745chr71760 --1176 --
NM_152758chr81558 ------
NM_152765chr812417 ----12308
NM_152780chrX1254 --11238 --
NM_152787chrX12589 12883 1621 --
NM_152789chr73574 520 137 ------
NM_152835chr162772 2532 2294 2170 764 531 193 12311 12214
NM_152838chr2053157 3082 1323 1168 798 ------
NM_152857chr6269 21 ------
NM_152858chr6269 21 ------
NM_152862chr21341 ------
NM_152878chr2271386 1354 1221 620 388 286 26 11193 --11085
NM_152890chr151265 831 477 81 38 --11153 --
NM_152896chr92136 115 ------
NM_152903chr1352415 1790 1768 1755 691 1736 ----
NM_152924chr1576159 5548 5167 5054 4640 4297 2394 1499 34979 4939 4860 --
NM_152994chr21132 ------
NM_152995chr4--1245 ----
NM_153026chr126534 504 476 387 347 39 ------
NM_153029chr16113828 3795 3360 3128 2542 1613 1592 745 739 727 590 13668 31596 809 787 --
NM_153035chr143160 2198 502 28 13130 --1339
NM_153047chr6176 ------
NM_153048chr6176 ------
NM_153050chr22114432 3363 3149 3056 1954 1162 841 779 552 414 373 --21958 924 --
NM_153051chr22114432 3363 3149 3056 1954 1162 841 779 552 414 373 --21958 924 --
NM_153181chr18------1519
NM_153184chr321924 133 ------
NM_153188chr533477 2025 562 ------
NM_153235chr622154 1883 ------
NM_153260chr1521084 293 ------
NM_153267chr91598 ------
NM_153321chr172828 88 ------
NM_153322chr172828 88 ------
NM_153331chr31569 ------
NM_153456chr1361985 1879 1598 1542 1093 1035 35891 4207 1249 21602 1235 --
NM_153464chr19--1235 ----
NM_153487chr6114487 4410 4111 3520 3194 2920 1889 1833 1255 857 169 1447 13505 --
NM_153619chr1521108 134 ------
NM_153631chr731544 1340 1120 --11256 1527
NM_153632chr731544 1340 1120 --11256 1527
NM_153634chr121278 ------
NM_153649chr141601 832 558 61 --1917 --
NM_153693chr122747 153 ------
NM_153695chr9--1266 ----
NM_153756chr1131 31719 1711 698 1663 --
NM_153759chr231263 1203 1032 ------
NM_153810chr1054749 3917 3817 3383 305 ----14876
NM_153812chr172236 1682 824 754 473 413 170 12242 11765 1198
NM_153828chr23622 593 138 2664 345 ----
NM_153836chr281955 1865 1611 857 654 645 462 71 ----165
NM_170606chr721218 613 ------
NM_170662chr32450 205 ------
NM_170665chr1284390 4148 3626 3415 3265 3214 2917 314 54237 3596 3229 1587 1576 1502 23409 1613
NM_170679chr531036 492 181 ------
NM_170686chr752954 2585 2379 910 524 22001 803 ----
NM_170695chr181157 ------
NM_170706chr193531 3378 3042 3036 1735 1718 934 610 176 13491 11018 11726
NM_170721chr1731239 322 90 1276 ----
NM_170731chr1142497 2193 1814 191 12415 ----
NM_170732chr1142497 2193 1814 191 12415 ----
NM_170733chr1142497 2193 1814 191 12415 ----
NM_170734chr1142497 2193 1814 191 12415 ----
NM_170735chr1142497 2193 1814 191 12415 ----
NM_170768chr1141400 1375 1194 238 ------
NM_171825chr572686 2236 2121 2111 1131 805 193 ------
NM_171998chrX41640 1576 1020 209 11759 11586 --
NM_172069chr232366 2265 94 12017 ----
NM_172128chr411805 ------
NM_172169chr1031604 1558 139 --156 136
NM_172170chr1031604 1558 139 --156 136
NM_172171chr1031604 1558 139 --156 136
NM_172173chr1031604 1558 139 --156 136
NM_172193chr1421356 118 ------
NM_172200chr10124 ------
NM_172230chr1151082 726 707 696 192 ------
NM_172240chr123953 869 386 ------
NM_172337chr143379 272 68 1809 ----
NM_172344chr231513 1440 137 1527 ----
NM_172373chr1311037 ------
NM_172375chr14------188
NM_173065chr1133326 3207 3117 2796 2745 1392 1133 990 693 371 309 71 60 --22558 2506 --
NM_173198chr952541 964 825 688 397 1176 ----
NM_173200chr952541 964 825 688 397 1176 ----
NM_173207chr181157 ------
NM_173208chr181157 ------
NM_173209chr181157 ------
NM_173210chr181157 ------
NM_173211chr181157 ------
NM_173214chr1698279 6879 5922 5277 3317 2636 2316 2302 696 16281 16211 25604 1668
NM_173354chr2111396 --11763 --
NM_173355chr23697 332 311 ------
NM_173463chr464262 3073 1655 871 561 209 11160 ----
NM_173469chr152393 293 ------
NM_173470chrX82693 2678 2576 2536 2381 1866 1813 836 22118 1153 ----
NM_173476chr1692314 2225 2197 788 739 528 495 431 124 --32272 1535 57 --
NM_173495chrX42327 2309 963 473 1566 ----
NM_173496chr1032491 468 403 22096 302 12297 --
NM_173500chr1521070 477 ------
NM_173510chr2251826 1023 979 812 157 --11114 --
NM_173511chr221562 857 13473 ----
NM_173519chr841884 167 151 52 ------
NM_173545chr221499 457 11662 ----
NM_173552chr322007 954 1404 ----
NM_173557chr181558 ------
NM_173582chr11106297 6115 5850 5261 5230 1985 1657 1402 1371 770 --12120 --
NM_173595chr1244701 3600 3225 1081 13408 11470 1524
NM_173602chr1253118 2662 2368 1128 462 22564 413 11215 --
NM_173630chr18264 36 ------
NM_173642chr1128241 8132 7391 6792 5723 3451 3279 2851 2702 2429 858 763 35816 2488 1419 23067 2421 12228
NM_173645chr22470 395 ------
NM_173653chr32450 222 ------
NM_173681chr791915 1677 1593 1483 709 676 648 260 30 21711 108 137 12001
NM_173694chrX32086 1955 65 ----11906
NM_173797chr53504 490 446 ------
NM_173800chr531279 320 115 ------
NM_173808chr154107 3421 1294 1089 307 13319 ----
NM_173812chr1221327 1250 ------
NM_173822chr212112 11345 ----
NM_173825chr332383 2134 1898 22259 613 ----
NM_173829chr5135227 5205 5143 4647 4545 4416 3748 2114 1731 1612 1442 1133 212 --11704 --
NM_173832chr8103593 3461 3341 2873 2807 2775 2685 2531 788 254 --1535 1152
NM_173848chr81371 ------
NM_174886chr181157 ------
NM_174911chr863171 2556 991 780 324 52 22495 420 2784 154 --
NM_174934chr1163191 2903 2245 1389 813 204 --33533 1416 177 --
NM_174963chr12897 218 --2161 54 1139
NM_174964chr12897 218 --2161 54 1139
NM_174965chr12916 237 --2180 73 1158
NM_174966chr12897 218 --2161 54 1139
NM_174967chr12916 237 --2180 73 1158
NM_174968chr12897 218 --2161 54 1139
NM_174969chr12897 218 --2161 54 1139
NM_174970chr12916 237 --2180 73 1158
NM_174971chr12897 218 --2161 54 1139
NM_175058chr113945 561 251 --1239 --
NM_175061chr741888 1880 1812 62 ------
NM_175069chr92963 851 ------
NM_175607chr3152 ------
NM_175612chr3152 ------
NM_175629chr231263 1203 1032 ------
NM_175733chr1152116 1979 1806 731 183 ------
NM_175736chr1265844 5305 3039 1243 1048 682 37572 7093 4766 ----
NM_175852chr172972 2773 2408 2265 2097 257 98 12373 33036 2889 48 --
NM_175854chr1311085 1759 1138 12271
NM_175863chr611135 ------
NM_175866chr12197 135 ------
NM_175898chr1581453 1421 1376 568 447 422 205 186 21162 389 ----
NM_175907chr1882621 2239 1820 1814 1032 942 446 322 --12697 --
NM_175920chr52616 89 ------
NM_175921chr534213 3514 687 1794 ----
NM_175931chr1661987 1975 1546 1425 779 217 --11296 --
NM_176814chr721462 251 11298 ----
NM_176871chr893286 2770 2484 2258 2094 1303 864 313 57 ----12088
NM_177414chr12526 407 ------
NM_177553chr112757 64 ------
NM_177559chr201145 ------
NM_177560chr201145 ------
NM_177951chr14----183 --
NM_177952chr141584 --1156 --
NM_177972chr1163825 3763 3482 3221 1031 394 23030 404 54325 3704 914 147 143 --
NM_177974chr1541478 640 570 236 ------
NM_177989chr31384 ------
NM_177990chr203498 306 108 131 1197 --
NM_177996chr2032130 1077 549 32804 382 45 11297 --
NM_177999chr952774 1149 1141 693 464 23561 3368 43125 2957 2541 697 --
NM_178013chr1462629 2527 913 851 835 374 2328 29 1483 --
NM_178033chr1156 ----1173
NM_178037chr1283567 3535 3483 3404 2680 2601 2342 24 12353 21187 1056 --
NM_178038chr1283567 3535 3483 3404 2680 2601 2342 24 12353 21187 1056 --
NM_178042chr31384 ------
NM_178123chr2298 70 ------
NM_178136chr2251896 1812 1681 1268 474 ----122
NM_178140chr552451 2207 1883 910 775 1326 1914 --
NM_178151chrX97787 7412 7071 6021 4869 3053 2920 2668 870 47437 6420 5128 2148 ----
NM_178152chrX97787 7412 7071 6021 4869 3053 2920 2668 870 47437 6420 5128 2148 ----
NM_178153chrX97787 7412 7071 6021 4869 3053 2920 2668 870 47437 6420 5128 2148 ----
NM_178313chr242036 842 785 474 1535 1691 --
NM_178424chr51553 ------
NM_178426chr141505 861 811 48 ------
NM_178498chr1163926 2949 2538 629 589 580 21259 1180 12552 --
NM_178554chr341068 929 670 615 143 --12371
NM_178562chr71670 2929 597 1647 1738
NM_178565chr8--11214 --11188
NM_178566chr921452 1162 --11514 --
NM_178568chr1761662 1548 1260 1192 497 446 11759 2224 211 --
NM_178818chr164446 276 251 161 22013 1797 11672 --
NM_178826chr121659 ------
NM_178835chr42867 305 ------
NM_180989chr1321648 899 ------
NM_181077chr15--1920 11521 --
NM_181302chr142224 218 ------
NM_181308chr142224 218 ------
NM_181332chrX31775 371 156 ------
NM_181349chr742538 2463 1249 407 22094 1195 42793 828 505 248 --
NM_181351chr1132381 479 268 ------
NM_181354chr821242 1140 ------
NM_181358chr143590 3388 2739 108 ------
NM_181361chr31407 --1542 --
NM_181443chr2022746 2727 12065 ----
NM_181457chr2--3446 191 28 ----
NM_181458chr2--2579 324 ----
NM_181459chr2--2345 90 ----
NM_181460chr2--2392 137 ----
NM_181481chr1856300 4587 1670 1438 1205 35420 2246 361 25787 434 11472
NM_181482chr1856300 4587 1670 1438 1205 35420 2246 361 25787 434 11472
NM_181483chr1856300 4587 1670 1438 1205 35420 2246 361 25787 434 11472
NM_181504chr543622 3072 2733 38 12879 ----
NM_181505chr171223 ------
NM_181507chr111250 ------
NM_181508chr111250 ------
NM_181521chr1696145 5227 5057 5032 4942 812 759 432 51 26794 6578 46453 1749 499 219 --
NM_181523chr543622 3072 2733 38 12879 ----
NM_181524chr543622 3072 2733 38 12879 ----
NM_181537chr17155 ------
NM_181552chr71717 --129 --
NM_181553chr162762 471 21104 1013 1791 --
NM_181554chr162762 471 21104 1013 1791 --
NM_181645chr11------1142
NM_181672chrX11821 ----1146
NM_181673chrX11821 ----1146
NM_181689chr203340 145 72 --160 1822
NM_181702chr82182 122 ------
NM_181706chr1141536 829 784 447 11608 ----
NM_181714chr641324 575 533 481 ------
NM_181784chr262606 2217 1758 555 208 36 --42290 1899 530 154 --
NM_181809chr1103593 3140 3068 2657 2541 2454 1506 1167 267 28 --21265 751 --
NM_181825chr222633 261 1193 1320 --
NM_181828chr22113680 3393 3328 1543 1158 1048 797 734 553 450 75 23778 3126 32654 1162 915 --
NM_181829chr22113680 3393 3328 1543 1158 1048 797 734 553 450 75 23778 3126 32654 1162 915 --
NM_181830chr22113680 3393 3328 1543 1158 1048 797 734 553 450 75 23778 3126 32654 1162 915 --
NM_181832chr22103695 3408 3343 1173 1063 812 749 568 465 90 23793 3141 32669 1177 930 --
NM_181837chr6161 122 ----
NM_181892chr411405 165 ----
NM_181897chr321019 246 21735 412 ----
NM_182485chr451201 1183 962 145 117 ------
NM_182487chr9154231 3992 3280 3232 2838 2747 2705 1724 1507 894 650 612 585 487 101 --1819 --
NM_182507chr1211790 51482 777 690 250 60 31916 878 714 --
NM_182515chr19166677 6633 6108 5904 5674 5563 5323 5234 4711 4679 4546 4166 1920 1875 959 929 ------
NM_182527chr2261949 1743 779 616 490 403 --1884 11382
NM_182551chr222982 1184 22530 244 --1865
NM_182557chr1182098 2060 1841 1409 552 325 227 25 --11769 1572
NM_182641chr172445 88 175 ----
NM_182643chr812189 ------
NM_182646chr451201 1183 962 145 117 ------
NM_182663chr141775 1453 919 808 --1329 --
NM_182664chr131905 1583 938 --1459 --
NM_182665chr141775 1453 919 808 --1329 --
NM_182691chr731266 201 31 ------
NM_182692chr731266 201 31 ------
NM_182697chr771657 1544 1520 1402 666 481 271 ------
NM_182701chr61875 ------
NM_182756chr21238 ------
NM_182765chr1032263 432 403 12117 22379 2375 --
NM_182789chr51919 ------
NM_182796chr52276 174 ------
NM_182830chr1421808 738 1642 22090 1477 --
NM_182898chr785670 5437 5130 5078 5021 4931 4374 289 --15969 --
NM_182899chr785670 5437 5130 5078 5021 4931 4374 289 --15969 --
NM_182907chr64875 757 543 52 ------
NM_182948chr163118 2368 2357 2222 1098 856 ----1612
NM_182964chr1143102 174 100 90 --1507 --
NM_182970chr2074211 1498 1334 970 724 490 442 12853 23744 380 --
NM_183004chr1463400 3209 2829 2386 1208 730 33256 2957 1152 12707 23568 63
NM_183047chr203750 649 90 ------
NM_183048chr203750 649 90 ------
NM_183075chr442208 2012 1839 189 ------
NM_183078chr653036 1010 966 76 55 --12764 --
NM_183227chr611336 ------
NM_183238chr1243090 1112 954 291 13424 --21039 842
NM_183323chr51919 ------
NM_183353chrX41092 902 463 22 ------
NM_183360chr2----1219 --
NM_183361chr2----1219 --
NM_183381chr33636 353 251 ------
NM_183383chr33636 353 251 ------
NM_183384chr33636 353 251 ------
NM_183397chr20104038 3512 3486 3326 1876 1844 1710 1186 892 478 35027 4476 1281 12063 --
NM_183415chr1241228 1162 289 128 --1536 --
NM_183416chr142070 1853 1703 1339 11564 12085 --
NM_183422chr13186 ------
NM_184041chr161191 ------
NM_184043chr161191 ------
NM_184231chr3----137 --
NM_194247chr263301 3139 2951 2930 223 201 1147 11478 --
NM_194278chr1493420 3377 3303 3126 2766 1402 1370 849 471 --12819 --
NM_194285chr1143089 2872 2841 2623 --22929 301 --
NM_194286chr1286134 5474 4959 4521 1878 930 821 333 11826 1954 --
NM_194291chr82506 237 1614 ----
NM_194298chr1031422 577 484 --1488 --
NM_194301chr14136 ------
NM_194314chr114957 1598 ----
NM_194454chr7--21279 159 ----
NM_194455chr7--21279 159 ----
NM_194456chr7--21279 159 ----
NM_197939chr1741068 956 271 175 --1107 --
NM_197941chr532523 1996 939 --12321 --
NM_197956chr941884 1725 1682 95 --2856 630 --
NM_197970chr211377 ----189
NM_198056chr3--22074 605 171 2443 174
NM_198123chr81549 ------
NM_198124chr81549 ------
NM_198128chr1841560 761 417 115 12222 ----
NM_198147chr173968 879 259 1772 --1840
NM_198181chr1522423 2094 1929 ----
NM_198215chr102313 203 1982 1446 --
NM_198225chr1021930 1538 --11295 --
NM_198240chr122983 967 ------
NM_198261chr122616 598 1566 177 --
NM_198262chr122616 598 1566 177 --
NM_198268chr143590 3388 2739 108 ------
NM_198269chr143590 3388 2739 108 ------
NM_198270chrX12349 ------
NM_198275chr11166 ------
NM_198336chr711667 --11269 --
NM_198390chr162464 64 --31466 675 76 --
NM_198395chr531154 317 25 ------
NM_198400chr1562068 1873 1828 601 511 243 --12606 --
NM_198401chr821222 306 ------
NM_198490chr3113204 2999 2853 1322 1294 1161 1144 1123 907 290 80 33482 3129 444 53356 686 663 214 112 --
NM_198513chr81682 ------
NM_198560chr373380 3214 2761 2731 2710 2548 2358 22831 658 ----
NM_198562chr372253 731 691 529 497 363 67 22094 1602 ----
NM_198568chr6--1844 ----
NM_198581chr2137105 6616 6569 6140 5763 5626 5297 5000 4811 2926 2836 2316 2028 ------
NM_198679chr972634 2459 1719 990 891 165 125 1850 41723 1032 994 218 --
NM_198715chr155824 5719 4761 4450 4295 36180 6091 1679 ----
NM_198793chr333774 2737 1039 22681 828 ----
NM_198794chr1411099 --1173 --
NM_198830chr172618 121 ------
NM_198859chr334201 378 238 24998 54 13606 --
NM_198889chr421049 1039 --1946 --
NM_198892chr4------1117
NM_198896chr112615 182 ------
NM_198900chr1265844 5305 3039 1243 1048 682 37572 7093 4766 ----
NM_198904chr541999 1679 1336 275 ------
NM_198968chr1363401 3385 3235 671 549 33 --13762 --
NM_198990chr752056 1134 1096 892 633 ------
NM_199000chr741593 455 46 26 ------
NM_199050chr2153147 1260 923 848 615 128 2169 71 --
NM_199051chr11120 ------
NM_199132chr1921419 728 11668 ----
NM_199138chr134914 698 389 348 1977 ----
NM_199160chr921364 671 --21645 25 --
NM_199181chr20147 ------
NM_199245chr1222416 821 --12066 --
NM_199262chr1742063 1991 1736 1648 --2906 695 --
NM_199320chr422736 814 11177 1566 --
NM_199320chr422736 814 11177 1566 --
NM_199324chr433270 3000 1425 13443 ----
NM_199355chr1651400 1177 1166 482 32 ------
NM_199421chr14104519 4125 3856 3767 3722 3252 3192 1178 968 838 --14966 --
NM_199436chr222909 2331 22360 1985 12413 --
NM_199440chr2187 ------
NM_199462chr184283 4251 1901 1870 827 693 417 402 23348 556 23413 511 --
NM_199478chrX41421 1414 774 644 ------
NM_199482chr221551 1545 ------
NM_199511chr33685 596 65 1562 130 --
NM_199512chr33685 596 65 1562 130 --
NM_201263chr121958 1438 ------
NM_201269chr12269 25 ------
NM_201280chr631247 1149 481 1270 ----
NM_201403chr141940 1383 1167 453 11322 11699 --
NM_201413chr211323 ------
NM_201414chr211323 ------
NM_201428chr1141398 647 508 372 ------
NM_201429chr1141398 647 508 372 ------
NM_201430chr1141324 573 434 298 ------
NM_201432chr17126116 5471 5454 5178 2411 2096 1831 1563 892 550 470 421 15315 14671 --
NM_201433chr17126116 5471 5454 5178 2411 2096 1831 1563 892 550 470 421 15315 14671 --
NM_201434chr173787 583 302 ------
NM_201436chr71749 ------
NM_201516chr71805 ------
NM_201517chr71749 ------
NM_201570chr1032027 1995 664 1344 11860 --
NM_201571chr1032027 1995 664 1344 11860 --
NM_201572chr1032027 1995 664 1344 11860 --
NM_201590chr1032027 1995 664 1344 11860 --
NM_201593chr1032027 1995 664 1344 11860 --
NM_201596chr1032027 1995 664 1344 11860 --
NM_201597chr1032027 1995 664 1344 11860 --
NM_201599chrX31145 909 244 ------
NM_201632chr551752 1562 1396 298 93 11532 --1501
NM_201634chr551851 1661 1495 397 192 11631 --21252 600
NM_201999chr411170 ------
NM_202002chr124915 621 161 150 ------
NM_203307chr1941658 1491 1459 1370 ----1194
NM_203327chr2084000 3781 3614 1418 1082 823 712 298 23677 3620 --23976 3209
NM_203350chr13489 418 256 ------
NM_203351chr1782486 2439 2407 2317 933 480 280 164 1999 1123 --
NM_203406chr532446 921 833 ------
NM_203413chr1741043 827 811 715 4906 845 393 100 ----
NM_203446chr2182972 2784 2401 1053 612 583 498 108 ------
NM_203453chr941640 1565 187 76 11719 ----
NM_203458chr143141 2595 1427 892 1239 ----
NM_203459chr112456 ------
NM_203487chr1321167 183 ------
NM_203494chr15126 --1161 --
NM_205768chr1--1197 ----
NM_205846chr51353 ------
NM_205860chr143073 2180 633 559 --12805 --
NM_206594chr163409 3069 1437 1080 820 578 ------
NM_206595chr163409 3069 1437 1080 820 578 ------
NM_206827chr13149 ------
NM_206839chr151595 ------
NM_206853chr6--13023 1101 --
NM_206854chr633552 649 51 14284 11362 --
NM_206855chr664517 1614 1016 942 615 477 15249 12327 --
NM_206866chr2142872 2258 1278 487 ------
NM_206876chr232681 2274 86 ------
NM_206907chr542541 1054 445 58 --11312 --
NM_206909chr8106450 5919 2873 2606 2568 2426 1304 1204 671 458 36385 2654 1116 ----
NM_206927chr111237 ------
NM_206928chr111237 ------
NM_206929chr111237 ------
NM_206930chr111237 ------
NM_206943chr21644 ------
NM_206944chr92619 290 ------
NM_206945chr92619 290 ------
NM_206946chr92619 290 ------
NM_206947chr92619 290 ------
NM_207012chr1093164 3132 2868 2371 2218 1258 984 412 386 13362 ----
NM_207043chr121962 1446 2104 82 ----
NM_207044chr121962 1446 2104 82 ----
NM_207047chr121962 1446 2104 82 ----
NM_207111chr772558 2299 1007 693 668 366 105 --12444 --
NM_207116chr772558 2299 1007 693 668 366 105 --12444 --
NM_207303chr1032755 1485 207 --11153 --
NM_207304chr1322498 46 --1246 --
NM_207306chr164475 4331 3764 3749 2952 42 --153273 1632 1365 1041 933 897 829 685 649 613 577 505 469 351 315 --
NM_207313chr175984 957 862 810 725 1745 167 --
NM_207317chr52331 34 ------
NM_207325chr192734 381 ------
NM_207351chr34265 238 97 24 --2519 454 --
NM_207362chr23541 511 177 1192 ----
NM_207404chr372259 1859 1583 619 375 207 108 11630 ----
NM_207406chr495762 5316 5248 5077 4535 2572 1844 1770 1100 35091 4453 251 24634 2442 --
NM_207411chr862576 1297 1051 665 497 186 33487 2726 861 13032 12414
NM_207481chr21246 ------
NM_207518chr19------2321 87
NM_207520chr23622 593 138 2664 345 ----
NM_207521chr23622 593 138 2664 345 ----
NM_207577chr1142849 2099 1932 1815 11915 12416 --
NM_212461chr122226 142 ------
NM_212464chr1591965 1695 1661 1352 1332 714 349 282 270 ------
NM_212467chr1572542 2272 2238 1929 1909 779 96 ------
NM_212471chr17----1795 --
NM_212472chr17----1795 --
NM_212558chr933952 3119 650 ------
NM_213589chr264953 4614 3625 3589 1384 122 --15540 --
NM_213594chr1231258 228 206 1235 ----
NM_213648chr551752 1562 1396 298 93 11532 --1501
NM_213662chr1742311 1555 850 168 --1689 11729